high affinity binding of the large t protein of polyoma virus to a genomic mouse dna sequence

Vol. 148, No. 3, 1 987

November 13, 1 987

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Pages 1053-1062

HIGH AFFINITY BINDING OF THE LARGE T PROTEIN OF POLYOMA VIRUS

TO A GENOMIC MOUSE DNA SEQUENCE

Cedric Galup, Pierre L~opold, Laura Trejo-Avila, Philip El Baze,

Minoo Rassoulzadegan, Patrick Gaudray and Francois Cuzin

Unit~ 273 de I'INSERM, Universit~ de Nice, 06034 Nice, France

Received September Ii, 1987

SUMMARY: We purified a fragment of mouse DNA to which the large T protein of polyoma virus was bound in chromatin prepared from transformed mouse cells. This sequence, which is not repeated to a measurable extent within the mouse genome, does not show any significant homology to the viral ori region, except in a short region, which comprises a sequence related to the consensus for recognition by large T proteins ((A,T)GPuGGC). This region of pCG4 was confirmed by in vitro binding assays to be essential for T antigen binding. ® 1987 Academic Press, Inc.

The large T antigen of polyoma virus is a plelotroplc regulatory

protein which plays an essential role in the lytlc cycle of the virus as

an initiator of DNA replication, a repressor of early transcription and a

positive regulator of late transcription. Fundamental to these functions

is the property of the protein to bind specifically to complex arrays of

sites within the viral origin of replicatlon and promoters, all of them

containing repeats of the pentanucleotlde GPuGGC (I-3). Large T also acts

during transformation of rat embryo flbroblasts: it cooperates with the

polyoma middle T protein and with ras oncogene products for complete

transformation, and, by itself, it reduces the requirements In serum

factors of established cell lines and promotes long term grovcth ("immor-

talization") of primary culture cells (see ref. 4 for review). It was

tempting to speculate that these activities result from interactions of

the protein with specific sites in the cell genome (prornotors, origins of

replication), to which it should be found associated in chromatin extracts

from virus-transformed cells.

We developed an experimental approach for the cloning of potential

T antigen binding sites from genomic mouse DNA, based on our previous

observation (5) that the large T complexes wlth viral DNA extracted from

lytically infected cells are stable at ionic strengths up to 1.5 M KCI.

1053

0006-291X/87 $1.50 Copyright © 1987 by Academic Press, Inc.

All rights of reproduction in any form reserved.

Vol. 148, No. 3, 1987 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Assuming that the same would be true for specific complexes with cellular

DNA binding sites, we fragmented the chromatin of polyoma-transformed

cells, dissociated the less stable complexes and non-specifically bound

protein by exposure to high salt concentrations, and tried to irnmuno-

precipitate large T-containlng complexes and to recover and clone DNA

fra£~nents from the inTnunoprecipitates. Preliminary experiments (6)

indicated that this approach was feasible. The fact that a significant

amount of DNA could be associated non-specifically with the immuno-

precipltates made it necessary to check that the cloned fragments are

indeed capable of binding the protein in vitro with high affinity. The

first experiments provided one positive clone (6), but its short size made

further analysis difficult. We wish to report the isolation and structural

ana lys is o f a second c lone, which was shown In an independent ser ies o f

experlments to e x h i b i t i n t e r e s t i n g b i o l o g i c a l p rope r t i es (7 ,8 ) .

MATERIAL AND METHODS

Cel l l i nes t an t ibod ies t vec tor DNAs. The polyoma v i rus - t rans fo rmed l i nes scop-T1 and scop-T3 (9) and the reference l l nes C127 and 3T6 were propa- gated In Dulbecco modi f ied Eagle 's medium (GIBCO) supplemented w i th 10% newborn c a l f serum (GIBCO). F lu id from asc i tes induced by the polyoma transformed PyB8 c e l l l i ne in Brown Norveglan rats (10) was used a source o f a n t l - T ant igen an t i bod ies . Plasmld pUC8 and phage M13mp10 were pur- chased from comt~rc ia l sources (BOhringer, Pharrnacla). Nuclease d i ges t i on and high s a l t t reatment o f chromat in. D igest lon w i th micrococcal nuclease was performed on nuc le i prepared according to r e f . 12 (100 micrococcal nuclease units/m1 f o r 5 min. at 25°C). The suspension was then brought to 0.45 M KCI by addition of 20 mM Tris pH 7.5, i n~M EDTA, 10% glycerol, 1 mM dithiotreitol, 0.5 M KCI and 0.5% Nonldet P40, and clarified by centrifugation at 18,000 x g for 10 min. Labeling of DNA restriction fragments. Fragments purified by gel electrophoresis in low melting point agarose9were labeled at their 3' ends to specific activities in the range of 10 dpm/ug ofz~00 BP fragment, using terminal deoxynucleotidyltransferase and (~ P)dideoxyadenosinetri- phosphate (3' End Labeling Kit, Amersham). T antigen-containing extracts. Extracts were prepared from virus-infected 3T6 cells as previously described (11). .C.ompetitlon assay for large T binding to DNA: the affinity of large T for various DNA sequences was estimated by the competition binding assay described previously (I). Immunoassay for large T-DNA complexes (modified from ref. 13): the soluble T antlgen:DNA con~lexes were separated by adsorption on InTnobilized Staphylococcus protein A, either directly from nuclease treated high salt ch~omatin extracts, or after in vitro binding (incubation of extract from 10 virus-infected cells with labeled DNA for 1 h at 0°C in 1 ml of 20 mM sodium phosphate buffer pH 7 containing 2 mM dithlothreitol, 1 mM EDTA, 50 mM NaC], 0.1 n~g/m] bovine serum albumin, 0.5% NP40, 5 ug/ml sheared calf thymus DNA). 50 ul of a washed suspension of fixed bacterial cells (Pansorbin, Caibiochem) were first added and the mixture was incubated for 20 mln. at 4°C; after centrlfugation, supernatants were incubated for 60 min. at 0°C with anti-T antigen antibodies (20 ul of ascites fluid), and immune complexes were precipitated with 100 ul of fixed bacteria. DNA was recovered by elutlon with 0.1 ml of 2% sodium dodecylsulfate in 10 mM

1054

Vol. 14.8, No, 3, 1987 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Tris-HCl buffer pH 8, i mM EDTA, containing 50 uglml proteinase K ( i0 mln. at 25°C followed by 5 mln. at 70°C3; it was then purified by phenol- chloroform, and chloroform extractions and precipitated with ethanol before gel electrophoresis. DNA sequencing: the dideoxy chain termination method (14) was used to sequence DNA inserts cloned in M13mp10. Searches in libraries were performed using the IFIND program and sequence analysis, using the SEQ program (BIONET~m).

RESULTS

Salt-stable complexes between the large T protein and DNA In transformed

cel ls .

Nuclei were isolated from 3H-thymidine-labeled transformed mouse

cel ls which express the large T protein (9) and from control normal ce l ls .

Preparations were treated with micrococcal nuclease, exposed to high ionic

strength (0.45 M KCI), and submitted to In~nunoprecipitation as described

under Methods, using either polyclonal anti-T antigen rat antibodies or

control non-iEmune rat antibodies. Values obtained using anti-T ant i -

bodies, corrected by substracting the blank values obtained with control

serum, are shown in Table 1 for normal cel ls (C127), spontaneously trans-

formed cel ls (3T6) and two polycma-transformed lines derived from C127,

stop-T1 and stop-T3. A small but reproducible fract ion of the input

radioact iv i ty was speci f ical ly inTnunoprecipltated from the chromatin of

the v i ra l transformants. Gel electrophoresis of labeled DNA recovered from

the inTnunoprecipitates indicated sizes in the range of 150 to 500 BP (data

not shown).

These results were in agrement with our assumption that the viral

protein Is stably bound to a limited number of gencrnic sites In the

chromatin of transformed cells. In order to demonstrate that the mouse DNA

fragments present in the InTnunoprecipitates are Indeed capable of binding

Table i. In~Jnopreclpitatlon of large T-DNA complexes from chromatln

Chromatln

prepared from

cell line

Fraction of input radioactivity

specifically Irnmunopreclpitated

(x 10 6)*

3T6

C127

stop-T1

stop-T3

<0.2

<0.2

146

17

* see Text

1055


the protein with high affinity, and to further characterize them, we

proceeded to their cloning and amplification in bacterial vectors.

Molecular cloning of sequences complexed with large T in extracts from

transformed cells.

DNA fragments were purified from the inT~Jnoprecipitates obtained

after micrococcal nut]ease digestion and high salt treatment of the

chromatin of scop-T1 cells. They were inserted at the HincII site of

plasmld pUC8 by blunt end ligation with T4 phage DNA ligase after filling

the ends with T4 DNA polymerase (15). Eight independent bacterial clones

carrying plasmids with inserts of foreing DNA were initially isolated

(pla~_~nids pCG1 through 8 and pCGT7). A first screening for the ability of

these D~s to bind in vitro the large T protein demonstrated that only

three of them (pCGI, 4, 7) were able to bind efficiently the protein (not

shown, see below for pCG4). Blot hybridization under stringent conditions

indicated a significant degree of similarity between the inserts of pCG1

and pCG7, whereas the pCG1 and pCG4 inserts not only did not hybridize

with each otherp but did not hybridize with either polyoma or SV40 DNA

(scop-T1 ceils had been established after transformation with a recom-

binant DNA including the complete large T coding region under control of

the SV40 early promotor (9)). This report describes the structure of the

rr~use DNA fragment carried in p]asmld pCG4.

High affinity binding of large T antigen

The relative affinities of the large T protein for various DNA

fragments can be estimated by a competition assay (1), based on the

specific elution in the presence of minute amounts of competitor DNA of

the protein initially bound to calf thymus DNA cellulose. The intrinsic

ATPase activity of large T (11) provides a convenient and sensitive assay

and equilibrium dissociation constants can be estimated from the apparent

K0. 5 values (16). From the data shown in Figure 1, dissociation constants

were estimated at about 5 x 10 -11M for large T complexes with pCG4 DNA,

as compared with values of 2 x 10 -11M for the complete polyoma virus ori

region (which contains several binding sites (2,3)), and of 1 x 10 -9 M for

pBR322 DNA.

These results were confirmed when complex formation was assayed

(Figure 2) by co-ir~nunopreclpitation of labeled DNA fragments with

T antigen (10). The results obtained with a purified fragment covering the

complete insert (PstI-Ban~II, Figure 3) again suggested a relative affinity

only 3 to 5-fold lower than for the multiple sites of tile viral ori

region. By contrast, only background levels were detected with an Aval-

Aval fragment (Figure 2, lane 7), which appeared at first to contain

1056


2o O

!°

0 I

0 0.5 1

I / D N A c o n c e n t r a t i o n (nM)

Figure 1. E l u t l o n o f large T ATPase from DNAIcel lu lose by va r ious concen t ra t ions o f polyoma v i r u s , pCG4 and pBR322 DNA. Compet i t ion assays were performed according to r e f . 1. ATPase a c t i v i t y e l u ted at va r ious DNA concen t ra t ions was p l o t t e d f o l l o w i n g the Lineweaver & Burk rep resen ta t i on . Open c i r c l e s : pBR322 DNA; c losed c i r c l e s : polyoma DNA; squares: peG4 DNA.

essentially the same sequences and whose size could not be distinguished

from the former by gel eiectrophoresis. As revealed by subsequent nucleo-

tide sequencing (see below), AvaI cleavage removed in fact 23 nucleotides

from the insert, and this experiment therefore suggests that a region

necessary for high affinity binding is included within these 23 BP.

1 2 3 4 5 6 7

Figure 2. I ITrnunoprecipi tat lon o f complexes between the large T p r o t e i n and the pCG4mouse DNA i n s e r t . I n t runop rec lp l t a t i on o f complexes w i t h r a d i o a c t i v e l y labe led DNA fragments and subsequent e l ec t ropho res l s were performed as ind ica ted under Methods. Lane 1 to 3: increas ing amounts (5, 50 and 500 ng, r e s p e c t i v e l y ) o f the PstI-BalTi-lI fragment o f pCG4 DNA con ta in i ng the c e l l u l a r DNA inse r t (see Figure 3) . Lanes 4 to 6: increas ing amounts (5, 50 and 500 ng, r e s p e c t i v e - ] y ) o f a fragment o f polyoma DNA extend ing from the Bc l I s i t e (nuc l . 5021) t o the Hph] s i t e (nuc ] . 155) (19) and inc lud ing a l l the known T a n t i g e n - b ind ing s i t e s ( 2 , 3 ) . Lane 7 : 5 0 ng o f the sinai] AvaI -AvaI fragment o f pCG4 DNA (see Figure 3) .

1057

Vol 148, No. 3, 1987 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Aval

TGAAGCCAGTTTATCTA~T~GAGCTTCCAAAAAATTCTAGTC Pvull

47 TTTCATGCCCGCAGTTAGGCAG~TGGAAATAAAAATTGATCATAGA

c d e l ~coRl 3 ~ATGAACGGGAAACTCAGTCACATGGCACAGACGAGACAGCAGAAT

39 cde3 TCCCAGAGACATCGGGGAATGATTTCCGIIIICCCAGCACTAGTC'I-r

186 GATCCATCAGTAGCATCCTACATGCTAATACTCTCTGCC'I-rCTGCCA

233 GGAATAGTGTGCATACCCCGATACCTAGTTACTGCGACTCC]-rCCAG

TG TCTG G ATTGTTTCTACTCCG CAGTTCAG GCTCACTCG Grl-r AT-IT

" ccA Ac cTccA T

~ vull

Figure 3. Map and sequence of pCG4. cdel, cde3: sequences corresponding to yeast centr~neric elements (7);

5'..GCCTC..3' hatched box: putative T antigen binding site ( 3'..CGGAG. 5' )

Nuc leo t ide sequence.

The nuc leo t i de sequence o f pCG4 (F igure 3) revealed a number o f

p e c u l i a r i t i e s . As in fered from h y b r i d i z a t i o n data, i t d id not e x h i b i t any

extended s i m i l a r i t y w i t h the o r i g i n o f r e p l i c a t i o n o f SV40, in tegra ted in

the chromosomes o f the o r i g i n a l t rans formant (9 ) , nor w i t h t ha t o f

polyoma. I t inc ludes a s i n g l e mot ive corresponding to the consensus f o r T

ant igen b lnd lng (A=T)G(A>G)GGC (1 -3 ) , located w i t h i n the 23 nuc leo t ides

whose removal by AvaI endonuclease abo l ishes b ind ing (F igure 2) . Th is

pu ta t i ve b ind ing s l t e (GCCTC in F igure 3) is a c t u a l l y inc luded w i t h i n a

somewhat l a rge r region showing s i m i l a r i t i e s w i t h the o r i g i n s o f r e p l i -

ca t i on o f both polyoma and SV40 (Table 2). Another remarkable fea tu re o f

the cloned mouse sequence is t ha t i t con ta ins a large number o f inver ted

repeats, 13 to 21BP in length (Table 3) . Computer aided searches d id not

reveal any s i g n i f i c a n t s i m i l a r l t y w i t h any sequence stored in the GENBANK

l i b r a r y .

1058

Vol. 148, No. 3, 1987 BIOCHEMICAL, AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Table 2. Sequence s i m i l a r i t i e s wi th the o r i g i n s of r e p l i c a t i o n

of polyoma and SV40 v i ruses

SV40

pCG4

polyoma strain A3

(5202) AAGCCTCCTCACTACTTCT..

(16) TAGCCTCTCGAG CTTC

(45) AAGCCTCTCTT

• .TAAAAAAAATT (30)

CAAAAAATT (403

CTTTTTCT . . . . TAAAAAAAACA (5255)

Nucleot ide sequences of SV40 and polyorna A3 s t r a i n according to

re f . 20 and 21; * : Ident ica l nuc leot ides; consensus sequences fo r

large T binding are under l ined,

Analysis o f the 9enomic sequence homologous to pCG4.

Southern b lo t hyb r i d i za t i on experiments (Figure 4) indicated tha t the

genomic sequence i d e n t i f i e d by rad io labe led pCG4 probes is not repeated to

a measurable ex tent . I t Is car r ied on a l im i t ed number o f r e s t r i c t i o n

fragments of mouse DNA, and comparison w lth the Intensity of bands

produced on the same blots by a probe for the single copy c-KI-ras gene

(plasmid pHiHi-3 (17)) indicated that it is either unique or of a low

degree of repetitivlty. It is present in the mouse genome within large DNA

molecules, as shown by its sensitivity to shearing in blot hybridization

Table 3. Dyad symmetries In pCG4 mouse DNA sequence

155 GAATGATTT-CC-GTT 168 216 CTCTCT-GCCTTCTGCCA 232

112 CTGACTCAAAGGGCAA 97 132 GACAGAGCAGA-CACGGT 116

220 CTGCCT-TCTGCCAGGAAT 237 231 CAGGAATAGTG-TG 243

68 GACGGATTGACG-CCCGTA 51 186 GTTCTGATCACGAC 173

262 TACTGC-GACTCCTTCC 277 274 TTCCAGATGTCTGGATTG 291

247 AT-ACGTGTGA-TAAGG 233 74 AAGGTCGACGGA-TTGAC 58

275 TCC-AGATGTCT--GG--ATT 291 328 AA-CCAGGACAACT 340

156 AGGGGCTACAGAGACCCTTAA 136 290 TTAGGTC-TGTAGA 278

Search for dyad symmetries was performed using the SEQ program.

1059


1 2 3 4 5

Figure 4. B lo t h y b r i d i z a t i o n ana lys i s o f the c e l l u l a r DNA sequence homologous to the pCG4 Inse r t . Lane I : mouse t a l l DNA ( s t r a l n B6D2) c leaved w i t h Bani-II and hyb r id i zed w l th labe led pCG4 DNA; " 2: " " " " randomly sheared and hybridized with labeled

pCG4 DNA; " 3: " " " " cleaved with BarnHI and hybridized with a

mixture of pCG4 and pHiHi (c-Ki-ra__~s) DNAs, labeled at the same specific radioactivity; " 4: rat (FR3T3) DNA cleaved with BanHI and hybridized with labeled

pCG4 DNA; " 5: human DNA cleaved with BamHI and hybridized with labeled pCG4 DNA.

Each lane contains 10 ~g of denatured DNA bound to nitrocellulose.

experiments (Figure 4, lane 2). It is not, as a whole, highly conserved,

since hybridization revealed the presence of partially homologous

sequences in rat, but, even under less stringent hybridization conditions

(not shown), in none of the other DNAs that we tested (human, horse,

sheep, cow, xenopus, sea urchin).

DISCUSSION

In vitro binding of a protein to a cloned DNA fragment is obviously

no sufficient proof that this interaction is biologically meaningful. This

is especially true in the case of large T, which binds to a simple motive

(GPuGGC), widely represented in eukaryotic DNAs. Our hope was that by

searching for sequences to which the protein is bound in extracts from

transformed cells, one would have a better chance of isolating a genomic

site of biological significance, and we therefore developed the approach

described in the present and in a previous report (6), in parallel with

similar work performed by others on SV40 T antigen binding sites (18).

Even using this procedure, one cannot be sure, however, of whether or

not the cloned sequences are playing a functional role, and still less of

what this role might be. From what we know of the molecular biology of the

virus, two obvious candidate functions might be origin of replication,

large T acting as an initiator, and/or transcriptional cis-regulatory

~equences, large T being known as a repressor of early transcription and

1060


an activator of late transcription. It is clear that the next step after

isolating such DNA fragments must be to develop biological assays in order

to ascertain their possible functions. The case of pCG4 is interesting in

this respect, since we observed, starting from a fortuitous observation

(8), that it can be maintained in an autonomously replicating state in

transgenic mouse strains. Moreover, it was efficiently transmitted in low

copy number through meiosis, implying that it contains sequences which can

act as centromere. A partial nucleotide sequence was previously published

(7) for a plasmid DNA (p12B1), which had been recovered from a transgenic

~use, but was eventually found to be identical with pCG4 (8). It includes

sequences corresponding to the consensus established for elements cdel and

cde3 of yeast centromeres (Figure 3).

ACKNOWLEDGMENTS

One of us (PL) is a fellow of the Ligue Nationa]e Fran~aise contre le Cancer, France. We are indebted to L. Carbone, C. Godefroid, A. Grima, E. Lay, C. Minghe]li and F. Tillier for skilled technical help. This work was supported by in part a grant from Association pour la Recherche sur le Cancer, France. Computer resources used to carry out our studies were provided by the BIONET J" National Computer Resource for Molecular Biology, whose funding is provided by the Biomedical Research Technology Program, Division of Research Resources, National Institutes of Health, Grant 1U41RR-01685-02.

REFERENCES

1. Gaudray, P., Tyndall, C., Kamen, R. & Cuzin, F. (1981) Nucl. Acids Res., 9, 5697-5710.

2. Pomerantz, B.J., Mueller, C.R. & Hassell, J.A. (1983) J. Virol., 47, 600-610. Cowie, A. & Kamen, R. (1984) J. Virol., 52, 750-760. Cuzin, F. (1984) Biochim. Biophys. Acta, 781, 193-204. Clertant, P., Gaudray, P. & Cuzin, F. (1984) The EMBO J., 3, 303-307. Galup, C., Trejo-Avila, L., Mougneau, E., Lemieux, L., Gaudray, P., Rassoulzadegan, M. & Cuzin, F. (1983) INSERM Coll., 117, 255-276.

7. Rassoulzadegan, M., L~opold, P., Vailly, J. & Cuzin, F. (1986) Cell, 46, 513-519.

8. L~opold, P., Vailly, J., Cuzin, F. & Rassoulzadegan, M. (1987) Cell, in press.

9. Rautmann, G., Glaichenhaus, N., Naghashfar, Z., Breathnach, R. & Rassoulzadegan, M. (1982) Virology, 122, 306-317.

10. Goldman, E. & Benjamin, T.L. (1975) Virology, 66, 372-384. 11. Gaudray, P., Clertant, P. & Cuzin, F. (1980) Eur. J. Blochern., 109,

553-560. 12. Wu, C., Bingham, P.M., Livak, K.J., Holmgren, R. & Elgin, S.C.R.

(1979) Cell, 16, 797-806. 13. McKay, R.D.G. (1981) J. Mol. Biol., 145, 471-488. 14. Sanger, F., Nicklen, S. & Coulson, A.R. (1977) Proc. Natl. Acad. Sci.

USA, 74, 5463-5467.

3. 4. 5. 6.

1061


15. Maniatis, T., Frltsch, E.F. & Sambrook, d. (1982) Cold Spring Harbor Laboratory, New York.

16. De Haseth, P.L., Gross, C.A., Burgess, R.R. & Record, M.T. (1977) Biochemistry, 16, 4777-4782.

17. E l l i s , R.W., DeFeo, D., Shlh, T.Y., Gonda, M.A., Young, H.A., Tsuchlda, N., Lowy, D.R. & Scolnlck, E.M. (1981) Nature, 292, 506-511.

18. Lane, D.P., Simanis, V., Bartsch, R., Yewcle11, J., Gannon, d. & Mole, S. (1985) Proc. Roy. Soc. Lond., 226, 25-42.

19. Soeda, E., Arrand, J.R., Smolar, N., Waish, J.E. & Gr i f f in , B.E. (1980) Nature, 283, 445-453.

20. Buchman, A.R., Burnett, L. & Berg, P. (1981) In DNA Tumor Viruses, 2nd edition, d. Tooze, ed., Cold Spring Harbor Laboratory, pp. 799-841.

21. Friedman, T., Esty, A., La Porte, P. & Delnlnger, P. (1979) Cell, 17, 715-724.

1062

high affinity binding of the large t protein of polyoma virus to a genomic mouse dna sequence

Documents