Aiming at developing cyanobacterial-based biosensors for heavy metal detection, expression of heavymetal inducible genes of the cyanobacterium Synechocystis PCC 6803 was investigated by quantitativeRT-PCR upon 15 minutes exposure to biologically relevant concentrations of Co2+, Zn2+, Ni2+, Cd2+,Cr6+, As3+ and As5+. The ziaA gene, which encodes a Zn2+-transporting P-type ATPase showed a marked-ly increased mRNA level after incubation with Cd2+ and arsenic ions, besides the expected induction byZn2+ salts. The Co2+ efflux system-encoding gene coaT was strongly induced by Co2+ and Zn2+ salts,moderately induced by As3+ salts, and induced at a relatively low level by Cd2+ and As5+ ions. Expressionof nrsB, which encodes a part of a putative Ni2+ efflux system was highly induced by Ni2+ salts and at alow extent by Co2+ and Zn2+ salts. The arsB gene, which encodes a putative arsenite-specific efflux pumpwas highly induced by As3+ and As5+ ions, while other metal salts provoked insignificant transcript levelincrease. The transcript of chrA, in spite of the high sequence similarity of its protein product with sev-eral bacterial chromate transporters, shows no induction upon Cr6+ salt exposure. We conclude that dueto the largely unspecific heavy metal response of the studied genes only nrsB and arsB are potential can-didates for biosensing applications for detection of Ni2+ and arsenic pollutants, respectively.

Keywords: Cyanobacteria – gene induction – heavy metal stress – Synechocystis PCC 6803 – biosensors

INTRODUCTION

During the last decades an increasing concern has been emerged about health hazardscaused by environmental heavy metal pollution since these toxic compounds are per-sistent and accumulate in organisms once introduced to the biosphere via mining orother industrial activities.

Acta Biologica Hungarica 58 (Suppl.), pp. 11–22 (2007)DOI: 10.1556/ABiol.58.2007.Suppl.2

0236-5383/$ 20.00 © 2007 Akadémiai Kiadó, Budapest

CHARACTERIZATION OF THE ACTIVITYOF HEAVY METAL-RESPONSIVE PROMOTERS

IN THE CYANOBACTERIUM SYNECHOCYSTIS PCC 6803LOREDANA PECA, P. B. KÓS and I. VASS*

Institute of Plant Biology, Biological Research Center, Hungarian Academy of Sciences,Szeged, Hungary

(Received: March 8, 2007; accepted: June 18, 2007)

* Corresponding author; fax: +36-62-433-434; e-mail: imre@brc.hu

12 LOREDANA PECA et al.

Acta Biologica Hungarica 58, 2007

Plants and cyanobacteria have a complex metal homeostasis system, whichincludes cytosolic chelate formation with metallothioneins and phytochelatines, andexclusion via active transport with e.g. CPx-ATPases [22]. Analysis of the completegenome sequence of the cyanobacterium Synechocystis PCC 6803 (henceforthreferred to as Synechocystis) [6] led to the identification of a metal-regulated genecluster involved in resistance against zinc, cobalt and nickel [3]. This 12 kb regionconsist of 11 open reading frames (ORFs) organized into six putative transcriptionalunits (Fig. 1): (i) nrsBACD operon involved in Ni2+ and Co2+ tolerance and regulat-ed by the upstream nrsSR operon [8], (ii) ziaA encoding a putative Zn2+ efflux P-typeATPases and regulated by the product of the preceding ORF, ziaR [25], and (iii) coaTencoding a putative Co2+ translocating P-type ATPase under the regulation of theupstream corR product [20]. Current knowledge about the expressions of genes inthis locus is summarized below.

In the presence of Ni2+, the expression of Synechocystis nrs genes was shown tobe highly induced. The nrs genes are induced in the presence of Co2+ as well, but ata lower extent [8]. However, their function has not been fully elucidated. García-Domínguez et al. [2] speculate that NrsA and NrsB form a Ni2+ efflux system, basedon their homology with czcABC gene products, the components of a cation effluxsystem conferring resistance to Co2+, Zn2+, and Cd2+ in Ralstonia eutrophus [15].NrsD is a possible member of the MFS (major facilitator superfamily) of permeasesinvolved in Ni2+ export [8]. The protein product of nrsC shows no homology to pro-teins encoded by the czc or related operons. The nrsRS open reading frames ( andsll0798) seem to form a single transcriptional unit that encode a two-component sys-tem controlling the nickel-dependent expression of the nrsBACD operon [8].

The zia system contains two open reading frames, ziaA and ziaR, which encode aZn2+ transporter and its regulator, and are divergently transcribed from a central pro-moter region. ZiaA is a metal ion-translocating P-type ATPase with sequence simi-larity to CadA from Staphylococcus aureus [16] that confers an increased Zn2+ tol-erance and a reduction in Zn2+ accumulation by cells. ZiaA mediates the efflux ofZn2+ from the cytosol to the periplasmic space of cyanobacterial cells. ZiaR is a tran-scriptional repressor [25] and belongs to the ArsR super-family of metal-responsiveregulators [21].

Fig. 1. A metal-regulated gene cluster of Synechocystis PCC 6803. The pentagons represent ORFs (openreading frames) and indicate the direction of translation. From left to right: sll0798 (nrsS), sll0797 (nrsR),slr0793 (nrsB), slr0794 (nrsA), slr0795 (nrsC), slr0796 (nrsD), sll0794 (coaR), slr0797 (coaT), sll0793,

sll0792 (ziaR), slr0798 (ziaA). Black arrows mark the putative operons

The divergently transcribed coaT and coaR encode a putative cobalt efflux system.From a range of tested metals, the coaT transcript was induced only by Co2+ and Zn2+

with a significantly higher response to Co2+. The phenotype of coaT disrupted mutantshowed a decreased resistance to Co2+, but not to Zn2+ [3] and an increased accumu-lation of 57Co in the cytoplasm [20]. These lines of evidence, together with the clearhomology of the coaT product with cation-transporting P-type ATPases suggestedthat the coaT protein product is a Co2+ efflux P-type ATPase [3]. Rutherford et al.[20] demonstrated that coaR encodes a transcriptional activator of coaT expressionwhose carboxyl-terminal Cys-His-Cys motif is required for cobalt sensing.

The arsenic resistance conferred by the ars operon is found in many prokaryotesand it has been extensively studied [10, 19, 23]. In Synechocystis, the chromosomalputative ars operon is composed of the arsB, arsH and arsC genes [7]. ORF arsBencodes a putative arsenite-specific efflux pump that shows 35% amino acid identi-ty to the S. cerevisiae ARR3 protein and 26% amino acid identity to the B. subtilisArsB protein [29]. The second ORF is designated arsH, based on 67% amino acididentity of its protein product with Y. enterocolica ArsH protein [11]. The third geneof the cluster (arsC) encodes a predicted protein with sequence similarity to the arse-nate reductases of Staphylococcus (42% amino acid identity) and Bacillus (37%amino acid identity). The function of arsH is not known. Contrary to the above dis-cussed resistance systems, its repressor, ArsR is coded in a distant genomic region.

Cadmium is another highly toxic heavy metal, widely spread in ecosystems.Cadmium-binding metallothioneins have been identified in cyanobacteria [28], butthe mechanisms of Cd2+ resistance are largely unknown [27]. No metallothionein andno specific Cd2+-resistance gene were reported up to date in Synechocystis. Weincluded Cd2+ salts in our studies in order to check if other resistance systems fromSynechocystis can cope with this metal.

The product of chrA gene from Synechocystis was defined as a chromate trans-porter based on sequence homology [4] and belongs to the CHR family ofProkaryotic Proton Motive Force-Driven Transporters [14]. The best functionallycharacterized members of this protein family are ChrA proteins from Alcaligeneseutrophus [13] and Pseudomonas aeruginosa [2], that seem to be involved in chro-mate efflux. Another member of the family, SrpC protein from Synechococcus PCC7942 may function in the active transport of chromate under sulfur-deficient condi-tions [12].

Exploration of metabolic pathways involved in detoxification of heavy metal con-taminations via sequestration, chelation or transport in prokaryotes or higher organ-isms offers potential applications in pollution monitoring and control. Geneticallymodified organisms that couple the genes encoding heavy metal transporters withreporter genes can be used as whole-cell biosensors for heavy metal detection inenvironmental samples.

In this work we investigated heavy-metal dependent induction of several genes oroperons that had been reported, or hypothesized to be involved in tolerance to cobalt,nickel, cadmium, zinc, arsenic, and chromium in Synechocystis.

Heavy metal-responsive promoters in Synechocystis PCC 6803 13

Acta Biologica Hungarica 58, 2007

14 LOREDANA PECA et al.

Acta Biologica Hungarica 58, 2007

MATERIALS AND METHODS

Cyanobacterial strains and growth conditions

Synechocystis cells were grown photoautotrophically at 30 °C in BG-11 medium [18]with orbital shaking (120 rpm), continuous illumination (40 µE m–2 s–1) and a 5%CO2 enriched atmosphere. The heavy metal treatment was carried out in 20 ml mid-log-phase liquid cultures of Synechocystis ( O.D.720 nm ≈ 0.5) using different concen-trations of NiCl2 (Ni2+), CoCl2 (Co2+), ZnSO4 (Zn2+) and CdCl2 (Cd2+), NaAsO2(As3+), KH2As04 (As5+), CuSO4 (Cu2+), Cr2(SO4)3 (Cr3+), K2Cr2O7 (Cr6+). Growth ofthe cultures was followed by measuring the optical density (turbidity) of the cell sus-pension at 720 nm using a Shimadzu 1601 spectrophotometer.

Nucleic acid extraction and qRT-PCR analysis

Total RNA was isolated from 20 ml samples of Synechocystis culture by hot phenolmethod [9] with the following modifications: the cultures were immediately mixedwith an equal volume of cell stop solution (5% H2O-saturated phenol in absoluteethanol) and the 3-step hot phenol extraction was followed by a single-step chloro-form extraction. Samples of 5 µg of total RNA were further purified usingDeoxyribonuclease I (RNase-free, Fermentas) and NucleoSpin RNA II (Macherey-Nagel, Düren, Germany). First-strand cDNA was synthesized from 0.4 µg of totalcellular RNA using RevertAid H Minus M-MuLV Reverse Transcriptase(Fermentas) and random hexamer primers. The reverse transcription was carried outat 42 °C for 60 min. The resulted cDNA was used as template for qPCR (quantita-tive real-time PCR). Primer pairs were designed using Primer Express 2.0 software(Applied Biosystems). The primer sequences for nrsB gene are 5’ CTTTCTG-GCACTGGGTTTGAC 3’ (sense) and 5’ TGGGCTGTTACGAGATTGGG 3’ (anti-sense). The primer sequences for coaT gene are 5’ TGCTCAACAGGTGGGAGT-CA 3’ (sense) and 5’ TCTTCGGGCAAAAGTTCTGC 3’ (antisense). The primersequences for ziaA gene are 5’ TTGGTAAAGCCGGGTGAAAA 3’ (sense) and 5’TCCCCCTAAAATCTCGCCAT 3’ (antisense). The amplification was performed byincubating the reaction mixture at 94 °C for 2 min, followed by 40 cycles of PCRamplification (95 °C for 15 s and 60 °C for 1 min) on an ABI 7000 sequence detec-tor (Applied Biosystems, Foster City, CA, USA). SYBR Green JumpStart TaqReadyMix for Quantitative PCR was purchased from Sigma Chemical Corp. (St.Louis, Missouri). The gene expression was calculated using delta-delta CT methodand was normalized to the expression of the rnpB gene (RNase P subunit B) as inter-nal standard.

Growth of cultures and growth inhibition

The growth of cyanobacterial cultures was assessed according the increase in theirturbidity, measured as optical density at 720 nm (OD720). Percentage growth inhibi-tion was established with respect to the OD720 values after 3 or 4 days. We introducedthe terms “minimal inhibitory concentration” and “maximal inhibitory concentra-tion” for describing the extremities of the concentration ranges of concentration-dependent growth inhibition with respect to each metals. “Minimal inhibitory con-centration” (ICmin) refers to the lowest tested concentration where growth inhibitioncould be observed and “maximal inhibitory concentration” (ICmax) refers to the low-est tested concentration where no further growth could be observed.

RESULTS

We aimed to investigate gene expression changes specific to the applied heavy met-als. For this end we had to choose a concentration for each metal that is high enoughfor inducing the corresponding defence genes but not as high as to cause pleiotropiceffects with other aspecifically induced genes of Synechocystis. We first investigatedthe concentration dependence of growth inhibition of Co2+, Zn2+, Ni2+, Cd2+, Cr6+ andAs3+ salts for a period of 2 to 5 days as a simple marker of the toxic effect.Representative growth curves are shown on Fig. 2. The borders of concentrationranges respective to concentration-dependent growth inhibition were established foreach metal using these data, as described in the Materials and Methods.

We found about an order of magnitude ratio between ICmin, with only slight retar-dation, if any, in growth and ICmax with complete growth inhibition. These concen-trations and their ratios were specific to each metal (Table 1.) We found that Cd2+ andCo2+ were the most toxic compounds among the tested metals, causing slight growth

Heavy metal-responsive promoters in Synechocystis PCC 6803 15

Acta Biologica Hungarica 58, 2007

Table 1Characteristic concentrations of the studied metal ions

on the growth of Synechocystis PCC6803

ICmin (µM) ICmax (µM)Gene expression

assessment at (µM)

Co2+ 2 >32 3Ni2+ 3 50 15Zn2+ 5 32 5Cd2+ 1.5 >10 1.5As3+ 330 3.5 1Cr6+ 7 >40 7

ICmin and ICmax refer to the lowest tested concentrations where growth inhibitioncould be observed and to the lowest tested concentration where no further growth couldbe observed, respectively.

16 LOREDANA PECA et al.

Acta Biologica Hungarica 58, 2007

inhibition at as low as 1 mM salts concentration. As the other extremity, no severegrowth inhibition was observed up to 2 mM As3+. It is also noteworthy that 3.5 mMAs3+ caused complete growth inhibitio, so ICmin and ICmax differed by only abouttwofold, while this ratio was up to sixteen fold in the other ions, suggesting differenttypes of sensing and defense mechanisms.

In order to characterize the heavy metal response of the metal homeostasis systemof Synechocystis we have selected representative genes of each of the known heavymetal related operons. An important problem frequently associated with heavy metalcontamination is the co-occurrence of several metal species. The possible cross talksbetween detoxification systems specific to certain metals may make it difficult toidentify and correctly assess the concentration of the particular heavy metal contam-inants using single-gene biosensors. For a broader understanding of the effects of themost significant environmental polluting metals on various promoters of heavy metal

Fig. 2. Effect of metal cations on cell growth. Synechocystis PCC 6803 cultures grown in BG-11 medi-um were supplemented with different metal salts as indicated below and growth was monitored by mea-suring O.D.(720). A) Zn2+ at 0 (squares), 8 (circles), 16 (up triangles), and 32 µM (down triangles). B)Ni2+ at 0 (squares), 9 (circles), 27 (up triangles), and 50 µM (down triangles). C) Cd2+ at 0 (squares), 2.6(circles), 6.5 (up triangles), and 10 µM (down triangles). D) Co2+ at 0 (square), 2 (circles), 8 (up trian-gles), and 32 µM (down triangles). E) Cr6+ at 0 (squares), 10 (circles), 20 (up triangles), and 40 µM(down triangles). F) As3+ at 0 (squares), 0.33 (circles), 1.9 (up triangles) and 3.5 mM (down triangles)

inducible genes, we have investigated the expression pattern of the selected genesupon incubation with Co2+, Zn2+, Ni2+, Cd2+, Cr6+, As3+ and As5+ salts. This way weaimed to obtain information necessary for developing a complex cyanobacterialbiosensor system that could be used for monitoring the most frequently occurringtoxic metals.

We investigated the gene expression levels of the chosen genes upon exposure tothe above mentioned heavy metals at arbitrarily chosen concentrations between ICminand ICmax causing slight growth inhibition. These concetrations were: 3 µM Co2+,6 µM Zn2+, 15 µM Ni2+, 1.5 µM Cd2+, 7 µM Cr6+, 1 mM As3+ and 1 mM As5+. Sincegrowth inhibition indicates saturation of the cellular defense system, metal ions areexpected to exert their full potential in gene overexpression at these respective con-centrations. Therefore, comparison of gene expression levels brought about by dif-fering metal ion concentrations is possible. We found that irrespective of the differ-ences in the possible lag periods, a pronounced gene overexpression occurred with-in 15 minutes exposure (Fig. 3), with a simliar expression pattern as observed afterone hour exposure (data not shown).

We found that most studied genes responded significantly to more than one heavymetals:

– ziaA, which encodes a zinc transporter showed marked increase of mRNA levelafter incubation with Cd2+ and arsenic ions, besides the expected induction byZn2+ (≈30×).

Heavy metal-responsive promoters in Synechocystis PCC 6803 17

Acta Biologica Hungarica 58, 2007

Fig. 3. Cross-reactivity of gene overexpression by heavy-metal cations. Mid-log-phase SynechocystisPCC 6803 cultures were grown in BG-11 medium with no metal supplement, then exposed to Ni2+

(15 µM), Co2+ (3 µM), Zn2+(6 µM), Cd2+ (1.5 µM), Cr6+ (7 µM), As3+ (1 mM) or As5+ (1 mM) for 15minutes, and the expression level of the indicated genes was determined as it is described in Materials

and Methods

18 LOREDANA PECA et al.

Acta Biologica Hungarica 58, 2007

– The Co2+ efflux system-encoding coaT showed strong induction by Co2+ andZn2+ (≈15×), weaker expression by As3+ (≈5×), and a minor effect by Cd2+ andAs5+.

– Expression of nrsB, which encodes a part of a putative Ni2+ efflux system washighly induced by Ni2+ (≈350×) and at a low extent by Co2+ and Zn2+ (≈8×).

– arsB, which encodes a putative arsenite-specific efflux pump was highlyinduced by arsenic ions (≈1800× by As3+ and ≈700× by As5+), while other metalsalts provoked an insignificant increase in the transcript level.

Fig. 4. Concentration-dependent gene expression. Synechocystis PCC6803 cells were grown in BG-11were supplemented with the indicated concentrations of Ni2+, Zn2+ or Co2+. Total RNA was isolated fromthe cultures after 15 minutes exposure and the expression levels of ziaA (squares), coaT (circles) and

nrsB (triangles) genes was determined

The transcript of chrA, in spite of its similarity to the chromate transporters family(CHR) [14], showed no induction upon Cr6+ exposure.

The tested metal ions differ in their specificities with respect to detoxifying sys-tems. While more than two orders of magnitude overexpression of nrsB dominatedupon Ni2+ treatment with slight overexpression of arsB, the transcript levels of coaTand nrsB upon Co2+ treatment or the levels of coaT and ziaA upon Zn2+ exposurewere comparable. On the other hand, the tested resistance genes show different levelof stringency in their metal ion specificities. While ziaA is expressed at similar levelupon exposure to Zn2+, Cd2+ and the arsenic ions, nrsB and arsB genes showed morethan tenfold difference between overexpression by their specific ions and by othermetals.

We also assessed Zn2+, Co2+ and Ni2+ concentration dependence of the ziaA, coaTand nrsB expression levels (Fig. 4). We found closely linear dependence of ziaA andcoaT genes in the range of 0.5 to 3 µM Zn2+. nrsB responded in a concentrationdependent way to Ni2+ below 0.5 µM, while the semi-linear range of coaT and nrsBinduction by Co2+ spanned from 0.2 to as high as 3 µM. In these concentrationranges, the data shown here would allow quantitation of the respective metals, as dis-cussed below. We also found that the growth inhibitory metal concentrations thatwere used for the above studies are at a saturated level of gene induction, accordingto the above-mentioned expectations.

DISCUSSION

Toxicity and cellular response to individual metal ions are concentration dependent.At low, permissive concentrations the metal ions cause no interference with cellularprocesses. Indeed, contrary to its toxicity at high concentrations to both eukaryotesand prokaryotes, Zn2+ as well as Co2+ are important trace elements, being necessaryfor the cells at low concentrations. Beyond this neutral range, cells tend to exert theirprotective functions against the toxic metal ions. Under such conditions, geneexpression is expected to be specific to the given stressors and proportional to theeffective concentration of the harmful compounds. As long as the detoxifying sys-tems can cope with the metals, there is no visible detrimental effect, like growth inhi-bition, on the cells at these permissive concentrations. As the ions are chelated and/orexcreted from the cells there are no secondary, general damages to the cell metabo-lism and therefore the primary and specific effect of the metals can be traced backand investigated. Further increasing the toxic metal ion concentration the cell growthis impaired and general damages, such as redox changes, oxidative damages canoccur. Such limiting concentrations depend on the chemical nature and biochemicalactions of a given metal ion, as well as the possible influx through the cell mem-branes. Therefore these interfering concentrations of different metal ions do not nec-essarily fall in the same order of magnitude, similarly to the differences in the toxic-ities of the given metals.

Heavy metal-responsive promoters in Synechocystis PCC 6803 19

Acta Biologica Hungarica 58, 2007

20 LOREDANA PECA et al.

Acta Biologica Hungarica 58, 2007

By investigating the effect of a broad concentration ranges of the metal ions, wedetermined the minimal and the maximal inhibitory concentrations for Zn2+, Ni2+,Cd2+, Co2+, Cr2+ and As3+ in Synechocystis. We found about one order of magnitudedifferences between the maximum permissive concentrations and the lethal concen-trations for all but the As3+ ions. In this range, the detoxifying systems reach satura-tion state, therefore higher metal concentrations result in more damages and conse-quently higher level of growth inhibition. Contrary to these, arsenic detoxificationseems to work very effectively coping well with arsenic concentrations up to about2 mM. Interestingly, the non-inhibitory (≈2 mM) and completely inhibiting concen-trations (≈3.5 mM) differ only by about twofold.

Based upon these results, we determined the expression levels of representativegenes from operons reported or hypothesized to be involved in tolerance to all select-ed metals, using metal concentrations that produce maximal, but still specificresponses. We found that there is a level of overlap in the specificities of the nrs, ziaand coa operons, in accordance with their co-localization, similar function and puta-tive co-evolution. We show in the present work a similar range of induction of coaTtranscript by Co2+ and Zn2+ in agreement with the hypothesis by García-Domínguezet al. [3] that CoaT ATPase might be involved in Zn2+ tolerance, as well, beside theZiaA ATPase.

We could not observe Cd2+-induced overexpression of the arsB gene, which is incontrast with the expectation based on the finding that Staphylococcus aureusarsBHC promoter is induced by Cd2+ in an E. coli mutant host [24]. We observed thatCd2+ induced ziaA and to a lesser extent coaT, which is in concert with othercyanobacterial systems, like Oscillatora [26] where co-tolerance to Cd2+ and Zn2+ isexerted by this gene.

The putative chromate transporter homolog gene, char did not respond to any ofthe tested metal ions. This gene may function in the active transport of chromate intothe cell under sulfur deficient conditions as is hypothesized for its homolog SrpCfrom Synechococcus PCC 7942 [12]. The other five genes, responded to one or moremetals, to different extent. This is an important feature regarding the possibility ofidentifying individual toxic metals in complex environmental samples. The biosen-sors available to date are effective for monitoring one single heavy metal species, ortwo related ones, by utilizing the heavy metal concentration specific expression of areporter gene under a single promoter [1, 6, 17]. The data summarized in Fig. 3, showthe limitations imposed to the potential use of the studied promoters by their non-spe-cific responses. For example, ziaA overexpression could indicate the presence ofZn2+ in a sample, but according to the data presented here, differentiation betweenZn2+, Cd2+ or As3+ is not possible by using ziaA overexpression alone. Therefore,data obtained from a biosensor using the ziaA promoter fused to a reported genecould be misinterpreted. Among the investigated promoters, nrsB gives the most spe-cific response to Ni2+ with below 3% error from other metals, and therefore, could bepotentially suitable for biosensor application. arsB is also highly specific to arsenicions with less than 1% error from other metals. However, it can not distinguishbetween As3+ and As5+. For detection of Co2+, Zn2+, Cd2+ or Cr6+ combined applica-

tion of more than one single-promoter sensor would be needed. Such systems can beestablished by constructing sensor mutants in which the expression of bacterialluciferase is controlled by the heavy metal-responsive promoters characterized here.A set of such transgenic Synechocystis strains is under construction.

ACKNOWLEDGEMENTS

The work was supported by a grant from the Hungarian National Office for Research and Technology(OM-00246/2004)

REFERENCES

1. Blum, L. J., Gautier, S. M., Coulet, P. R. (1989) Design of Luminescence Photobiosensors. J.Biolumin. Chemilumin. 4, 543–550.

2. Cervantes, C., Ohtake, H., Chu, L., Misra, T. K., Silver, S. (1990) Cloning, Nucleotide-Sequence, andExpression of the Chromate Resistance Determinant of Pseudomonas-Aeruginosa Plasmid Pum505.J. Bacteriol. 172, 287–291.

3. Garcia-Dominguez, M., Lopez-Maury, L., Florencio, F. J., Reyes, J. C. (2000) A gene clusterinvolved in metal homeostasis in the cyanobacterium Synechocystis sp strain PCC 6803. J. Bacteriol.182, 1507–1514.

4. Kaneko, T., Tanaka, A., Sato, S., Kotani, H., Sazuka, T., Miyajima, N., Sugiura, M., Tabata, S. (1995)Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strainPCC6803. I. Sequence features in the 1 Mb region from map positions 64% to 92% of the genome.DNA Res. 2, 153–166.

5. Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa,M., Sugiura, M., Sasamoto, S., Kimura, T., Hosouchi, T., Matsuno, A., Muraki, A., Nakazaki, N.,Naruo, K., Okumura, S., Shimpo, S., Takeuchi, C., Wada, T., Watanabe, A., Yamada, M., Yasuda, M.,Tabata, S. (1996) Sequence Analysis of the Genome of the Unicellular CyanobacteriumSynechocystis sp. Strain PCC6803. II. Sequence Determination of the Entire Genome andAssignment of Potential Protein-coding Regions. DNA Res. 3, 109–136.

6. Liao, V. H. C., Chien, M. T., Tseng, Y. Y., Ou, K. L. (2006) Assessment of heavy metal bioavailabil-ity in contaminated sediments and soils using green fluorescent protein-based bacterial biosensors.Environ Pollut. 142, 17–23.

7. Lopez-Maury, L., Florencio, F. J., Reyes, J. C. (2003) Arsenic sensing and resistance system in thecyanobacterium Synechocystis sp strain PCC 6803. J. Bacteriol. 185, 5363–5371.

8. Lopez-Maury, L., Garcia-Dominguez, M., Florencio, F. J., Reyes, J. C. (2002) A two-component sig-nal transduction system involved in nickel sensing in the cyanobacterium Synechocystis sp PCC6803. Mol Microbiol. 43, 247–256.

9. Mohamed, A., Janson, C. (1989) Influence of light on accumulation of photosynthesis-specific tran-scripts in the cyanobacterium Synechocystis 6803. Plant Mol Biol. 13, 693–700.

10. Mukhopadhyay, R., Rosen, B. P., Pung, L. T., Silver, S. (2002) Microbial arsenic: from geocycles togenes and enzymes. FEMS Microbiol Rev. 26, 311–325.

11. Neyt, C., Iriarte, M., Thi, V. H., Cornelis, G. R. (1997) Virulence and arsenic resistance in yersiniae.J. Bacteriol. 179, 612–619.

12. Nicholson, M. L., Laudenbach, D. E. (1995) Genes Encoded on A Cyanobacterial Plasmid AreTranscriptionally Regulated by Sulfur Availability and Cysr. J. Bacteriol. 177, 2143–2150.

13. Nies, A., Nies, D. H., Silver, S. (1990) Nucleotide Sequence and Expression of A Plasmid-EncodedChromate Resistance Determinant from Alcaligenes eutrophus. J. Biol. Chem. 265, 5648–5653.

Heavy metal-responsive promoters in Synechocystis PCC 6803 21

Acta Biologica Hungarica 58, 2007

22 LOREDANA PECA et al.

Acta Biologica Hungarica 58, 2007

14. Nies, D. H., Koch, S., Wachi, S., Peitzsch, N., Saier, M. H. (1998) CHR, a novel family of prokary-otic proton motive force-driven transporters probably containing chromate/sulfate antiporters. J.Bacteriol. 180, 5799–5802.

15. Nies, D. H., Nies, A., Chu, L., Silver, S. (1989) Expression and Nucleotide Sequence of A Plasmid-Determined Divalent Cation Efflux System from Alcaligenes eutrophus. Proc. Natl. Acad. Sci. USA86, 7351–7355.

16. Nucifora G., Chu L., Misra T., K., Silver S. (1989) Cadmium resistance from Staphylococcus aureusplasmid pI258 cadA gene results from a cadmium-efflux ATPase. Proc. Natl. Acad. Sci. USA 86,3544–3548.

17. Ramanathan, S., Shi, W. P., Rosen, B. P., Daunert, S. (1997) Sensing antimonite and arsenite at thesubattomole level with genetically engineered bioluminescent bacteria. Anal Chem. 69, 3380–3384.

18. Rippka, R., Deruelles, J., Waterbury, J. B., Herdman, M., Stanier, R. Y. (1979) Generic Assignments,Strain Histories and Properties of Pure Cultures of Cyanobacteria. J. Gen. Microbiol. 111, 1–61.

19. Rosen, B. P. (2002) Biochemistry of arsenic detoxification. FEBS Lett. 529, 86–92.20. Rutherford, J. C., Cavet, J. S., Robinson, N. J. (1999) Cobalt-dependent transcriptional switching by

a dual-effector MerR-like protein regulates a cobalt-exporting variant CPx-type ATPase. J. Biol.Chem. 274, 25827–25832.

21. Shi, W. P., Wu, J. H., Rosen, B. P. (1994) Identification of A Putative Metal-Binding Site in A NewFamily of Metalloregulatory Proteins. J. Biol. Chem. 269, 19826–19829.

22. Silver, S., Phung, L. T. (1996) Bacterial heavy metal resistance: New surprises. Annu. Rev. Microbiol.50, 753–789.

23. Silver, S., Phung, L. T. (2005) Genes and enzymes involved in bacterial oxidation and reduction ofinorganic arsenic. Appl. Environ. Microbiol. 71, 599–608.

24. Tauriainen, S., Karp, H., Chang, W., Virta, M. (1997) Recombinant luminescent bacteria for mea-suring bioavailable arsenite and antimonite. Appl. Environ. Microbiol. 63, 4456–4461.

25. Thelwell, C., Robinson, N. J., Turner-Cavet, J. S. (1998) An SmtB-like repressor from SynechocystisPCC 6803 regulates a zinc exporter. Proc. Natl. Acad. Sci. USA 95, 10728–10733.

26. Tong, L., Nakashima, S., Shibasaka, M., Katsuhara, M., Kasamo, K. (2002) A novel histidine-richCPx-ATPase from the filamentous cyanobacterium Oscillatoria brevis related to multiple-heavy-metal cotolerance. J. Bacteriol. 184, 5027–5035.

27. Trevors, J. T., Stratton, G. W., Gadd, G. M. (1986) Cadmium Transport, Resistance, and Toxicity inBacteria, Algae, and Fungi. Can. J. Microbiol. 32, 447–464.

28. Turner, J. S., Robinson, N. J. (1995) Cyanobacterial Metallothioneins-Biochemistry and Molecular-Genetics. J. Ind. Microbiol. 14, 119–125.

29. Wysocki, R., Bobrowicz, P., Ulaszewski, S. (1997) The Saccharomyces cerevisiae ACR3 geneencodes a putative membrane protein involved in arsenite transport. J. Biol. Chem. 272,30061–30066.