www.elsevier.com/locate/yexpr

Experimental Parasitology 108 (2004) 81–88

Identification and characterization of an interspersed repetitiveDNA fragment in Plasmodium vivax with potential use

for specific parasite detection

Silvana Carnevalea,*, Jorge N. Velasquezb, Hernando del Portilloc,Jorge H. Labbea, Marta G. Cabreraa, Marcela Ferellad,

Bjorn Anderssond, Eduardo A. Guarneraa, Sergio O. Angela,e

a Departamento de Parasitologıa, Instituto Nacional de Enfermedades Infecciosas, ANLIS ‘‘Dr. Carlos G. Malbran,’’

Ciudad de Buenos Aires, Argentinab Hospital Municipal de Infecciosas ‘‘Dr. Francisco Javier Muniz,’’ Ciudad de Buenos Aires, Argentina

c Instituto de Ciencias Biomedicas II, Universidad de Sao Paulo, Sao Paulo, Brazild Center for Genomics and Bioinformatics, Karolinska Institute, Stockholm, Sweden

e Laboratorio de Parasitologıa Molecular, UB2, IIB-INTECH, Chascomus, Prov. de Buenos Aires, Argentina

Received 18 August 2003; received in revised form 26 July 2004; accepted 26 July 2004

Available online 2 September 2004

Abstract

We cloned and characterized a Plasmodium vivax repeat element of 7872 bp named PvRE7.8. Several internal tandem repeats

were found along the sequence. The repetitive nature of the PvRE7.8 element was confirmed by hybridization of a P. vivax

YAC library. Based on the data bank analysis and the presence of two contiguous putative genes that may encode proteins related

to DNA metabolism, PvRE7.8 could be considered an inactivated transposon-LINE element. By using Pv79 as probe or primers

derived from Pv79-flanking sequences, P. vivax DNA Could be detected from whole blood and mosquito samples. We consider that

the repeat element described here has potential for P. vivax malaria diagnosis and for epidemiological analysis of P. vivax transmis-

sion areas.

� 2004 Elsevier Inc. All rights reserved.

Index Descriptors and Abbreviations: DNA, deoxyribonucleic acid; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; bp, base pairs;

dNTP, deoxynucleotide triphosphate; ORF, open reading frame; LINE, long interspersed nuclear element; SINE, small interspersed nuclear element

Keywords: Plasmodium vivax; Polymerase chain reaction; Repetitive element; LINE

1. Introduction

The malarial parasite Plasmodium vivax causes dis-ease in humans, including chronic infections and recur-

rent relapses, but the course of the infection is rarely

fatal (Garcia and Bruckner, 1993), unlike that caused

by Plasmodium falciparum. Whereas P. vivax is present

0014-4894/$ - see front matter � 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.exppara.2004.07.012

* Corresponding author. Fax: +54 11 4301 7437.

E-mail address: parasitologia@anlis.gov.ar (S. Carnevale).

in tropical and temperate areas, P. falciparum is only re-

stricted to tropical areas (Garcia and Bruckner, 1993).

In Argentina, malaria is actually associated with P. vi-

vax (Ministerio de Salud, 2002), but patients with P. fal-

ciparum infection are also detected as the result of

travel-related malaria.

In Argentina, endemic P. vivax malaria corresponds

to the northwestern area and it is transmitted by Anoph-

eles pseudopunctipennis. There is also an epidemic area,

in the northeast, related to the vector Anopheles darlingi

82 S. Carnevale et al. / Experimental Parasitology 108 (2004) 81–88

(Rey, 1991; Ministerio de Salud, 2002). Argentina

bounds in the north with Bolivia and Brazil, in which

P. vivax and P. falciparum parasites are established.

Thus, malaria in Argentina is a complex problem related

to poverty in areas with limited access and fluid migra-

tory movements at the bound areas (WHO, 2000;OPS, 2001). In spite of these important problems, up

to now, there were no adequate tools for epidemiologi-

cal studies and control activities.

The detection of malaria classically relies on the dem-

onstration of the pathogen in blood samples, being easy

to differentiate P. vivax from P. falciparum (WHO,

1991). However, this technique is not adequate if large

samples must be analyzed either for screening or epide-miological studies. For this reason, several molecular

analysis were developed, mainly to detect P. falciparum

(Tirasophon et al., 1991; Wataya et al., 1993).

Repetitive DNA elements have shown to be very use-

ful in the development of diagnostic molecular tools. This

repetitive feature allows the improvement of sensitivity

and, in general, these elements are very specific markers.

In nature, repetitive DNA elements have also been takenas important elements to generate variations in genome

structure and expression associated to species evolution

(Kidwell and Lisch, 1997). In this sense, the Plasmodium

spp. genomes showed to have tandem repeat DNA ele-

ments mainly related to subtelomeric regions which were

suggested to promote chromosome pairing, facilitating

meiotic recombination and gene conversion between telo-

mere and proximal genes (DeBruin et al., 1994).We cloned and characterized a P. vivax repeat DNA

element. The DNA fragment was sequenced and its

genomic organization was analyzed through genomic

programs. A highly specific P. vivax region was detected

along the DNA fragment, which was used as source of

DNA probes or PCR-target. Finally, its possible useful-

ness to detect parasite in human blood or mosquito sam-

ples was determined.

2. Materials and methods

2.1. Blood samples

Twenty blood samples from patients with P. vivax

infection and three from patients with P. falciparum

infection were obtained from a ‘‘Blood Bank,’’ orga-

nized by the laboratory of Malaria Diagnosis (Departa-

mento de Parasitologıa, ANLIS ‘‘Dr. Carlos G.

Malbran’’). Additionally, 60 blood samples from a

non-endemic/epidemic area were used as negative con-

trols. Malaria infection was determined by thin and

thick smears. The clinic history and Plasmodium spp./

ll counting were obtained for all positive blood samples.Blood samples were stored at 4 �C and processed in the

next 5 days after their collection.

2.2. Mosquito samples

Homogenates of 18 P. vivax- and six P. falciparum-

experimentally infected mosquitoes were kindly pro-

vided from Dr. J.B. Pereira Lima (Instituto Militar,

Rio de Janeiro, Brazil). These samples had been pre-pared by lysis in 0.01 PBS, pH 7.2, with addition of

3% non-fat milk and 0.5% Nonidet P-40. Sixteen Culex

spp. and eight Aedes spp. mosquitoes were used as neg-

ative controls.

2.3. Purification of parasites

Five milliliters of fresh blood samples infected with P.

vivax (n = 8) or with P. falciparum (n = 2) was centri-

fuged at 800g during 10 min. The pellet was resuspended

in 5 ml of 0.01 M PBS (pH 7.2), and filtered through Bio-

fil R filters (Biofil, Italy). The collected sample was centri-

fuged, the pellet resuspended in PBS and the infected

erythrocytes were separated by centrifugation of the sam-

ple in Nicodenz (57% v/v in PBS) gradient. Erythrocytes

were washed in PBS, resuspended in 0.1% saponin-PBSduring 5 min at room temperature, centrifuged at

10,000g at 4 �C, and washed. Thin smears of 1 ll sample

were dyed with Giemsa and parasites were counted.

2.4. Preparation of DNA samples

DNA from blood and parasites samples were ex-

tracted by Proteinase K/phenol–chloroform protocolas described (Angel et al., 1997). Before extraction,

blood samples were aliquoted in 300 ll. Finally, the

DNA was resuspended in 300 ll (for dot blot) or 10 ll(for PCR) of TE (10 mM Tris–HCl, pH 7.4, and

1 mM EDTA, pH 8.0).

The DNA from vectors was extracted as described

previously (Coulson et al., 1990). After extraction,

DNA was precipitated in absolute ethanol, centrifuged,washed with ethanol at 70 �C, and resuspended in 12 llTE. Homogenates of positive controls were treated by

the same procedure without rehydration steps.

2.5. Screening and obtaining of P. vivax probes

Purified P. vivax DNA was labeled by nick transla-

tion (Nick translation DNA Labeling Kit, Life Technol-ogies) with [32P]dCTP and used for screening a genomic

P.vivax gtWES library by colony hybridization (Mania-

tis et al., 1982). Hybridization was performed in 2· SSC

plus 0.25% non-fat dried milk at 65 �C, and washing at

high stringency in 0.1· SSC, 0.1% SDS at 68 �C. Positiveclones were re-screened for homogeneity.

To obtain Pv79 probe, clone Pv10 was digested with

several endonucleases and analyzed by agarose gel elec-trophoresis stained with ethidium bromide. Since diges-

tion with HaeIII produced smallest DNA fragments,

S. Carnevale et al. / Experimental Parasitology 108 (2004) 81–88 83

500 ng of Pv10 DNA was digested with HaeIII and

cloned into the SmaI site of pUC18 plasmid, and used

to transform DH5a strain of Escherichia coli. Pv10-

HaeIII mini-library was screened with [32P]dCTP radio-

labeled genomic P. vivax and P. falciparum.

To obtain PvE/C probe, clone Pv10 was digested withEcoRI and ClaI and cloned into EcoRI and ClaI sites of

pBluescript KS+ plasmid.

2.6. Sequence analysis

DNA sequencing was performed using a Perkin–El-

mer ABI 377 MegaBACE 1000 machine (Amersham

Biosciences) with a BigDye Terminator Cycle Sequenc-ing Kit (Perkin–Elmer) and a MegaBACE 1000 sequen-

cer and ET terminator Kit (Amersham Biosciences).

Several internal oligonucleotides were designed to allow

the complete sequencing. Sequence similarity and do-

main searches were performed using the Blast program

of the National Center for Biotechnology Information

(NCBI) web page (www.ncbi.nlm.nih.gov). Open read-

ing frame (ORF) searches were performed by ORF fin-der at the NCBI web page. G + C content and tandem

and inverted repeat analysis were performed by Geecee,

Einverted, Equicktandem, Etandem, Palindrome at

www.bioweb.pasteur.fr and as described by Benson

(1999). Curvature and bendability analysis were per-

formed at www3.icgeb.trieste.it/~dna/. The GenBank

Accession No. of PvRE7.8 is AF017049.

2.7. Genomic analysis

Filters containing 560 P. vivax genomic-YAC clones

(Camargo et al., 1997) were hybridized with random

priming (Random Priming Labeling Kit, Life Technolo-

gies) radiolabeled PvRE7.8, Pv79, Pv E/C and the single

copy MSP-1 gene (Premawansa et al., 1993) as well as

with internal oligonucleotide probes. When internal oli-gonucleotides were used, radiolabeling was done by

[c-32P]ATP by using 5 0Terminus Labeling Kit (Life

Technologies) and hybridization and washes were per-

formed at 42 �C.

2.8. Dot blot analysis

Genomic DNA isolated from either purified para-sites, blood or recombinant plasmid was spotted onto

nylon filters (Hybond, Amersham) and treated as de-

scribed (Maniatis et al., 1982). Hybridization and

washes of the filters were performed under the same con-

ditions described above. Probes were 32P-radio- or

digoxigenin-dUTP labeled. Digoxigenin-dUTP labeling

was performed using the DIG DNA Labeling Kit

(Boehringer–Mannheim). Hybridization and signaldevelopment conditions were established as described

previously (Angel et al., 1997). To quantify the levels

of the hybridization, filters were scanned by a Phospho

imager (Bio-Rad) and band-density was analyzed by

using the Molecular Analyst software (Bio-Rad).

2.9. PCR analysis

Amplifications were performed in a Gene Ataq ther-

mal cycler (Pharmacia) with 1 U of Taq DNA polymer-

ase (BRL) in a final volume of 50 ll with 50 mM KCl,

10 mM Tris–HCl, pH 9, 0.1% Triton X-100, 1.5 mM

MgCl2, 0.2 mM (each) dNTP, and 0.2 mM of each oli-

gonucleotide. When mosquito DNA was used as target,

0.2 mg/ml bovine serum albumin was added to the reac-

tion mixture. Samples were amplified for 25 (MSP-1F/Rprimers) or 35 (Pv79F/R and Pv411F/R primers) cycles

as follows: 1 min at 94 �C, 1 min at 42 �C (MSP-1 prim-

ers) (Premawansa et al., 1993), 43 �C (Pv411F/R prim-

ers, 5 0 TGTACATGGAAGCGCTAGCG 3 0 and 5 0

ACTTCCACTTGACGCAGAAG 3 0, respectively) or

55 �C (Pv79F/R primers, 5 0 CCCTGCCGCATCGGC

ACGAA 3 0 and 5 0 CCCACAGGGGGGACACCTTT

3 0, respectively), and 1 min at 72 �C. An initial step of1 min at 98 �C and a final step of 5 min at 72 �C were in-

cluded. PCR products were analyzed by ethidium bro-

mide dying in 1.5% agarose gel.

3. Results

3.1. Isolation of repetitive DNA sequences and cloning of

specific P. vivax DNA probe

To isolate P. vivax repetitive DNA sequences, a geno-

mic cgtWES library screening was screened with 32P-la-

beled P. vivax genomic DNA. One recombinant phage

was selected on the basis of its strongest signal, showing

a 7.8-kpb insert, which was called PvRE7.8 (data not

shown).To detect P. vivax-specific internal regions, PvRE7.8

was digested with HaeIII, their products cloned into

pUC18 plasmid, and the library was screened by repli-

cate plate with 32P-labeled P. vivax and P. falciparum

genomic DNAs. One recombinant pUC18 plasmid re-

leased a P. vivax-specific fragment of approximately

80 bp, which was named Pv79 (Fig. 3).

To confirm theP. vivax specificity of Pv79,P. vivax andP. falciparum genomic DNA obtained from blood sam-

ples of infected individuals were hybridized with both

PvRE7.8 and Pv79 probes. Clearly, Pv79 specifically rec-

ognized P. vivax DNA, whereas PvRE7.8 showed cros-

shybridizationwithP. falciparumDNA(data not shown).

3.2. Genomic characterization of PvRE7.8 and Pv79

A genomic P. vivax YAC library was hybridized with

PvRE7.8, Pv79 and the single copy MSP-1 gene. Several

Fig. 1. Determination of Pv79 copy number in the parasite genome.

Plasmid containing Pv79 was spotted from right to left in quantities of

1010–101 vector molecules, in successive 1:10 dilutions. Parasites were

spotted from right to left in quantities of 25,600 to 50 in successive 1:2

dilutions (107 signal intensity was equivalent to 3200 parasites).

Fig. 2. Schematic representation of the PvRE7.8 region sequence

(thick line). (A) Distribution of repeat DNA elements (boxes) along

the PvRE7.8 sequence. Inverted repeat (IR) sequences flanking the

Pv79 element are indicated as nucleotides. (B) The thin line represents

the nucleotide sequence of a P. knowlesi (PKN) DNA fragment and its

corresponding accession number is indicated above. Identity is

indicated as percentage. (C) Thin lines represent protein sequences

(aa, amino acidic residue). The P. falciparum (Pf) and P. yoeli yoeli

(Pyy) accession numbers corresponding to these proteins are indicated

above these lines. Identities are indicated as percentage.

84 S. Carnevale et al. / Experimental Parasitology 108 (2004) 81–88

clones were identified by using PvRE7.8 and Pv79

probes, but only 2 were detected with the MSP-1 probe,

indicating that the P. vivax probes are repetitive DNA

elements of the parasite (data not shown). As expectedPvRE7.8 and Pv79 probes shared almost all of the posi-

tive clones. However, Pv79 showed more positive signals

than the observed by using PvRE7.8 probe.

To determine the copy number of the P. vivax-specific

probe in the parasite genome, a quantitative assay was

developed (Fig. 1). It could be inferred by comparison

of signal intensities in dot blot hybridization that Pv79

has 1.5 · 103 copies/haploid genome.

3.3. Sequence analysis of PvRE7.8

The nucleotide sequence showed that PvRE7.8 is a

7872-bp element. It is possible to detect several internal

tandem repeats along the sequence that range between 2

and 6 monomers of 6 and 32 bp length (Fig. 3A). It was

also possible to detect several T/A and G/C stretches,and a %G + C of 55% uniformly distributed along the

sequence. The Pv79 repeat element showed to be flanked

by a 9–10 bp inverted repeat including the HaeIII site

(Fig. 2A).

The data Bank searching displayed low homology

with other sequences excepting those emerging of the

2021–2044 bp tandem repeat (element e, [TCTTCA]4),

which had >90% identity with similar elements fromDNAs of a wide range of animals and plants species

(data not shown). Since the ubiquitous feature of this re-

peat it was denominated UbiRE. UbiRE was also de-

tected in a wide number of mRNA and EST sequences

from different organisms (data not shown).

The search in Plasmodium spp. genome data bank

displayed its main identity with short fragments (about

500 bp) of P. vivax and a long fragment of P. knowlesi(Fig. 2B).

3.4. Detection of putative genes in PvRE7.8

When the analysis was performed by Blastx, long

fragments of PvRE7.8 showed a high identity with two

hypothetical proteins from other Plasmodium spp.

(Fig. 2C). In addition, several ORFs were detected alongthe PvRE7.8 sequences (data not shown). Interestingly

the deduced amino acid sequence of the five longest

ORFs (750, 996, 1302, 1431, and 1506 bp) correspondedto the sequences with identity to the P. falciparum and

P. yoelii yoelii hypothetical proteins (data not shown).

Blastp analysis with the amino acid sequences from

these five ORFs showed identities with the Plasmodium

sequences mentioned. To search in protein data bank,

two proteins were constructed based on these five ORFs

and the alignment with these hypothetical Plasmodium

protein sequences, one of them (PvRE7.8-1) with 912residues (from nucleotide 3225 to 494, reverse comple-

mentary sequence) and another (PvRE7.8-2) also with

912 residues (from the end to 4581, reverse complemen-

tary sequence). Some regions of PvRE7.8-1 presented

identity with a human replicative senescence downregu-

lated leo1-like protein, a family of proteins that are part

of the Paf1/RNA polymerase II complex; a 5-methylcy-

tosine G/T mismatch-specific DNA glycosylase, aPhotorhabdus luminescens transposase, and a P. falcipa-

rum b-adaptin (Fig 3A), whereas PvRE7.8-2 showed

identity with several proteins among them an Arabidop-

sis thaliana reverse transcriptase and a Bacillus halodu-

Fig. 3. Amino acid sequence analysis. (A) Blastp sequence alignment between PvRE7.8-1 deduced protein and Hum elong, a human leo1-like protein

elongase (Accession No. NP_620147); Gg DNA-Gl, a Gallus gallus 5-methylcytosine G/T mismatch-specific DNA glycosylase (Accession No.

AAF68981, Zhu et al., 2000); Pl transp, a Photorhabdus luminescens transposase (Accession No. AAN64216, Waterfield et al., 2002); and a P.

falciparum b-adaptin (AN: NP_703622). (B) Blastp sequence alignment between At RT, an Arabidopsis thaliana reverse transcriptase (Accession No.

NP_180710); Bh recomb, a Bacillus halodurans cassette chromosome recombinase B1 (Accession No. NP_241548, Takami et al., 2000); and a SbcC

Dom, a consensus domain corresponding to a SbcC protein (gnl/CDD/10293, COGO419). Points, identical amino acid; +, conservative amino acid.

S. Carnevale et al. / Experimental Parasitology 108 (2004) 81–88 85

rans recombinase B1 (Fig. 3B). In addition, a Blast do-

main analysis detected the presence of a SbcC protein,

an ATPase involved in DNA replication, recombina-

tion, and repair (Fig. 3B). The same analysis with Plas-

modium hypothetical proteins (Fig. 2C) only displayed

identity with themselves (data not shown).

3.5. Detection of parasite in blood and mosquito samples

The feasibility of detecting P. vivax in blood samples

obtained from an infected patient was studied by PCR

analysis using MSP-1F/R and Pv411F/R (F, positions

352–371 and R, positions 743–756 on PvRE7.8). DNA

from blood samples that amplified by using MSP-1primers were used to analyze DNA amplification with

Pv411F/R primers. The expected 411-bp amplification

band was observed in the three positive samples but

not with DNA of a patient with P. falciparum infection

or non-infected patient (Fig. 4A). The sensitivity analy-

sis of Pv411-PCR assay was determined by using blood

samples with a known quantity of P. vivax, resulting in

the detection up to a minimum of 100 parasites (Fig.4B), that is equivalent to 1.7 plasmodium/ll of blood.

The analysis of mosquito samples by dot blot using

non-isotopic-labeled Pv79 probe allowed the specific

detection of P. vivax infected mosquitoes, but with a

low level intensity signal (data not shown). To improve

the diagnosis, Pv411-PCR assay on purified mosquito

DNA was performed. Once again, PCR-amplificationwas observed only in positives samples but not in P.

falciparum infected or non-infected mosquito DNA

(Fig. 5).

4. Discussion

Contrasting that occurs with P. falciparum, up tonow little is known about P. vivax genome. According

to McCutchan et al. (1984), P. vivax genome presents

two G + C components, one of them of 18% and the an-

other one of 30%, but current estimates of the (G + C)

content of the P. vivax genome put it at approximately

45%, in comparison to the (G + C) content of P. falcipa-

rum which is 19% (http://www.tigr.org/tdb/e2k1/pva1/).

PvRE7.8 showed a 55% of G + C content, inferring thatit is an unusual sequence region of the parasite genome.

Fig. 4. Agarose gel electrophoresis of Pv411-PCR products. (A) Feasibility of detecting P. vivax in blood samples; lane M, molecular size marker

(100 bp ladder); lanes 1, 2, and 3, positive controls of P. vivax; lane 4, positive control of P. falciparum; lanes 5 and 6, negative controls; lane 7,

PvRE7.8 DNA; lane 8, reaction mixture. (B) Sensitivity analysis of Pv411-PCR assay in quantified parasite DNA; lane M, molecular size marker(c/HindIII); lanes 1–5, 105–10 parasites in successive 1:10 dilutions; lane 6, PvRE7.8 DNA; and lane 7, reaction mixture.

Fig. 5. Agarose gel electrophoresis of Pv411-PCR products with

mosquito samples. Lane M, molecular size marker (100 bp ladder);

lanes 1 and 2, negative control mosquitoes; lanes 3 and 4, P. vivax-

infected mosquitoes; lanes 5 and 6, P. falciparum-infected mosquitoes;

lane 7, PvRE7.8 DNA; and lane 8, reaction mixture.

86 S. Carnevale et al. / Experimental Parasitology 108 (2004) 81–88

In addition, the presence of several and different tandem

repeats and the Pv79 element seems indicate a high de-gree of genome changes in this region.

The repetitive nature of PvRE7.8 element was con-

firmed by hybridization of a P. vivax YAC library with

the PvRE7.8 and Pv79 DNA probes, suggesting either a

mosaic structure of different interspersed DNA elements

as it was described in Trypanosoma cruzi (Olivares et al.,

2000) or, more probably, a LINE-like element (Kidwell

and Lisch, 1997). Interestingly, the translation ofPvRE7.8 showed identities with two hypothetical Plas-

modium proteins, encoded in PvRE7.8 by two contigu-

ous intron-free genes, that showed some similarities

with transposases, DNA glycosylase, reverse transcrip-

tase and nuclease sbcC subunit C proteins, all of them

related to transposable elements (Alberts et al., 1994).

PvRE7.8-1 also displayed identity with another P. falci-

parum protein, a b-adaptin, a protein related with clath-

rin complexes (see Sosa, 1996). Since, one of the

hypothetical proteins and one of the ORFs showed to

continue beyond the 7872 bp, other ‘‘transposon’’ ele-

ments like inverted and direct repeat at the ends of the

element or the presence of long terminal repeats se-quences, could not be being analyzed. Further studies

are necessary to clarify the identity of these proteins.

Data Bank analysis at nucleotide level showed iden-

tity only with a long DNA fragment of P. knowlesi,

the closest organism related to P. vivax. These data

strongly support the specificity observed by hybridiza-

tion and PCR analysis.

Regarding the potential diagnostic uses of PvRE7.8,the results shown here demonstrated that Pv79 as probe

or primers derived of Pv79-flanking sequences (Pv411F/

R) allow the specific molecular detection of P. vivax

from whole blood and mosquito samples. Pv411-PCR

was a bit more sensitive (1.7 parasite/ll of blood) thanthe observed by other PCR systems, that reached detec-

tion limits of 2 parasites/ll of blood (Cox-Singh et al.,

1997; Vu et al., 1995; Kimura et al., 1995; Lokman Ha-kim et al., 1995; Patsoula et al., 2003; Postigo et al.,

1998; Rubio et al., 1999; Schindler et al., 2001; Schoone

et al., 2000; Snounou et al., 1993a,b; Zhong et al., 2001).

Up to now the more expanded target used to diagnose

Plasmodium spp. by PCR was the rRNA sequence (Bar-

ker et al., 1992; Brown et al., 1992; Lal et al., 1989;

Snounou et al., 1993a; Tirasophon et al., 1991; Waters

and McCutchan, 1989; Zhong et al., 2001).Analyzing the presence of P. vivax in blood, there

were reported false negatives in PCR assay, requiring

hybridization to improve the sensitivity (Laserson

et al., 1994; Normaznah et al., 1997; Snounou et al.,

1993b; Tirasophon et al., 1994). Recently, Patsoula

S. Carnevale et al. / Experimental Parasitology 108 (2004) 81–88 87

et al. (2003), developed a multiplex PCR assay, that al-

lowed to differentiate in a 4-h-assay P. falciparum and P.

vivax by differential amplification band length. The

Pv411-PCR developed here is also a single-step, accu-

rate, and reproducible assay that allows to detect specif-

ically P. vivax in a short time either from blood ormosquito samples. In addition, our assays showed that

parasites could be detected by a hybridization assay.

The development of simple PCR or an alternative

technique as dot blot assay could represent a very

important tool for malaria control programs. The detec-

tion of parasites in mosquitoes should be highly valu-

able since different areas could be studied to know the

transmission potential based on the detection of infectedvectors (Ramsey, 1988). In addition, a large number of

human blood samples of low volume could be also ana-

lyzed with epidemiological purposes. In conclusion, we

consider that the repeat element described here could

be an interesting tool for P. vivax malaria diagnosis

and for epidemiological analysis of P. vivax transmis-

sion areas. In addition, it showed to be the first LINE

element described in Plasmodium spp.

Acknowledgments

We acknowledge Dr. Jose Bento Pereira Lima from

Instituto Militar, Rio de Janeiro, Brazil, for kindly pro-

viding infected-mosquito samples. We thank Dr. Nico-

las Schweigmann, from Facultad de Ciencias Exactas yNaturales, Universidad de Buenos Aires, Argentina,

for providing negative mosquito controls. S.O. Angel

is a member of the Consejo Nacional de Investigaciones

Cientıficas y Tecnicas (CONICET) and of the Universi-

dad de Buenos Aires (Departamento de Fisiologıa y

Biologıa Molecular, FCEyN). This work was supported

by ANLIS Dr. Carlos G. Malbran.

References

Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., Watson, J.D.,

1994. Molecular Biology of the Cell, third ed. Garland Publishing

Inc., New York.

Angel, S.O., Matrajt, M., Margarit, J., Nigro, M., Illescas, E.,

Pszenny, V., Amendoeira, R., Guarnera, E., Garberi, J.C., 1997.

Screening for active toxoplasmosis in human patients by DNA

hybridizations with ABGTg7 probe in blood samples. Journal of

Clinical Microbiology 35, 591–595.

Barker, R.H., Banchongaksorn, T., Courval, J.M., Suwonkerd, W.,

Rimwungtragoon, K., Wirth, D.F., 1992. A simple method to

detect Plasmodium falciparum directly from blood samples using

PCR. The American Journal of Tropical Medicine and Hygiene 46,

416–426.

Benson, G., 1999. Tandem repeats finder: a program to analyze DNA

sequences. Nucleic Acids Research 27, 573–580.

Brown, A.E., Kain, K.C., Pipithkul, J., Webster, H.K., 1992.

Demonstration by the polymerase chain reaction of mixed Plas-

modium falciparum and P. vivax infections undetected by conven-

tional microscopy. Transactions of the Royal Society of Tropical

Medicine and Hygiene 86, 609–612.

Camargo, A.A., Fischer, K., Lanzer, M., del Portillo, H.A., 1997.

Construction and characterization of a Plasmodium vivax genomic

library in yeast artificial chromosomes. Genomics 42, 467–473.

Coulson, R.M.R., Curtis, C.F., Ready, P.D., Hill, N., Smith, D.F.,

1990. Amplification and analysis of human DNA present in

mosquito bloodmeals. Medical Veterinary Entomology 90, 357–

366.

Cox-Singh, J., Mahayet, S., Abdullah, M.S., Singh, B., 1997. Increased

sensitivity of malaria detection by nested polymerase chain reaction

using simple sampling and DNA extraction. International Journal

for Parasitology 27, 1575–1577.

DeBruin, D., Lanzer, M., Ravetch, J.V., 1994. The polymorphic

subtelomeric regions of Plasmodium falciparum chromosomes

contain arrays of repetitive sequence elements. Proceedings of the

National Academy of Sciences of the United States of America 91,

619–623.

Garcia, L.S., Bruckner, D.A., 1993. Malaria and Babesia spp. In:

Garcia, L.S., Bruckner, D.A. (Eds.), Diagnostic Medical Parasi-

tology. American Society for Microbiology, Washington, DC, pp.

113–138.

Kidwell, M.G., Lisch, D., 1997. Transposable elements as sources of

variation in animals and plants. Proceedings of the National

Academy of Sciences of the United States of America 94, 7704–

7711.

Kimura, M., Miyake, H., Kim, H.S., Tanabe, M., Arai, M., Kawai, S.,

Yamane, A., Wataya, Y., 1995. Species-specific PCR detection of

malaria parasites by microtiter plate hybridization: clinical study

with malaria patients. Journal of Clinical Microbiology 33, 2342–

2346.

Lal, A.A., Changkasiri, S., Hollingdale, M.R., McCutchan, T.F.,

1989. Ribosomal RNA-based diagnosis of Plasmodium falciparum

malaria. Molecular and Biochemical Parasitology 36, 67–71.

Laserson, K., Petralanda, Y., Hamlin, D., Almera, R., Fuentes, M.,

Carrasquel, A., Barker, R., 1994. Use of polymerase chain reaction

to directly detect malaria parasites in blood samples from the

Venezuelan Amazon. The American Journal of Tropical Medicine

and Hygiene 50, 169–180.

Lokman Hakim, S., Furuta, T., Noor Rain, A., Normaznah, Y.,

Mohd Zamri, M.R., Kojima, S., 1995. Diagnosis of malaria using a

plate hybridization method for the detection of polymerase chain

reaction products. Transactions of the Royal Society of Tropical

Medicine and Hygiene 89, 271–272.

Maniatis, T., Fritsch, E.F., Sambrook, J., 1982. Molecular Cloning: A

Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring

Harbor, New York.

McCutchan, T.F., Dame, J.B., Miller, L.H., Barnswell, J., 1984.

Evolutionary relatedness of Plasmodium species as determined by

the structure of DNA. Science 225, 808–811.

Ministerio de Salud, 2002. Boletın epidemiologico Nacional. Available

from: <http//www.direpi.vigia.org.ar>.

Normaznah, Y., Furuta, T., Saniah, K., Noor Rain, A., Kojima, S.,

Mak, J.W., 1997. Diagnosis of malaria by enzymatic detection of

polymerase chain reaction products. Southeast Asian Journal of

Tropical Medicine and Public Health 28, 432–433.

Olivares, M., Thomas, M.C., Lopez-Barajas, A., Requena, J.M.,

Garcıa-Perez, J.L., Angel, S.O., Alonso, C., Lopez, M.C., 2000.

Genomic clustering of the Trypanosoma cruzi non-long terminal

L1Tc retrotransposon with defined interspersed repeated DNA

elements. Electrophoresis 14, 2973–2982.

Organizacion Panamericana de la Salud, 2001. Boletın Epidemiolog-

ico, vol. 22, No. 1, OPS, Washington, DC.

Patsoula, E., Spanakos, G., Sofianatou, D., Parara, M., Vakalis, N.C.,

2003. A single-step, PCR-based method for the detection and

differentiation of Plasmodium vivax and P. falciparum. Annals of

Tropical Medical Parasitology 97, 15–21.

88 S. Carnevale et al. / Experimental Parasitology 108 (2004) 81–88

Postigo, M., Mendoza Leon, A., Perez, H.A., 1998. Malaria diagnosis

by the polymerase chain reaction: a field study in south-eastern

Venezuela. Transactions of the Royal Society of Tropical Medicine

and Hygiene 92, 509–511.

Premawansa, S., Snewin, V.A., Khouri, E., Mendis, K.N., David,

P.H., 1993. Plasmodium vivax: recombination between potential

allelic types of the merozoite surface protein MSP1 in parasites

isolated from patients. Experimental Parasitology 76, 192–199.

Ramsey, J.M., 1988. La deteccion de parasitos de la malaria en el

mosquito por observacion microscopica. In: Lopez Antunano, F.J.,

Schmunis, G., (Eds.), Diagnostico de Malaria. Publicacion

Cientıfica No. 512. OPS, Washington, DC, pp. 51–56.

Rey, L., 1991. Parasitologia. Segunda Edicao. Guanabara Koogan

S.A., Rio de Janeiro, Brazil.

Rubio, J.M., Benito, A., Roche, J., Berloza, P.J., Garcıa, M.L., Mico,

M., Edu, M., Alvar, J., 1999. Semi-nested, multiplex polymerase

chain reaction for detection of human malaria parasites and

evidence of Plasmodium vivax infection in Equatorial Guinea. The

American Journal of Tropical Medicine and Hygiene 60, 183–187.

Schindler, H.C., Montenegro, L., Montenegro, R., Carvalho, A.B.,

Abath, F.G., Jaureguiberry, G., 2001. Development and optimi-

zation of polymerase chain reaction-based malaria diagnostic

methods and their comparison with quantitative buffy coat assay.

The American Journal of Tropical Medicine and Hygiene 65, 355–

361.

Schoone, G.J., Oskam, L., Kroon, N.C.M., Schallig, H.D.F.H., Omar,

S.A., 2000. Detection and quantification of Plasmodium falciparum

in blood samples using quantitative nucleic acid sequence-based

amplification. Journal of Clinical Microbiology 38, 4072–4075.

Snounou, G., Viriyakosol, S., Jarra, W., Thaithong, S., Neil Brown,

K., 1993a. Identification of the four human malaria parasite species

in field samples by the polymerase chain reaction and detection of a

high prevalence of mixed infections. Molecular and Biochemical

Parasitology 58, 283–292.

Snounou, G., Viriyakosol, S., Zhu, X., Jarra, P., Pinheiro, W., do

Rosario, L., Thaithong, V.E., Brown, K.N., 1993b. High sensitivity

of detection of human malaria parasites by the use of nested

polymerase chain reaction. Molecular and Biochemical Parasitol-

ogy 61, 315–320.

Sosa, M.A., 1996. The adaptor complexes: a bridge between the

transmembrane proteins and clathrin lattices. Biocell 20, 301–305.

Takami, H., Nakasone, K., Takaki, Y., Maeno, G., Sasaki, R., Masui,

N., Fuji, F., Hirama, C., Nakamura, Y., Ogasawara, N., Kuhara, S.,

Horikoshi, K., 2000. Complete genome sequence of the alkaliphilic

bacterium Bacillus halodurans and genomic sequence comparison

with Bacillus subtilis. Nucleic Acids Research 28, 4317–4331.

Tirasophon, W., Ponglikitmongkol, M., Wilairat, P., Boonsaeng, V.,

Panyim, S., 1991. A novel detection of a single Plasmodium

falciparum in infected blood. Biochemical and Biophysics Research

Communications 175, 179–184.

Tirasophon, W., Rajkulchai, P., Ponglikitmongkol, M., Wilairat, P.,

Boonsaeng, V., Pnyim, S., 1994. A highly sensitive, rapid, and

simple polymerase chain reaction-based method to detect human

malaria (Plasmodium falciparum and Plasmodium vivax) in blood

samples. The American Journal of Tropical Medicine and Hygiene

51, 308–313.

Vu, T.T., Tran, V.B., Phan, N.T., Le, T.T., Luong, V.H., O�Brien, E.,Morris, G.E., 1995. Screening donor blood for malaria by

polymerase chain reaction. Transactions of the Royal Society of

Tropical Medicine and Hygiene 89, 44–47.

Wataya, Y., Arai, M., Kubochi, F., Mizukoshi, C., Kakutani, T., Ishii,

A., 1993. DNA diagnosis of falciparum malaria using a double

PCR technique; a field trial in the Solomon Islands. Molecular and

Biochemical Parasitology 58, 283–292.

Waterfield, N.R., Daborn, P.J., French-Constant, R.H., 2002. Geno-

mic islands in Photorhabdus. Trends in Microbiology 10, 541–545.

Waters, A.P., McCutchan, T.F., 1989. Rapid, sensitive diagnosis of

malaria based on ribosomal RNA. Lancet 17, 1343–1346.

World Health Organization, 1991. Basic Malaria Microscopy. WHO,

Geneva, Switzerland.

World Health Organization, 2000. WHO Expert Committee on

Malaria. Twentieth Report. WHO Technical Report Series 892.

WHO, Geneva, Switzerland.

Zhong, K.J.Y., Salas, C.J., Shafer, R., Gubanov, A., Gasser, R.A.,

Magill, A.J., Russ Forney, J., Kain, K.C., 2001. Comparison of

Iso-Code STIX and FTA Gene Guard collection matrices as

whole-blood storage and processing devices for diagnosis of

malaria by PCR. Journal of Clinical Microbiology 39, 1195–1196.

Zhu, B., Zheng, Y., Angliker, H., Schwarz, S., Thiry, S., Siegmann,

M., Jost, J.P., 2000. 5-Methylcytosine DNA glycosylase activity is

also present in the human MBD4 (G/T mismatch glycosylase) and

in a related avian sequence. Nucleic Acids Research 28, 4157–4165.