Isolation and Characterization of HomogentisatePhytyltransferase Genes from Synechocystis sp. PCC 6803and Arabidopsis

Beth Savidge, James D. Weiss, Yun-Hua H. Wong, Michael W. Lassner1, Timothy A. Mitsky,Christine K. Shewmaker, Dusty Post-Beittenmiller, and Henry E. Valentin*

Monsanto Company, Calgene Campus, 1920 Fifth Street, Davis, California 95616 (B.S., M.W.L., C.K.S.);and Monsanto Company, 800 N. Lindbergh Boulevard, St. Louis, Missouri 63167 (J.D.W., Y.-H.H.W.,T.A.M., D.P.-B., H.E.V.)

Tocopherols, synthesized by photosynthetic organisms, are micronutrients with antioxidant properties that play importantroles in animal and human nutrition. Because of these health benefits, there is considerable interest in identifying the genesinvolved in tocopherol biosynthesis to allow transgenic alteration of both tocopherol levels and composition in agriculturalcrops. Tocopherols are generated from the condensation of phytyldiphosphate and homogentisic acid (HGA), followed bycyclization and methylation reactions. Homogentisate phytyltransferase (HPT) performs the first committed step in thispathway, the phytylation of HGA. In this study, bioinformatics techniques were used to identify candidate genes, slr1736and HPT1, that encode HPT from Synechocystis sp. PCC 6803 and Arabidopsis, respectively. These two genes encode putativemembrane-bound proteins, and contain amino acid residues highly conserved with other prenyltransferases of the aromatictype. A Synechocystis sp. PCC 6803 slr1736 null mutant obtained by insertional inactivation did not accumulate tocopherols,and was rescued by the Arabidopsis HPT1 ortholog. The membrane fraction of wild-type Synechocystis sp. PCC 6803 wascapable of catalyzing the phytylation of HGA, whereas the membrane fraction from the slr1736 null mutant was not. Themicrosomal membrane fraction of baculovirus-infected insect cells expressing the Synechocystis sp. PCC 6803 slr1736 werealso able to perform the phytylation reaction, verifying HPT activity of the protein encoded by this gene. In addition,evidence that antisense expression of HPT1 in Arabidopsis resulted in reduced seed tocopherol levels, whereas seed-specificsense expression resulted in increased seed tocopherol levels, is presented.

Tocopherols are important lipophilic antioxidantsthat are synthesized by photosynthetic organisms.These include higher plants and certain eukaryoticalgae where they are synthesized in the plastids, aswell as photosynthetic prokaryotes such as blue-green algae. The four major forms of tocopherols, �,�, �, and �, differ in the position and number ofmethyl groups (Fig. 1). The predominant form in theleaves of higher plants is �-tocopherol, whereas inseeds �-tocopherol is often the major isoform (Tan,1989; Demurin et al., 1996). Tocopherols predomi-nantly function as antioxidants in vivo in photosyn-thetic organisms and in animals, as well as in isolatedcompounds such as oils. The antioxidant propertiesof tocopherols derive from their ability to quench freeradicals and different tocopherols may be optimal asantioxidants for different biological systems. For hu-man and animal utility, �-tocopherol has the highestvitamin E activity and has been implicated in a vari-ety of health areas, including possible benefits inpreventing cardiovascular disease, certain cancers,

and cataract formation (DellaPenna, 1999; Bramley etal., 2000). The amounts of vitamin E needed toachieve these effects are often quite high, 100 to 400International Units (I.U.) and even up to 800 I.U.compared with the recommended daily allowance of40 I.U. In fats and oils, tocopherols protect unsatur-ated fatty acids from oxidation. In these systems,�-tocopherol appears to have the greater utility(Parkhurst et al., 1968; Chow and Draper, 1974;Gottstein and Grosch, 1990). In fact, tocopherols areoften included in processed oils to help stabilize thefatty acids. For human health as well as food andfeed utility, it is desirable to have plants with in-creased tocopherol content along with those wherethe tocopherol composition is customized.

Tocopherols contain an aromatic head group,which is derived from homogentisic acid (HGA) anda hydrocarbon portion, which arises from phytyl-diphosphate (phytyl-DP). HGA is derived from theshikimic acid pathway and phytyl-DP is generatedfrom the condensation of four isoprenoid units. Theisoprenoid contribution to tocopherol biosynthesis isthought to come primarily from the plastidal methyl-erythritol phosphate pathway, and not the cytosolicmevalonic acid pathway (Arigoni et al., 1997; Licht-enthaler et al., 1997). The condensation of HGA andphytyl-DP to form 2-methyl-6-phytylplastoquinol,

1 Present address: Maxygen, Inc., 515 Galveston Drive, RedwoodCity, CA 94063.

* Corresponding author; e-mail henry.e.valentin@monsanto.com;fax 314 – 694 – 8275.

Article, publication date, and citation information can be foundat www.plantphysiol.org/cgi/doi/10.1104/pp.010747.

Plant Physiology, May 2002, Vol. 129, pp. 321–332, www.plantphysiol.org © 2002 American Society of Plant Biologists 321

the first committed step in tocopherol biosynthesis, isa prenyltransferase reaction that is performed by ahomogentisate phytyltransferase (HPT; Fig. 2). Sub-sequent cyclization and methylation reactions (Soll etal., 1980; Fiedler et al., 1982; Marshall et al., 1985)result in the formation of the four major tocopherols(Fig. 1). The enzymatic reactions in tocopherol bio-synthesis were identified 15 to 20 years ago (Soll etal., 1980; Schultz-Siebert et al., 1987), but cloning ofthe genes encoding these enzymes has only occurredin the last few years.

Tocopherol biosynthesis takes place in the plastidand the enzymes are associated with the chloroplastenvelope (Soll et al., 1980, 1985). The membrane as-sociation of the enzymes has made purification dif-ficult (Soll et al., 1980, 1985; Camara and d’Harlingue,1985). With the advent of genomics and the availabil-ity of complete genome sequences of a number oforganisms, including Synechocystis sp. PCC 6803 andArabidopsis, it has become possible to use bioinfor-matics techniques to identify and clone additionalgenes in the tocopherol pathway.

The first enzyme cloned in the tocopherol pathway,�-tocopherol methyl transferase (�-TMT), was iden-tified in Synechocystis sp. PCC 6803 and Arabidopsisusing bioinformatics (Shintani and DellaPenna,1998). In that study, the Arabidopsis �-TMT wasshown to alter seed tocopherol composition whenoverexpressed in Arabidopsis. �� Tocopherol, nor-mally the predominant tocopherol isomer in Arabi-dopsis seeds, was almost completely converted to�-tocopherol.

HPT catalyzes the first committed reaction in thetocopherol pathway, and was unidentified previ-ously. Concomitant with this study, slr1736 wasfound to encode a HPT in Synechocystis sp. PCC 6803(DellaPenna et al., 2000; Savidge et al., 2000; Colla-kova and DellaPenna, 2001; Schledz et al., 2001) andthe Arabidopsis HTP was identified (DellaPenna etal., 2000; Savidge et al., 2000; Collakova and Della-Penna, 2001).

There are prenyltransferases that condense prenylgroups with allylic chains and those that condenseprenyl chains with aromatic groups. The prenyltrans-ferases that catalyze sequential condensations of iso-pentenylpyrophosphate with allylic chains sharecommon features, including Asp-rich motifs, andlead to the formation of compounds with two isopre-noid units, such as geranylpyrophosphate, or tomuch longer molecules, such as rubber, which con-tains greater than 1,000 isoprenoid units (Chen et al.,1994; Ogura et al., 1997). Prenyltransferases that cat-alyze condensations with nonisoprenoid groups havean Asp-rich motif (Saiki et al., 1993) distinct from thatof the allylic class (Ashby and Edwards, 1990; Carot-toli et al., 1991; Marrero et al., 1992), and include UbiA,which attaches a prenyl group to 4-hydroxybenzoicacid, and chlorophyll synthase, which attaches a pre-nyl group to chlorophyllide (Melzer, 1994; Oster andRudiger, 1997; Oster et al., 1997).

The first committed step in tocopherol biosynthesisis catalyzed by an aromatic prenyltransferase thattransfers a phytyl chain to HGA. Assuming thatstructural features are shared among aromatic pre-nyltransferases, bioinformatics techniques were usedto identify candidate genes encoding HPT in bothSynechocystis sp. PCC 6803 and Arabidopsis, whichwere then characterized by biochemical and geneticstudies. Furthermore, the current study provides ev-idence that seed-specific expression of HPT1 in-creases tocopherol levels 2-fold in Arabidopsis seed,an important first step in increasing tocopherol levelsin the feed and food supply.

RESULTS

Position-Specific Iterative (PSI)-BLAST Analysis

The HPT is thought to catalyze both the condensa-tion of phytyl-DP with HGA and the decarboxylationof HGA, resulting in the formation of 2-methyl-6-

Figure 1. Tocol and tocopherol structure.

Figure 2. Tocopherol biosynthetic pathway.

Savidge et al.

322 Plant Physiol. Vol. 129, 2002

phytylplastoquinol (Fig. 2). To identify the gene en-coding this enzyme, a PSI-BLAST profile (Altschul etal., 1997) was generated using the Escherichia coli4-hydroxybenzoate-octaprenyltransferase (ubiA, Gen-Bank accession no. 1790473) amino acid sequence asa query. UbiA was chosen for profile generationbecause the reaction catalyzed by this enzyme,the prenylation of 4-hydroxybenzoic acid to form3-octaprenyl-4-hydroxy-benzoic acid, closely resem-bles that of the HGA phytyltransferase. The PSI-BLAST profile was used to search the Synechocystissp. PCC 6803 genome (available at CyanoBase,http://www.kazusa.or.jp/cyano/index.html) for genesthat may encode a prenyltransferase belonging to thearomatic type. The search resulted in the identificationof five candidate genes: slr1736, slr0926, sll1899, slr0056,and slr1518 (Table I).

A parallel PSI-BLAST search was performed on theArabidopsis public database (TBLASTN) and resultedin the identification of four putative prenyltransferasegenes that appeared to be potential orthologs of genesidentified in the Synechocystis sp. PCC 6803 search(Table I). These sequences were originally designatedATPT2 (Arabidopsis prenyltransferase 2), ATPT3,ATPT4, and ATPT12 (GenBank accession nos. 3004556,4454035, 3341672, and 2129675, respectively). How-ever, after functional characterization, ATPT2 was re-named as HPT1 and will be referred to as such for theremainder of the paper. Although Slr1736 and its pu-tative ortholog, HPT1, are annotated as unknown pro-teins, they do share low levels of similarity to chloro-phyll synthase (ATPT12; Gaubier et al., 1995).Chlorophyll synthase catalyzes a reaction similar tothat of the HPT, adding phytyl-DP to chlorophyllide.After obtaining 5� sequences of the four putative pre-nyltransferases sequences by RACE, only HPT1 andATPT12 were strongly predicted to encode plastidtargeted proteins (PSORT). Based on predicted target-ing information and the observation that ATPT12 islikely chlorophyll synthase, HPT1 and the putativeSynechocystis sp. PCC 6803 ortholog, slr1736, were thestrongest candidates to encode HPT.

To determine if HPT1 and slr1736 encode HPT,isolation and functional testing of both genes were

pursued. Primers for slr1736 were designed basedon the published sequence (CyanoBase, http://www.kazusa.or.jp/cyanobase/). The sequence of thePCR product was verified and the product was clonedinto appropriate vectors for functional testing. Thefull-length Arabidopsis HPT1 cDNA was isolated(GenBank accession no. AY089963) by performing5� and 3� RACE based on a partial expressed sequencetag sequence. HPT1 encodes a 44-kD protein with393 amino acids. Comparison of the full-length cloneto the public predicted protein from Arabidopsisgenomic sequence (Arabidopsis public database) re-vealed that the public predicted sequence lacked 110amino acids in the amino terminus and 17 amino acidsfrom the carboxy terminus. This inaccurate predictionis likely attributable to the fact that HPT1 contains 13exons, most of which are only 100 to 130 bp long. Thepublic predicted protein did not contain a plastid tar-geting sequence, and had only low levels of similarityto another prenyltransferase, chlorophyll synthase,making it difficult to infer function until the full-length sequence was obtained. Both Slr1736 and HPT1have predicted transmembrane domains, based onKyte-Doolittle hydropathy plotting (Kyte andDoolittle, 1982), suggesting that they are membraneproteins. Using ChloroP (Emanuelsson et al., 1999;http://www.cbs.dtu.dk/services/ChloroP/), the pu-tative plastid transit peptide cleavage site of HPT1 isbetween amino acids 36 and 37; however, an align-ment of HPT1 and Slr1736 (Fig. 3A) suggested that thetransit peptide could be considerably longer. ClustalWwas used to align Slr1736 and HPT1, revealing 37%identity overall, and several regions with higher levelsof identity. Site-directed mutagenesis of another pre-nyltransferase of the aromatic type, heme-O-synthase(Saiki et al., 1993), resulted in the identification of aputative catalytic domain. The region correspondingto the putative catalytic domain was compared amongSlr1736, HPT1, other Arabidopsis putative prenyl-transferases, as well as UbiA, which was used as thequery in the original PSI-BLAST search (Fig. 3B).Amino acid residues identified as essential for cata-lytic activity in heme-O-synthase are conserved

Table I. Synechocystis and Arabidopsis putative phytyltransferases identified by PSI-BLAST

E. coli UbiA protein sequence was used as a query in a PSI-BLAST search against Synechocystis and Arabidopsis public databases. Namesgiven to the genes identified in the search are listed for each species along with known genes for which homology is shared and correspondingannotation. Predicted targeting (PSORT) for Arabidopsis proteins is indicated.

Synechocystis Arabidopsis Targeting Homolog Annotation

Slr0926 ATPT3 Mitochondria UbiA 4-Hydroxybenzoate-octaprenyl transferaseSlr1736 HPT1 Chloroplast – Hypothetical protein of unknown functionSl11899 ATPT4 Mitochondria CtaB Heme O:farnesyltransferase

Heme A:farnesyltransferasea

Slr1518 None – MenA Menaquinone biosynthesis proteinSlr0056 ATPT12 Chloroplast G4 Chlorophyll synthetase

a ATPT4 exhibits higher similarity to heme A:farnesyltransferase.

Homogentisate Phytyltransferase Genes

Plant Physiol. Vol. 129, 2002 323

among these proteins, suggesting that this region mayalso play a role in catalysis.

Synechocystis sp. PCC 6803 slr1736 Null Mutant andComplementation with HPT1

To determine if slr1736 plays a role in tocopherolbiosynthesis, a null mutant in Synechocystis sp. PCC6803 was generated in the slr1736 ORF via insertionof the nptI gene. A confirmed mutant strain wasassayed for tocopherol content and composition us-

ing HPLC. No tocopherols were detected in the nullstrain (Fig. 4), suggesting ORF slr1736 is essential fortocopherol biosynthesis. A complementation experi-ment was performed with the Synechocystis sp. PCC6803 slr1736 null mutant to determine if HPT1 is theortholog of slr1736. A vector, pMON21690, contain-ing HPT1 under control of the Tac (Russell and Ben-net, 1982) promoter, was transformed into the slr1736null strain and grown under standard conditions for5 d. HPLC analysis demonstrated that tocopherolbiosynthesis was restored in this strain (Fig. 4C), thusconfirming that HPT1 and slr1736 encode proteins ofsimilar function.

Phytyltransferase Activity of the slr1736 Gene Product

The reaction carried out by HPT results in theformation of 2-methyl-6-phytylplastoquinol from thecondensation of HGA and phytyl-DP (Fig. 2). Toconfirm that the slr1736 gene product catalyzed thisreaction, slr1736 was expressed in the Baculovirus

Figure 4. HPLC chromatographic analysis of ethanol extracts ofwild-type Synechocystis sp. PCC 6803, slr1736 null mutant, andslr1736 null mutant complemented with HPT1. A, Wild-type Syn-echocystis sp. PCC 6803 transformed with control vector. Peak 4corresponds to �-tocopherol at 4.6 min. B, slr1736 null mutantlacking tocopherol peak at 4.6 min. C, slr1736 null mutant comple-mented with Arabidopsis HPT1 with tocopherol signal apparent at4.6 min. A compound eluting at 8.5 min represents the tocol internalstandard (peak 5). Peak 1 corresponds to the solvent front, and peaks2 and 3 are two unknown compounds.

Figure 3. Protein alignment of HPT1 and Slr1736 and conservedputative catalytic domain. A, Alignment of HPT1 and Slr1736 usingthe ClustalW algorithm. B, Alignment of putative catalytic domain ofSlr1736 and Arabidopsis putative prenyltransferases identified usingUbiA as a query in a PSI-BLAST search. Gray shading indicatesidentity. Underlined sequence corresponds to the putative catalyticdomain. Asterisks indicate amino acids required for catalytic activity inheme-O-synthase, which are conserved in HPT1. The putative chlo-roplast target peptide processing site is indicated by an arrowhead.

Savidge et al.

324 Plant Physiol. Vol. 129, 2002

Expression System (Invitrogen, Carlsbad, CA) andassayed for activity (Table II). The membrane fractionfrom slr1736 expressing Sf9 cells was able to catalyzethe phytylation of HGA to generate 2-methyl-6-phytylplastoquinol, whereas membrane fractionsfrom Sf9 control cells showed no conversion (TableII). In addition, HPT activity was detected in mem-brane fractions from Synechocystis sp. PCC 6803 wildtype, but not in the null strain (Table II; Fig. 5). Theability of the slr1736 gene product to catalyze thisreaction, combined with the genetic data describedabove, provides strong evidence that slr1736 encodesa phytyltransferase involved in tocopherol biosyn-thesis. Membrane fractions from spinach chloroplastswere used as a positive control in the phytyltrans-ferase assay.

HPT1 Expression in Arabidopsis Seed

Because phytylation of HGA is the first committedstep of tocopherol biosynthesis, it was hypothesizedthat expression of HPT1 in Arabidopsis may result inincreased tocopherol levels. To test this hypothesis,we expressed HPT1 under the seed-specific napinpromoter. Tocopherol analysis of pooled segregatingT2 seed from the pNapin::HPT1 sense lines indicatedthat expression of HPT1 resulted in up to a 60%increase in total seed tocopherol (Fig. 6). Statisticalevaluation of tocopherol data from pNapin::HPT1events compared with controls revealed that 33 of 36independent events produced elevated tocopherollevels. The analysis of T3 seed pools from three se-lected events (1,848, 1,860, and 1,863) demonstratedthat the transgenic populations were distinct (P �0.001) from wild-type and vector controls (Table III),further validating the increased tocopherol pheno-type. Whereas homozygous lines, identified by kana-mycin selection, generally produced the highest to-copherol content (up to a 2-fold increase), only events1,848 and 1,863 showed significant differences in to-copherol content between homozygous and hemizy-gous in T3 seed populations. Based on their kanamy-cin selection pattern, these three lines were alsodetermined to have a single insert. Genomic PCRusing gene-specific and napin promoter-specificprimers demonstrated that T3 plants from the three

events, 1,848, 1,860, and 1,863, all contain the HPT1transgene (data not shown).

To determine if HPT1 is required for tocopherolaccumulation in Arabidopsis seed, an antisense ex-pression construct under control of the enhancedcauliflower mosaic virus e35S promoter was tested.Tocopherol levels were assayed in pooled segregat-ing T2 seed from 88 independent transformationevents. Seed tocopherol levels of 19 events fell out-side of the lower limit of the 95% confidence intervalfor the controls, indicating that HPT1 is necessary fortocopherol biosynthesis. Two events (1,393 and1,401) with significantly reduced tocopherol levelswere carried forward to the T3 generation, revealingup to a 10-fold decrease in total tocopherols in someindividual T3 pools (data not shown). Statistical anal-ysis of T3 seed pools from these lines demonstratedthat the transgenic populations were distinct fromwild-type and vector controls, further validating thereduced tocopherol phenotype (Table III). GenomicPCR using gene-specific and e35S promoter-specificprimers demonstrated that T3 plants from the twoevents, 1,393 and 1,401, both contain the HPT1 trans-gene in the antisense orientation (data not shown).Because of the low HPT enzyme activity observed inchloroplast preparations (Table II), enzyme assayswere not performed on HPT1-expressing or HPT1-antisense seed samples. The whole plant phenotypeof T2 antisense lines did not differ substantially fromthe wild type. These combined sense and antisensedata further confirm that HPT1 encodes an HGAphytyltransferase, and show that it is possible to altertocopherol levels in seed using this gene.

DISCUSSION

Vitamin E is comprised of a mixture of varioustocopherols, with �-tocopherol being the most bioac-tive (Sheppard and Pennington, 1993). Tocopherolsare naturally occurring micronutrients, produced inplants and cyanobacteria. Many studies have dem-onstrated that the antioxidant activity of these mole-cules has the potential to positively impact humanand animal health. Therefore, tocopherols are valu-able micronutrients and there is consequently inter-est in developing plants that produce high levels ofnatural tocopherols. One possible strategy to elevatetocopherol levels is to increase flux through the path-way by overexpressing the enzyme that catalyzesthe first committed step in tocopherol biosynthesis,the HPT.

Evidence that slr1736 is involved in tocopherol bio-synthesis in Synechocystis sp. PCC 6803 has been re-ported recently (Schledz et al., 2001). In that study, anslr1736 deletion mutant produces reduced levels oftocopherol, and based on a colorimetric assay, accu-mulates HGA. Other prenyllipids including phyllo-quinones, plastoquinones, and carotenoids are notaffected in this mutant. However, slr1736 occurs in an

Table II. Homogentisate phytyltransferase activity

Homogentisate phytyltransferase activity is defined as picomoles2-methyl-6-phytylplastoquinone formation per milligram protein perhour.

Enzyme Source Enzyme Activity

pmol mg�1 � h�1

slr1736 Expressed in SF9 cells 102Sf9 Cell control �0.05Synechocystis 6803 0.2Synechocystis 6803 slr1736� �0.01Spinach (Spinacia oleracea) chloroplasts 0.20

Homogentisate Phytyltransferase Genes

Plant Physiol. Vol. 129, 2002 325

operon-like structure with a downstream gene(slr1737). Even though the amino acid sequence ofslr1736 has similarity to known prenyltransferases,complementation analysis of these genes in the dele-tion mutant, or an enzyme assay of a recombinantexpressed gene, is necessary to verify function andthat loss of Slr1736 activity is responsible for themutant phenotype. Here, the isolation and character-ization of HPT from Synechocystis sp. PCC 6803(slr1736) and Arabidopsis (HPT1) is described. HPTactivity was demonstrated for slr1736 in the baculo-virus system and HPT1 was shown to complementthe slr1736 null mutant. Further, it was shown thatexpression of the Arabidopsis gene, HPT1, under aseed-specific promoter led to increased levels of seedtocopherols.

Using the UbiA protein sequence as a query in aPSI-BLAST search, several HTP candidates from Syn-echocystis sp. PCC 6803 and Arabidopsis were iden-tified. Based on the level of similarity to the UbiAprotein, efforts were focused on one Arabidopsis can-didate, HPT1, and the corresponding Synechocystissp. PCC 6803 ortholog, Slr1736, to test in functionaland enzymatic assays. It is worthwhile to note that

when UbiA was used as a query in a standard BLASTsearch (which performs only a single pass) of theArabidopsis public database, the only significant hitwas to the putative UbiA Arabidopsis ortholog,ATPT3 (8e�3). In contrast, the use of a protein profilegenerated by the iterative PSI-BLAST program(fourth iteration) resulted in a score of 1e�18 for HPT1and 2e�29 for Slr1736. The increased sensitivity of thisprogram was particularly important given that thepublic predicted protein of HPT1 lacked a significantportion of the amino terminus and lacked the last 17amino acids at the carboxy terminus, making it moredifficult to identify similarity to known proteins andtargeting signal peptides.

The fact that Slr1736 and HPT1 share conservedamino acid residues known to be required for cata-lytic function in another aromatic prenyltransferase(Fig. 3) suggests that these residues may be involvedin catalysis of the prenyltransfer reaction. These res-idues are also found in the other Arabidopsis prenyl-transferases presented, as well as in UbiA, suggestingthat these residues function in a broad array of pre-nyltransferase reactions.

Figure 5. HPT activity of Synechocystis sp. PCC6803 wild-type and slr1736 null mutant mem-brane fractions. A, Formation of [3H]2-methyl-6-phytylplastiquinone in membrane fractions ofSynechocystis sp. PCC 6803 wild-type cellsfrom [3H]HGA and phytyl-DP. B, Lack of accu-mulation of [3H]2-methyl-6-phytylplastiquinoneformation by membrane fractions from Syn-echocystis sp. PCC 6803 slr1736 null mutants.

Savidge et al.

326 Plant Physiol. Vol. 129, 2002

Characterization of the tocopherol null mutant ofslr1736 in Synechocystis sp. PCC 6803 and Arabidop-sis HPT1 antisense lines with substantially reducedseed tocopherol levels confirmed that these genes areessential for tocopherol biosynthesis. Restoration oftocopherol biosynthesis in the Synechocystis sp. PCC6803 slr1736 null mutant by HPT1 confirmed thatthese genes are orthologs. Interestingly, the slr1736null strain was not compromised in its ability togrow, indicating that tocopherols are not required forthe growth of this cyanobacterium under growthconditions used here. Whereas tocopherols were notdetected in the slr1736 null mutant in this study,Schledz et al. (2001) report a 90% reduction in to-copherol levels. The basis for this discrepancy isunclear.

Molecular analysis of slr1736 and HPT1, describedabove, suggests that these genes encode HPTs. Todemonstrate that these genes encode functional HPT,an enzyme assay was developed. HPT is thought tocatalyze the phytyltransfer from phytyl-DP ontoHGA and the decarboxylation reaction to yield2-methyl-6-phytyl plastoquinol. Soll et al. (1980) de-termined that in spinach, the HPT activity is associ-ated with membrane fractions. HPT1 and slr1736 arepredicted to encode integral membrane proteins,agreeing with these observations. Enzyme assays ofSynechocystis sp. PCC 6803 wild-type and slr1736 nullmutant membrane fractions confirmed that slr1736 isessential for this activity (Table II). Expression ofslr1736 in insect cells conferred HPT activity to the

membrane fraction, further confirming that thesegenes encode for HPT activity.

In a previously published study of a screen forArabidopsis carotenoid mutants (Norris et al., 1995),a putative mutant in HPT or a related step, pds2, wasidentified. The gene encoding PDS2 has not beencloned, but it maps to chromosome III, whereas HPT1maps to the top of chromosome II. Thus, pds2 doesnot correspond to HPT1. There are a variety of func-tions that could be encoded by PDS2, including aregulatory factor or effector molecule. Further map-ping or other studies will be needed to determine thesequence of PDS2, but the identification of at leasttwo loci involved in controlling this step points to thediversity of regulation that the sequencing of theArabidopsis genome will allow us to explore.

In plants, HPT1 was shown to be important fortocopherol accumulation based on the reduction oftotal tocopherols in e35S::HPT1 antisense T3 seedpools (Table III). Total tocopherol levels as low as 50ng mg�1 tissue were observed, which is 10-fold lowerthan in wild-type seed. Interestingly, the levels of�-tocopherol were not significantly reduced in indi-vidual T3 lines, whereas �- and �-isoforms are dra-matically reduced in the most affected progeny (datanot shown). These data suggest that there is stillsufficient �-tocopherol to saturate �-TMT, such thatwild-type levels of �-tocopherol are still achieved.

Expression of HPT1 under the seed-specific napinpromoter resulted in up to a 2-fold increase in toco-pherols in T3 homozygous seeds. These data further

Figure 6. Tocopherol content of T2 seed from pNapin::HPT1 Arabidopsis plants. A, Total tocopherol levels (ng mg�1 seed)in individual pools of segregating T2 seed derived from 36 independent transgenic events containing the pCGN10822construct (pNapin::HPT1) compared with vector (VC) and wild-type (WT) control populations. B, Total tocopherol levels (ngmg�1 seed) in individual pools of T2 seed derived from 86 independent transgenic events harboring the pCGN10803construct (e35S::HPT1antisense) are compared with control populations. Error bars on control samples represent the 95%confidence interval with the sample size indicated as n. The gray bar in the background includes the 95% confidenceinterval of both controls. Seed tocopherol levels of wild-type (u), vector control (�), and T2 transgenic lines (f).

Homogentisate Phytyltransferase Genes

Plant Physiol. Vol. 129, 2002 327

validate the role of HPT1 in tocopherol biosynthesisin Arabidopsis seed and demonstrate that tocopherollevels can be modified in seed. The majority of theincrease in total tocopherols was caused by an in-crease in �-tocopherol (data not shown). �-Tocopheroldid not increase, again indicating that �-TMT is satu-rated at wild-type levels of �-tocopherol.

The initial step in tocopherol biosynthesis is thecondensation of HGA and phytyl-DP by HPT. It isoften assumed that the first committed step in apathway will be a regulated step. As a consequence,one might predict that enhanced expression of suchan enzyme would lead to increased flux through agiven pathway. An example of increased flux wasdemonstrated in another plastidial isoprenoid path-way, with the overexpression of phytoene synthasein canola (Brassica napus) seeds resulting in a 50-foldincrease in carotenoid levels (Shewmaker et al.,1999). Expression of HPT1 under the napin promoterconsistently resulted in elevated levels of total toco-pherols in seed; however, the magnitude of increasewas not above 2-fold in homozygous T3 seed. In thehigh-carotenoid canola seeds, the 50-fold increasewas possible only because carotenoids normallycomprise such a small fraction of the total isoprenoidpopulation. The overall increase in isoprenoid unitswas only 4-fold (Shewmaker et al., 1999). These datasuggest that there may be a limit to the level thatisoprenoids can be increased without increasing fluxthrough the methyl-erythritol phosphate pathway. Infact, there are studies that demonstrate that gera-nylgeranylpyrophosphate, a phytol precursor, maybe limiting in tocopherol biosynthesis (Furuya et al.,1987).

The antioxidant properties of tocopherols arestrongly implicated in many aspects of humanhealth, including heart disease, cancer, and inflam-matory responses. Because of these demonstratedhealth benefits, there is interest in developing waysto increase the intake of natural tocopherols in hu-man and animal diets. One strategy is to increase thelevels of tocopherols in oilseed crops by engineering

components of the tocopherol biosynthetic pathway.To engineer the pathway, it is first necessary to iden-tify the genes that encode all of the enzymes of thepathway. In this study, the HPT responsible for thefirst committed step in tocopherol biosynthesis wasidentified from Arabidopsis and Synechocystis sp.PCC 6803. It was further demonstrated that seed-specific expression of the Arabidopsis HPT1 in Ara-bidopsis can elevate seed tocopherols 2-fold, a firststep in engineering oilseeds for high levels of toco-pherols.

MATERIALS AND METHODS

Bacterial Strains and Growth Conditions

Cultures of Synechocystis sp. PCC 6803 were grown pho-toautotrophically in BG11 media (Sigma, St. Louis) at 30°Cunder a light intensity of 50 �E m�2 s�1, and 70% relativehumidity. Growth media for null mutants was supple-mented with 25 �g mL�1 of kanamycin. Plasmids werestabilized in Synechocystis sp. PCC 6803 by addition of 10�g mL�1 gentamycin. For growth on solid media, BG11was supplemented with 10 mm TES, pH 8.0, and 15 g L�1

agar.

Construction of slr1736 Deletion Plasmid andSynechocystis sp. PCC 6803 Transformation

Synthetic oligos A, B, C, and D were generated to amplifyregions from the 5� and 3� ends of slr1736 (A, 5�-TAATGT-GTACATTGTCGGCCTC-3�; B, 5�-GCAATGTAACATCAG-AGATTTTGAGACACAACGTGGCTTTCCACAATTCCCC-GCACCGTC-3�; C, 5�-GGTATGAGTCAGCAACACCTTC-TTCACGAGGCAGACCTCAGCGGAATTGGTTTAGGTTA-TC-3�; and D, 5�-AGGCTAATAAGCACAAATGGGA-3�).The underlined nucleotides indicate regions homologous tothe nptI gene. The 5� ends of primers B and C contain a 40-bpregion of DNA sequence that is complementary to the 5� and3� sequence of the nptI gene from pUC4K (GenBank acces-sion no. X06404), respectively. The 5� and the 3� fragments ofslr1736 were PCR amplified and gel purified (spin columns,Qiagen Inc., Valencia, CA) separately. The nptI gene wasobtained from pUC4K by HincII digest followed by gelpurification. To insert the nptI gene into slr1736, the purified5� and 3� slr1736 fragments were mixed in a 1:1 ratio with thepurified nptI gene annealed and amplified for 40 cyclesunder the following conditions: 1 min of incubation at 94°C,1 min at 55°C, and 1 min at 72°C (�5 s per cycle) using pfupolymerase (Stratagene, La Jolla, CA) in 100 �L of totalreaction volume (Zhao and Arnold, 1997). A volume of 1 to5 �L of this reaction was used as template DNA for a secondamplification reaction using primers A and D, so that theresulting product contained 100 to 200 bp of the 5�-end ofslr1736, nptI, and 100 to 200 bp of the 3� end of slr1736. ThisPCR product was then cloned into the vector pGEM-T easy(Promega, Madison, WI), resulting in pMON21681 and usedfor stable integration into the Synechocystis sp. PCC 6803genome. Synechocystis sp. PCC 6803 transformations were

Table III. Seed tocopherol levels of T3 HPT1 sense and antisensepopulations

Line Description Event No. of PlantsSeed Tocopherol

(Mean)

ng mg�1

pNapin�HPT1sense 1,848 19 785a

1,860 20 863a

1,863 20 926a

Vector control – 5 525Wild type – 5 527e35S�HPT1antisense 1,393 20 174b

1,401 18 262b

Wild type – 5 445a Significant at P � 0.001 when compared with control popula-

tions. b Significant at P � 0.005 when compared with controlpopulations.

Savidge et al.

328 Plant Physiol. Vol. 129, 2002

performed as described in Porter (1988). Cells grown with 25�g mL�1 kanamycin were harvested to verify successfulgene disruption by PCR, and for tocopherol analysis.

Plant Vector Construction, Arabidopsis Transformation,and Plant Growth

HPT1 5� and 3� ends were extended using RACE (Ad-vantage PCR kit, CLONTECH, Palo Alto, CA) from Arabi-dopsis accession No-O inflorescence and silique cDNAlibraries using the Marathon cDNA Amplification kit(CLONTECH) plus primers 5�-CCCACCAGCAGCGGA-AACAAGAGAAGAACT-3� and 5�-GTTTCTGGCTTGGGTG-GATTGTTGGTTCAT-3�. The RACE products were se-quenced and the information was used to amplify thecomplete coding region from the silique cDNA library usingthe primers 5�-GGATCCGCGGCCGCACA ATGGAGTCTC-TGCTCTCTAGTTCT-3� and 5�-GGATCCTGCAGGTCACT-TCAAAAAAGGTAACAGCAAGT-3�. BamHIand NotI sitesflanked the 5� end of the gene and Sse8387I (Fisher Scien-tific, Pittsburgh) and BamHI sites flanked the 3� end of thegene. The PCR product was cloned into the pCR2.1 TAvector (Invitrogen), resulting in the formation ofpCGN10817. The DNA sequence was confirmed by DNAsequencing. Subsequently, NotI- and Sse8387I-digestedHPT1 was cloned into the binary expression vectorspCGN8643 (pNapin::HPT1sense::napin 3�; Kridl et al., 1991)and pCGN8644 (e35S::HPT1antisense::tml 3�; Chibbar et al.,1993), with final construct names pCGN10822 andpCGN10803, respectively. These vectors were electropo-rated into Agrobacterium tumefaciens strain ABI and grownunder standard conditions (McBride et al., 1994), recon-firmed by restriction analysis, and transformed into Arabi-dopsis accession No-O using the dipping method (Cloughand Bent, 1998). T0 plants were grown in a growth chamberunder 16 h of light, 19°C, and T1 seeds were selected ongermination plates with kanamycin (1� Murashige andSkoog salts, 10 g L�1 Suc, 100 mg L�1 myo-inositol, 1 mgL�1 thiamine-HCl, 0.5 mg L�1 pyridoxine-HCl, 0.5 mg L�1

nicotinic acid, 0.5 g L�1 MES, 100 mg L�1 carbenicillin, 50mg L�1 kanamycin, and 20 mg L�1 benlate, pH 5.7) andresistant plants were grown at 22°C. The number of inser-tions was determined by plating segregating T2 seed ontogermination plates and scoring the number of germinatingand non-germinating seeds.

Complementation of slr1736 Null Mutant Strain

For complementation of the Synechocystis sp. PCC 6803slr1736 null mutant, mature HPT1 was cloned intopSL1211, a vector based on the broad host range plasmidRSF1010 (Ng et al., 2000). The mature HPT1 gene wasamplified from the vector pCGN10817 by PCR using prim-ers HPT1nco.pr (CCATGGATTCGAGTAAAGTTGTCGC)and HPT1r1.pr (GAATTCACTTCAAAAAAGGTAACAG).These primers were designed to remove 36 amino-terminalamino acids, which are predicted to serve a plastidial targetsequence. In addition, these primers engineered an NcoIsite at the new translational start codon and an EcoRI site at

the 3� end of the gene. The PCR product was ligated intopGEM-T easy (Promega), resulting in the formation ofpMON21689 and sequence confirmed. The NcoI/EcoRIfragment from pMON21689 was ligated with the EagI/EcoRI and EagI/NcoI fragments from pSL1211, resulting inthe formation of pMON21690. The plasmid pMON21690was introduced into the Synechocystis sp. PCC 6803 slr1736null mutant via conjugation (Elhani and Wolk, 1988).

Baculovirus Expression Vectors

For confirmation of HPT activity of slr1736 and matureHPT1 expression products, both genes were cloned asEcoRI fragments into the Bac-to-Bac Baculovirus Expres-sion Systems (Invitrogen). Integration into the bacmid,transformation, and gene expression was done accordingto the manufacturer’s protocol.

HPT Assay

HPT was assayed using tritiated HGA (40 Ci mmol�1)and nonlabeled phytyl-DP as substrates. Tritiated HGAwas obtained by bromination of unlabeled HGA at roomtemperature in the presence of acetic acid and subsequenttritiation in the presence of Pd-activated charcoal in etha-nol (Koelsch, 1955). 3,4-[3H]HGA was stored in 0.1% (v/v)H3PO4. Phytyl-DP was synthesized as described by Joo etal. (1973). Standard compounds for 2-methyl-6-phytyl-plastoquinol and 2,3-dimethyl-5-phytylquinol were syn-thesized as described by Soll et al. (1980). The structureswere verified by mass spectroscopy. Nonlabeled HGA wasobtained from Sigma. �-, �-, �-, �-tocopherol, and tocol,were purchased from Matreya (Pleasant Gap, PA). Forenzyme assays of Synechocystis sp. PCC 6803 strains, totalmembranes were isolated by a variation of the procedure ofZak et al. (1999), in which the chlorophyll content wasadjusted to 0.1 to 0.5 mg chlorophyll mL�1, protease inhib-itor cocktail (Roche, Basel) was added to the extractionbuffer, and the ultracentrifugation time for isolation of totalmembranes was increased from 30 min to 1 h at 100,000g.Membrane fractions from insect cells were isolated as de-scribed in Cases et al. (1998). The HPT assay was validatedusing spinach (Spinacia oleracea) chloroplasts and Synecho-cystis sp. PCC 6803 membrane preparations as positivecontrols. For HPT assays using spinach chloroplasts, chlo-roplasts were isolated from 250 g of spinach leaves ob-tained from local markets as described by Douce and Joy-ard (1982).

The enzyme assay contained 60 �m [3H]HGA, which hadbeen adjusted to a specific activity of 0.16 to 4 Ci mmol�1.In addition to HGA, the enzyme assay (final volume 1 mL)contained 50 mm Tris-HCl, pH 7.6, 4 mm MgCl2, and 100�m phytyl pyrophosphate. The reaction was initiated byaddition of membrane fractions or chloroplast preparationsand terminated by adding 2 mL of chloroform:methanol(1:2 [v/v]) after 2 h of incubation at 23°C. The extractionprocedure was initiated by addition of tocol (2–5 �g L�1

final concentration), which served as an internal standardto monitor the extraction efficiency. Phase separation was

Homogentisate Phytyltransferase Genes

Plant Physiol. Vol. 129, 2002 329

achieved after supplementation with 2 mL of 0.9% (w/v)aqueous NaCl solution and vigorous shaking. This extrac-tion procedure was repeated three times. The organic layercontaining the prenylquinones was filtered (0.2-�mGelman PTFE acrodisc, 13-mm syringe filters, Pall GelmanLaboratory Inc., Ann Arbor, MI), evaporated under N2, andthen resuspended in 100 �L of ethanol.

The reaction products were separated by isocraticnormal-phase HPLC (90% [v/v] hexane and 10% [v/v]methyl-t-butyl ether), using a Zorbax silica column (Agi-lent Technologies, Atlanta), 4.6 � 250 mm (5 �m). Alter-natively, samples were analyzed by isocratic reversed-phase HPLC (0.1% [v/v] H3PO4 in MeOH), using a Vydac201HS54 C18 column (Western Analytical, Murrieta, CA),4.6 � 250 mm, coupled with a C18 guard column (Alltech,Inc., Nicholasville KY). The amount of reaction productswere calculated based on the specific radioactivity of thesubstrate, and adjusted according to the recovery based onthe tocol standard. Tocol recovery was determined basedon fluorescence measurement.

Tocopherol and Chlorophyll Analysis

Tocopherols were separated by normal phase HPLCeluting with a hexane (solvent A) methyl-t-butyl ether(solvent B) gradient (gradient conditions: 0–10 min, 90%[v/v] A and 10% [v/v] B; 11 min, 25% [v/v] A and 75%[v/v] B; and 12 min, 90% [v/v] A and 10% [v/v] B) usingan injection volume of 20 �L, a flow rate of 1.5 mL min�1,and a run time of 12 min (40°C). Tocopherol concentrationand composition was calculated based on standard curvesfor �-, �-, �-, and �-tocopherol using Chemstation software(Agilent Technologies). Synechocystis sp. PCC 6803 sampleswere harvested in late logarithmic growth phase by cen-trifugation. One gram of 0.1-mm microbeads (BiospecificsTechnologies Corp., Lynbrook, NY) and 500 �L of 1%(w/v) pyrogallol (Sigma) in ethanol were added to a cellpellet from 1 mL of culture. Tocol was added as internalstandard. The mixture was shaken for 1 min in a mini-Beadbeater (Biospecifics Technologies Corp.) on “fast”speed. For seed tocopherol determination, 10 mg of matureseed was added to 1 g of microbeads (Biospecifics Tech-nologies Corp.) in a sterile microfuge tube to which 500 �Lof 1% (w/v) pyrogallol (Sigma) in ethanol was added. Themixture was shaken for 3 min in a mini-Beadbeater (Bio-specifics Technologies Corp.) on “fast” speed. The extractwas filtered (0.2-�m Gelman PTFE acrodisc, 13-mm syringefilters, Pall Gelman Laboratory Inc.) into an autosamplertube. HPLC was performed on a Zorbax silica HPLC col-umn, 4.6 � 250 mm (5 �m), with a fluorescent detectionusing a Hewlett-Packard HPLC (Agilent Technologies).Sample excitation was at 290 nm, and emission was mon-itored at 336 nm. Chlorophyll concentration was deter-mined (Arnon, 1949).

Statistical evaluation of seed tocopherol data was per-formed with Excel 2000 (Microsoft Corp., Seattle). BecauseT2 seed pools were derived from independent transforma-tion events, they do not represent replicates, and cannot beregarded as a homogeneous population. Therefore, tocoph-

erol data from single events were compared with the 95%confidence interval of control populations. Data points out-side the 95% confidence interval were regarded as signifi-cantly different from the controls. In contrast, T3 seedsamples are homogeneous for the insertion locus of a givenevent. Therefore, T3 populations were compared via a Stu-dent’s t test to the control populations. Populations with aP value � 0.05 were regarded as significantly different.

ACKNOWLEDGMENTS

We would like to thank Susan Baszis for technical assis-tance, as well as Charlene Levering, Brenda Reed, andTawnya MacNeil for plant transformations and care. RobinEmig is thanked for his support in developing bioinformat-ics tools. Brad Mckinnis deserves our thanks for providingtritiated HGA, and Anabayan Kessavalou is thanked forstatistical support. Additional thanks to Thomas J. Savagefor critical reading of the manuscript.

Received August 16, 2001; returned for revision November7, 2001; accepted January 24, 2002.

LITERATURE CITED

Altschul S, Madden TL, Schaffer AA, Zhang J, Zhang Z,Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograms. Nucleic Acids Res 25: 3389–3402

Arigoni D, Sagner S, Latzel C, Eisenreich W, Bacher A,Zenk MH (1997) Terpenoid biosynthesis from 1-deoxy-d-xylulose in higher plants by intramolecular skeletalrearrangement. Proc Natl Acad Sci USA 94: 10600–10605

Arnon DI (1949) Copper enzymes in isolated chloroplasts.Polyphenol oxidase in Beta vulgaris. Plant Physiol 24:1–15

Ashby MN, Edwards PA (1990) Elucidation of the defi-ciency in two yeast coenzyme Q mutants. J Biol Chem265: 13157–13164

Bramley P, Elmadfa I, Kafatos A, Kelly FJ, Manios Y,Roxborough HE, Schuch W, Sheehy PJA, Wagner K-H(2000) Review vitamin E. J Sci Food Agric 80: 913–938

Camara B, d’Harlingue A (1985) Demonstration and solu-bilization of S-adenosylmethionine: �-tocopherol meth-yltransferase from Capsicum chromoplasts. Plant CellRep 4: 31–32

Carottoli A, Romano N, Ballario P, Morelli G, Macino G(1991) The Neurospora Crassa carotenoid biosyntheticgene “Albino 3” reveals highly conserved regions amongprenyl transferases. J Biol Chem 266: 5854–5857

Cases S, Smith SJ, Zheng YW, Myers HM, Lear SR, SandeE, Novak S, Collins C, Welch CB, Lusis AJ et al. (1998)Identification of a gene encoding an acyl CoA:diacylg-lycerol acyltransferase, a key enzyme in triacylglycerolsynthesis. Proc Natl Acad Sci USA 95: 13018–13023

Chen AK, Kroon PA, Poulter CD (1994) Isoprenyl diphos-phate synthases: protein sequence comparisons, a phy-logenetic tree, and predictions of secondary structure.Prot Sci 3: 600–607

Savidge et al.

330 Plant Physiol. Vol. 129, 2002

Chibbar R, Kartha KK, Datta RSS, Leung N, Caswell K,Mallard CS, Steinhauer L (1993) The effect of differentpromoter-sequences on transient expression of gus re-porter gene in cultured barley (Hordeum vulgare L.) cells.Plant Cell Rep 12: 506–509

Chow C, Draper HH (1974) Oxidative stability and antiox-idant activity of the tocopherols in corn and soybean oils.Int J Vitam Nutr Res 44: 396–403

Clough S, Bent AF (1998) Floral dip: a simplified methodfor Agrobacterium-mediated transformation of Arabidopsisthaliana. Plant J 16: 735–743

Collakova E, DellaPenna D (2001) Isolation and functionalanalysis of homogentisate phytyltransferase from Syn-echocystis sp. PCC 6803 and Arabidopsis. Plant Physiol127: 1113–1124

DellaPenna D (1999) Nutritional genomics: manipulatingplant micronutrients to improve human health. Science285: 375–379

DellaPenna D, Collakova E, Coughlan SJ, Helentjaris T(2000) Phytyl/prenyltransferase nucleic acids, polypep-tides and uses thereof. Patent Application WO 0068393

Demurin Y, Skoric D, Karlovic D (1996) Genetic variabil-ity of tocopherol composition in sunflower seeds as abasis of breeding for improved oil quality. Plant Breed115: 33–36

Douce R, Joyard J (1982) Purification of the chloroplastenvelope. In M Edelman, RB Hallick, N-H Chua, eds,Methods of Chloroplast Molecular Biology. Elsevier,Amsterdam, pp 239–256

Elhani J, Wolk P (1988) Conjugal transfer of DNA intocyanobacteria. Methods Enzymol 167: 747–754

Emanuelsson O, Nielsen H, von Heijne G (1999) ChloroP,a neural network-based method for predicting chloro-plast transit peptides and their cleavage sites. Prot Sci 8:978–984

Fiedler E, Soll J, Schultz G (1982) The formation of ho-mogentisate in the biosynthesis of tocopherol and plas-toquinone in spinach chloroplasts. Planta 155: 511–515

Furuya T, Yoshikawa T, Kimura T, Kaneko H (1987) Pro-duction of tocopherols by cell culture of Safflower. Phy-tochemistry 26: 2741–2747

Gaubier P, Wu H-J, Laudie M, Delseny M, Grellar F(1995) Chlorophyl synthetase gene from Arabidopsis thali-ana. Mol Gen Genet 249: 58–64

Gottstein T, Grosch W (1990) Model study of differentantioxidant properties of �- and �-tocopherol in fats. FatSci Technol 4: 139–144

Joo CN, Park CE, Kramer KG, Kates M (1973) Synthesisand acid hydrolysis of monophosphate and pyrophos-phate esters of phytanol and phytol. Can J Biochem 51:1527–1536

Koelsch FC (1955) 6-Bromo-2-naphthol. In EC Horning, ed,Organic Synthesis Collective Vol 3, A Revised Edition OfAnnual Volumes 20–29. John Wiley & Sons, Inc., NewYork, pp 132- 133

Kridl J, McCarter DW, Rose RE, Scherer DE, Knutzon DS,Radke SE, Knauf VC (1991) Isolation and characteriza-tion of an expressed napin gene from Brassica napus.Seed Sci Res 1: 209–219

Kyte J, Doolittle RF (1982) A simple method for displayingthe hydropathic character of a protein. J Mol Biol 157:105–132

Lichtenthaler HK, Rohmer M, Schwender J (1997) Twoindependent biochemical pathways for isopentenyldiphosphate and isoprenoid biosynthesis in higherplants. Physiol Plant 101: 643–652

Marrero PF, Poulter CD, Edwards PA (1992) Effects ofsite-directed mutagenesis of the highly conserved aspar-tate residues in domain II of farnesyl diphosphate syn-thase activity. J Biol Chem 267: 21873–21878

Marshall P, Morris SR, Threlfall DR (1985) Biosynthesis oftocopherols: a re-examination of the biosynthesis andmetabolism of 2-methyl-6-phytyl-1,4-benzoquinol. Phy-tochemistry 24: 1705–1711

McBride KE, Schaaf DJ, Daley M, Stalker DM (1994) Con-trolled expression of plastid transgenes in plants based ona nuclear DNA-encoded and plastid-targeted T7 RNApolymerase. Proc Natl Acad Sci USA 91: 7301–7305

Melzer M (1994) Characterization of polyprenyldiphos-phate: 4-hydroxybenzoate polyprenyltransferase fromEscherichia coli. Biochim Biophys Acta 1212: 93–102

Ng W-O, Zentella R, Wany Y, Taylor JS, Pakrashi HB(2000) phrA, the major photoreactivating factor in cya-nobacterium Synechocystis sp. strain PCC 6803 codes forcyclobutane-pyrimidine-dimer-specific DNA photol-yase. Arch Microbiol 173: 412–417

Norris SR, Barrette TR, DellaPenna D (1995) Genetic dis-section of carotenoid synthesis in Arabidopsis definesplastoquinone as an essential component of phytoenedesaturation. Plant Cell 7: 2139–2149

Ogura K, Koyama T, Sagami H (1997) Polyprenyl diphos-phate synthases. In R Bittman, ed, Subcellular Biochem-istry, Vol 28. Plenum Press, New York, pp 57–87

Oster U, Bauer CE, Rudiger W (1997) Characterization ofchlorophyll A and bacteriochlorophyll A synthases byheterologous expression in Escherichia coli. Biol Chem272: 9671–9676

Oster U, Rudiger W (1997) The G4 gene of Arabidopsisthaliana encodes a chlorophyll synthase of etiolatedplants. Bot Acta 110: 420–423

Parkhurst R, Skinner WA, Sturm PA (1968) The effect ofvarious concentrations of tocopherols and tocopherolmixtures on the oxidative stability of a sample of lard.J Am Oil Chem Soc 45: 641–642

Porter RD (1988) DNA transformation. In L Packer, ANGlazer eds, Methods in Enzymology, Section VI, Vol 167,Cyanobacteria. Academic Press, Inc., San Diego, pp703–712

Russell D, Bennet GN (1982) Construction and analysis ofin vivo activity of E. coli promoter hybrids and promotermutants that alter the �35 to �10 spacing. Gene 20:231–243

Saiki K, Mogi T, Hori H, Tsubaki M, Anraku Y (1993)Identification of the functional domains of heme-O-synthase. J Biol Chem 268: 26927–26934

Savidge B, Lassner MW, Weiss JD, Post-Beittenmiller D(2000) Protein and cDNA sequences of Arabidopsis di-methylallyltransferase and the uses thereof on altering

Homogentisate Phytyltransferase Genes

Plant Physiol. Vol. 129, 2002 331

tocopherol synthesis in plants. Patent Application WO0063391 A2

Schledz M, Seidler A, Beyer P, Nuehaus G (2001) A novelphytyltransferase from Synechocystis sp. PCC 6803 in-volved in tocopherol biosynthesis. FEBS Lett 499: 15–20

Schultz-Siebert D, Homeyer U, Soll J, Schultz G (1987)Synthesis of plastoquinone-9, �-tocopherol and phylloqui-none (vitamin K1) and its integration in chloroplast car-bon metabolism of higher plants. In P Stumpf, JB Mudd,WD Nes, eds, The Metabolism, Structure and Function ofPlant Lipids. Plenum Press, New York, pp 29–36

Sheppard AJ, Pennington JAT (1993) Analysis and distri-bution of vitamin E in vegetable oils and foods. In JFLPacker, ed, Vitamin E in Health and Disease. MarcelDekker, New York, pp 9–31

Shewmaker C, Sheehy JA, Daley M, Colburn S, Ke DY(1999) Seed-specific overexpression of phyoene synthase:increase in carotenoids and other metabolic effects. PlantJ 20: 401–412

Shintani D, DellaPenna D (1998) Elevating the Vitamin EContent of plants through metabolic engineering. Science282: 2098–2100

Soll J, Kemmerling M, Schultz G (1980) Tocopherol andplastoquinone synthesis in spinach chloroplasts subfrac-tions. Arch Biochem Biophys 204: 544–550

Soll J, Schultz G, Joyard J, Douce R, Block MA (1985)Localization and synthesis of prenylquinones in isolatedouter and inner envelop membranes from spinach chlo-roplasts. Arch Biochem Biophys 238: 290–299

Tan B (1989) Palm carotenoids, tocopherols and tocotrien-ols. J Am Oil Chemists Soc 66: 770–776

Zak E, Norling B, Andersson B, Pakrashi HB (1999) Sub-cellular location of the BtpA protein in the cyanobacte-rium Synechocystis sp. PCC 6803. Eur J Biochem 261:311–316

Zhao H, Arnold FH (1997) Optimization of DNA shufflingfor high fidelity recombination. Nucleic Acids Res 25:1307–1308

Savidge et al.

332 Plant Physiol. Vol. 129, 2002