Impact of alg3 gene deletion on growth, development, pigmentproduction, protein secretion, and functions of recombinant Trichodermareesei cellobiohydrolases in Aspergillus niger

Ziyu Dai a,⇑, Uma K. Aryal b,1, Anil Shukla b, Wei-Jun Qian b, Richard D. Smith b, Jon K. Magnuson a,William S. Adney e,2, Gregg T. Beckham c,d, Roman Brunecky e, Michael E. Himmel e, Stephen R. Decker e,Xiaohui Ju f, Xiao Zhang f, Scott E. Baker a,g,⇑a Fungal Biotechnology Team, Chemical and Biological Processes Development Group, Pacific Northwest National Laboratory, Richland, WA 99352, United Statesb Biological Sciences Division and Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, WA 99352, United Statesc National Bioenergy Center, National Renewable Energy Laboratory, Golden, CO, United Statesd Department of Chemical Engineering, Colorado School of Mines, Golden, CO, United Statese Biosciences Center, National Renewable Energy Laboratory, Golden, CO, United Statesf Bioproducts, Science Engineering Laboratory, Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University,Richland, WA 99354, United Statesg Environmental Molecular Science Laboratory, Pacific Northwest National Laboratory, Richland, WA 99352, United States

a r t i c l e i n f o

Article history:Received 24 July 2013Accepted 16 September 2013Available online 25 September 2013

Keywords:Asparagine-linked glycosylation 3 (ALG3)Aspergillus nigerFilamentous fungiN-linked glycosylationTrichoderma reesei cellobiohydrolase (Cel7A)Protein secretion and expression

a b s t r a c t

Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl a-1,3-mannosyltransferase (also known as ‘‘asparagine-linked glycosylation 3’’, or ALG3) is involved in early N-linked glycan synthesis and thus is essentialfor formation of N-linked protein glycosylation. In this study, we examined the effects of alg3 gene dele-tion (alg3D) on growth, development, pigment production, protein secretion and recombinant Tricho-derma reesei cellobiohydrolase (rCel7A) expressed in Aspergillus niger. The alg3D delayed sporegermination in liquid cultures of complete medium (CM), potato dextrose (PD), minimal medium(MM) and CM with addition of cAMP (CM + cAMP), and resulted in significant reduction of hyphal growthon CM, potato dextrose agar (PDA), and CM + cAMP and spore production on CM. The alg3D also led to asignificant accumulation of red pigment on both liquid and solid CM cultures. The relative abundances of54 of the total 215 proteins identified in the secretome were significantly altered as a result of alg3D, 63%of which were secreted at higher levels in alg3D strain than the parent. The rCel7A expressed in the alg3Dmutant was smaller in size than that expressed in both wild-type and parental strains, but still largerthan T. reesei Cel7A. The circular dichroism (CD)-melt scans indicated that change in glycosylation ofrCel7A does not appear to impact the secondary structure or folding. Enzyme assays of Cel7A and rCel7Aon nanocrystalline cellulose and bleached kraft pulp demonstrated that the rCel7As have improved activ-ities on hydrolyzing the nanocrystalline cellulose. Overall, the results suggest that alg3 is critical forgrowth, sporulation, pigment production, and protein secretion in A. niger, and demonstrate the feasibil-ity of this alternative approach to evaluate the roles of N-linked glycosylation in glycoprotein secretionand function.

! 2013 Elsevier Inc. All rights reserved.

1. Introduction

Filamentous fungi, such as Aspergillus niger, are well known fortheir ability to produce a variety of products including heterologousproteins of industrial interest and organic acids on an industrialscale (Nevalainen et al., 2005; Punt et al., 2002; Magnuson andLasure, 2004). Some industrial A. niger strains can grow in liquidcultures with more than 20% glucose or sucrose and be able toconvert almost the entire supplied carbohydrates to citric acid. Inparticular, A. niger has been extensively studied and optimized forcitric acid production and is currently the primary source of

1087-1845/$ - see front matter ! 2013 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.fgb.2013.09.004

⇑ Corresponding authors. Addresses: Fungal Biotechnology Team, Chemical andBiological Process Development Group, Pacific Northwest National Laboratory, P.O.Box 999, MSIN: K8-60, Richland, WA 99352, United States (Z. Dai), EnvironmentalMolecular Science Laboratory, Pacific Northwest National Laboratory, 3335 Inno-vation Blvd, MSIN: K8-91, Richland, WA 99352, United States (S.E. Baker). Fax: +1509 372 4732.

E-mail addresses: ziyu.dai@pnnl.gov (Z. Dai), scott.baker@pnnl.gov (S.E. Baker).1 Present address: Department of Biochemistry, Purdue University, West Lafayette,

IN 47907, United States.2 Present address: Center for Agricultural, Environmental Biotechnology, RTI

International, Research Triangle Park, NC 27709, United States.

Fungal Genetics and Biology 61 (2013) 120–132

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier .com/ locate/yfgbi

commercial production of citric acid (Magnuson and Lasure, 2004).In addition to citric acid, A. niger has been explored for production ofother organic acids and secondary metabolites (Nielsen et al., 2009;Frisvad et al., 2011; Chiang et al., 2011).

Production of both proteins and chemicals in A. niger is tightlycontrolled and regulated spatially and temporally at differentlevels. Various research efforts have examined the morphology ofA. niger (Dai et al., 2004; Driouch et al., 2012), its protease dynam-ics in cultures (Braaksma and Punt, 2008; van den Hombergh et al.,1997), its bioprocessing strategies (Wang et al., 2005), and itsgenomics (Andersen et al., 2011) to understand the underlyingcellular mechanisms. For example, comparative genomics wasapplied to compare citric-acid-producing and enzyme-producingA. niger strains (Andersen et al., 2011), proteomics was used toexamine secretory responses to culture conditions (de Oliveiraet al., 2011), and a combination of both genomics and proteomicswas used to examine enzyme or organic acid production (Jacobset al., 2009; Tsang et al., 2009). Although past studies examinedpotential involvement of the selected genes in the production oforganic acids or proteins, the effects of altering or deleting suchgenes on growth, development, and protein production are stillnot well investigated.

N-linked protein glycosylation is one of the most common post-translational modifications, wherein glycans are primarily linkedto asparagine (N) and involved in a variety of biochemical andcellular processes (e.g., cell to cell recognition, cell signaling,host-defense, and protein secretion and function) in various organ-isms (Adney et al., 2009; Beckham et al., 2012; Nam et al., 2008;Trombetta and Parodi, 2003; Yang et al., 2009). Glycosylationmotifs have been identified in more than two-thirds of eukaryoticproteins (Apweiler et al., 1999), and have been extensively studiedin both mammals (Kornfeld and Kornfeld, 1985) and yeast(Kukuruzinska et al., 1987; Wildt and Gerngross, 2005; Yan andLennarz, 2005). With the rapid progress in genomics and proteo-mics of filamentous fungi, several protein glycosylation pathwaysin filamentous fungi have also been deduced recently (Deshpandeet al., 2008; Geysens et al., 2009). Further, several genes involved inN-linked glycosylation have recently been studied in filamentousfungi (Kainz et al., 2008; Kotz et al., 2010; Maddi and Free, 2010;Motteram et al., 2011) and demonstrated their effects on N-linkedglycan patterns, cell wall formation, overall protein secretion andphenotypic changes.

Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl a-1,3-manno-syltransferase (ALG3) incorporates the first dolichyl-P-man-derived mannose in an a-1,3-linkage into the Man(5)GlcNAc(2)-PP-Dol inside the endoplasmic reticulum (ER) (Fig. 1). Hence, it isa key enzyme in the early N-linked glycan synthesis for formationof a Glc3Man9GlcNAc2 core oligosaccharide. The alg3 gene has beenidentified and functionally characterized in several organisms (e.g.,yeast [Saccharomyces cerevisiae, Pichia pastoris, and Yarrowia lipoly-tica], filamentous fungus [A. nidulans and A. niger], parasitic flagel-lates [Trypanosoma brucei], higher plants [Arabidopsis thaliana], andhumans) (Aebi et al., 1996; Davidson et al., 2004; De Pourcq et al.,2012; Kainz et al., 2008; Korner et al., 1999; Kajiura et al., 2010;Manthri et al., 2008). No obvious phenotypes were observed inthe alg3D mutants of S. cerevisiae, P. pastoris, A. nidulans, T. brucei,and A. thaliana. Lately, two independent studies showed that thealg3 deletion reduced the growth and sporulation in S. cerevisae(Deutschbauer et al., 2002; Yoshikawa et al., 2011). In humans,the alg3 defect leads to several severe diseases (e.g., profoundpsychomotor delay, optic atrophy, acquired microcephaly, iris col-obomas, and hypsarrhythmia) (Denecke et al., 2005; Schollen et al.,2005; Stibler et al., 1995). Glycan analyses confirmed that the alg3mutants in these studies produced glycoproteins with variousN-glycan profiles (e.g., Man3GlcNAc2, Man4GlcNAc2, Man5GlcNAc2,GlcMan5GlcNAc2, Glc2Man5GlcNAc2 and Glc3Man5GlcNAc2), which

affected the overall N-linked glycosylation and incomplete glyco-site occupancy in the glycoproteins. Due to its involvement inthe early glycan synthesis, it has been explored for the potentialapplications in producing humanized complex N-glycans on thetherapeutic proteins in P. pastoris, Y. lipolytica, A. nidulans, andA. niger (Gerngross, 2004; Kainz et al., 2008).

Additionally, A. niger has been actively explored for heterolo-gous production of industrial enzymes. However, the effects ofpost-translational modifications such as N-linked glycosylationon their function have not been well defined. Recently, the involve-ment of alg3 gene in a Glc3Man9GlcNAc2 core oligosaccharideformation and overall N-linked glycosylation has been analyzedin A. niger (Kainz et al., 2008). However, the effects of alg3 geneon growth, development, metabolisms, protein secretion andindustrial enzyme production have not been examined. Thus, theobjective of this study is to demonstrate the involvement of alg3in spore germination, hyphal growth, sporulation, pigment produc-tion, overall protein secretion, and heterologous expression andfunction of Trichoderma reesei cellobiohydrolase Cel7A in A. niger.

2. Material and methods

2.1. Strains, chemicals and media

The Escherichia coli strain Top10 and S. cerevisiae strain YVH10were used as hosts for routine cloning and gap repair experiments.A. niger wild-type strain (ATCC 11414 [derived from ATCC 1015/CBS 113.46/NRRL 328], from the American Type Culture Collection[Rockville, MD, 20852]), was grown on complete medium (CM) orpotato dextrose agar (PDA) plates at 30 "C for culture maintenanceand spore preparation. The parent strain of 11414kusA was gener-ated by the homologous replacement of kusA in A. niger 11414-pyrGD strain with Aspergillus fumigatus orotidine-5-phosphate

Fig. 1. Diagram showing functional role of ALG3 in biosynthesis of the lipid-boundoligosaccharide by the addition of the first dol-P-man derived mannose in an alpha-1,-3-linakge to man5GlcNac2-pp-Dol inside endoplasmic reticulum. The alg3deletion (alg3D) leads to loss of N-linked glycan complexity. Blue square representsGlcNac, while the green circle depicts the mannose. The red hexagon depicts thespecific mannose resulted from ALG3function. The a2 is for alpha-1,2-, a3 foralpha-1,3-, a6 for alpha-1,6-, and b4 for beta-1,4-linkage, respectively. RFT1 is anenzyme that catalyzes the translocation of the Man5GlcNAc2-pppDol from cyto-plasmic to the luminal side of the endoplasmic reticulum (ER) membrane; andALG9 is an enzyme of asparagine-linked glycosylation 9. (For interpretation of thereferences to color in this figure legend, the reader is referred to the web version ofthis article.)

Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132 121

decarboxylase (pyrG), where the kusA encodes the orthologue ofthe ku70 protein that involves in the non-homologous end joiningpathway of DNA repair for the integration of a DNA fragment intothe genome, and confirmed by Southern blotting analysis (Chianget al., 2011). The 11414kusA strain with a high homologous replace-ment rate was used as a parent strain in this study. The cultures onPDA or CM agar plates were incubated for 4 days at 30 "C and thespores were harvested afterwards by washing with sterile 0.5%Tween 80 (polyoxyethylenesorbitan monooleate). The spores wereenumerated with a hemocytometer. Aliquots of the resulting sporesuspension (about 109 spores/mL) were used to inoculate differentagar-plates or liquid cultures. The PDA, CM and minimal medium(MM) were prepared following the description of Bennett andLasure (Bennett and Lasure, 1991). The 100 mM cAMP stock solu-tion was prepared in sterile distilled H2O. Hygromycin B stock solu-tion was purchased from Agro Bio, Inc. (Miami, FL, USA) and Zeocinstock solution from Invitrogen (Grand Island, NY, USA).

2.2. Culture methods

Glass baffled-flasks of 250 mL or 1000 mL were silanized byrinsing with a 5% solution of dichlorodimethylsilane in heptane(Sigma, St. Louis, MO) to minimize spore adherence to the glasssurface. A. niger biomasses for genomic DNA isolation wereprepared from 2 mL stationary CM liquid cultures in16 ! 125 mm glass culture-tubes at 30 "C. The biomasses formedon the surfaces of the liquid cultures were collected, frozen imme-diately in liquid nitrogen and dried in the VirTis benchtop manifoldfreeze dryer (SP Scientific, Gardiner, NY). For total secretomeisolation, 200 mL modified MM (Wang et al., 2012) were usedand cultures were grown at 30 "C and 200 rpm for 18 h. For heter-ologous expression of T. reesei Cel7A (rCel7A), the mutant strainswere grown at 30 "C and 200 rpm for 48 h in the CM liquid cultureswith maltose as carbon source.

2.3. The alg3 gene deletion and complementation, heterologousexpression of T. reesei Cel7A gene, and A. niger transformation

The putative Alg3 protein sequence (jgi|Aspni5|42720) wasidentified by a database search based on the amino acid sequence

of S. cerevisiae ALG3p (access number YBL082C) in A. niger genomedatabase of the U.S. Department of Energy (DOE) Joint GenomeInstitute (JGI). The constructs for alg3 gene deletion and comple-mentation and heterologous expression of T. reesei Cel7A wereprepared by yeast gap repairing method as described by Colotet al. (2006). Briefly, oligo No: 1–6 (Table 1) were used for PCRisolation of about 1 kb DNA fragments of 50- (oligo 1&2) and30- (oligo 5&6) franking regions of alg3 gene from A. niger genomicDNA and the 1.5 kb hygromycin B phosphotransferase (hph)marker gene (oligo 3&4) from vector pCSN44 (Staben et al.,1989). The final alg3D construct with three PCR fragments wasfused together into pRS426 by yeast gap repairing.

Due to the high homologous replacement efficiency of 1141kusAstrain, the alg3D complementation (alg3D + alg3) construct wastargeted to trpC locus, where the trpC coding region was inter-rupted by DNA fragment insertion previously (Chiang et al.,2011). About 1 kb DNA fragments of 50- (oligo 7&8) and 30- (oligo13&14) franking regions of trpC gene from A. niger genomic DNA,1.6 kb DNA fragment of bleomycin selectable marker gene (oligo9&10) from pAN8-1 (Punt et al., 1988), and a 2.3 kb genomicDNA fragment of alg3 gene (oligo 11&12), were isolated by PCR.Yeast gap repairing was carried out to fuse them together for alg3Dcomplementation construct.

Similarly, the heterologous expression cassette for T. reeseiCel7A gene expression in A. niger was also constructed by yeastgap repairing with 1 kb PCR fragment of A. niger glucoamylase(glaA) promoter (oligo 15&16), 2.9 kb ClaI/StuI plasmid DNAfragment containing the T. reesei Cel7A coding region under thecontrol of A. niger glaA promoter and A. nidulans trpC transcrip-tional terminator from pFE2-Cel7A (Adney et al., 2009), 1.35 kbPCR fragment of the phleomycin resistant marker gene (ble) (oligo17&18) from pAN8-1 (Punt et al., 1988), and 0.4 kb PCR fragment ofS. cerevisiae cyc1 transcriptional terminator (oligo 19&20), and 1 kbPCR fragment of 30-franking region of A. niger glucoamylase gene(oligo 21&22). The DNA sequences of the alg3 gene for complemen-tation and T. reesei Cel7A gene for heterologous expression in thepRS426 plasmid DNA vectors were confirmed by DNA sequencing.The homologous replacement of the above three constructs in A.niger genome was carried out by standard polyethylene glycol(PEG)-mediated protoplast transformation.

Table 1Ligonucleotides used in this study.

Oligo no: Oligonucleotide name Sequence

Alg3 gene deletion1 5alg3-5F GTAACGCCAGGGTTTTCCCAGTCACGACGTCATAACTTCTCTCCCCTCC2 5alg3-3R ATCCACTTAACGTTACTGAAATCTCCAACTTCATGGACACACACAGACC3 hph-5F GGTCTGTGTGTGTCCATGAAGTTGGAGATTTCAGTAACGTTAAGTGGAT4 hph-3R GCTACTACTGATCCCTCTGCGTCGGAGACAGAAGATGATATTGAAGGAG5 3alg3-5F CTCCTTCAATATCATCTTCTGTCTCCGACGCAGAGGGATCAGTAGTAGC6 3alg3-3R GCGGATAACAATTTCACACAGGAAACAGCCGTGAGAGGTTTGTAGTACG

Alg3 gene complementation at pryG locus7 5pyrG5F GTAACGCCAGGGTTTTCCCAGTCACGACGTTTAAACATGCATCATTCTCCCGCTTTGT8 5pyrG3R AGAAAGAGTCACCGGTCACGACATCGCCAATCACCTCAATCAC9 ble5F GTGATTGAGGTGATTGGCGATGTCGTGACCGGTGACTCTTTCT

10 Ble3R ACGTAGACACCTCTTCATCGGCTTCGAGCGTCCCAAAACCT11 alg3-5F AGGTTTTGGGACGCTCGAAGCCGATGAAGAGGTGTCTACGT12 alg3-3R TTGATCCTTGTGCCACACCATCGCTAAGCAAGCTGCTGTTGT13 3pyrG5F ACAACAGCAGCTTGCTTAGCGATGGTGTGGCACAAGGATCAA14 3pyrG3R GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACTGTGCCAGTCAATTGTCCGAAGT

Heterologous expression cel7A at the glaA locus15 1138CBHI1F GTAACGCCAGGGTTTTCCCAGTCACGACGTTTAAACGAATTATCGCGTGGGAGGTT16 1139CBHI2R TCGTTCGCTCCGAAATTCATC17 1140CBHI3F CCAGAATGCACAGGTACACTGCAGGGATCGTGACCGGTGACTCTTTCT18 1141CBHI4R TCGGTCAGTCCTGCTCCTGGATCTCAAGCTCCTGGGA19 1142CBHI5F TCCCAGGAGCTTGAGATCCAGGAGCAGGACTGACCGA20 1143CBHI6R TCCACCATGCATCTCGGCTATTACCATGATTACGCCAAGCTTGCA21 1144CBHI7F TGCAAGCTTGGCGTAATCATGGTAATAGCCGAGATGCATGGTGGA22 1145CBHI8R GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACGGTTTCGCTGGTATGTCGCA

122 Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132

2.4. Total genomic DNA isolation for PCR and Southern blottinganalysis

Total genomic DNA was isolated from A. niger according to theSDS extraction method described by Dellaporta et al. with somemodifications (Dellaporta et al., 1983). Briefly, 0.1 g dried biomassand two 3.5 mm diameter glass beads were transferred into a 2 mLpolypropylene micro-vial, where biomass was pulverized into finepowders with a Mini-Beadbeater-8 (Bio Spec Products Inc., Bartles-ville, OK, USA) for one min. Then, further procedures were followedin the detailed description by Dellaporta et al. (1983) with properamounts of buffers and chemical solutions. Finally, the genomicDNA was re-suspended in 80–100 lL 10 mM Tris–HCl (pH8.0) buf-fer and quantified with Qubit fluorometer (Invitrogen, Carlsbad,CA, USA). The genomic DNAs were used for genomic DNA PCRand Southern blotting analysis.

For Southern blotting analyses of alg3 gene deletion and heter-ologous expression of T. reesei Cel7A gene, one microgram of totalgenomics DNA was digested with the restriction endonucleaseBamHI and SacII for alg3 gene and HindIII for Cel7A gene. The geno-mic DNA fragments were separated in 1% agarose gel electropho-retically and transferred onto the zeta-probe membrane (BioRad,Hercules, CA, USA) with alkaline capillary transfer method. The3.8 kb genomic DNA fragment of A. niger containing the Alg3 orthe 1.6 kb ble marker gene fragment was used for preparation ofthe biotin-labeled probe. The genomic DNA in Zeta-probe mem-brane was hybridized with the biotin-labeled probe overnight at60 "C in the Problot Hybridization Oven (Labnet International, Edi-son, NJ, USA). The genomic DNA on the hybridized membrane wasvisualized with North2South chemiluminescent detection kit(Pierce Protein Research Products, Rockford, IL) in Koda ImagingStation 2000R (Eastman Kodak Company, Rochester, NY, USA).

2.5. Total RNA isolation and real-time PCR (qPCR)

The biomass of parent, Alg3D and alg3D + alg3 strains from 18 hliquid cultures (citric acid production medium, Dai et al., 2004) or48 h CM agar plate cultures was collected and immediately groundto fine powders in a frozen mortar and pestle with liquid nitrogen.The biomass powders in liquid N2 was transferred into 15 mLpre-chilled centrifuge tubes and stored at "70 "C. The total RNAswere isolated with Trizol RNA reagent (Life Technologies, Grand Is-land, NY, USA). Briefly, about 100 mg of frozen ground biomasseswere transferred into chilled microcentrifuge tube and 1 mL Trizolreagent was added onto the sample. The samples were immediatelymixed well with the Trizol reagent and incubated at room temper-ature for 30 min. The manufacturer’ instructions were followed forfurther RNA purification. Two-step RT-PCR was performed for real-time PCR (qPCR). The total RNA was first reversely transcribed intocDNA with high capacity RNA to cDNA kit (Applied Biosystems, Fos-ter City, CA, USA). The equal amount of cDNA from parent, alg3D, oralg3D + alg3 strains was mixed with TaqMan universal PCR mastermix for RT-PCR, which was performed in the 7900HT fast system(Applied Biosystems, Foster City, CA, USA). The threshold cycle(CT) was determined for both alg3 and reference b-tubulin genesin parent, alg3D, and alg3D + alg3 complementation strains. Threereplicates were carried out for each strain.

2.6. Spore production and germination

After 4 days growth at 30 "C, a piece of PDA or CM agar slice,containing the parental or mutant strain of spore productiondescribed above with the same amount of spore inoculation(5 ! 105 spores/plate), was excised with plastic closures of culturetubes in 27 mm diameter and transferred into the 50 mL centrifugetubes containing 25 mL 0.8% Tween 80. Three replicate plates were

prepared for each strain and four agar slices per plate were excised.The spores were released by scrapped with plastic loops andvortexed with vortex mixer at top speed for 3 min. The spores werediluted and enumerated with a hemocytometer. The spore produc-tion in a unit area (cm2) was determined. The data was the averageof 12 spore count events from 12 agar slides.

For the spore germination study, 0.5 mL cultures of 1 ! 105

spores with 5 replicates were prepared and added into each wellof a 24-well Schwarz sensoplate (Greiner Bio-One, Inc. Monroe,NC, USA) and incubated in the microscopic incubator at 30 "C. Afterthe first 2 h incubation, the specific view areas with about 100–150spores at a specific location were selected for multipoint captureand the spore germination was automatically imaged hourly for12 h by the Olympus inverted system microscope (Olympus,Miami, FL, USA). The spore germination was visualized with AdobePhotoshop CSS (Adobe, San Jose, CA, USA) and counted manually.

2.7. Colony diameter measurement

The freshly prepared spores of 11414kusA, alg3D, and alg3-D + alg3 strains were diluted to the final concentration of 1000spores per microliter. Five microliters of diluted spores were spot-ted onto agar plates of CM, CM + 10 mM cAMP, PDA, and MM withsix colony replicates in two replicate agar plates. After 15 h initialgrowth at 30 "C, the colony diameter on the culture plates wasmeasured with a thin transparent plastic millimeter ruler under-neath the plate under the stereomicroscope-Leica MZ16 (LeicaMicrosystem Ltd, Bannockburn, IL, USA) at different intervals from15 to 35 h of incubation. The percentage of parent strain colonydiameter was calculated by dividing the mutant colony diameterwith the parental colony diameter and timing 100 at a given timepoint to determine the effects of alg3 deletion on hyphal growthand the restorative levels of its complementation.

2.8. The red pigment measurements

The absorbance of the red pigments in liquid culture filtrates atthe wavelength ranging from 230 to 620 nm was determined withthe SpectraMax M5 multi-mode microplate reader (MolecularDevices, Sunnyvale, CA, USA), a UV–Visible spectrophotometry in1 mL quartz cuvette. In order to reduce the protein interference,the filtrates were filtered through 3000 Daltons Amicon Ultra-0.5centrifugal filter devices (Millipore, Billerica, MA, USA) to removemost of proteins in filtrates. Ten percent of filtrates were mixedwith dH2O for absorbance measurement. The actual pigmentabsorbance in the mutant strain culture filtrates was estimatedby subtracting the corresponding absorbance of parent strainculture filtrates. The corresponding data was the average of threereplicates with standard errors.

2.9. Protein extraction and digestion for global proteomics analysisusing LC–MS/MS

The protein extraction and digestion for global proteomicsanalysis mainly followed the methods described previously (Wanget al., 2012). LC–MS/MS raw data were converted into ‘‘.dta’’ filesusing Extract_MSn (version 4.0) from Bioworks Cluster 3.2 (Ther-mo Scientific), and the SEQUEST algorithm (version 27, revision12) was used to independently search all the MS/MS spectraagainst the Department of Energy (DOE)-Joint Genome Institute(JGI) A. niger v3.0 protein database that had 11,200 entries. TheSEQUEST output files were imported to Microsoft Office Access2007 filtering. The false discovery rate (FDR) of the identified pep-tides was estimated based on the decoy-database searching meth-odology (Elias and Gygi, 2007). Data were filtered using MS-GFspectral probabilities (Kim et al., 2008), score of 61E"9 and peptide

Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132 123

mass tolerance of ±10 ppm to achieve final FDR of <0.4% at the pep-tide and <2.6% at the protein level for all types of datasets. After fil-tering, the data were loaded into Data Analysis Tool Extension(DAnTE) version 1.2 (Polpitiya et al., 2008) for normalization,statistical analysis and clustering into heat maps.

DAnTE uses intensities or spectral count data for quantitativemeasurement, and allows users to apply many analysis algorithmsfor normalization, peptides rollup into proteins, data plotting andstatistical analysis. In this study, the spectral count data of individualproteins were used for semi-quantitative measurement, which werenormalized by log2 transformation and central tendency adjust-ment and subjected to statistical analysis using analysis of variance(ANOVA). The statistically significant proteins (P 6 0.05) were usedfor hierarchical clustering and visualization into heat maps.

2.10. SDS–PAGE for total secretome or the rCel7A expressed in A. niger

For 1D SDS–PAGE of secretomes, 20 lg (#10 lL) of totalsecreted proteins from each of the 11414kusA and alg3D strainswas mixed with 10 lL of the Laemmli sample buffer (Bio-Rad, Her-cules, CA, USA) and electrophoresed on a 1.0 mm, 12 well, 4–12%Bis–Tris NuPAGE gels (Invitrogen, Grand Island, NY, USA) in aCriterion Cell (Bio-Rad, Hercules, CA, USA) at a constant voltageof 120 V. The separated proteins were washed three times withMilliQ water and stained with Gel Code Blue Stain Reagent (Pierce,Rockford, IL, USA) overnight and scanned using Canoscan 300 Ex(Canon Solutions, Melville, NY, USA).

For the rCel7A variants from A. niger, wild-type, parent, and mu-tant strains were grown in the CM liquid cultures with maltose ascarbon source. The mycelia were separated from the one liter cul-ture medium by filtration through one layer of miracloth (Calbio-chem, San Diego, CA, USA) and culture filtrate was collectedseparately. The detailed procedures for rCel7A purification weredescribed by Adney et al. (2009). The actual protein concentrationwas quantified with BCA protein assay kit (Pierce, Rockford, IL,USA). Twenty micrograms of rCel7As and T. reesei Cel7A wereseparated in a 4–15% Criterion™ TGX stain-free (SDS–PAGE) pre-cast gel by electrophoresis at 200 V and room temperature andvisualized with Gel Doc™ EZ system (Bio-Rad, Hercules, CA, USA).

2.11. Circular dichroism (CD) measurement of Cel7A and rCel7A

CD measurements were carried out using a Jasco J-715 spectro-polarimeter (Jasco Incorporated, Easton, MD, USA) with a jacketedquartz cell with a 1.0 mm path length. The cell temperature wascontrolled to within ±0.1 "C by circulating 90% ethylene glycolusing a Neslab R-111m water bath (NESLAB Instruments, Ports-mouth, NH, U.S.A.) through the CD cell jacket. The results wereexpressed as mean residue ellipticity [è]mrw. The spectra obtainedwere averages of five scans. The spectra were smoothed using aninternal algorithm in the Jasco software package, J-715 forWindows. Protein samples were studied in 20 mM sodium acetatebuffer, pH 5.0 with 100 mM NaCl at a protein concentration of0.5 mg/mL for near and far-UV CD. Thermal denaturation of differ-ent constructs was monitored by CD in the near UV (190–260 nm)region. For the analysis of thermostability, the temperature wasincreased from 35 to 80 "C with a step size of 0.2 "C, and monitoredat a wavelength of 222 nm.

2.12. Hydrolysis of bleached kraft pulp and nanocrystalline cellulosewith T. reesei Cel7A and rCel7A

T. reesei Cel7A was purchased from Megazyme (Wicklow,Ireland). Novozyme 188 (b-glucosidase, BG) was obtained fromNovozymes North America Inc. (Franklinton, NC, USA). Prior tohydrolysis, Cel7A and BG were dialyzed against sodium acetate

(50 mM, pH 5.0) buffer by ultrafiltration in an Amicon stir cellusing 3 KDa Millipore membrane at 4 "C overnight. The rCel7Apreparation was described at previous section in detail.

Enzymatic hydrolysis experiments were performed in 2 mLEppendorf tubes at 50 "C for 48 h with 50 mM sodium acetate buf-fer (pH 5.0) at 1% (w/v) substrate consistency. Enzymes wereloaded at 4 mg protein/g substrate using either dialyzed Cel7A orrCel7A from 11414, 11414kusA, and alg3D strains with 12 mg/gb-glucosidase supplementation. Glucose released in the filtratesduring the hydrolysis was measured by glucose oxidase/peroxi-dase (GOPOD) assay kit from Megazyme (Wicklow, Ireland). Thehydrolysis was done in triplicates. Two pure cellulose substrateswere used, bleached kraft pulp (BKP) and nanocrystalline cellulose(NCC) from poplar (Ju et al., 2013). The NCC has an average dimen-sion of 20 ! 100 nm (width ! length) with a CrI of 0.87 from XRDanalysis (Fig. 11B). BKP is a pure cellulose substrate with a CrI of0.77 and average dimension of 22 ! 833 lm (width ! length).

3. Results

3.1. The alg3 gene isolation, deletion, and complementation

ALG3 is the first enzyme inside the lumen of endoplasmic retic-ulum for the early N-linked glycan synthesis (Fig. 1). A databasesearch based on the amino acid sequence of S. cerevisiae ALG3(access number YBL082C) resulted in the identification of the puta-tive a-1,3-mannosyltransferase gene (jgi|Aspni5|42720) in the U.S.Department of Energy (DOE) Joint Genome Institute (JGI) A. nigerstrain ATCC 1015 genome sequence database (Andersen et al.,2011). The A. niger alg3 gene contains two introns and its 1242 bpmature transcript encodes a protein consisting of 413 amino acids,containing one potential N-glycosylation site at Asn-374 that fol-lows the motif Asn-Xxx-Ser/Thr. The predicted A. niger ALG3 aminoacid sequence is 100% identical to the algC protein reported previ-ously in another A. niger (A888 derived from ATCC 9029/CBS120.49/NRRL 3/N400, Kainz et al., 2008) and 39% and 36% to the S.cerevisiae and Pichia stipitis ALG3 orthologues, respectively.

To determine ALG3 functions in A. niger, the alg3 gene deletion(alg3D) and its complementation (alg3D + alg3) strains were gener-ated and confirmed by PCR, Southern blot, and/or real-time PCRanalyses. Initially, the PCR confirmations were conducted (datanot shown). Fig. 2A and B shows the predicted restriction enzymedigestion patterns of genomic DNA of the parent and mutantstrains with BamHI and SacII, respectively and Fig. 2C shows theSouthern blot analysis of the digested genomic DNA of the parentand mutant strains with correctly corresponding restriction frag-ment length polymorphism pattern.

The real-time RT-PCR analysis of alg3 messenger ribonucleicacid (mRNA) from parental, alg3D and alg3D + alg3 strains grownon CM culture plates or in citric acid production (CAP) liquidcultures showed that the cycle threshold (Ct) value of the alg3 genein the alg3D strain (Ct: 28.9[CM]/30.8 [CAP]) is about 6–7 cyclesmore than that in parental strain (Ct: 22.9/23.8), while the alg3-D + alg3 strain (Ct: 22.6/23.5) had similar Ct values of the parentalstrain. In contrast, the Ct values of reference b-microtublin genewere similar in parental (Ct: 16.9/17.5), Dalg3 (Ct: 16.1/17.7),and alg3D + alg3 (Ct: 16.4/16.9) strains. These results confirmedthat the alg3 coding region in A. niger was replaced by the hphselection marker gene in the alg3D strain and its deletion couldbe complemented by alg3 gene integration.

3.2. Effects of alg3D on growth and sporulation

When parent, alg3D, and alg3D + alg3 strains were grown in CMliquid culture, their spore germinations were first detected after

124 Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132

4 h incubation, however, both alg3D and alg3D + alg3 strains hadmuch lower germination rate at a given time and needed addi-tional 1–2 h to achieve a similar level of parent strain (Fig. 3A).In potato dextrose (PD), the spore germinations of all three strainswere first observed about 1 h earlier than that in CM. Similarly, thegermination rates of spores from the alg3D and the complementa-tion strains were much lower than the parent strain (Fig. 3B). How-ever, the parent and alg3D + alg3 strains achieved 100% sporegermination at the same incubation duration, while alg3D strainspores also required additional 2 h (Fig. 3B). Also, the spore germi-nation of all three strains in MM was first observed after 3 h incu-bation (Fig. 3C). However, the overall effects on the sporegermination by alg3D were subtle. Contrastingly, the spore germi-nations of all three strains in CM + cAMP cultures were firstdetected after 7 h incubation, about 3 h longer than that in CM cul-ture (Fig. 3D). The difference of spore germination rates betweenparent and alg3D strains in CM + cAMP cultures was much smallerthan that in CM cultures, while no difference between parent andalg3D + alg3 strains was observed. The final percentage of sporegerminations was unaffected in all culture media. The resultsshowed that the alg3D caused a substantial delay of spore germi-nation in all media, which can be partially restored by its comple-mentation. Addition of cAMP into CM culture significantly delayed

spore germination of all three strains and reduced the alg3D effecton that, suggesting that the alg3D spore germination phenotype isinfluenced via cAMP signal pathway.

The alg3D effects on hyphal growth were examined by mea-surement of colony diameter. Levels of the alg3D effects on hyphalgrowth are expressed as the percentage of parent strain colonydiameter. Fig. 4 shows the colony diameter and its correspondingpercentage against parent strain during 35 h incubation. Therelative growth rate of alg3D strain drops to about 70% of parentstrain on CM or CM + cAMP between 15 and 25 h, while only about85% of that on MM (right panels of Fig. 4). With further growth onCM and MM, the relative growth rates of alg3D strains show some

Fig. 2. Confirmation of the alg3 deletion in alg3D strain by Southern blot analysis.(A). Restriction map of the 10.9 kb fragment containing the A. niger alg3 gene. (B)The hygromycin-selective marker (hph) gene was flanked by the upstream anddownstream genomic DNA sequences of alg3. Integration of the linear molecules byhomologous recombination replaces alg3 with hph in the chromosome. (C) Southernblot showing the genomic DNA hybridization of parent and alg3D strains. Oneparent and two selected alg3D strains were shown, which had the correct enzymerestriction pattern.

Fig. 3. The time course of spore germination of parent (11414kusA), alg3 deletion(alg3D) and alg3D complementation (alg3D + alg3) strains of A. niger grown inliquid culture of complete medium (CM), potato dextrose (PD), minimal medium(MM) and complete medium (CM) plus 10 mM cAMP at 30 "C. Five replicates wereprepared and total 1 ! 105 spores in 0.5 mL cultures were added into each well of a24-well sterile Schwarz sensoplate. About 100–150 spores at specific location wereselected to determine spore germination under the Olympus IX81 motorizedinverted microscope. Each data points are the average of five replicates withstandard error (mean ± SE, n = 5).

Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132 125

recoveries, especially of the complementation strain with lessgrowth reduction and earlier recovery than alg3D mutant. Theoverall suppression of hyphal growth by cAMP was also observedin all three strains grown on CM + cAMP, which had about 5–13%of further reduction as compared to that on CM only. In contrast,during the entire 35 h incubation the relative hyphal growth ofalg3D and alg3D + alg3 strains on PDA gradually dropped to71.8% and 82.1% of parent strain, respectively. The results furthersuggest that the alg3D may also affect hyphal growth throughcAMP signal pathway.

The sporulation phenotype of the alg3D strain was only ob-served on the CM plate, and was partially restored by complemen-tation (alg3D + alg3) (Fig. 5). Addition of cAMP to CM culture platesled to the loss of sporulation in all three strains (Fig. 5D). The alg3Dsporulation phenotype was further quantified by spore counts. Theaverage spore production of the alg3D strain on CM plates was2.6 ! 107 spores/cm2, which was about 40% of the parental strain(6.4 ! 107 spores/cm2) (Fig. 6A) and the difference could be visual-ized (Fig. 6B–E). In contrast, the average spore production on PDAplates was similar (i.e., 8.05 ! 107, 7.72 ! 107, and 7.5 ! 107

spores/cm2 for parent, the alg3D, and its complementation strain,respectively). When the alg3D strain was complemented with

alg3, the spore production on CM plate was recovered back to74.9% (4.8 ! 107 spores/cm2) of the parent strain, but was also sup-pressed by cAMP suggesting that the alg3D sporulation phenotypeon CM plates occurs through the cAMP signal pathway in A. niger.

3.3. Effects of alg3D on pigment production

Filamentous fungi are well known for their ability to produceand secrete different metabolites into their culture medium undercertain growth conditions. The alg3D in A. niger led to a significantaccumulation of red pigment on the CM plate (Fig. 7A). When theparent and alg3D strains were grown in CM liquid culture, the redpigment was only observed in the alg3D strain. The ultraviolet(UV)-visible absorption spectrum of culture filtrates exhibited fourvisible peaks at 240, 270, 300, and 480 nm (Fig. 7B). When thealg3D mutant was complemented with the alg3, no obvious redpigment was observed on CM culture plate (Fig. 7A).

3.4. Effects of alg3D on overall protein secretion

Because N-linked glycosylation plays a pivotal role in proteinsecretion, its perturbation by alg3D may influence the overall

Fig. 4. The time course of colony diameters and corresponding percentage of the parent strain of parent (11414kusA), alg3 deletion (alg3D) and alg3D complementation(alg3D + alg3) strains of A. niger grown on the agar plates of the complete medium (CM), potato dextrose (PDA), or minimal medium (MM) at 30 "C. The left panels are theaverage colony diameter of six replicates measured under stereo microscopy at different growth intervals (mean ± SE, n = 6). The right panels are the percentage of averagemutant colony diameter to the parent strain calculated by dividing the mutant colony diameter with the parental colony diameter and timing 100 at a given time point andculture condition.

126 Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132

protein secretion in A. niger. Secreted proteins from modified MM(Wang et al., 2012) liquid cultures of the parent and alg3D strainswere examined by SDS–PAGE- and LC–MS/MS-based proteomicanalyses. The stained SDS–PAGE gel in Fig. 8A shows that overallprotein secretion by alg3D mutants was higher than in parentstrains. More than 215 secreted proteins were identified fromeither the parent or mutant strains (Fig. 8B), of which 150 werecommon to both strains. The relative abundance of secreted pro-teins between the parent and alg3D strains was compared using to-tal spectral counts for a given protein as a semi-quantitativemeasure (Qian et al., 2005). Fig. 8C shows hierarchical clusteringof 54 proteins, which exhibited significant abundance differences(P < 0.05) between the two strains (Supplemental Table 1). Thirty-three secretory proteins were selected and classified into five groupslisted in Table 2. About 60.6% of them had a higher level of secretionin alg3D strain than the parental strain on the basis of average spec-tral counts. Eleven of them were identified in previous study (Tsanget al., 2009), nine of which have much higher secretion in alg3D mu-tant than parent strain. Those higher secretion proteins include sixglycosyl hydrolases (GH17, 18, 43, 47, 55 and 81), six putative pro-teases and related hydrolases, putative catalase, sulfhydryl oxidaseand putative amine oxidase. Our observations indicate that alg3Dmay increase overall protein secretion in A. niger.

3.5. Effects of alg3D on heterologous production and functions of T.reesei Cel7A (rCel7A)

Because the alg3D influences the overall abundance of secretedproteins, glycan structure, and possibly the occupancy of N-glyco-sylation sites within proteins, it is reasonable to postulate that itmay affect the physical and enzymatic properties of the aberrantlyglycosylated enzymes. We examined the consequence of alg3D onthe molecular weight of the rCel7A produced in A. niger. As shownin Fig. 9, the molecular weight of rCel7A from the wild type, parent,and alg3D strains was larger than T. reesei Cel7A, likely due toinsufficient deglycosylation in A. niger compared to the extracellu-lar glycan removal in T. reesei (Beckham et al., 2012; Stals et al.,2010). As expected, the molecular weight of rCel7A in the alg3Dwas lower than in the wild-type or parent strain, but still higher

than the Cel7A produced in T. reesei, possibly due to a decreasedextent of N-glycosylation in alg3D mutant.

The secondary structure of all glycosylation variants as deter-mined by far-UV-circular dichroism (CD) indicated that all rCel7Aproteins were structured, predominantly b-sheet folds suggestedby minima near 215 nm (Fig. 10B), which agrees well with the T.reesei Cel7A native crystal structure previously reported (Stahlberget al., 2001). All of the glycosylation variants appear to foldcorrectly. The CD-melt scans of the proteins indicate a meltingtemperature of approximately 62.5 "C. With the melt curve of thevariant 11414-rCel7A construct suggesting that it is slightly morethermostable than the T. reesei Cel7A and other rCel7A variantsby approximately 2 "C.

Hydrolysis of bleached kraft pulp (BKP) and nanocrystallinecellulose (NCC) by Cel7A and rCel7A variants was examined. Theconcentrations of glucose released after 48 h of hydrolysis isshown in Fig. 11A. There was little difference in the extent ofhydrolysis on BKP among different enzymes. The standard

Fig. 5. The colony photos of parent (11414kusA), alg3 deletion (alg3D) and alg3Dcomplementation (alg3D + alg3) strains of A. niger grown on agar plates of completemedium (CM), potato dextrose (PDA), minimal medium (MM), and completemedium (CM) plus 10 mM cAMP (CM + 10 mM cAMP), respectively after 50 hincubation at 30 "C.

Fig. 6. The sporulation of parent (11414kusA), alg3 deletion (alg3D) and Dalg3complementation (alg3D + alg3) strains of A. niger grown on agar plates of completemedium (CM) or potato dextrose (PDA) at 30 "C for 4 days. The panel (A) is theaverage spore production of parent (11414kusA), alg3 deletion (alg3D) and Dalg3complementation (alg3D + alg3) on CM and PD agar plates (mean ± SE, n = 12).Panel (B) is the camera photo of CM culture plates and panel (C), (D), and (E) arestereo microscopic images with 50 !magnification.

Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132 127

deviation is less than 0.25 g/L or 5% among all the data. A P value>0.15 was obtained after comparing the hydrolysis results betweenT. reesei Cel7A and each of the rCel7A using one-way analysis ofvariance (ANOVA). As shown previously (Ju et al., 2013), BKP is sus-ceptible to cellulose hydrolysis. Therefore, the difference in glycancontent may have little effect on easily hydrolysable cellulosicsubstrate.

When the digestibility of highly crystallized NCC is comparedbetween T. reesei Cel7A and different rCel7As, it is apparent thatall three rCel7A variants have improved activity on hydrolyzingthis recalcitrant cellulose. The rCel7A from 11414kusA has shownapproximately 40% increase in the conversion rate on NCC after48 h. It is noted that a high standard deviation up to 12% isobtained due the testing conditions used (small volume and lowsubstrate concentration). Based on one-way analysis of variance(ANOVA), a P value <0.01 was obtained by comparing the hydroly-sis performance between T. reesei Cel7A and rCel7A of either11414kusA or 11414, while a P value of 0.07 is obtained by compar-ing the hydrolysis performance between T. reesei Cel7A withrCel7A from alg3D strain. The ANOVA suggested that a notableimprovement of rCel7A activity from 11414 and 11414kusA onhydrolysis of NCC. However, the difference in hydrolysabilitybetween T. reesei Cel7A and rCel7A from alg3D mutant is insignif-icant. Although, rCel7A from alg3D strain is higher in activity thanthe native Cel7A, it is still less active than the other two rCel7Avariants from 11414 and 11414kusA, indicating that loss of ALG3function affected function of the recombinant protein to someextent, although not severely.

4. Discussion

N-linked glycosylation influences many of the functionalaspects including cellular localization, translocation, signaling,and protein quality control in different organisms (Apweileret al., 1999; Nothaft and Szymanski, 2010; Helenius and Aebi,2001; Molinari, 2007; Yang et al., 2009). Recently, it has been dem-onstrated that ALG3 is one of the key enzymes influencing globalN-linked glycosylation in A. niger (Kainz et al., 2008). In this study,we examined the alg3D effects on cellular growth and develop-ment, metabolism, overall protein secretion, and the expressionand functions of recombinant T. reesei Cel7A (rCel7A) in A. niger.

The delay in spore germination (Fig. 3) and reduction of hyphalgrowth (Fig. 4) as a result of alg3D are similar to that observed in A.nidulans and A. niger mutants with defects in their signal-transduc-tion pathways (Fillinger et al., 2002; Saudohar et al., 2002; Xueet al., 2004), and suggest that alg3D in A. niger could alter theN-linked glycosylation and functions of those proteins involvedin signal-transduction pathways. As compared to the CM culture,the effects with an addition of cAMP to CM liquid culture on sporegermination of parent and alg3D + alg3 (complementation) strainswere much more profound than that of alg3D strains (Fig. 3). Thereduction of hyphal growth was also observed on the CM + cAMPmedium plates in parent, alg3D, and alg3D + alg3 strains (Fig. 4).Similarly, the cAMP dramatically reduced the spore production inparent and alg3D + alg3 strains (Fig. 5D), which was similar tothe alg3D mutant grown on CM plate with substantial reductionof sporulation (Figs. 5A and 6). These phenotypes were observedpreviously, where cAMP was added into the glucose containing-medium, or the pkaR was deleted or pkaC over-expressed (Bencinaet al., 1997; Oliver et al., 2002; Staudohar et al., 2002). Further-more, we examined the N-glycosites of selected proteins relatedto the signal-transduction pathways in A. niger with the N-Glyco-site searching tool (Zhang et al., 2004) and found that most of thoseselected proteins contain 1–6 N-glycosites, e.g. 6 in ste11/steC (mapkinase kinase kinase), 3 in pkaC, 2 in pkaC2, 1 in pkaR, 4 in flbA, and3 in Gb. Comparison of our results with previous studies suggests

Fig. 7. Effect of alg3 deletion (alg3D) on pigment production in A. niger. Upperpanels (A) shows a camera photo exhibiting the red pigment accumulation on thecomplete medium (CM) agar plate by alg3 deletion (alg3D) strain of A. niger withparental (11414kusA) and its complementation (alg3D + alg3) strains as references.The lower panel (B) shows the average of UV–Visible absorbance of culture filtratefrom alg3 deletion (alg3D) mutant strain grown in the liquid culture of completemedium (CM) by subtraction of absorbance background of parent (11414kusA) atthe corresponding UV–Visible wavelength. The data was averaged from threereplicates and standard error (mean ± SE, n = 3).

Fig. 8. A comparison of secretome between parent (11414kusA) and alg3 deletion(alg3D) strains of A. niger grown in liquid culture of modified MM with the 0.05 Mglucose replaced by 0.1 M sorbitol and supplement of 0.25% yeast extract for 17 h at30 "C and 200 rpm. Panel (A) is the total secretome separated by SDS–PAGE, wherethe 1 and 2 are two biological replicates. Venn diagram at panel (B) shows theoverlap of secreted proteins detected by LC–MS-based proteomic analysis betweenparental 11414kusA (kusA) and alg3D strains. Heatmap at Panel (C) depicts 54secreted proteins quantified by normalized spectral counts (P < 0.05, Student’st-test), where 1-1 and 1-2, or 2-1 and 2-2 are two technical replicates for eachbiological sample.

128 Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132

that the alg3D spore germination, hyphal growth, and sporulationphenotypes may be due to altered N-linked glycosylation ofproteins involved in signal-transduction pathways and cellularmetabolisms in A. niger.

Red pigment accumulation on CM plate and liquid culture is anadditional phenotype of alg3D (Fig. 7). Certain secondary metabolitesare produced at specific stages of cellular development in filamentousfungi, and are influenced by biotic and abiotic factors (Shwab andKeller, 2008). The effects of those abiotic factors are transducedthrough different regulatory pathways (e.g., the cAMP signaling path-ways). Moreover, experimental evidence indicates that the cAMP sig-naling pathways regulate not only the pathways involved in growthand development of filamentous fungi, but also the gene expressionof secondary metabolites (Fox and Howlett, 2008; Saudohar et al.,2002; Yin and Keller, 2011; Yu and Keller, 2005). Thus, increasedaccumulation of red pigments in the alg3D strain on CM plate(Fig. 7) may be due to the combined effects of alg3Don both metabolicand signal transduction pathways in A. niger.

A. niger has been extensively studied as a protein productionhost, and N-glycosylation has important roles in protein function,production, and secretion. The majority of secretory proteins infilamentous fungi are glycosylated (Peberdy, 1994). In this study,

we demonstrated the role of the alg3 gene in protein secretion inA. niger (Fig. 8). Our results show an increase in protein secretionin alg3D mutant strain when grown in modified MM (Wanget al., 2012) liquid cultures. By the spectral count analysis, 60.6%of those proteins listed in Table 2 have increased levels of secretionin alg3D strain than the parent. The cellular mechanism of highersecretion in alg3D mutant is not known. One possible reason is thatthe reduction of overall N-glycosylation complex by alg3D may af-fect the N-glycosite occupancy, the overall secretory pathway, andcell wall structure, a barrier for protein secretion. To our knowl-edge, this is the first experimental evidence that links aberrantN-glycosylation with the level of protein secretion in A. niger. Thisinteresting finding could be explored further for strain improve-ment programs in industrial enzyme production.

Recently, several studies indicate that the N-linked glycans areessential for both thermodynamic and kinetic stabilities and solu-bility of glycoproteins (Hanson et al., 2009; Shental-Bechor andLevy, 2008; Culyba et al., 2011). Indeed, heterologous expressionof T. reesei Cel7A in A. niger var. awamori resulted in an increasedlevel of N-glycosylation complexity, its activity reduction, and highnon-productive binding on bacterial cellulose and phosphoricswollen cellulose as substrates (Jeoh et al., 2008). In contrast, the

Table 2List of A. niger secretory proteins whose abundances were significantly different (P < 0.05) between the parent (11414KusA) and the mutant (Alg3D). The kusA_01 and kusA_02 aretwo biological samples for parent strain, while alg3_01 and alg3_02 are two biological replica of mutant strain. The relative protein abundances are represented by spectral count,the number of observations by MS for a given protein.

Protein ID Protein description Spectral counta

kusA_01 kusA_02 alg3_01 alg3_02

Glycoside hydrolases41807 Putative a-1,2-mannosidase, GH92 43 112 2 155270 Glucan 1,3-beta-glucosidase, GH55 123 66 145 147170223 Putative endo-1,3(4)-beta-glucanase 2, GH81 73 22 143 108182100 Putative xylosidase, GH43 27 15 43 28196122 Probable glycosidase crf1, GH16 36 21 47 59197446 Probable chitinase, GH18 89 125 147 164198063 Beta-fructofuranosidase, GH32 24 46 43 44202490 Glucan 1,3-beta-glucosidase, GH5 140 160 81 61205517 Putative mannosyl-oligosaccharide a-1,2-mannosidase, GH47 99 45 131 108208214 Beta-1,3-glucanosyltransferase, GH17 124 120 196 142212716 Putative beta-1,3-glucanosyltransferase, GH72-CBM43 36 92 10 4

Proteases and related hydrolases41638 Putative carboxypeptidase cpdS 28 33 3 352421 Putative peptidase M18, aminopeptidase 73 78 5 254734 Putative serine carboxypeptidase 57 47 70 8655665 Putative tripeptidyl-peptidase 1 53 72 40 43201655 Aspergillopepsin pepA 127 75 196 153206384 Putative aspergillopepsin A 3 2 9 5206384b Putative aspergillopepsin A 3 3 9 6210306 Putative aspergillopepsin A 1 1 4 6211032 Hypothetical tripeptidyl-peptidase 179 147 392 354

Oxidases and reductases55494 Putative catalase 40 32 135 125189206 Sulphydryl oxidase 39 19 63 53192222 Putative amine oxidase 8 6 11 12

Phospholipases35378 Putative phosphoesterase 21 43 15 1457215 Putative acid phosphatase 6 3 8 7

Miscellaneous proteins41522 Hypothetical protein 31 29 8 845683 Putative fungal hydrophobin dewA 27 46 6 250599 Unknown protein 41 84 28 3351794 Putative ribonuclease 34 93 6 352126 Putative allergen Asp f 154 135 38 3256792 Unknown protein 12 12 26 28128537 Putative allergen Asp f 7 7 9 15 16210988 Putative cell wall protein PhiA 10 4 16 22

a The average of two technical replicates.b Different isozyme of Aspergillopepsin A.

Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132 129

activity of rCel7A from A. niger was significantly improved byremoval of the N-384 glycosite of Cel7A from T. reesei as comparedwith the T. reesei Cel7A with the bacterial cellulose as substrate(Adney et al., 2009).

In this study, we further examined the effects of alg3D on T.reesei rCel7A expressed in wild-type, parent, and alg3D strains of

A. niger. On the basis of SDS–PAGE, the molecular weight of rCel7A,expressed in alg3D strain, was much smaller than that in bothwild-type and parental strains, but still was slightly larger thanthat of T. reesei Cel7A. The secondary structure of rCel7A from allstrains was determined by far-UV-CD and confirmed that thechanges in N-linked glycosylation do not appear to impact thesecondary structure or folding of the protein to any appreciabledegree. The extent of hydrolysis of BKP and NCC by T. reesei Cel7Aand rCel7A was evaluated as well. BKP digestibility was similarbetween T. reesei Cel7A and rCel7As. In contrast, rCel7A variantsfrom all three strains exhibited relatively higher NCC activity overT. reesei Cel7A. The improvement of rCel7A on highly crystallizedNCC hydrolysis will be the subject of further studies.

In summary, the alg3 protein product influences spore germina-tion, hyphal growth, sporulation, and pigment and protein produc-tions in A. niger. Its effects may be exerted by alternation of overallN-linked glycosylation of those glycoproteins that are importantfor cell wall formation, signal transduction, and different metabolicpathways. In addition, effects on overall protein secretion and thefunctions in cellulose hydrosability of rCel7A proteins are likelydue to alternation of N-linked glycosylation. Therefore, the mutantstrains with targeted alteration of N-linked glycosylation can serveas alternative systems to dissect the roles of the complex glycosyl-ation in improvement of targeted chemical productions, overallprotein secretion, and functional characteristics of endogenousand exogenous proteins in industrial filamentous fungi.

Acknowledgments

The authors thank Drs. Kenneth S. Bruno and Sue A. Karagiosisfor their excellent technical assistance in microscopy observation.

Fig. 9. The sodium docecyl polyacrymide gel electrophoresis (SDS–PAGE) ofTrichoderma reesei Cel7A and recombinant Cel7A (rCel7A) expressed in wild-type(11414-rCel7A), parent (11414kusA-rCel7A) and alg3 deletion (alg3D-rCel7A) strainof A. niger grown in the CM liquid cultures with maltose as carbon source. Twentymicrograms of T. reesei Cel7A and recombinant Cel7A (rCel7A) isolated from wild-type (11414-rCel7A) and 11414kusA (11414kusA-rCel7A) and alg3D (alg3D-rCel7A)strains were used.

Fig. 10. Circular dichroism (CD) measurement for the secondary structures of T.reesei Cel7A and recombinant Cel7A (rCel7A) isolated from wild-type (11414-rCel7A), parent (11414kusA-rCel7A), and alg3D (alg3D-rCel7A) strains of A. niger.The protein concentration for CD measurement was 0.5 mg/mL protein sample in20 mM sodium acetate buffer, pH5.0 and 100 mM sodium chloride. Panel (A) is theaverage of protein CD spectra at different temperatures ("C) and panel (B) is thereconstruction of protein CD spectra. The spectra obtained were averages of fivescans.

Fig. 11. Extent of hydrolysis on bleached kraft pulp (BKP) and nanocrystallinecellulose (NCC) by T. reesei Cel7A and recombinant Cel7A (rCel7A) isolated fromwild-type (11414-rCel7A), parent (11414kusA-rCel7A), and alg3D (alg3D-rCel7A)strains of A. niger. Panel (A) is the average glucose (g/L) released from BKP or NCC.BG is Novozyme 188 (b-glucosidase). The hydrolysis was done in triplicates. Panel(B) is the cellulose crystalline structure analyzed by X-ray diffraction.

130 Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132

ZD, JKM, WSA, GTB, MEH, SRD, and SEB thank the funding from theBioEnergy Technologies Office, U.S. Department of Energy. WJQthanks the funding from the Early Career Research Award fromthe Office of Science, U.S. Department of Energy. XZ acknowledgesthe funding by National Science Foundation (Award Number1067012). Proteomics experiments and the X-ray diffractionmeasurement were performed in the Environmental MolecularSciences Laboratory, a U.S. Department of Energy (DOE) Office ofBiological and Environmental Research national scientific userfacility on the Pacific Northwest National Laboratory (PNNL)campus. PNNL is multi-program national laboratory operated byBattelle for the DOE under Contract No. DE-AC05-76RLO1830.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.fgb.2013.09.004.

References

Adney, W.S. et al., 2009. Probing the role of N-linked glycans in the stability andactivity of fungal cellobiohydrolases by mutational analysis. Cellulose 16, 699–709.

Aebi, M. et al., 1996. Cloning and characterization of the ALG3 gene ofSaccharomyces cerevisiae. Glycobiology 6, 439–444.

Andersen, M.R. et al., 2011. Comparative genomics of citric-acid-producingAspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. GenomeRes. 21, 885–897.

Apweiler, R. et al., 1999. On the frequency of protein glycosylation, as deduced fromanalysis of the SWISS-PROT database. Biochim. Biophys. Acta 1473, 4–8.

Bencina, M. et al., 1997. Characterization and overexpression of the Aspergillus nigergene encoding the cAMP-dependent protein kinase catalytic subunit.Microbiology 143, 1211–1220.

Beckham, G.T. et al., 2012. Harnessing glycosylation to improve cellulase activity.Curr. Opin. Biotechnol. 23, 338–345.

Bennett, J.W., Lasure, L.L., 1991. Growth media. In: Bennett, J.W., Lasure, L.L. (Eds.),More Gene Manipulations in Fungi. Academic press, San Diego, pp. 441–458.

Braaksma, M., Punt, P.J., 2008. Aspergillus as a cell factory for protein production:controlling protease activity in fungal production. In: Goldman, G.H., Osmani,S.A. (Eds.), The Aspergilli: Genomics, Medical Aspects, Biotechnology, andResearch Methods. CRC Press, Boca Raton, FL, pp. 441–455.

Chiang, Y.-M. et al., 2011. Characterization of a polyketide synthase in Aspergillusniger whose product is a precursor for both dihydroxynaphthalene (DHN)melanin and naphtho-c-pyrone. Fungal Genet. Biol. 48, 430–437.

Colot, H.V. et al., 2006. A high-throughput gene knockout procedure for Neurosporareveals functions for multiple transcription factors. Proc. Natl. Acad. Sci. USA103, 10352–10357.

Culyba, E.K. et al., 2011. Protein native-state stabilization by placing aromatic sidechains in N-glycosylated reverse turns. Science 331, 571–575.

Dai, Z. et al., 2004. Identification of genes associated with morphology in Aspergillusniger by using suppression subtractive hybridization. Appl. Environ. Microbiol.70, 2474–2485.

Davidson, R.C. et al., 2004. Functional analysis of the ALG3 gene encoding the Dol-P-Man: Man5GlcNAc2-PP-Dol mannosyltransferase enzyme of P. pastoris.Glycobiology 14, 399–407.

de Oliveira, J.M.P.F. et al., 2011. Proteomic analysis of the secretory response ofAspergillus niger to D-maltose and D-xylose. PLoS ONE 6, e20865.

De Pourcq, K. et al., 2012. Engineering the yeast Yarrowia lipolytica for theproduction of therapeutic proteins homogeneously glycosylated withMan8GlcNAc2 and Man5GlcNAc2. Microb. Cell Fact. 11, 53.

Dellaporta, S. et al., 1983. A plant DNA minipreparation: Version II. Plant Mol. Biol.Rep. 1, 19–21.

Denecke, J. et al., 2005. Congenital disorder of glycosylation type Id: clinicalphenotype, molecular analysis, prenatal diagnosis, and glycosylation of fetalproteins. Pediatr. Res. 58, 248–253.

Deshpande, N. et al., 2008. Protein glycosylation pathways in filamentous fungi.Glycobiology 18, 626–637.

Deutschbauer, A.M. et al., 2002. Parallel phenotypic analysis of sporulation andpostgermination growth in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA99, 15530–15535.

Driouch, H. et al., 2012. Improved enzyme production by bio-pellets of Aspergillusniger: targeted morphology engineering using titanate microparticles.Biotechnol. Bioeng. 109, 462–471.

Elias, J.E., Gygi, S.P., 2007. Target-decoy search strategy for increased confidence inlarge-scale protein identifications by mass spectrometry. Nat. Methods 4, 207–214.

Fillinger, S. et al., 2002. CAMP and ras signalling independently control sporegermination in the filamentous fungus Aspergillus nidulans. Mol. Microbiol. 44,1001–1016.

Fox, E.M., Howlett, B.J., 2008. Secondary metabolism: regulation and role in fungalbiology. Curr. Opin. Microbiol. 11, 481–487.

Frisvad, J.C. et al., 2011. Fumonisin and ochratoxin production in industrialAspergillus niger strains. PLoS ONE 6, e23496.

Gerngross, T.U., 2004. Advances in the production of human therapeutic proteins inyeasts and filamentous fungi. Nat. Biotechnol. 22, 1409–1414.

Geysens, S. et al., 2009. Genomics of protein folding in the endoplasmic reticulum,secretion stress and glycosylation in the aspergilli. Fungal Genet. Biol. 46, S121–S140.

Hanson, S.R. et al., 2009. The core trisaccharide of an N-linked glycoproteinintrinsically accelerates folding and enhances stability. Proc. Natl. Acad. Sci. USA106, 3131–3136.

Helenius, A., Aebi, M., 2001. Intracellular functions of N-linked glycans. Science 291,2364–2369.

Jacobs, D.I. et al., 2009. Effective lead selection for improved protein production inAspergillus niger based on integrated genomics. Fungal Genet. Biol. 46, S141–S152.

Jeoh, T. et al., 2008. Implications of cellobiohydrolase glycosylation for use inbiomass conversion. Biotechnol. Biofuels 1, 10.

Ju, X. et al., 2013. An advanced understanding of the specific effects of xylan andsurface lignin contents on enzymatic hydrolysis of lignocellulosic biomass.Bioresour. Technol. 132, 137–145.

Kainz, E. et al., 2008. N-glycan modification in Aspergillus species. Appl. Environ.Microbiol. 74, 1076–1086.

Kajiura, H. et al., 2010. Arabidopsis thaliana ALG3 mutant synthesizes immatureoligosaccharides in the ER and accumulates unique N-glycans. Glycobiology 20,736–751.

Kim, S. et al., 2008. Spectral probabilities and generating functions of tandem massspectra: a strike against decoy databases. J. Proteome Res. 7, 3354–3363.

Korner, C. et al., 1999. Carbohydrate deficient glycoprotein syndrome type IV:deficiency of dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichylmannosyltransferase. EMBO J. 18, 6816–6822.

Kornfeld, R., Kornfeld, S., 1985. Assembly of asparagine-linked oligosaccharides.Annu. Rev. Biochem. 54, 631–664.

Kotz, A. et al., 2010. Approaching the secrets of N-glycosylation in Aspergillusfumigatus: characterization of the AfOch1 protein. PLoS ONE 5, e15729.

Kukuruzinska, M. et al., 1987. Protein glycosylation in yeast. Annu. Rev. Biochem.56, 915–944.

Maddi, A., Free, S.J., 2010. Alpha-1,6-mannosylation of N-linked oligosaccharidepresent on cell wall proteins is required for their incorporation into the cellwall in the filamentous fungus Neurospora crassa. Eukaryot. Cell 9, 1766–1775.

Magnuson, J.K., Lasure, L.L., 2004. Organic acid production by filamentous fungi. In:Lange, J., Lange, L. (Eds.), Advances in Fungal Biotechnology for Industry,Agriculture, and Medicine. Kluwer Academic/Plenum Publishers, New York, pp.307–340.

Manthri, S. et al., 2008. Deletion of the TbALG3 gene demonstrates site-specific N-glycosylation and N-glycan processing in Trypanosoma brucei. Glycobiology 18,367–383.

Molinari, M., 2007. N-glycan structure dictates extension of protein folding or onsetof disposal. Nat. Chem. Biol. 3, 313–320.

Motteram, J. et al., 2011. Aberrant protein N-glycpsylation impacts upon infection-related growth transitions of the haploid plant-pathogenic fungusMycosphaerella graminicola. Mol. Microbiol. 81, 415–433.

Nam, J.H. et al., 2008. The effects of culture conditions on the glycosylation ofsecreted human placental alkaline phosphatase produced in Chinese hamsterovary cells. Biotechnol. Bioeng. 100, 1178–1192.

Nevalainen, K.M. et al., 2005. Heterologous protein expression in filamentous fungi.Trends Biotechnol. 23, 468–474.

Nielsen, K.F. et al., 2009. Review of secondary metabolites and mycotoxins from theAspergillus niger group. Anal. Bioanal. Chem. 395, 1225–1242.

Nothaft, H., Szymanski, C.M., 2010. Protein glycosylation in bacteria: sweeter thanever. Nat. Rev. Microbiol. 8, 765–778.

Oliver, B.G. et al., 2002. CAMP alteration of growth rate of Aspergillus fumigatus andAspergillus niger is carbon-source dependent. Microbiology 148, 2627–2633.

Peberdy, J.F., 1994. Protein secretion in filamentous fungi-trying to understand ahighly productive black box. Trends Biotechnol. 12, 50–57.

Polpitiya, A.D. et al., 2008. DAnTE: a statistical tool for quantitative analysis of -omics data. Bioinformatics 24, 1556–1558.

Punt, P.J. et al., 1988. A vector for Aspergillus transformation conferring phleomycinresistance. Fungal Genet. Newsl. 35, 25–30.

Punt, P.J. et al., 2002. Filamentous fungi as cell factories for heterologous proteinproduction. Trends Biotechnol. 20, 200–206.

Qian, W.J. et al., 2005. Comparative proteome analyses of human plasma followingin vivo lipopolysaccharide administration using multidimensional separationscoupled with tandem mass spectrometry. Proteomics 5, 572–584.

Saudohar, M. et al., 2002. Cyclic AMP-dependent protein kinase is involved inmorphogenesis of Aspergillus niger. Microbiology 148, 2635–2645.

Schollen, E. et al., 2005. CDG-Id caused by homozygosity for an ALG3 mutation dueto segmental maternal isodisomy UPD3(q21.3-qter). Eur. J. Med. Genet. 48,153–158.

Shental-Bechor, D., Levy, Y., 2008. Effect of glycosylation on protein folding: a closelook at thermodynamic stabilization. Proc. Natl. Acad. Sci. USA 105, 8256–8261.

Shwab, E.K., Keller, N.P., 2008. Regulation of secondary metabolite production infilamentous ascomycetes. Mycol. Res. 112, 225–230.

Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132 131

Staben, C. et al., 1989. Use of a bacterial hygromycin B resistance gene as adominant selectable marker in Neurospora crassa transformation. Fungal Genet.Newsl. 36, 78–81.

Stals, I. et al., 2010. Identification of a gene coding for a deglycosylating enzyme inHypocrea jecorina. FEMS Microbiol. Lett. 303, 9–17.

Stahlberg, J. et al., 2001. Structural basis for enantiomer binding and separation of acommon b-blocker: crystal structure of cellobiohydrolase Cel7A with bound (s)-propranolol at 1.9 Å resolution. J. Mol. Biol. 305, 79–93.

Staudohar, M. et al., 2002. Cyclic AMP-dependent protein kinase is involved inmorphogenesis of Aspergillus niger. Microbiology 148, 2635–2645.

Stibler, H. et al., 1995. Carbohydrate-deficient glycoprotein syndrome – a fourthsubtype. Neuropediatrics 26, 235–237.

Trombetta, E.S., Parodi, A.J., 2003. Quality control and protein folding in thesecretory pathway. Annu. Rev. Cell Dev. Biol. 19, 649–676.

Tsang, A. et al., 2009. Analytical and computational approaches to define theAspergillus niger secretome. Fungal Genet. Biol. 46, S153–S160.

van den Hombergh, J.P.T.W. et al., 1997. Aspergillus as a host for heterologousprotein production: the problem of proteases. Trends Biotechnol. 15, 256–263.

Wang, L. et al., 2005. Bioprocessing strategies to improve heterologous proteinproduction in filamentous fungal fermentations. Biotechnol. Adv. 23, 115–129.

Wang, L. et al., 2012. Mapping N-linked glycosylation sites in the secretome andwhole cells of Aspergillus niger using hydrazide chemistry and massspectrometry. J. Proteome Res. 11, 143–156.

Wildt, S., Gerngross, T.U., 2005. The humanization of N-glycosylation pathways inyeast. Nat. Rev. Microbiol. 3, 119–128.

Xue, T. et al., 2004. A mitogen-activated protein kinase that senses nitrogenregulates conidial germination and growth in Aspergillus fumigatus. Eukaryot.Cell 3, 557–560.

Yan, A., Lennarz, W.J., 2005. Unraveling the mechanism of protein N-glycosylation. J.Biol. Chem. 280, 3121–3124.

Yang, H.-Y. et al., 2009. Glycosylation defects activate filamentous growth Kss1MAPK and inhibit osmoregulatory Hog1 MAPK. EMBO J. 28, 1380–1391.

Yin, W., Keller, N.P., 2011. Transcriptional regulatory elements in fungal secondarymetabolism. J. Microbiol. 49, 329–339.

Yoshikawa, K. et al., 2011. Comprehensive phenotypic analysis of single-genedeletion and overexpression strains of Saccharomyces cerevisiae. Yeast 28, 349–361.

Yu, J.H., Keller, N., 2005. Regulation of secondary metabolism in filamentous fungi.Annu. Rev. Phytopathol. 43, 437–458.

Zhang, M. et al., 2004. Tracking global patterns of N-linked glycosylation sitevariation in highly variable viral glycoproteins: HIV, SIV, and HCV envelopesand influenza hemagglutinin. Glycobiology 14, 1229–1246.

132 Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132