health med neutropenia; 2011

HealthMEDVolume 5 / Number 3 / 2011 ISSN 1840-2291

Journal of Society for development in new net environment in B&H

Thomson Reuters ISI web of Science,Science Citation Index-Expanded, Scopus

EBSCO Academic Search Premier, Index Copernicus, getCITED

HealthMED journal with impact factor indexed in:

HealthMED - Journal of Society for developm

ent of teaching and business processes in new net environm

ent in B&

H - Volum

e 5 / Num

ber 3 / 2011

EDITORIAL BOARD

Editor-in-chief Mensura Kudumovic Execute Editor Mostafa Nejati Associate Editor Azra Kudumovic Editorial assistant Jasmin Musanovic Technical editor Eldin Huremovic Members Paul Andrew Bourne (Jamaica) Xiuxiang Liu (China) Nicolas Zdanowicz (Belgique) Farah Mustafa (Pakistan) Yann Meunier (USA) Forouzan Bayat Nejad (Iran) Suresh Vatsyayann (New Zealand) Maizirwan Mel (Malaysia) Budimka Novakovic (Serbia) Diaa Eldin Abdel Hameed Mohamad (Egypt) Zmago Turk (Slovenia) Bakir Mehic (Bosnia & Herzegovina) Farid Ljuca (Bosnia & Herzegovina) Sukrija Zvizdic (Bosnia & Herzegovina) Damir Marjanovic (Bosnia & Herzegovina) Emina Nakas-Icindic (Bosnia & Herzegovina) Aida Hasanovic(Bosnia & Herzegovina) Bozo Banjanin (Bosnia & Herzegovina)

Address of the Sarajevo, Bolnicka BB Editorial Board phone/fax 00387 33 956 080

[email protected] http://www.healthmedjournal.com

Published by DRUNPP, Sarajevo Volume 5 Number 3, 2011 ISSN 1840-2291

HealthMEDVolume 5 / Number 3 / 2011


Sadržaj / Table of Contents

HealthMED journal with impact factor indexed in: - Thomson Reuters ISI web of Science, - Science Citation Index-Expanded, - Scopus, - EBSCO Academic Search Premier, - Index Copernicus, - getCITED, and etc.

Injury Epidemiology in a Safe Community HealthService Center in Shanghai, China ............................... 479Wang S, Zou J, Yin M, Yuan D, Dalal K

Neutropenia induction by vinorelbine alone and incombination with doxorubicin and cisplatin incancer patients ................................................................ 486Taha Nazir , Habib-Ur-Rehman, Owais Omar, Tahir Aziz Mughal

Postoperative meningitis and pre-existentneurosurgical disease ..................................................... 491Nada Koluder, Aida Pitic, Enra Lukovac, Amir Hadjic,Belma Gazibera, Lejla Dzananovic, Meliha Hadzovic Cengic

The association of Writer’s Cramp and CervicalPolyradiculopathy- accidental or causalrelationship? .................................................................... 495Zoran Peric, Irina Stojanovic, Stevo Lukic, Dejan Savic,Gordana Manic

Hyperandrogenism, Insulin sensitivity and Sonographic characteristics of Polycystic Ovary Syndrome (PCOS): Comparison between Nonobese and Obesereproductive women ....................................................... 501Elrmira Hajder, Midhat Hajder, Tarik Arapcic

Effect of bee venom (Apis mellifera) on thephagocytosis of peritoneal macrophages and onthe rise of life expectancy of Ehrlichtumor-bearing mice ........................................................ 509David Feder, André Neves Alves, João Roberto Beltramo, Luana Ap. Beltramo, Maria Gabriela P. Coriolano, Fabio F. Perazzo, Fernando L. A. Fonseca

Looking for winds of change with a PBL scenario about communication and empathy ........................................ 515Nazan Karaoglu, Muzaffer Seker

Functional electric stimulation of children withCerebral Palsy: a pilot study ......................................... 522Cila Demesi-Drljan, Aleksandra Mikov, Rastislava Krasnik,Dea Karaba-Jakovljevic, Karmela Filipovic,Snezana Tomasevic-Todorovic

Sadržaj / Table of ContentsEffects of physiotherapy on hemodynamic variables in newborns with Acute Respiratory Distress Syndrome ... 528Luiz Carlos de Abreu, Vitor E. Valenti, Adriana G. de Oliveira, Claudio Leone, Arnaldo A. F. Siqueira, Paulo R. Gallo, Fernando L. A. Fonseca, Viviane G. N. Simon, Paulo H. N. Saldiva

A new cell line detected in Mus musculus: Oct4 gene expression in mouse ear blastoma cell ......................... 535Parham Jabbarzadeh, Mohammadsadegh Amiri

Determination of the Anxiety Level of WomenWho Present for Mammography .................................. 543Nurgül Bölükbaş, Nülüfer Erbil, Azize Nuran Kahraman

Chlamydia Trachomatis – infections in women .......... 549Vera Jerant Patic, Vesna Milosevic, Ivana Hrnjakovic Cvjetkovic, Aleksandra Patic, Mirjana Bogavac, Deana Medic, Vera Gusman, Jelena Radovanov, Zelimir Eric

An investigation study on occupational stress and quality of life among the Chinese insurance practitioners ............ 557Ling Liu, Baojiang Chen, Pinyi Chen, Kunlin He, Yazhou Wu, Yanqi Zhang, Xiaohua Zhou, Dong Yi

Psychometric properties of the parents’ fevermanagement scale in a Turkish population ................. 567İnsaf Altun, Nursan Dede Cınar, Anne Walsh

The first documented case of loxoscelism inCentral Europe - Case report ........................................ 576Jan Hajer, Jaromír Hajer, Eva Plísková

Partial resection of the horseshoe kidney because ofUrolithiasis – perioperative complications .................. 583Svetlana Pavlovic, Jablan Stankovic, Slađana Zivkovic,Vladimir Milic

The effects of Two Sequential Earthquakes on Tuberculosis Patients: An Experience from Duzce Earthquake .......... 589Oner Balbay, Ege Güleç Balbay, Peri Arbak, Ali Nihat Annakkaya, Cahit Bilgin

Perirenal hematoma became bilateral ureteropelvicjunction obstruction after one month later:a case report .................................................................... 596Luo Yang, Xiang Li, Kun Jie Wang

Comparative analysis of Electromyoneurographicfindings in Alcoholic and DisulfiramPolyneuropathy ............................................................... 599Zoran Peric, Irina Stojanovic, Gordana Manic

Microscoping method in microbiologicaldiagnostic of amoebiasis and cyst-bearingEntamoeba histolytica .................................................... 604Sadeta Hamzic, Edina Beslagic, Ines Rodinis-Pejic,Fadila Avdic-KamberovicThe Relationship between mobbing andassertiveness in nurses ................................................... 609Ayşe Okanli, Sibel Asi Karakaş, Hava Özkan

Strength and endurance training does not leadto changes in major markers of oxidative stress ......... 616Tatjana Trivic, Patrik Drid, Miodrag Drapsin, Sergej Ostojic, Slavko Obadov, Izet Radjo

Ordu Women And Children’s HospitalEmergency Clinic to Applicant Evaluation ofChildren’s patients ......................................................... 621Nurgül Bölükbaş

Collection time of Thyroid hormones and TSHin preterm newborns ..................................................... 627Simone Holzer de Moraes, Silvia Espiridião, Fernando A. Fonse-ca, Luiz Carlos de Abreu, Vitor E. Valenti, Ricardo Peres do Souto

Relationship between Parental Smoking andRespiratory Illness in Infants ........................................ 633Ayşe Gürol, Cantürk Çapik, Serap Ejder Apay, Çiğdem Köçkar

Control and prophylaxis of gram negativenosocomial infections in the intensive care units ........ 639Svetlana Pavlovic, Natalija Vukovic, Biserka Ignjatovic, Vladimir Milic, Slobodan Ljubenovic, Zdenka Kalcic, Ivan Ignjatovic

Do Expectant Fathers Experience SympatheticPregnancy? ...................................................................... 643Hava Özkan, Ayşe Nur Aksoy

Perioperative Pain Comparison in Patients Undergoing Open versus Laparoscopic Cholecystectomy .............. 648Hodzic Enes, Imamovic Semir, Hasukic Sefik, Majdancic Husnija, Imamovic Goran, Iljazagic-Halilovic Fatima

Evaluation of the effect of physical therapy for kneeosteoarthritis using Womac index ................................ 654Dzevad Dzananovic, Nedima Kapidzic-Basic, Farid Ljuca, Sahza Kikanovic, Tatjana Nozica-Radulovic The usage of the antipsychotic drugs in the specificdifferent centers in Federation of Bosnia andHerzegovina ..................................................................... 660Svjetlana Loga-Zec, Saida Fisekovic, Slobodan Loga

Functional parameters of those suffering fromPosttraumatic Stress Disorder ...................................... 665Emir Tupkovic, Eldina Malkic Salihbegovic, Zumreta Planic

Impact of left Ventricular Hypertrophy on diastolicfunction in hemodialysis (HD) patients ........................ 671Arapcic Sedija

Understanding reading in persons with hearingimpairments .................................................................... 676Alma Huremovic, Dzevida Sulejmanovic

Antioxidative imbalance in patients withSchizophrenia .................................................................. 683Lilijana Oruc, Amra Memic, Lejla Burnazovic-Ristic

Indirect Immunofluorescence Test (IFT) andEnzyme Immunoassay (ELISA) in diagnosticof Hantavirus infections ................................................. 688Sadeta Hamzic, Edina Beslagic, Sukrija Zvizdic

Instructions for the authors ........................................... 695

HealthMED - Volume 5 / Number 3 / 2011

Journal of Society for development in new net environment in B&H 479

Abstract

The current study has investigated the injury epidemiology in a community health service cen-ter (CHSC) under a Safe Community in Shanghai, China. It was a cross sectional study with data ge-nerated from hospital records and ‘Injury Report Card’ (IRC). Open wounds constituted 571 (50.8%) injuries. Majority of the injuries (99.64%) did not need any hospitalization. Among the injured vic-tims, 59.16% were floating population and occu-pied in the manufacturing or transportation sector (31.49% of the injury), commercial services and farms. Finger, toes, head and face were most af-fected part of the body due to injuries. Mechanical objects and falls constituted nearly 95% causes of injuries. During start of working hours (9am) and during Wednesday and Thursday the frequencies of injuries were highest. In a WHO Safe Community program, injury epidemiology has great emphasize as it dwelled with proper scientific evidences of the injury etiologies. The study had identified some im-portant issues within its objected framework. Edu-cation and supervision of the floating workers can be effective for reducing injuries.

Key words: injury epidemiology, injury report card, China.

Introduction

Injury has been emerged as a major public he-alth problem worldwide. 1-5 Injury not only incurs ill-health, disability and deaths but also results se-

veral negative economic consequences. 6-8 Injuri-es consume a considerable amount of health care resources.5, 9, 10 It disproportionately affects low income countries. 11, 12 However, despite its deva-stating impact on individuals, societies and health budgets, injury still remains a neglected area, es-pecially in low and middle income countries. 5, 9, 12

According to World Health Organization (WHO) prediction, by the year 2020, injuries will be responsible for even more morbidity, mortality and disability, with significant socioeconomic im-pact on the developing countries.10 With a mortali-ty rate of 83.7/100,000 population, during the year 2000 an estimated 5 million people died worldwide from injuries accounting for 9% of the world’s de-aths and 12% of the world’s burden of disease. 13 The available statistics indicates that during 1999, injuries accounted for approximately 750,000 dea-ths and 3.5 million hospitalizations in China, resul-ting annual economic loss of 12.5 billion US dollars – almost four times that of the total public health services budget of China. 14, 15 Injury has become an important public health problem in China. 15

The World Health Organization (WHO) Mani-festo for Safe Communities states that “All human beings have an equal right to health and safety”. “A ‘Safe Community’ can be a: Municipality; a County; a City or a District of a City working with safety promotion, Injury-, Violence- and Suici-de- prevention and prevention of the consequen-ces (human injuries) related to Natural Disaster, covering all age groups, gender and areas and is a part of an international network of accredited programmes”. 16 The Safe Communities program

Injury Epidemiology in a Safe Community Health Service Center in Shanghai, ChinaWang S1, Zou J1, Yin M1, Yuan D1, Dalal K2

1 School of Public Health, “Key Laboratory of Public Health Safety, Ministry of Education”, Fudan University, Shanghai, China,2 Institute for Medicine and Health Sciences, Division of Social Medicine and Public Health Sciences, Linkoping University, Linkoping, Sweden

480



emphasizes on collaboration, partnership and co-mmunity capacity building to reduce the injury in-cidence and promote behaviours related to injury-reduction. Throughout the world approximately 200 (until 25 June 2010) communities have been designated as ’Safe Communities’, in countries as diverse as Sweden, Australia, China, Taiwan, Sou-th Africa, the Czech Republic and Serbia.

Safe Community has to fulfill the following six criteria:

1. An infrastructure based on partnership and collaborations, governed by a cross- sectional group that is responsible for safety promotion in their community;

2. Long-term, sustainable programs covering both genders and all ages, environments, and situations;

3. Programs that target high-risk groups and environments, and programs that promote safety for vulnerable groups;

4. Programs that document the frequency and causes of injuries;

5. Evaluation measures to assess their programs, processes and the effects of change;

6. Ongoing participation in national and international Safe Communities networks.

Safe Community program is almost 20 years in continuous progress. There are several indications that Safe Communities are effective to reduce inju-ries.17-20 However, those literatures are mainly from Nordic and Western Pacific countries suggesting more literatures from the developing countries such as China. 19 China has resorted the Safe Community movement for the last 10 years. Until June 2010, there are 33 safe Communities in China. To the best of authors’ knowledge there is lack of literature about Safe Community activities in China.

Shanghai has three levels of hospitals: First le-vel = Community Health Service Center; Second level = district level hospital and Third level = municipal level hospital which is most advanced in terms of equipments and HR. In Shanghai each community has one Community Health Service Center (CHSC). People can choose which hospi-tal they would like to visit the doctor. If they have severe health problem normally they prefer to se-cond or third level hospital.

The current study has investigated the injury epidemiology in a community health service cen-ter (CHSC) under a Safe Community in Shanghai, China.

Methods

It was a cross sectional study with hospital re-cords. So far for communities there are four possi-ble channels to get injury information at regular basis in Shanghai. The first one is vital registration system which provides population level data on causes of death on an annual basis.21 The second is CHSC as we did in this study. The third one is from police department including traffic injury and violence et al. The last one is from school or insurance company et al. In terms of general injury surveillance CHSC should have the first priority. First of all the data covers only its own commu-nity instead of covering many communities. Next CHSC is within the community it is much easier to establish long term cooperation and collaborati-on relationship to cover all kinds of injuries.

In Shanghai, every patient who visited the CHSC because of injury needed to answer que-stions from the ‘Injury Report Card’ (IRC), a user friendly questionnaire form. The trained nurse on duty interviewed the patient and then filled the form. The current study has extracted data from the injury report cards (IRC) for a period of two years from 1st January 2007 to 31st December 2008. (more details of IRC can be obtained from author upon request)

Statistical analysis

Data were presented in simple descriptive stati-stics. Micro Soft Excel software was used for data analysis.

Ethical issues

The study has used secondary anonymous data without revealing any personal information of the injury victims. Appropriate permission was obta-ined from the hospital authority for using the data for scientific analysis.



Results

In total 1124 persons were injured during two years study period. In the year 2007, there were 543 injury incidences while 581 were injured du-ring 2008. Number of male was 892 while female was 232, resulting a ratio of 3.84:1. The oldest per-son was 88.7 years old and the youngest was only several months old (average age 37.69±13.98, median age 36.95). Open wounds constituted 571 (50.8%) injuries. Majority of the injuries (99.64%) did not need any hospitalization while only four patients (0.36%) were hospitalized.

Productive age group 25-44 had highest pro-portions (57%) and 46-65 age group had 24% injuries. Among the injured victims, 59.16% were floating population. People working in manufac-

turing or transportation industry had accounted for 31.49% of the injured persons. Commercial ser-vices and farms had almost same level of injury incidences (table 1).

As indicated in table 2, among the study samples almost all (99.47%) had unintentional injuries. Indu-strial and constructed areas constituted for more than 50% injuries after home (22%). Considering physi-cal position of the human body, fingers and toes had highest level of injuries (48%) after head and face (20%), crura (16%) and shoulders/arms (14%).

Considering causes of injuries in table 3, the study indicated that mechanical force by various objects constituted almost 78% injuries after fall (18%). Other causes like motorized- and non-moto-rized traffic accidents, animal bites/pushes, burn and other causes constituted very few injuries (≤ 1%).

Table 1. Information about the injured personsIndividual Information Number of Person Percentage (%)

Age

<=5 20 1.785-14 18 1.6015-19 48 4.2720-24 92 8.1925-44 639 56.8545-64 267 23.75>=65 40 3.56

Type of household registration

Same district within which the community located 428 38.08

Other districts in Shanghai 25 2.22Out of Shanghai 666 59.25Unknown 5 0.44

Occupation

Manufacture/transportation 354 31.49Professional 193 17.17Commercial or service 133 11.83

Farmer 124 11.03Homemaker 56 4.98Retired 51 4.54Civil servant 33 2.94Children before shcool 29 2.58Unemployed 21 1.87School students 14 1.25Military 2 0.18Other/Unknown 114 10.14

482



Table 2. Injury characteristicsNumber of inured Percentage (%)

IntentUnintentional 1118 99.47Self-inflicted 3 0.27Intentional by someone else 3 0.27

Place of occurrence

Industrial or construction area 569 50.62Home 245 21.80Commercial area 103 9.16Residential area 70 6.23Street/highway 63 5.60School/ 53 4.72Farm/Field 12 1.07Sports and athletic area 5 0.44Other 4 0.36

Region of body

Finger and toe 534 47.51Head and face 224 19.93Crura 175 15.57Shoulder and arm 152 13.52Thorax 9 0.80Neck 8 0.71Other 8 0.71Nerve system 7 0.62Involving multiple body regions 7 0.62

Table 3. Causes of injury

Cause Number of injured Percentage (%) Accumulative number of injured

Mechanical force by object 872 77.58 872Fall 190 16.90 1062Non motor vehicle traffic accident 19 1.69 1081Mechanical force by animal 13 1.16 1094Motor vehicle traffic accident 10 0.89 1104Exposure or contacting heat or hot thing 10 0.89 1114Other 5 0.44 1119Suffocation/hanging 2 0.18 1121Drowning 1 0.09 1122Other transportation accident (ship et al) 1 0.09 1123Overwork/travelling/fatigue 1 0.09 1124



The study had investigated time of occurrence of injuries (figure 1 and 2). During January (44) and February (47) number of injuries were lowest while July (150) and August (138) had constituted highest numbers of injuries. Within 24 hours framework, injury incidences had a sudden jump at 0700am with continuous rise till morning 0900am (52 to 132 to 163). Then the incidences started to fall to 119 at 1000am to 19 at 1100am. The trend had another slightly upward movement to 51 at 1200 noon to 80 at 1300pm. After 1600pm the trend had continuous decrease (figure 1). During Wednesday the numbers of injuries was highest 192 (figure 2). The differences in injury incidences were visibly marked in Saturday (119) and Sunday (156).

Figure 1. Distribution of injury cases in 24 hours

Figure 2. Distribution of injury cases in a week

Discussion

The current study had investigated the injury epidemiology in a community health service cen-ter (CHSC) in designated Safe Community in Shanghai, China. In a WHO Safe Community pro-gram, injury epidemiology has great emphasize as it dwelled with proper scientific evidences of the injury etiologies. The study had identified some important issues within its objected framework.

Over half of the injured were not Shanghai citi-zens (59.25%). Most of the injured were working

in manufacture or transportation (31.49%) while majority of those injuries were happened in in-dustrial or construction area (50.62%). The most frequent activities during the injury occurrence was in work (62.01%). Hospital records revealed that mechanical force by object was the main ca-use (77.58%) of injury. Combining the informati-on above it may suggest that floating populations working in manufacture or transportation should be considered as the top priority when carrying out community injury prevention programmes. Because of the urbanization every year thousands of people from rural areas migrate to big cities like Shanghai and most of them work in industry or construction or service industry. In 2000 the floa-ting population people living for over half a year in Shanghai was around 2.99 million. By the end of 2008 this number went up to 5.17 million which might result two to three fold increase in injuries without any effective intervention.22 Other priori-ties suggested by this study included home safety and fall prevention. Therefore the study has pro-vided necessary information to the policy makers for effective planning for injury reduction.

The current study suggests two ways for floa-ting population injury prevention:

- Education: because of low awareness on risk factors and injury outcomes which leads to risk behavior during working, for example not wearing helmet.

- Supervision: in one side to strength the supervision of worker to follow the safety rules; in the other side to strength the supervision of the working site including identification of risk environments and beha-viors, checking establishments regularly.

Since China is such a big country it is under-standable that each region, each city or each com-munity should have different priorities regarding injury prevention. So CHSC based injury surve-illance will definitely play very important role in this regard. But obviously it is not enough by just using the data from CHSC. The disadvantages of CHSC based data are the mortality cases are not available. And the severe injures normally are sent to first or second level hospital. Some local people they prefer to visit more advanced hospitals when they get any kind of medical issues.

484



So the ideal way is to work together of diffe-rent sectors and departments and to combine the four possible resources which is also one of the requirements to become the member of interna-tional safe community member. If allowed hou-sehold survey can be one of the options as well. However, in that case, recall bias and expensi-ve interview techniques should be considered.23 The current study has presented the injury epide-miology in a designated safe community in China. Studies from Europe and Australia indicate a strong decline of injuries in their designated Safe Communities and also highlighted effectiveness of injury reduction under different social strata. 17-

19 The current study warrants such epidemiologi-cal (both cross sectional and longitudinal) studies from different Safe Communities in China, which not only help the policy makers also reduce the economic burden of the society by saving direct and indirect costs of injuries.

Reference

1. Smith GS, Barss P. Unintentional injuries in develo-ping countries: the epidemiology of a neglected pro-blem. Epidemiologic Reviews.1991;13: 228–266.

2. World Health Organization. Global medium term programme 1990–95 (Program 8.3). Accident pre-vention. WHO: Geneva, 1988.

3. World Health Organization. Handle life with care. Information kit: Prevent violence and negligence. 7 April, World Health Day. WHO: Geneva, 1993.

4. Alptekin F, Uskun E, Kisioglu AN, Ozturk M. Unin-tentional non-fatal home-related injuries in Central Anatolia, Turkey: Frequencies, characteristics, and outcomes. . 2007; 39(5): 535–546.

5. Dalal K, Rahman A.Out-of-pocket payments for unintentional injuries: a study in rural Bangladesh. Int J Inj Contr Saf Promot. 2009;16(1):41-7.

6. World Health Organization. The economic dimen-sions of interpersonal violence. WHO: Geneva, 2004.

7. Dalal K, Jansson B. Cost calculation and econo-mic analysis of violence in a low-income country: a model for India. African Safety Promotion. 2007; 5(1): 45–56.

8. Hadley J. Insurance coverage, medical care use, and short-term health changes following an unin-tentional injury or the onset of a chronic conditi-on. Journal of the American Medical Association. 2007; 297(16):1773–1784.

9. Krug E, Sharma GK, Lozano R. The global burden of injuries. American Journal of Public Health. 2000; 90(4): 523–526.

10. Z. Zhao and L. Svanström, Injury status and per-spectives on developing community safety pro-motion in China. Health Promot Int. 2003; 18: 247–253.

11. Krug E. et al. World report on violence and health. WHO,Geneva. 2002.

12. Peden M, McGee K, Krug E. Injury: a leading ca-use of the global burden of disease 2000. WHO, Geneva. 2002.

13. Peden M, McGee K, Sharma G. The injury chart book: a graphical overview of the global burden of injuries. Geneva, WHO. 2002.

14. Zhou Y, Baker TD, Rao K, Li G. Productivity losses from injury in China. Inj Prev 2003, 9(2):124-127.

15. Ma J, Guo X, Xu A, Zhang J, Jia C. Epidemio-logical analysis of injury in Shandong Province, China. BMC Public Health.2008; 8:122.

16. http://www.phs.ki.se/csp/who_safe_communiti-es_en.htm. Accessed, Aug 15 2010.

17. Lindqvist K, Dalal K. The impact of child safety promotion on different social strata in a WHO Safe Community. Journal of Injury and Violence Research. 2010 (online first)

18. Lindqvist K, Timpka T, Schelp L. Ten years of experiences from a participatory community-ba-sed injury prevention program in Motala, Sweden. Public Health 1996;110:339–46.

19. Spinks A, Turner C, Nixon J, McClure RJ. The ’WHO Safe Communities’ model for the preven-tion of injury in whole populations. Cochrane Database of Systematic Reviews 2009, Issue 3. Art.No.: CD004445. DOI: 10.1002/14651858.CD004445.pub3.

20. Svanström L, Ekman R, Schelp L, et al. The Lidkö-ping Accident Prevention Program - a community approach to preventing childhood injuries in Swe-den. Injury Prevention 1995;1:169–72.



21. Yang G, Hu J, Rao KQ, Ma J, Rao C, Lopez AD. Mortality registration and surveillance in China: history, current situation and challenges. Popul Health Metr. 2005; 3: 3.

22. Shanghai Municipal Government. Shanghai Statistical Yearbook. http://www.stats-sh.gov.cn/2004shtj/tjnj/tjnj2009.htm#. Accessed, August 5, 2010.

23. Harel Y, Overpeck MD, Jones DH, Scheidt PC, Bijur PE, Trumble AC, Anderson J: The effects of recall on estimating annual nonfatal injury rates for children and adolescents. Am J Public Health. 1994; 84(4):599-605.

Corresponding author Wang S., School of Public Health, “Key Laboratory of Public Health Safety, Mini-

stry of Education”, Fudan University, China, E-mail: [email protected]

486



Abstract

Neutropenia is a kind of leukopenia associa-ted with shortage of neutrophils. It is included by myelotoxic drugs, acute infectious stress and le-ukemia. The anticancer drugs beside cancer trea-tment have the deleterious effects on the metabo-lism and vital organs. These drugs could damage the blood producing cells of bone marrow and re-duce the neutrophils counts resulting in increased chance of infection. This study aimed to investi-gate the alterations in neutrophilic count in can-cer patients and was administered vinorelbine as part of their chemotherapy. A total 60 adult cancer patients were randomly divided in to two groups; Group-1 received the treatment of Vinorelbine alone and group 2 patients on Vinorelbine base combinations. Results showed significantly lower potential of neutropenia induction in the patients on vinorelbine alone (p value <0.001) as compare with the patient received vinorelbine based combi-nations (p value 0.021). The comparison of mean values of these two groups at every week indica-ted higher chance of neutropenia at week-3 in the patients receiving vinorelbine based combinations (Mean ±SEM: 1.8180±0.3018, p value 0.118). The mean neutrophils counts before therapy were si-gnificantly lower than that of after therapy in both of the groups (p values during weeks 0-4: 0.742, 0.208, 0.425, 0.048, and 0.791). However, among the groups, the potential for induction of neutro-penia is similar. Thus; in conclusion, there is no significant difference in the overall neutropenia in both of the chemotherapy protocols. The clinical oncologist, consultant physician and pharmacist, can select either of the treatment plan.

Key words: Neutropenia, Vinorelbine, Cispla-tin, Doxorubicin, breast cancer and NSCLC

Introduction

Neutropenia is a hematological disorder cha-racterized by an abnormally low number of ne-utrophils. Neutrophils usually make up 50-70% of circulating white blood cells and serve as the primary defense against infections. The causes of neutropenia are either problems in the production by the bone marrow or destruction elsewhere in the body. It affects as many as one in three patients receiving chemotherapy for cancer. Neutropenia can be a serious crisis requiring quick attention. Without proper medical care, patients may find it hard to lead normal lives especially neutropenic sepsis can be life threatening (Neutropenia Sup-port Assoc. Inc. 2010).

Moreover; there are several types of neutrope-nia; the cyclic neutropenia is an autosomal domi-nant disorder of unknown etiology in which 3-6 days of neutropenia occur every 21-30 days in a periodic pattern. During the periods of neutrope-nia the patient may develop fever and infections such as stomatitis, cellulitis, and vaginitis. There appears to be some abnormality of feedback mec-hanisms. Chronic idiopathic neutropenia is a dis-order in which the neutrophil count is less than 1.0 x 109/L, but results in few infections (Pathology, 2010).

In addition to that; the drug-induced neutrope-nia also is caused by four mechanisms: a) drugs induce cytolysis cause marrow depression and aplastic anemia (alkylating agents, inhibitors of

Neutropenia induction by vinorelbine alone and in combination with doxorubicin and cisplatin in cancer patientsTaha Nazir1, Habib-Ur-Rehman2, Owais Omar2, Tahir Aziz Mughal3

1 Department of pharmacy, University of Sargodha, Pakistan,2 University of Veterinary & Animal Sciences, Pakistan,3 Shaukat Khanum Memorial Cancer Hospital & Research Centre, Pakistan



mitosis, DNA depolymerizors, ionizing radiation). b) impairment of DNA synthesis (phenothazines, chloramphenicol, methotrexate, hydroxyurea, azothioprine, cytosine arabinoside, and 6-mercap-topurine). c) Ideiosyncratic reactions (chloramp-henicol, gold salts, phenylbutazone, thiazides, sulfonamides, quinine, procanamide). d) immuno-logic neutropenia, the drug and neutrophil surfa-ce protein form an antigenic complex. Antibody is produced against this complex and remains inactive in the plasma. When this drug is given it interacts with neutrophil surface protein and com-plexes antibody. This causes leukoagglutiation or activation of complement (Pathology, 2010). The initial symptoms of neutropenia begin after 1-3 days with malaise, chills, sore throat, fever. Later easy fatigability and weakness are seen. Infection is the most serious consequence of neutropenia. Neutropenia less than 1.0 x 10 9/L seriously com-promises the ability to fight infection. Agranulo-cytosis (< 0.5 x 10 9 /L) may lead to death within days due to overwhelming infection.

Cancer is treated stereoscopically in certain sta-ges with abundant agents (Perry, 1996). Vinorelbi-ne, cisplatine and doxorubicin are major drugs gi-ven for breast, cervix and non-small cell lung can-cer. Vinorelbine is semi-synthetic vinca alkaloid obtained from the rosy periwinkle, Catharanthus roseus. Cisplatin/ cisplatinum/ cis-diamminedic-hloroplatinum is a platinum-based drug employ for sarcomas, carcinomas, lymphomas and germ cell tumors. Platinum complexes react in vivo, binding to and causing crosslinking of DNA whi-ch ultimately triggers apoptosis (programmed cell death). Doxorubicin is an anthracycline antibiotic and works by intercalating DNA. It was originally isolated from bacteria found in soil samples taken from Castel del Monte, an Italian castle in 1950’s. It is used in the treatment of wide range of cancers, many types of carcinoma and soft tissue sarcomas.

Thus; we have aimed this project, to evaluate the neutropenia induced by vinorelbine alone and in combinations with these three widely used anti-cancer drugs. This may help to evaluate the thera-peutical credibility of treatment plans.

Materials and methods

The study was conducted at Shaukat Khanum Memorial Cancer Hospital & Research Center (SKMCH&RC), M.A Johar town, Lahore, Pakistan to investigate the changes in neutrophil count of adult cancer patients with Non small cell lung can-cer, metastatic breast cancer, and of cervix, treated with Vinorelbine alone, Vinorelbine/ Doxorubicin and Vinorelbine/Cisplatin treatment protocols.

Study Design

These patients were selected from outpatient department (OPD) of SKMCH&RC who were di-agnoses as breast cancer, NSCLC and cancer of cervix belong to any age group, had ether sex and consented for this study. An exclusion criterion is involvement of patient in any other study. A total 60 cancer patients were divided into two groups; Group-1 comprising of patient received vinorelbi-ne as single therapy and Group-2 having the can-cer patients on treatment protocol of vinorelbine based combinations i.e. Vinorelbine/ Cisplatin or vinorelbine/ Doxorubicin (Table1).

Preparations of Standard Regimen of Chemotherapeutical Agents

The standard treatment regimen for vinorelbine, cisplatin and doxorubicin is reported by Nazir et al, 2009. The vinorelbine was administered 25 mg/ml on day 1, weekly 4, i/v, with 045% sodium chlori-de or 5% glucose solution as diluents and delivered over intravenous push (IVP) (Kubota K., 2000). The injected dose infused over a short period -15 to 20 minutes (Reynald, et al 1996). In combination therapy the dose of Vinorelbine was decreased and administer as 20 mg/ml on day 1, 8 I/V with dilu-ent day 5 ½ normal saline and delivered over IVP. The Doxorubicin was given as 50 mg/m2 on day 1 only (Fauzia 2000). Doxorubicin was administe-red slowly in to tubing of freely running infusion of Sodium Chloride 0.9% or Glucose 5%. (USPDI, 1997). The Cisplatin was administered intra-veno-usly as 40mg/ml on day 1 only, with the diluent of day 5 ½ NS and delivered over IVP.

488



Sample Collection and Neutrophils Count: The 3ml of blood samples were drawn from

brachial veins in 5 cc disposal syringes and tran-sferred to appropriately labeled (complete blood count (C.B.C) vials containing 20 w/v of EDTA. The neutrophils count was performed using a com-puterized auto-analyzer (Technicon 113, Bayer Laboratories USA) at the Pathology laboratory, SKMCH&RC.

Data Analysis

The means of two groups were compared by student t-Test to avoid the consistent deviation of analytical results or systematic errors in the proce-dure. ANOVA used to identify any factor influen-cing the test results.

Result and discussion

The effect of different treatment on neutrophils is given in Table 1. On week 1, 2 and 4 of the trea-tment no significant difference in neutropenia was observed. However as shown by the neutrophils count on week 3, significant potential for neutro-penia was observed in the patients on treatment protocol of vinorelbine alone and vinorelbine ba-sed combinations. When the mean neutrophils co-unt before therapy (Week 0) were compared with that of after therapy (week 4), there a significant decrease was noted in the patients on treatment protocol of vinorelbine alone only.

The finding of this study are in line with the work of Dorr et al (1994), who reported the neu-tropenia, which have the dose limiting toxic effect of oral Vinorelbine. Kondo et al., (1999) reported

neutropenia as a major adverse effect of cancer chemotherapy and sometimes causes life-thre-atening events. The present study was therefore conducted to identify risk factors for such neutro-penia. Forty patients who had received chemothe-rapy at 3- or 4-week intervals for advanced lung cancer analyzed retrospectively. Thirty-seven of the patients had received cisplatin-based chemot-herapy. The mean monocyte counts on days 6 to 8 in the 32 patients with grade 3 or 4 neutropenia (5,181 +/- 1,830/microl and 87 +/- 84/microl, res-pectively) were significantly lower than those in the eight patients with grade 1 or 2 neutropenia (7175 +/- 1671/microl and 248 +/- 127/microl, respectively; p = 0.008 and p = 0.0001). Moreo-ver, all 30 patients with a monocyte count of less than 150/microl on days 6 to 8 had grade 3 or 4 neutropenia and 8 of 10 patients with a monocyte count of 150/microl or higher on days 6 to 8 had grade 1 or 2 neutropenia, despite the absence of a correlation between the leukocyte count on days 6 to 8 and the neutrophil nadir. We conclude that a monocyte count of less than 150/microl on days 6 to 8 may be a predictor of grade 3 or 4 neutropenia during cancer chemotherapy at 3- or 4-week inter-vals (sensitivity 94%, specificity 100%).

Figure 1. Mean Neutrophils count (in 000) Vs time (in weeks)

Table 1. The chemotherapy protocols follow up schedule and cancer site of experimental patients

Group Sample size Chemotherapy protocol Patient neoplasm type Chemotherapy

schedule (days)Follow up

schedule (days)

G- I 45 VinorelbineMetastatic breast cancer 1, 7, 14, 21 6, 13, 20, 28NSCL Cancer 1, 7, 14, 21 6, 13, 20, 28

G-II 15Vinorelbine/ Doxurubicin Metastatic breast cancer 1, 8 7, 15

Vinorelbine/ CisplatineNSCL Cancer 1, 8 7, 15Cervix Cancer 1, 8 7, 15



The study under discussion also supported by the work of Marty et al. (1989),who concluded the leucopenia as noncumulative and of short duration (<7 days). Shamseddine et al, (1999), reported the acceptable hematological toxicities of Cisplatin and Vinorelbine in combination therapy having.

In conclusion, there were insignificant diffe-rences observed in the overall hematological toxi-cities of both of the chemotherapy protocols. The clinical oncologist, consultant physician and phar-macist therefore can select either of the protocol to provide maximum relief to patients. Moreover the therapeutical efficacy should probably constitute the overall consideration while treating the parti-cular neoplasm.

References

1. Bruce A. Chabner, Thomas J. Lynch, Dan L. Longo (2008), Harrison’s manual of oncology, McGra-Hi-ll Grill Companies Inc., USA

2. Dorr T.R, Daniel D, and Hoffvon(1994), Cancer Chemotherapy Handbook, Appleton & Lange, USA, PP 286-292, 395-406, & 556-568

3. Fauzia (2000), The Chemotherapy Source Book, (Un-Published). Chemotherapy of Breast Cancer, Lung Cancer Chemotherapy, Pathology Labora-tory, Shaukat Khanum Memorial Cancer Hospital and Research Center, M.A. Johar Town, Lahore, Pakistan

4. Kondo M, Oshita F, Kato Y, Yamada K, Nomura I, Noda K (1999). “Early monocytopenia after che-motherapy as a risk factor for neutropenia”. Am. J. Clin. Oncol. 22 (1): 103–5.

5. Kubota K., (2000), Vinorelbine in the treatment of non-small cell lung cancer and breast cancer, Gan to kagaku Ryoho, 27(8): 1301-6

6. Marty M., Extra J.M., Espie M. (1989), advances in vinca alkaloids: vinorelbine, Nouv Rev Fr Hematol. 31:77, 84

7. Neutropenia Support Assoc. Inc. (2010) P.O. Box 243, 971 Corydon Ave. Winnipeg, MB, Canada R3M 3S7 Toll Free (Canada & U.S.)1-800-6 NEU-TRO http://www.neutropenia.ca/

Table 2. The mean ±SEM Neutrophils count (×103) per µl, Pre and post chemotherapy of cancer pati-ents on the treatment protocol of vinorelbine (Group I), vinorelbine based combinations (Group II) and overall total (60) patients

Time (week) Vinorelbine (Group-I) Vinorelbine in

combination (Group-II) Overall P value3

Mean SEM Mean SEM Mean SEMWeek 0 4.3361 0.32614 4.13133 0.48979 4.2822 0.27076 0.742Week 1 2.68023 0.208617 2.13 0.42235 2.5379 0.190063 0.208Week 2 1.87195 0.304722 2.344 0.497071 1.9983 0.258998 0.425Week 3 2.8 0.258624 1.818083 0.301872 2.5577 0.216248 0.048Week 4 2.01666 0.30368 2.17777 0.420667 2.05384 0.250712 0.791P value1 <0.001 0.021 <0.001P value2 <0.001 0.118

P value1 Overall comparison of mean values over time P value2 Independent comparison of mean values for two groups at every weekP value3 Comparison of mean values observed before therapy with that of at week 4

490



8. Pathology, (2010), University of Virgenia, College of Medicine, University of Virginia School of Me-dicine PO Box 800793, Charlottesville, VA 22908, 434-924-5118 http://www.med-ed.virginia.edu/co-urses/path/innes/wcd/leukopenia.cfm

9. Perry C. M. (1996), the Chemotherapy Source Book, 2nd Edition, William & Wilkins. Awaverly Company, USA p3-4, 19-20

10. Reynold P., Parfitt F.J., Parsolf. C., Martindal V.N (1996), Martindale, the extra pharmacopoeia, 31st Ed., Royal Pharmaceutical Society, London, UK pp 607

11. Romero Acu-na, Langhi L., Perez M., Romero J., Machiavelli J., and Lacava J. (1999), Vinorelbine and Paclitaxal as first line chemotherapy in me-tastatic breast cancer; Clin Oncol, 17(1): 74-81

12. Shamseddin A.I., Taher A., Dabaja8 B., Dandashi A., Salem Z and Saghir E.L. (1999), Combination Cisplatine – Vinorelbine for relapse and chemot-herapy – pretreatment metastatic breast cancer, AMI Clin Oncol, 22(3): 298-302

13. Subramanyan S., Abeloff M.D., Bond S.E., David-son N.E., Fetting J.H., Gordon G.B. and Kennedy MJ. (1999), A phase I/ II study of vinorelbine, doxorubicin and methotrexate with leucovorin rescue as first line treatment for metastatic breast cancer, cancer chemother Phyarmacolo, 43(6): 497-502

14. USPDI (United State Pharmacopoeia & Drug Information) (1997), advice for patient drug in-formation in lay language (Part I & II), 17th Edi-tion, (1997), 12601 Tein Book Parkway, Rockville Maryland, 20852 p. 719-21, 1281-1287

Corresponding authorHabib-Ur-Rehaman,Dept. of Physiology,University of Veterinary & Animal Sciences, Pakistan,E-mail: [email protected]



Abstract

Postoperative meningitis (POM) is a major problem in neurosurgery. Risk of development of POM as nozocomial infection is greater in pati-ents having some form of pre-existent neurosur-gical disease, demanding operative treatment. Precipitating factors in POM development may be patient’s sex and age.

This retrospective study analyzed 78 patient’s histories with clinical signs and laboratory findin-gs indicative of POM, grouped in 4 categories ba-sed on neurosurgical diagnosis (intracranial hae-morrhage – ICH, trauma, tumour, hydrocephalus) and operative treatment.

Out of 4,112 patients having neurosurgical treatment in period of four years, there were 78 cases of POM, meaning the incidence is 1.89%. The results were statistically significant in relati-on to categories based on neurosurgical diagno-sis (Chi-square=18.947; p<0.001). Sex difference in categories based on neurosurgical diagnosis is also statistically significant (Chi-square=9.34; p<0.03). In relation to patients’ mean age, the re-sults were statistically significant in category with diagnosis of ICH-Trauma (T-test= 4.164; p<0.01) and ICH-Tumour (T-test=2.182; p<0.05).

Pre-existent neurosurgical disease and opera-tive treatment related to it might precipitate de-velopment of POM, but factors such as age and sex might also play a role in some categories of patients.

Key words: postoperative meningitis, pre-exi-stent neurosurgical diseases

Introduction

Postoperative meningitis (POM) is dangero-us and life-threatening nozocomial infection fo-llowing neurosurgical treatment, increasing po-stoperative morbidity and mortality. Although the percentage of POM development in neurosurgical patients is relatively small, most authors consider this problem requires full attention and seriousne-ss in its approach (1-4). There are many risk fac-tors precipitating this postoperative complication. This primarily refers to operative treatment on pa-tients with pre-existent neurosurgical disease and postoperative treatment in intensive care units. As same anatomical location, together with pathop-hysiological and mechanical changes, can result in or anticipate damage, in order to better understand neurosurgical diagnoses and indications for opera-tive treatment, patients are grouped in categories with similar characteristics (5, 6). These are ICH, trauma, tumour, hydrocephalus (6-9).

Objective

The objectives of this study was to:1. determine the occurrence of POM in

neurosurgical patients hospitalized at Clinic for Neurosurgery, Clinical Centre University of Sarajevo and

2. investigate the influence of pre-existent neurosurgical disease and associated operative treatment on POM development.

Postoperative meningitis and pre-existent neurosurgical diseaseNada Koluder1, Aida Pitic2, Enra Lukovac1, Amir Hadjic1, Belma Gazibera1, Lejla Dzananovic3,Meliha Hadzovic Cengic1 1 Infectious Disease Clinic, Clinical Centre University of Sarajevo, Bosnia and Herzegovina2 Merck Sharp Dohme Idea AG, Sarajevo, Bosnia and Herzegovina3 Institute of Epidemiology and Biostatistics, Medical Faculty, University of Sarajevo, Bosnia and Herzegovina

492



Patients and methods

This retrospective study lasted from 01 Jan 2005 until 31 Dec 2008 and analyzed 78 patient’s histories with pre-existent neurosurgical disea-se treated operatively who had clinical signs and laboratory findings indicative of POM. Patients were analyzed regarding their pre-existent neuro-surgical disease; patients were grouped in 4 cate-gories based on neurosurgical diagnosis: 1. intra-cranial haemorrhage – ICH, 2. trauma, 3. tumour, 4. hydrocephalus. Analysis was conducted com-paring these groups among each other.

Results

At Clinic for Neurosurgery, Clinical Centre Uni-versity of Sarajevo, from 01 Jan 2005 to 31 Dec 2008, there were 4,112 hospitalized patients deman-ding neurosurgical treatment. Out of those 4,112 pa-tients, POM was confirmed in 78 cases, based on clinical, laboratory and microbiological findings, meaning the incidence of POM is 1.89% (Table 1).

Table 1. Occurrence of POM among patients un-der studyPatients treated operatively 4,112Patients with POM 78Incidence of POM (%) 1.89

The results were statistically significant in rela-tion to categories based on neurosurgical diagnosis (Chi-square=18.947; p<0.001). Sex difference in categories based on neurosurgical diagnosis is also statistically significant (Chi-square=9.34; p<0.03). Among patients in category “Trauma” there were 17 patients with statistically significant sex distribu-tion difference (M : F = 34.09% : 5.88%) (Table 2).

In analysis of neurosurgical diagnosis distribu-tion among total number of patients with POM, regarding patients’ mean age, the results were statistically significant in category with diagno-sis of ICH-Trauma (T-test= 4.164; p<0.01) and ICH-Tumour (T-test=2.182; p<0.05), and not statistically significant in category Trauma-Tu-mour (T-test=1.114) and ICH- Hydrocephalus (T-test=3,100; p<0,5) (Table 3).

Table 2. Distribution of patients with POM by diagnosis* and sex (N=78)

DiagnosisMales Females Total

Number Percentage Number Percentage Number Percentage

ICH 19 43.18 16 47.06 35 44.87Trauma 5 34.09 2 5.88 17 21.79Tumour 4 9.09 9 26.47 13 16.67

Hydrocephalus 6 13.64 7 20.59 13 16.67Total 44 100.00 34 100.00 78 100.00

* pre-existent neurosurgical diagnosis

Table 3. Distribution of patients with POM by diagnosis* and age (N=78)Diagnosis Number of patients Age-range (min-max) Mean age (yrs) SD

ICH 35 15-89 55.73 14.51Trauma 17 5-78 32.24 22.51Tumour 13 <1-58 41.72 23.47

Hydrocephalus 13 <1-60 18.76 22.63Total 78 <1-89 42.16 23.86

* pre-existent neurosurgical diagnosis



Discussion

Postoperative meningitis is a major problem in neurosurgery, as infection occurrence increases postoperative morbidity and mortality. Literature citations emphasize the need of follow-up of ne-urosurgical patients in their postoperative period (1-4, 10).

At Clinic for Neurosurgery, Clinical Centre University of Sarajevo, from 01 Jan.2005 to 31 Dec 2008, there were 4,112 hospitalized patients demanding neurosurgical treatment. Out of those 4,112 patients, POM was confirmed in 78 cases, meaning the incidence of POM is 1.89% - far less from the incidence in similar neurosurgical clinics in USA where the incidence of POM is 5%-7%, although the real incidence is believed to be much greater than this (1), compared to the incidence of POM in other environments (8, 11). This differen-ce in POM incidence might be related to better di-agnostic and therapeutic methods in highly speci-alized hospital facilities in which POM incidence was recorded.

All literature citations on this problem recor-ded POM incidence among both sexes, which was almost equal and in most cases not related to sex distribution. Tudor followed the incidence of POM after craniocerebral war injuries and found the distribution in favour of male sex (12). Similar results were reported from Taiwan civil-war hos-pital (7).

In relation to age distribution, the youngest pa-tient included in this study, who developed POM after neurosurgical treatment on brain tumour, was 14 days old, and the oldest patient, having ICH, was 89 years old. The highest mean age was in category of ICH (56.66 yrs), confirming the rela-tion of age to CNS haemorrhage, as a consequen-ce of blood vessel changes during life. Although ICH surgery is believed to be a “clean” surgery, we confirmed that haemorrhage and haematoma development means the risk of secondary con-tamination and infection occurrence, which was also confirmed by Brown (13). The mean age in category “Trauma” is 32.24 years, with occurren-ce of POM statistically significant greater in male sex. Male sex activities compared to activities in females is related to a greater risk of traumatism, which is confirmed in this study, but also in the

studies of Erdem, who showed the relation of traf-fic accidents to male sex and younger age (8). The mean age in category “Tumour” is 42.69 years, as expected regarding the relation of this diagnosis to broader age spectrum. In category “Hydrocep-halus”, most patients are children demanding the reduction of intracranial pressure by implanting the liquor drainage system. In adults, the need for drainage systems revisions, implanted after ICH, trauma, tumour or inflammation, is not a rare in-dication for neurosurgical operation. This is the reason literature cites smaller mean age in this diagnostic category, compared to other categories which are indication for neurosurgical treatment. Nejat et al. reported that mean age of patients with VP-shunt infections of younger age is 15 months and showed no correlation among sex, time of VP-shunt implantation and length of hospitalization, although the presence of foreign body is indeed a risk factor for infection development (14). In this study, the mean age in category “Hydrocephalus” was 18.76 years.

Analysis of diagnosis distribution in patients who developed POM in relation to their age, the results were statistically significant only in catego-ries “ICH-Trauma” (p<0.01) and “ICH-Tumour” (p<0.05).

Conclusions

At Clinic for Neurosurgery, Clinical Centre University of Sarajevo, from 01 Jan 2005 to 31 Dec 2008, the incidence of POM was 1.89%.

There is a highly statistically significant rela-tion among diagnostic categories of patients and POM development (p<0.001).

Depending on diagnosis, there is a statistically significant relation among sex distribution and POM development (p<0.03).

In relation to mean age, the results are stati-stically significant in some categories of patients (“ICH-Trauma” (p<0.01) and “ICH-Tumour” (p<0.05).

494



References

1. McClelland S, Hall WA. Postoperative central ner-vous system infection: incidence and associated factors in 2111 neurosurgical procedures. Clin In-fect Dis 2007; 45 (1):55-59.

2. Wagner MT, Andre GM, Hamilton M, Jose PP. CSF markers for diagnosis of bacterial meningitis in neurosurgical postoperative patients. Arq Neurop-siquiatr 2006;63(3):275-282.

3. More JA, Newell WD. Neurosurgery. London: Springer Verlang Limited, 2005.

4. Božinović D. Akutni meningitis. In: Begovac J, Bo-žinović D, Lisić M, Baršić B, Schonwald S. Infekto-logija. Zagreb:Profil;2006:228-254.

5. Barker F. Efficacy of prophylactic antibiotic thera-py in spinal surgery: a meta analysis. Neurosurgery 2003; 51(2):391- 400.

6. Nagulić I. Metode ispitivanja neurohirurških bole-snika. In: Neurohirurgija. 2. proš. i preur. izd. Beo-grad: Institut za stručno usavršavanje zdravstvenih radnika; 1975:1-58.

7. Ho YH, Wang LS, Chao KC, Su CF. Successful treatment of meningitis caused by multidrug-resi-stant Acinetobacter baumannii with intravenous and intratecal colistin. J Microbiol Immunol In-fect.2007;40(6):537-40.

8. Erdem I, Hakan T, Ceran N, Metin F, Senbayrak A.S, Kucukerkan M, Berkman MZ, Goktas P. Clini-cal features, laboratory data, management and risk factors that affect mortality in patient with posto-perative meningitis. Neurol India 2008; 56(4):433-437.

9. Beer R, Lackner P, Pfausler B, Schmutzhard E. No-socomial ventriculitis and meningitis in neurocriti-cal care patients. J Neurol 2008; 255(11): 1617-24.

10. Huttova M, Freybergh PF, Rudinski B, Sramka M, Kisac P, Bauer F, Ondrusova A. Postsurgical me-ningitis caused by Acinetobacter boumannii asso-ciated with high mortality. Neuroendocrinology Letters 2007; 28(2):15-16.

11. Korinek AM, Baugnon T, Golmard JL, van Ef-fenterre R, Coriat P, Puybasset L. Risk factors for adult nosocomial meningitis after cranioto-my; role of antibiotic prophylaxis. Neurosurgery 2006;62(2):532-9.

12. Tudor M, Tudor L, Tudor KI. Complications of mi-ssile craniocerebral injuries during the Croatian Homeland War. Mil Med 2005; 170(5):422-6.

13. Brown ME. Infectious in Neurosurgery. Drugs 2002; 62(6):909-9134.

14. Nejat F, Tajik P, El Khashab M,Kazmi SS, Khotaei GT, Salahesh S. A randomized trial of ceftriaxon versus trimetoprim-sulfamethoxazole to prevent ventriculoperitoneal shunt infections. J M Micro-biol Immunol Infect 2008;41(2):112-7.

Corresponding author Nada Koluder, Infectious Disease Clinic, Clinical Centre University of Sarajevo, Bosnia and Herzegovina, E-mail: [email protected]



Abstract

Introduction: Writer’s cramp (WC) is a focal dystonia involving the hand and/or arm muscles, causing abnormal posturing of the hand when writing. There are many studies and articles abo-ut WC in the literature, particularly about central nervous system (CNS) function changes in WC, but the possible role of peripheral nervous system (PNS) function changes in complex etiopathoge-nesis of WC has not been precisely defined yet.

Case presentation: We presented male, 60 ye-ars of age, civil engineer, right handed, with WC. In neurological examination, except focal right hand dystonic manifestation, other abnormalities were not registered (primary dystonia). Electroen-cephalography and endocranium imaging findings were normal. Electromyoneurography (EMNG) examination indicated lesion of right C5,C6 and C8 radices with preserved function of C7 radix, denervation activity as a consequence of C5 radix injury and also signs of current C8 radix iritation. Magnetic resonance (MR) finding of cervical spi-ne indicated cervical polydiscopathy (C3-C4, C4-C5, C5-C6 and C6-C7).

Conclusion: In patients with WC, registration of cervical polyradiculopathy signs is often acci-dental finding, but in some cases cervical polyra-diculopathy (specialy C5,C6,C8 polyradiculopat-hy, with preserved function of C7 radix) might be associated with WC and althought underlying pat-hophysiological mechanisms are not known yet, it could be considered as potential risk or trigger fac-tor in predisposed subjects. We suggest EMNG of arm (hand) muscles and nerves and MR cervical

spine examinations in all patients with WC, besi-des others examinations. Further investigations of this problem is necessary.

Key words: writer’s cramp, cervical polyradi-culopathy, electromyoneurography

Introduction

Writer’s cramp (WC), also known as graphos-pasm, la crampe des ecrivains, or scrivener’s palsy, is a focal dystonia involving the hand and/or arm muscles, causing abnormal posturing of the hand when writing; it is the most common of the task-specific dystonias, once known as ‘craft palsies’ (1). Other autors defined WC as a painful spasm in the muscles of the hand caused by repetitive mo-vements, what makes writing or typing impossible (2). In one series of patients with this problem, only 15,28% (11/72) complained about a pain (3). WC is the most common form of focal hand dystonia (4). In the literature there are descriptions of many si-milar varietes in different professions as musician´s cramp (in piano and clarinet players, guitarists and so on), as well as doctor’s cramp (surgeons with scalpel and gastroenterologists with endoscopy) (5), but there are pathophysiological differences between musician’s dystonia and WC (6).

There are many studies and articles about WC in the literature, particularly about central nervous system (CNS) function changes in WC, described as changes in the balance between motor cortical excitation and inhibition (7), impaired sensory-motor integration during grasping (8) and decre-ased high-frequency oscillations (9). Psychogenic

The association of Writer’s Cramp and Cervical Polyradiculopathy - accidental or causal relationship?Zoran Peric1,2, Irina Stojanovic3, Stevo Lukic1,2, Dejan Savic1,2, Gordana Manic4

1 Department of Neurology, Medical Faculty University of Niš, Serbia,2 Clinic for neurology, Clinical Centre of Niš, Serbia,3 Clinic for mental health protection, Clinical Centre of Niš, Serbia,4 Faculty of health studies, University of Sarajevo, Bosnia and Herzegovina

496



factors were also considered in genesis of WC (10). In an recent article autors have concluded that abnormalities in senory-motor circuitry resul-ting in a vulnerable CNS might be important for interpretation of dystonia and they suggest that old distinction between psychogenic and organic is not easily appricable and perhaps should be aban-doned (11).

On the other side, there are less articles about peripheral nervous system (PNS) function chan-ges in WC and possible role of PNS changes in complex etiopathogenesis of WC is not precisely defined yet. Cramp is also symptom due to radical irritation with prolapsed intervertebral (iv) disc and cramps appear twice as common in the cases having division of sensory roots than in those not having it (12). In some studies, patients with WC and electromyography (EMG) and electroneuro-graphy (ENG) signs of peripheral nerve or cervi-cal root abnormalities were excluded (13). In this paper, we presented a patient with WC and cer-vical polyradiculopathy. We suppose that cervical polyradiculopathy, in some patients, might have some role in complex WC etiopathogenesis.

Case presentation

We present male, 60 years of age, civil engi-neer, right handed. When he was 35 years old, during writing, flexion spasm of right hand and hand’s fingers occured and he stopped writing (WC- picture 1). Later, similar problems (flexion spasm of right hand and hand’s fingers) occured during shaking hands. During next 25 years, des-cribed disorder has been repeating, but there was neither progression nor generalisation. In pictures 2-4 we show the position when patient’s arms are stretched out with simultaneous contraction of agonist and antagonist muscles.

Picture 1. Writer’s cramp: when this patient tries to write, the right hand muscles involuntarily make dystonic painful spasm

Picture 2. Patient’s arms are stretched out

Picture 3. Occurence of simultaneous contraction of extensor digitorum communis, flexor digito-rum profundus and flexor digitorum superficialis muscles of the right hand



Picture 4. Occurence of associated simultaneous contraction of right flexor carpi radialis and ul-naris muscles

In neurological examination, except focal right hand dystonic manifestation, other abnormalities were not registered. Psychological test showed that he had overaverage intelligence (IQt=115, IQm=111, IQv=113), without psychoorganic test elements (with tendency for disimulation, but not simulation). Personality profil indicates tendenci-es for strong negation and repression processes. After neurological and psychiatrical examination, diagnosis of writer’s cramp and graphospasmus was made. He had psychotherapy and physical medicine treatments without any improvement. During 25 years clinical manifestations were sta-tionary and he was sent to EMG and ENG exa-mination to consider electrophysiological aspects of possible extrapiramidal manifestations. In the EMG finding, we registered in relaxation in right deltoideus muscle fibrillations and positive de-nervation potentials and in right abductor digiti minimi muscle sporadic fascicullations. During maximal muscle contraction, in right abductor digiti minimi, adductor pollicis, interosseus dor-salis primus, biceps brachii and deltoideus musc-les we registered signs of neurogenic lesions, but not in right extensor digitorum communis, caput mediale triceps brachii and pronator teres musc-les. Our findings indicated lesions of right C5, C6 and C8 radices, with signs of denervation activi-ties because of C5 radix injury and with signs of current iritation of C8 radix. After that, cervical spine magnetic resonance (MR) examination was done. MR finding of cervical spine indicated cer-

vical polydiscopathy. At C3-C4 level dorsomedi-al protrusion of iv disc was registered with taper of anterior arachoidal space; at C4-C5 level there was broad protrusion of iv disc without alteration of spinal canal and neural foramen, at C5-C6 level biforaminal stenosis was registered, with disc-ra-dicular contact on the right side. At C6-C7 level, right dorsolateral protrusion of iv disc with shor-ten right recessus was registered (picture 5).

Picture 5. MR finding: Polydiscopathia cervicalis

Electroencephalography (EEG) finding was normal; computed tomography (CT) endocranium finding was also normal. In anamnesis vitae is in-formation that a few months before WC occuren-ce, the patient was operated on for duodenal ulcus perforation; there is no hystory of other illness. In anamnesis familliae there is no positive familiar hystory.

So, in this case the question is whether cervical polyradiculopathy is a cause or a consequence of WC or two entities exist indipendently in the same patient ?

Discussion

In this paper we analysed the patient with WC and we considered extrapiramidal disorders, psyc-hogenic factors and cervical polyradiculopathy as the possible cause and, also different combination

498



of those possible etiopathogenetic factors. Dystonia in our patient had an adult onset (after 21 years of age) and it has focal distribution (limb dystonia- WC). Dystonia also may be segmental, with affect on two contiguous body regions (cervical dystonia and WC for example) and generalized. In our patient with WC, dystonia did not progress and generalize during 25 years of evolution. When dystonia is the only sign, without associated neurological findings (as in our patient) it is primary dystonia and pati-ents with this form of dystonia infrequently require extensive laboratory or neuroimaging exploration. Primary dystonia may be genetic or sporadic. The most of adult-onset dystonias are sporadic and they have no family history. Some, on the other hand, may have genetic basis (14). Familial forms may be associated with mutations in the epsilon sarco-glycan gene, DYT11 (1). Genetic primary dystonia may be DYT1, with typical onset in childhood and with spread to become generalized dystonia, and DYT2,4,7,11,13 (14). DYT11 is myoclonus dy-stonia syndrome and criterias for definite diagno-sis of this entity include onset before 20 years of age, myoclonus predominating in the upper body, positive family history and also additional sugge-stive features like alcohol responsiveness (15). Our patient’s disorder does not have any one of cited elements and may be classified as sporadic form of primary dystonia. Tremor or myoclonus may be superimposed on dystonic spasms or might be the main feature of the WC (16), but this tremor sho-uld not be confused with primary writing tremor in which there is no dystonia (1). Some autors wrote that WC was usually not affecting the hand in any other activities than writing (16), but our patient had also problems during handshake. The problem may be exclusive to writing (simple WC) but some people develop difficulties with other activities like shaving (dystonic WC) reflecting a dystonia of the hand or arm (1).

WC is more common in males than females and the onset is usually between the third and the fifth decade (17). In an recent study it was established that the risk for WC increased with the time spent writing each day and was also associated with an abrupt increase in the writing time during the year before WC onset. Also, head trauma with loss of consciousness and myopia are registered as risk factors for this condition (18). Analysed patient is

civil engineer, so he spent a plents of time writing and drowing. There is no history of head trauma and myopia.

Because WC is highly task specific dystonia, specialy simple WC, some neurologist and psyc-hiatrist believed that WC was of psychogenic ori-gin. Some authors described that 15 patients with WC had been treated with multimodal behaviour therapy and biofeedback, and 9 patients had been considered as improved at the follow up period (1-9 months), with conclusion that WC seemed to be related to stressful situations at work (10). But in an recent study writing in stressful situa-tions was not registered as a risk factor for WC (18). There are many evidences implicating that dysfunction of the basal ganglia might be signi-ficant in the pathophysiology of dystonia (15) as well as abnormalities of sensorimotor integration and cortical excitability, that are currently suppo-sed to be underlying cause of dystonia (11). On the other hand, there is a description of a patient with ‘psychogenic dystonia’ in recent published literature with inappropriately cheerful affect and phenomenon so-colled ‘la belle indifference’ (15). Making a diagnose of this condition could be difficult and multispecialty team, including a psychiatrist should be involved. Diagnostic featu-res include inconsistent signs and evidence of un-derlying stress disorders or psychiatric problems. Cognitive-behavioral therapy may be useful (17). Transcranial magnetic stimulation (TMS) could be used to distinguish patients with psychogenic dystonia (19), because slow repetitive TMS redu-ces cortical excitability (20).

Normally, excitation of one group of musc-les (agonist) is often associated with inhibition of another group of muscles (antagonist). This is phenomenon of reciprocal inhibition (21). Pati-ents with dystonia have simultaneous contraction of agonist and antagonist muscles (picture 3), be-cause of reduced spinal reciprocal inhibition. Co-contraction of agonist and antagonist muscles is characteristic but not specific for dystonia and it does rule out joint contractures and hysteria (22). Reciprocal inhibition studies can be used as a sen-sitive method for detecting abnormality in patients with dystonia (19). In cervical radiculopathy there is also reduced reciprocal inhibition of the alpha-motor neurons over the corresponding cervical



spinal segments (23). In the literature there is des-cription of the patient with thoracic outlet syndro-me and registered reduced reciprocal inhibition who developed focal hand dystonia (24) and also of the patient with focal hand dystonia appearance after cervical whiplash injury (25). Also, periphe-ral nerve injury, as ulnar neuropathy, can induce a rearrangement of reciprocal inhibition circuits at the spinal cord level and these changes might predispose patients for the development of a focal dystonia, which maybe clinically manifested in association with another, yet unknown factor, who is required to alter the intracortical circuits (26). There are some neurophysiological evidences that the WC is due to abnormalities within the spinal cord segmental motor programmes and muscle spindle afferent input to them (1). We registered the EMG signs of C5,C6, C8 radices injuries, with preserved C7 radix function and the dener-vation activity as consequence of C5 radix injury and also signs of current iritation of C8 radix. The mayority of C7 radix axons inervate caput mediale triceps brachii muscle via radial nerve and prona-tor teres muscle via median nerve (27) and during EMG examination we registered normal function of those muscles.We suppose that normal function of C7 radix and injuries of C5,C6 and C8 radices with current iritation of C8 radix could have con-tibuted to occurence of WC in presented patient. We didn’t find similar explanation for WC risk in literature. There are many clinical presentations of cervical polyradiculopathies in different articles, but they rarely consider cases with cervical pol-yradiculopathy where one normal radix function persists among impaired radices functions. Speci-fic for the patients with intact C7 level is that they gain three important motor functions: forearm extension using the triceps muscle , finger exten-sion and finger flexion. The patients have the ad-vantage of grasp and release afforded by activated finger extensors and flexors. Fine motor dexterity of the hand is impaired, as the intrinsic muscles of the hand are innervated from C8-Th1 level (28). We suppose that when in patient with cervical po-lyradiculopathy, C7 radix has preserved function with C5,C6,C8 radices injured and current C8 ra-dix iritation, that could contibute to WC occurence or could be a risk or trigger factor for WC appea-rance in predisposed patients.

Conclusion

1. In patients with WC, registration of cervical polyradiculopathy signs is often accidental finding, but in some cases cervical polyradiculopathy (specialy C5, C6, C8 polyradiculopathy, with preserve function of C7 radix) might be associated with WC and althought underlying pathophysiological mechanisms are not known yet, it could be considered as a potential risk or trigger factor in predisposed subjects.

2. We suggest EMNG of arm (hand) muscles and nerves and MR cervical spine examinations in all patients with WC, besides others investigations.

3. Further investigations of this problem is necessary.

References

1. Larner J.A. A dictionary of Neurological signs. Springer, New York, 2011: 374-375.

2. The British Medical Association: Illustrated Medi-cal Dictionary, A Dorling Kindersley Book, Lon-don, 2002: 150.

3. Marsden DC. Writer´s cramp. Brit Med J 1983; 286: 1057.

4. Fiorio M, Tinazzi M, Anglioti MS. Selective impair-ment of hand mental rotation in patients with focal hand dystonia, Brain 2006; 129: 47-54.

5. Lin TP, Shamim AE, Hallett M. Focal hand dysto-nia. Practical Neurology 2006; 6: 278-287.

6. Rosenkranz K, Williamon A, Butler K et al. Pathop-hysiological differences between musician’s dysto-nia and writer’s cramp, Brain 2005; 128: 918-931.

7. Ridding CM, Sheean G, Rothwell CJ, Inzelberg R, Kujirai T. Changes in the balance between mo-tor cortical excitation and inhibition in focal, task specific dystonia. J Neurol Neurosurg Psychiatry 1995; 59: 493-498.

8. Odergren T, Iwasaki N, Borg J, Forssberg H. Impa-ired sensory-motor integration during grasping in writer´s cramp. Brain 1996; 119: 569-583.

500



9. Cimatti Z, Schwartz PD, Bourdain F et al. Time-frequency analysis reveals decreased high-frequen-cy oscillations in writer´s cramp. Brain 2007; 130: 198-205.

10. Cottraux AJ, Juenet C, Collet U. The treatment of writer’s cramp with multimodal behaviour thera-py and biofeedback: A study of 15 cases. Brit J Psychiat 1983; 142: 180-183.

11. Munts GA, Koehler JP. How psychogenic is dy-stonia ? views from past to present. Brain 2010; 133:1552-1564.

12. Wolman L. Cramp in cases of prolapsed interver-tebral disc. J Neurol Neurosurg Psychiat 1949; 12:251-257.

13. Cohen GL, Hallett M, Geller DB, Hochberg F. Treatment of focal dystonias of the hand with botulinum toxin injections. J Neurol Neurosurg Psychiat 1989; 52: 355-363.

14. Comella AC. Diagnosis, classification and pat-hophysiology of dystonia. in: Dystonia. Jankovic J. (Ed), Demos, New York, 2005: 1-8.

15. Singer SH, Mink WJ, Gilbert LD, Jankovic J. Mo-vement Disorders in Childhood, Saunders-Elsevi-er, Philadelphia, 2010:97-268.

16. Okun SM. The dystonia patient- a guide to prac-tical management. Demos Medical, New York, 2009: 150-152.

17. Sherman R, Chaudhuri R. Dystonia. In: Move-ment Disorders in clinical practice. Springer-Ver-lag, London, 2010: 49-66.

18. Roze E, Soumare A, Pironneau I et al. Case-con-trol study of writer’s cramp. Brain 2009; 132: 756-764.

19. Aminoff JM. Electrodiagnosis in Clinical Neuro-logy. Elsevier- Churchill Livingstone, 2005: 396-405.

20. Hoffman ER, Cavus I. Slow transcranial magnetic stimulation, long-term depotentiation, and bra-in hyperexcitability disorders. Am J Psychiatry 2002; 159: 1093-1102.

21. Guyton CA, Hall EJ. Textbook of Medical Physio-logy, Elsevier-Saunders, 2006: 681-682.

22. Daube RJ, Rubin ID. Clinical Neurophysiology, Oxford University Press, 2009: 569-573.

23. Hall T, Quintner J. Responses to mechanical sti-mulation of the upper limb in painful cervical ra-diculopathy. Australian Physiotherapy 1996; 42: 277-285.

24. Quartarone A, Girlanda P, Risitano G et al. Fo-cal hand dystonia in a patient with thoracic outlet syndrome. J Neurol Neurosurg Psychiatry 1998; 65: 272-274.

25. Tamburin S, Zanette G. Focal hand dystonia af-ter cervical whiplash injury. J Neurol Neurosurg Psychiatry 2003; 74: 134.

26. Girlanda P, Quartarone A, Battaglia F et al. Changes in spinal cord excitability in patients af-fected by ulnar neuropathy. Neurology 2000; 55 (7): 975-978.

27. Perić Z. Clinical electromyoneurography, Prosve-ta, Niš, 2003: 1-340 (in serbian).

28. Durrant HD, True MJ. Myelopathy, Radiculopa-thy, and Peripheral entrapment syndromes. CRC Press, Boca Raton-London-New York-Washin-gton, D.C., 2002: 151-155.

Corresponding author Zoran Peric, Department of Neurology, Medical Faculty University of Niš, Serbia, E-mail: [email protected]



Abstract

Introduction: About 50% of reproductive wo-men with polycystic ovary syndrome (PCOS) has a body mass index greater than 24 kg / m2.

The aim of this study was to determine dif-ferences in insulin sensitivity, hyperandrogeni-sm and sonographic characteristics of ovarian between reproductive women with normal weight and obese women with PCOS.

Subjects and methods: This prospective study included 15 reproductive nonobese women with PCOS, 15 reproductive obese women with PCOS, selected by Rotterdam Diagnostic criteria and 15 women of reproductive age who do not have PCOS. All subjects had the same parameters in the middle follicular phase: gonadotropins, estradiol, total testosterone, prolactin, SHBG, free andro-gen index (FAI), dehydroepiandrosterone sulfate (DHEAS), 17-hydroxyprogesterone (17-OHP), insulin and glucose. Also, the 3-7 day cycle is de-termined by the volume of the ovary, the number of follicles, stroma / area ratio, index of resistance (RI) measured.

Results: Both PCOS groups had significantly higher (p <0.05) FG score, LH, LH / FSH ratio, to-tal testosterone, DHEAS, SHBG, FAI, FGIR, QU-ICK, ovarian volume, number of follicles, stroma / total area, compared to control group. Nono-bese PCOS group had significantly higher mean LH, LH / FSH ratio, total testosterone, DHEAS,

SHBG, FGIR, QUICK, stroma / total area ratio, while small number had significantly lower fa-sting insulin, FAI, BMI, lower family risk of T2 diabetes compared to obese PCOS group, while there were no significant differences in the morp-hology of the ovary.

Conclusion: The results of this study showed that there were differences between the obese and nonobese PCOS in insulin sensitivity, hyperandro-genism and PCOS. Nonobese morphology is domi-nated by signs of dysregulation hypotalamo ovar-pituitary-adrenal-axis and the more elevated andro-gens while obese PCOS have insulin resistance and tendency to develop T2 diabetes. In both groups the ovarian volume was increased, but the stroma / total area dominated in nonobese PCOS.

Key words: Hyperandrogenism- Insulin sensi-vity- PCOM- Nonobese PCOS- Obese PCOS

Sažetak

Uvod: Oko 50% reproduktivnih žena sa sin-dromom policističnih jajnika (PCOS) ima indeks tjelesne mase veći od 24 kg/m2.

Cilj ove studije bio je da se utvrde razlike u insulinskoj senzitivnosti, hiperandrogenizmu i so-nografskim karakteristikama jajnika između go-jaznih i negojaznih reproduktivnih žena sa PCOS.

Ispitanice i metode: Prospektivnom studijom obuhvaćeno je 15 negojaznih, 15 gojaznih repro-

Hyperandrogenism, Insulin sensitivity and Sonographic characteristics of Polycystic Ovary Syndrome (PCOS): Comparison between Nonobese and Obese reproductive womenElrmira Hajder1, Midhat Hajder2, Tarik Arapcic3

1 University Clinical Center Tuzla, Gynecology and Obstetrics clinic, Bosnia and Herzegovina,2 University Clinical Center Tuzla, Internal clinic, Department of Endocrinology, Bosnia and Herzegovina,3 Public Health Centre Lukavac, Bosnia and Herzegovina.

502



duktivnih žena sa PCOS, odabranih po Rotterdam dijagnostiškim kriterijima i 15 žena reproduktiv-ne dobi koje nemaju PCOS. Svim ispitanicama su određeni isti parametri u srednjoj folikularnoj fazi: gonadotropini, estradiol, ukupni testosteron, pro-laktin, SHBG, slobodni androgeni indeks (FAI), dehidroepiandrosteron sulfat (DHEAS), 17-hi-droksiprogesteron (17-OHP), insulin i glukoza. Takođe, od 3-7 dana ciklusa određen je volumen jajnika, broj i veličinu folikula, stroma jajnika/po-vršina jajnika odnos, indeks otpora (RI).

Rezultati: Obje grupe PCOS imale su značajno veće (p<0.05) F-G scor, LH, LH/FSH ratio, ukupni testosteron, DHEAS, SHBG, FAI, FGIR, QUIC-KI, volumen jajnika, broj folikula, stroma /ukupna površina jajnika odnos, RI u odnosu na kontrolnu skupinu. Negojazna grupa PCOS imala je značaj-no višu srednju vrijednost LH, LH/FSH ratio, uku-pni testosteron, DHEAS, SHBG, FGIR, QUICKI, stroma/ukupna površina jajnika odnos, dok su ima-le signifikantno niže srednje vrijednosti insulina na-tašte, FAI, BMI, niži porodični rizik za T2 diabetes u odnosu na gojaznu grupu PCOS, dok značajnih razlika nije bilo u morfologiji jajnika.

Zaključak: Rezultati ove studije su pokazali da postoje razlike između gojaznih i negojaznih žena sa PCOS u insulinskoj resistenciji/osjetljivosti, hi-perandrogenizmu i morfologiji jajnika. U negoja-znih PCOS dominiraju znaci disregulacije osovine hipotalamus-hipofiza-jajnik-adrenalna žlijezda sa više povišenim androgenima, dok gojazne PCOS imaju inzulinsku rezistenciju i sklonost razvoju diabetesa tip 2. U obje grupe volumen jajnika je povišen, ali je odnos stroma/ukupna površina jaj-nika dominantnija u negojaznih žena sa PCOS.

Ključne riječi: Hiperandrogenizam-Inzulinska sensitivnost-PCOM- Negojazne PCOS-Gojazne PCOS

Introduction

The polycistic ovary syndrome (PCOS) is a multisystemic, reproduction, endocrine-metabolic disorder with a prevalence of 5-10% of reproduc-tive women, and the cause of about 70% of female infertility (1). Approximately 82% of the total belon-gs to the hyperandrogenism of PCOS(2). Rotterdam diagnostic criteria (ROT) includes a positive two

of the three criteria with the exclusion of diseases with hiperandrogenemia: clinical / biochemical hyperandrogenism, ovulatory dysfunction and po-lycystic ovarian morphology (PCOM) and, with the exclusion of secondary causes of hyperandro-genism(3). PCOS disorders are chronic oligo-ano-vulation, increased levels of circulating androgens/clinical hyperandrogenism(4), PCOM(5) altered go-nadotrophin secretion(6), insulin resistance and / or hyperinsulinemia often associated with obesity. Women with PCOS often have a high risk for type 2 diabetes and metabolyc syndrome(7). Key pathop-hysiologic causes of PCOS are insulin resistance, hyperandrogenism, and altered dynamics of gona-dotropin secretion. Adrenal gland, pituitary gland, liver and adipose tissue are important factors in the development of PCOS(9). The role of the adrenal gland in PCOS is unknown, because the abnor-mal regulation of citochrome P450c17-alpha, cau-se abnormal function of the enzyme in the ovary and adrenal glands in synthesis 17-OHP. DHEAS is synthesized in 95% of the adrenal cortex, but is often elevated in PCOS for more than 50%(10) . Ultrasonic characteristics of ovarian cancers are ovarian volume greater than 10 ml, with 12 or more follicles (2-9 mm in diameter), such as necklaces made of beads, with increase stroma and sufficient existence of such a finding on only one ovary. Of all patients with polycystic ovarian morphology, 90% had PCOS(11). About 90% of patients with disor-ders of menstrual cycle. The most common disor-der of the cycle in PCOS have menstrual dysfuncti-on (amenorrhoea, oligomenorrhoea, menorrhagia). The aim of this study was to determine differences in insulin sensitivity, hyperandrogenism, and sono-graphic characteristics of ovarian among obese pe-ople with normal weight and reproductive women with PCOS.

Subjects and methods

This prospective study included 15 obese wo-men with normal weight and 15 reproductive fe-males with PCOS, selected by Rotterdam criteria(4), from 16-28 years, due to disorders of hyperandro-genism and menstrual cycle. From the study were excluded women who had non-classical CAH (NCAH) hyperprolactinemia, Cushing Syndrome,



androgen active tumors of the ovaries and adre-nal glands. The control group consisted of 15 he-althy women of reproductive age between 18-28 years. All respondents had the same parameters: dehydroepiandrosterone sulfate (DHEAS), total testosterone (UT), biding sex hormone binding globulin (SHBG), free androgen index (FAI) and 17-hydroxyprogesterone (17-OHP). In the mid fo-llicular phase of the menstrual cycle, we analyzed the basal levels of the hormone FSH, LH, estradiol, progesterone, glucose, insulin, prolactin. In the mid follicular phase of the menstrual cycle participants underwent ovarian color Doppler and had ovarian volume (OV), number of follicles and size of follic-les, ovarian stroma (OS) / ovarian area (OA), OS / OA ratio and the of resistance index (RI ).

Definition

Hirsutism is defined based on the Ferriman-Gallwey (FG) score greater than 8(12), ovulatory dysfunction was defined by less than 8 menstrual cycles per year or luteinized progesterone of less than 9.54 nmol / l, menstrual cycle dysfunction of more than 34 days and less than 21 days(13). Biochemical hyperandrogenism was defined if the total testosterone is greater than 2.08 nmmol / L, DHEAS greater of 7.8 umol / L. If the total testo-sterone (UT) is higher of 7.2 nmol / L and greater than DHEAS 20.8 umol / l suspected the existence of an active tumor androgynous. Elevated serum 17-OHP over 9.1 nmmol / L and elevated peak af-ter ACTH greater than 30.3 nmmol / L was con-sidered NCAH(14). HOMA-IR greater than 2.16 and decreased from 0.34 QUICK were signs of in-sulin resistance (IR) and reduced insulin sensitty, and are calculated by formulas(15). Transvaginal color Doppler (TVCD) criterion: more than 12 fo-llicles in the ovary, the size 2-9 ml, ovarian volu-me greater than 10 ml(11). The ovarian stroma / total area ratio > 0.34, is considered a plus stroma.

Laboratory assays

Blood is taken for determination of insulin and fasting glucose. Insulin (µU/ ml) was determined by RIA (direct radioimmunoasay) Wallec the auto-

matic counter (WIZARD) Turku Finald company. insi-CKIT Irma firm DiaSorin, Italy was used. Insu-lin sensitivity was calculated by formula: HOMA-IR = fasting insulin (UIU / ml) x fasting glucose (mmol / L) / 22.5. QUICK = 1/log.inzulin glucose (µU/ ml) + log fasting plasma glucose (mg / dl). Free androgen index (FAI) was calculated using the formula = (total nmmolL x 100 T / SHBG nmmol / L). DHEAS, 17-OHP, total T, 17-OHP, SHBG, were determined by RIA (direct radioimmunoasay) Wallec the automatic counter (WIZARD) Turku Fi-nald company. The original IRMA kits individual hormones company IMMUNOTHEC a Beckman Coulter Company, France were used. Estradiol, Pg, FSH, LH, prolactin, testosterone were determi-ned by the apparatus Fluroimmunoassay Wallace, DELFIA FLUROMETER. The original DELFIA kits for individual firms hormone Turku, Finald werw used. Glucose was measured in the hospital with enzyme-colorimetric method (Glucose GOG-PAP) on the appliance VP Super System, diagnosis Division, USA. Ultrasound examination of the ova-ries with transvaginal probe 6.5 MHz to 4000 plus TVCD Aloka, Japan. Ovarian volume was calcula-ted for each ovary using the formula for a prolatee-llipsoid (π/6 x (D1xD2xD3) where D represented the maximum diameter in the transverse, anteropo-sterior and longitudinal axes.


The collected data were entered in a specially created database on the personal computer. Sta-tistical analysis was performed by application software called SPSS for Windows version 12th. Numerical data were presented as mean +-SD, as median, the number was xpressed in%. To test the hypothesis between groups t-test and Fisher exact test were used, with significance level of p <0.05.

Results

Clinical characteristics (Table 1)

Obese PCOS group had significantly higher body weight, BMI (p <0.01), OS (p <0.01), higher family risk for type 2 diabetes (p <0,005), a gre-

504



ater presence of hirsutism (p <0.05), higher inci-dence of irregular menstrual cycle (p <0.01) com-pared with the control group. Nonobese PCOS group had significantly present hyperandrogenism (p <0.02), higher incidence of irregular cycles (p <0.01) compared with the control group. Obe-se PCOS group had significantly higher BMI (p <0.03), OS (p <0.01) and higher incidence of type 2 diabetes in the family (p <0.01), less irregular menstrual cycle (p <0.01) and there were no si-gnificant (ns) difference in the appearance of me-narche and clinical hyperandrogenism in PCOS compared with the nonobese (Table 1).

Insulin sensitivity (Table 2)

In nonobese PCOS group parameters of insulin sensitivity such as fasting insulin (p <0.03), HO-MA-IR (p <0.04), the QUICKI (p <0.02) were significantly higher, while FGIR (p <0.01) was

significantly lower than in the control group. In obese PCOS group fasting insulin (p <0,001), HOMA-IR (p <0.05) the QUICK index (p <0.05) were significantly higher, while FGIR (p <0.01) were significantly lower than in the control group. In obese PCOS fasting insulin (p <0.03) were significantly higher, while FGIR (p <0.03), QU-ICKI (p <0.05) HOMA-IR (p <0.05), were signi-ficantly lower than in nonobese PCOS (Table 2).

Hormonal characteristics (Table 3)

In both groups of PCOS: total testosterone, FAI, DHEAS, LH, LH / FSH ratio were signifi-cantly higher (p <0.05), while SHBG was signi-ficantly lower (p <0.05) compared to the control group. Nonobese PCOS had significantly higher mean LH (p <0.01), LH / FSH ratio (p <0.04), DHEAS (p <0.05), SHBG (p <0,001) compared with the obese PCOS group (Table 3 ).

Table 1. Clinical characteristicsVariables NonobesePCOS ObesePCOS Control

Age Age of menarche

25.1 ±5.612.8 ± 1.3

25.2 ±5.312.9 ± 1.4

24.6 ± 6.413.4 ± 1.2

BMI (kg/m2)Vaist circumference (cm)FH of DM(%)

23.4 ±1.3,a

78±2.3a

49 %, b,a

28.1±1.8 c 92±3.3 c

79% c

22.7 ±1.2 77±2.45%

Acne/ seborrhoea % 41.1 b 30.4% c 20%Hirsute ( F-G score) 11±6.8 b 9.5±5.2 c 4.1±11Iregularan MC % 82.7% b,a 54% c 1%Note: values are the mean ± SD, aP<0.05 for nonobese vs. obese PCOS, bP<0.05 for nonobese PCOS vs. control, cP<0.05 for obese PCOS vs. control.

Table 2. Glucose-and insulin-related parameters and measures of insulin sensitivity

Variables NonobesePCOS ObesePCOS Control

Fasting insulin ( µU/ ml ) 11.9±3.2 b,a 14.6±4.6, c 7.2 ±2.3Fasting glucose (mmol/L) HOMA-IR (ref. M 2.16) QUICKI (ref. < o.34)FGIRHbA1C %

4.6±0.23.1±0.2 b,a

0.36±0.02 b,a

6.9±2.4a b

5.1±0.2

4.5±0.32.8±, 0.4c

0.30±0.04 c

5.5±2.6 c

5.2±0.4,

4.1±0.11.8±0.30.28±0.019.7±2.55.0±0.1

Note: values are the mean ± SD, aP<0.05 for nonobese vs. obese PCOS, bP<0.05 for nonobese PCOS vs. control, cP<0.05 for obese PCOS vs. control, HOMA =homeostasis model assessment , QUICKI=quantative insulin sensitivity index, FGIR=fasting glucose to insulin ratio ( mg/dl/uU/ml).



Sonographics characteristics (Table 4)

In nonobese PCOS group mean ovarian volu-me (p <0.03), number of follicles (p <0.02), ova-rian stroma (p <0.01), S / A ratio (p <0.01) were significantly higher, while the RI (p <0.01) was significantly lower than in the control group. Obe-se PCOS group mean ovarian volume (p <0.05), number of follicles (p <0.02), ovarian stroma (p <0.01), S / A ratio (p <0.01) were significantly higher, while the RI (p <0.01 ) was significantly lower than in the control group. Nonobese PCOS group no significant differences among the other sonography parameters compared to obese PCOS group (Table 4).

Discussion

This study, conducted on reproductive women, aged from18-28 years, with the obese and nono-bese PCOS, was conducted to assess the possible

association of hyperandrogenism, insulin resi-stance, the ovarian volume and ovarian stroma, as measured by color Doppler. Key pathophysiologic causes of PCOS are insulin resistance, hyperan-drogenism, and altered dynamics of gonadotropin secretion. Adrenal gland, pituitary gland, liver and adipose tissue are important factors in the develo-pment PCOS(16). It is widely accepted that insulin resistence / hyperinsulinemia are underlying dis-orders of the PCOS and hyperandrogenism is not, and it is necessary to distinguish the molecular and genetic mechanismsof that patogenesis (17). Today’s studies show the prevalence of insulin re-sistance, about 65% in PCOS. Insulin resistance is a cause of hyperinsulinemia, which directly sti-mulates the secretion of androgen in theca ovary cells, and indirectly reduce production of SHBG in the liver that binds androgens and results in hi-perandrogenism(18). The role of the adrenal gland in polycystic ovarian syndrome (PCOS) is un-known, because the abnormal regulation of cito-chroma P450c17-alpha, cause abnormal function

Table 3. Hormonal characteristicsVariables NonobesePCOS ObesePCOS Control

FSH (IU/ml) 6.1±1.6 6.1±1.6 5.1±2.8LH (IU/ml) 13.6±4.9b,a 9.8±3.1, c 4.3±2.1LH/FSH ratio 2.3 ±0.7b,a 1.6.±0.7 c 0.92±0.3Total Testosterone (nmol/L) 3.6 ±0. b 2.8±0.7, c 1.4±0.5SHBG (nmol/L) 28.3 ±12. b,a 16.6±8.6, c 46.1±10.2FAI (range0-3)DHEAS (µmol/L)17-OHP (nmol/L)

10.7±3.3b

8.3 ±1.6b,a

3.1±0.7

12 ±4.2, c

6.5±1.4, c

3.2±0.8

2.9 ±0.93.2±1.12.1±0.7

Note: values are the mean ± SD, aP<0.05 for nonobese vs. obese PCOS, bP<0.05 for nonobese PCOS vs. control, cP<0.05 for obese PCOS vs. control, DHEAS-dehydroapiandrosterone sulphate, OHP-17 hydroxy progesterone, SHBG-sex hormone-binding hormone, LH=luteinizing hormone, FSH=follicle stimulating hormon, FAI= free androgen index.

Table 4. Sonographics findings

Variables NonobesePCOS ObesePCOS ControlMean ovarian volumen cm3 10.7±1.7b 10.4±1.5c 5.6± 1.3No. of folliculesOvarian area cm2

Ovarian stroma cm2 Stroma / area ratioResistance index

12.5±2. 2b

8.4± 1.5.3.1 ±0.2b

0.36±0.2b

0.56±0.02b,

14.2±3.1c

8,1. ±1.32.8±0.7c

0.35±0.05c

0.57±0.03c

6.1± 1.17.1±2.61.4±0.30.19±0.10.77±0.06

Note: values are the mean ± SD, aP<0.05 for nonobese vs. obese PCOS, bP<0.05 for nonobese PCOS vs. control, cP<0.05 for obese PCOS vs. control.

506



of the enzyme in the ovary and adrenal glands in synthesis of 17-OHP(10). Aproximately 40-60% of women have hyperandrogen excesive adrenal androgen response to ACTH stimulation(3).It is the androgen DHEAS which stimulates 95% of the adrenal glands in healthy women, but with wo-men with PCOS 50% of DHEAS origin is from the ovary(10). DHEAS was negatively correlated with insulin resistence(19). Vanky et al. (20) have shown that low-dose therapy dexametasone decre-ases adrenal androgens (DHEAS, androstenedio-ne, total testosterone) in PCOS, which indirectly confirms the relationship of adrenal gland secreti-on of androgens in PCOS.

The results of this study showed that insulin resistence is present in obese PCOS,while hype-randrogenism is present in both PCO groups, but higher levels of androgens are present in nonobese PCOS. The results of this study are consistent with results of other authors. Results in the Italian study showed that fasting hyperinsulinemia (p <0.028) insulinemia 120 minutes of OGTT for all three PCOS phenotypes (p <001), HOMA-IR (p <0.05) were significantly higher, whereas the insulin AUC 2h in all three criteria was lower (p <0,001) compared to the control group(21,22). Hajder et al. (26) also found that reproductive women with PCOS had higher insulin resistance (elevated fa-sting insulin, HOMA-IR increased and decreased QUICK).

Analysis of the ultrasound appearance of the ovaries showed that PCOS patients had shown a higher ovarian and stromal volume, stromal area and a higher stromal area / ovary area ratio (S / A ratio) compared with the control women (P <0.05) ( Table 4). The result of this study related to ovari-an morphology are consistent with the findings of other researchers. PCOS patients showed signi-ficantly higher ovarian volume, stromal volume, stromal area and S / A ratio as compared to the control group, confirming the role of diagnostic ultrasounds stroma measurement in the evalua-tion of PCOS patients(23). This is an important result, since joint ASRM / ESHRE consensus on PCOS meeting(3) established to take into account only the presence of 12 or more follicles measu-ring 2 ± 9 mm in diameter, and / or the increased ovarian volume (> 10 cm3), for the diagnosis of PCOS. Noteworthy, although ovarian volume is

more reliable in routinary clinical practice, only ovarian stroma measurement may correspond to histological findings of prominent theca and fibro-tic thickening of prominent lutheal cell albuginea, alterations that explain many of the clinical fea-tures of the syndrome(24) . Ovarian volume was significantly increased in both groups of PCOS, and increased ovarian stroma dominant in nono-bese PCOS.

Sahin et al. (25) found that nonobese PCOS have elevated androgen and ovarian volume com-pared to the control group and metformin as an etiological therapy reduced androgen levels after 6 months of treatment. Loverro et al. (25) demon-strated that the ovarian stroma, S / A ratio were present in Pócsi, positively correlated with eleva-ted androgen and increased metabolic parameters (PAI-1), Von Wilibrand, and increased cardiovas-cular risk. Silfen et al. have proven that nonobese adolescents with PCOS have high levels of LH, androstenedione, DHEAS, dihydrotestosterone (DHT), compared with the obese PCOS. Obese PCOS had higher fasting insulin and HOMA-IR, lower SHBG, quick index and a higher risk of de-veloping type 2 diabetes compared to nonobese adolescents. Ovarian volume was significantly higher in both groups of adolescents compared to a control group of healthy adolescents(8). Ful-ghesu et al. (27) found that ovarian volume was increased in PCOS compared with control group. Increased stroma / total area of the ovary was si-gnificantly positively correlated with levels of an-drogens compared to normal stroma. After nafa-relin test in patients with increased stroma there was significantly increased levels of androgens (testosterone, 17-OHP and oestradiol) compared to normal stroma. Increased stroma as a marker for hyperandrogenism.

In conclusion, patients with PCOS have insulin resistance, hiperandrogenism which is correlated with ovarian stroma of the ovaries and polycystic ovary morphology. Obese PCOS had significantly more present insulin resistance, decreased SHBG, and significantly lower levels of androgens com-pared to nonobese PCOS. Polycystic ovarian mor-phology was present in both groups without signi-ficant difference.



References

1. Franks S. Polycystic ovary syndrome. N Engl J Med 1995;333:853-61.

2. Azziz R,Sanchez LA, Knochenhauer MC, Lazenby J, Stefens KC,Taylor K and Boots LR. Androgen exces in wumen: Experience with ower 1000 conse-cutive patients. The J Clin Endocrinol Metab 2000; 89(2):453-462.

3. The Rotterdam ESHRE/ASRM-sponsored PCOS Concensus Work-shop Group 2004 Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycistic ovary syndrome (PCOS). Human Reproduction 2004; 19: 41-47.

4. Rosenfield RL, Barnes RB and Ehrmann DA. Studies of the nature of 17-hydroxyprogesterone hyperres-ponsiveness to gonadotrophin releasing hormone agonist challenge in functional ovarian hyperan-drogenism. J Clin Endocinol Metab 1994; 79: 1686-1692.

5. Sahin Y, and Kelestimur F. 17-hydroxyprogesterone response to busorelin testing in the PCOS. J Clin Endocrinol 1993; 39: 151-155.

6. Chang PL,Lindhein SR, et all. Normal ovulatry wo-men with polycystic ovaries have hyperandrogenic pituitary ovarian respones to GnRH agonist testing. Jornal of Clinical Endocrinology and Metabilism 2000;85:995-1000.

7. White D, Leigh A,Wilson C. et all. Gonadotropin and gonadal steroid response to a dose of long-acting agonist of gonadotropin-releasing hormone in ovu-latory and anovulatory women with polycystic ovary syndrom. Clin Endocrinol(Oxf) 1995; 42:475-481.

8. Silfen ME,Denburg, et all.Early endocrine, meta-bolic, and sonographic characteristics of polycystic ovary sandrome (PCOS): comparison between no-nobese and obese adolescents. . Jornal of Clinical Endocrinology and Metabilism 2003;88:4682-88.

9. Vallace AM, Sattar N .The changig role of clinical laboratory in the investigation of polycystic ovary syndrome. Clin Biochem Rev2007; 28:79-91.

10. Sahin Y, Kelestimur F. 17-Hydroxiprogesterone respons to gonadotrophin releasing hormone ago-nist busorelin and adrenocorticotrophin in polycy-stic ovary syndrome: investigation of adrenal and ovarian cytochrome P450c17-alfa disregulation. Humen Reproduction 1997;12:910-913.

11. Orsini LF, Venturoli S,et all. Ultrasonic fidings in polycystic ovarian disease. Fertility and Sterility 1985;43:709-714.

12. Legro RS, Myers ER, Barnhart HX, et al. The Pregnancy in Polycistic Ovary Syndrome Study: basaline caracteristices of the rondomizedcohort including racial effect. Fertil Steril2006;86:914-

13. Marco CA, Aldo G, et. Al.The evolution of meta-bolic parameters and insulin sensitivity for a more robust diagnosis of the polycistic ovary syndrome.Clinic Endocrinology 2008;69:52-60.

14. Carmina E, Lobo RA.Ovarian suppressio reduces clinical and endocrineexpression late onest con-genital adrenal hyperplasia due to 21-hydroxila-se deficiency.Fertil Steril 1994;62:738-743.

15. Belli SH, Graffigma MN, et all. Effect of rosigli-tazone, growth factors and reproductive distru-bancesin women with polycistic ovary syndrome. Fertil Steril 2004;81: 624-629.

16. Matsuda M, DeFronzo RA. Insulin sensitivity indi-ces obtanied from oral glucose tolerance testing: comparison with the euglycemic insulin clamp.Diabetes Care 1999;22:1462-1470.

17. Wallace AM, Sattar N. The changig role of clinical laboratory in the investigation of polycystic ovary syndrome. Clin Biochem Rev 2007; 28:79-91.

18. Dunaif A (1995) Hyperandrogenic anovulation (PCOS): A unique disorder of insulin action asso-ciated with an increased risk of non-insulin-depe-dent diabetes mellitus. Am J Med 98:33S-39S.

19. Dunaif A. Hyperandrogenic anovulation (PCOS): A unique disorder of insulin action associated with an increased risk of non-insulin-depedent di-abetes mellitus. Am J Med.1995; 98:33S-39S.

20. Brennan K, Huang A, Azziz R. Dehydroepina-drosterone sulfate and insulin resistance in pati-ents with polycistic ovary syndrome. Fertil Stertil 2008; 2:1-5.

21. Vanky E, Salvesen KA, Carlsen SM. Six-month treatment with low –dose dexamethasove further reduces androgen levels in PCOS women treated with diet and lifestyle advice and metformin. Hum reprod 2004;19: 529-533.

22. Apronidaze T, Essah PA, et, al. Prevalence and characteristics of the metabolic syndrome in wumen with polycistic ovary syndrome. Jour-

508



nal of Clinical Endocrynology and Metabolsm 2005;9o:1929-1935.

23. Marco CA, Aldo G, et. Al.The evolution of meta-bolic parameters and insulin sensitivity for a more robust diagnosis of the polycistic ovary syndrome.Clinic Endocrinology 2008;69:52-60.

24. Fulghesu AM, Ciampelli M, Belosi C, Apa R, Pa-vone V, Lanzone A: A new ultrasound criterion for the diagnosis of polycystic ovary sindrome: the ovarian stroma/total area ratio. Fertil Steril 2001; 76:326-31.

25. Bucket WM, Bouzayen R, Watkin KL, Tulandi T, Tan SL. Ovarian stromal echogenicity in women . Journal of Clinical Endocrynology and Metabol-sm 2005;90:1929-1935

26. Loverro G, De Pergola G, Naro E., et. all. Pre-dictive value of ovarian stroma measurement for cardiovascular risk in polycyctic ovary syndrome: a case control study. Journal of Ovarian Resear-ch 2010, 3:25with normal and polycystic ovaries. Hum Reprod 2003;18:598-603.

27. Hajder M , Hajder E. Insulin sensitivity and free androgen index in women with polycystic ovarian syndrome. HealthMed.2009; 3(4) :513-512.

28. Fulghesu M, Angioni S, et all. Pituitary-ovarian response to the gonadotrophin-relasing hormone-agonist test in anovulatory patients with polycy-stic ovary syndrome: predictive role of ovarian stroma. Clinical Endocrinology 2006; 65: 396-401.

Corresponding author Hajder E., University Clinical Center Tuzla, Gynecology and Obstetrics clinic, Bosnia and Herzegovina, E-mail: [email protected]



Abstract

Bee venom contains a variety of peptides, in-cluding the melittin, the apamine, the adolapin and mast cell degranulation peptides. Studies have shown anti-inflammatory and antitumor actions of this venom. The purposes of this study were to evaluate the bee venom antitumor action in Ehr-lich tumor-bearing mice and the phagocytosis of the peritoneal macrophages of mice treated with this venom. We did not observe any increase in the survival time of Ehrlich tumor-bearing mice trea-ted with bee venom in the dose 0.7 and 1.0 mg/kg/day. However, we observed an increase in the ma-crophage phagocythosis treated with bee venom in the dose 0.7 to 1.0 mg/kg/day.

In addition to the immunostimulant action, previous studies detected an apoptosis increase in the mice inoculated with experimental tumor and treated with bee venom. In the dose we used, we could observe only an increase in the macropha-ges phagocythosis. We have been considering the possibility of studying higher doses of the venom, pondering the benefits and the side effects, especi-ally those to the central nervous system.

Key words: bee venom, Ehrlich tumor and life expectancy.

Introduction

The appearance and evolution of tumors have been related to the alteration of the immune con-dition of the patient. Therefore, the depression of the immune defenses should facilitate the multi-plication of neoplastic cells which, though in heal-thy condition, should be destroyed, leading to the tumor development (1).

Tumor cells express tumor antigens, which may be recognized by the host’s immune system, both specific and non-specific. Peritoneal macrop-hages, efficiently activated to facilitate the Fc-de-pendent cellular cytotoxicity, not only inhibit the tumor growth, but also induce the cytolisis of tu-mor cells remarkably (2).

Bee venom is a complex mixture of substances that able to induce immune and/or allergic respon-ses in humans, and has been used to treat rheu-matoid arthritis including arthritis, angiocardio-pathy, back pain, musculoskeletal pain, cancerous tumors, anticancer, and multiple sclerosis (3,4,5).

The main components of bee venom contain peptides (melittin, apamin, promelittin, and mast cell deregulating peptide), enzymes (phospholipase A2 and hyaluronidase), histamine, sinkaline, glyce-rol, noradrenaline, and amino acids, which have di-verse pharmacological properties and biological ac-tivities (6). Bee venom is secreted by the poison and accessory glands of the working honeybee and is stored in the venom reservoir. Bee venom is usually

Effect of bee venom (Apis mellifera) on the phagocytosis of peritoneal macrophages and on the rise of life expectancy of Ehrlich tumor-bearing miceDavid Feder1, André Neves Alves1, João Roberto Beltramo1, Luana Ap. Beltramo1, Maria Gabriela P. Coriolano1, Fabio F. Perazzo2, Fernando L. A. Fonseca3,4

1 Disciplina de Farmacologia - Departamento de Morfologia da Faculdade de Medicina do ABC, Brasil,2 Departamento de Ciências Exatas e da terra – Campus Diadema - Universidade Federal de São Paulo, Brasil,3 Departamento de Ciências Biológicas, Campus Diadema - Universidade Federal de São Paulo, Brasil,4 Disciplina de Oncologia/Hematologia – Departamento de Clinica Médica da Faculdade de Medicina do ABC, Brasil.

510



collected by an electric shock method to stimulate the honeybee to sting the surface of the collector sheet and then is gathered to freeze dry (7).

Bee venom holds a variety of peptides, inclu-ding melittin, apamine, adolapin, and peptides which are able to induce mastocytes degranulation (8). In addition, phospholipase A2, histamine and non-peptidic components (9) can also be found in the bee venom. Hait et al. demonstrated that me-littin is a potent inhibitor of calmodulin activity, and as such, also a potent inhibitor of cell growth (8,10,11). The drugs which inhibit the calmodulin activity also inhibit the DNA synthesis in gliobla-stoma cell lines. Experimental bee venom I.V. ad-ministration reduced the number of lung metasta-sis in breast carcinoma, something not observed when the drug was S.C. administered (12). Studies have demonstrated the ability of BV and its major fraction, melittin, to induce an increase in GC le-vels, which may be responsible for its anti-inflam-matory action (13). No studies were made on the bee venom action on the Ehrlich tumor.

The purposes of this study were to evaluate the evolution of Ehrlich tumor-bearing mice when treated with bee venom and also to evaluate the bee venom action on the macrophage phagocytic activity.

Methods

1. Study on the phagocytosis of the peritoneal macrophages treated with bee venom

Male mice (Mus musculus, albinus, Swiss), specific pathogen free, weighing 40 g, respecti-vely, were acquired from the Central Biotery of Universidade de São Paulo. The animals were kept in polyethylene boxes (n = 5), in a climatic environment (21± 2 ◦C), with air humidity control, in 12 h/shifts with dark/light control, with food and water ad libitum, for at least 7 days before the experiments. This study was conducted according to internationally accepted principles of labora-tory animal use.

The animals were divided into four groups:1. Control group: 5 mice received saline

solution (0.9%) – 2 ml / day, administered subcutaneously (s.c.);

2. Bee Venom Group 1: 5 mice received 1.0 mg / kg / day of bee venom, s.c. administration;

3. Bee Venom Group 2: 5 mice received 0.7 mg / kg / day of bee venom, s.c. administration;

4. Bee Venom Group 3: 5 mice received 0.4 mg / kg / day of bee venom, S.C. administration.

On the eighth day of treatment, the animals re-ceived 1ml of 3% sodium thioglycolate (i.p.) to induce the macrophages attraction into the perito-neal cavity (14). Five days later, the animals were sacrificed in a carbon dioxide chamber and the pe-ritoneal exudate of each mouse was obtained and the macrophage phagocytic analysis was perfor-med using neutral red dye.

The analysis was according to the protocol established by Cao et al (15). The macrophages were obtained from the exudates, washed twice with saline solution and resuspended in RPMI-1640 containing 10% fetal bovine serum. The ce-lls were incubated in a microplate at 37° C, under humid atmosphere, and 5% CO2 for two hours, in such a way that the macrophages could adhere to the culture medium.

The supernatant was then discarded and 10µL of 0.075% neutral red dye was added and incu-bated for over an hour. Afterwards the cells were washed three times in PBS (saline solution) and incubated in lyses buffer (1 mol/L of 1:1 acetic acid: ethanol mixture) overnight. The outcome was determined by spectrophotometry, at a wa-velength of 540 nm. The results were analyzed through variance analyses (ANOVA) by using the GBstat software program.

2. Evaluation of the survival time of Ehrlich tumor-bearing mice treated with bee venom

Three groups (n= 10) OF adult male Swiss mice, averaging 40g in weight were used. The Ehrlich tumor was kept in its ascitic form. In or-der to conduct the experiment, a liquid sample was removed aseptically. An aliquot was stained in Turk’s dye and the number of cells / mL was de-



termined by the Neubauer chamber counting pro-cedure. A dilution with saline solution was made in such a way that it would contain 5 X10 cells/mL. All the animals were inoculated with 0.1 mL of the solution intraperitoneally. The animals were divided into three groups:

1. Control group: 10 animals; treated with 0.2 mL of 0.9% saline solution (i.p.);

2. Bee venom group I: 10 animals; received 0.7 mg/kg/day of bee venom, (i.p.);

3. Bee venom group II: 10 animals; received 1.0 mg/kg/day of bee venom, (i.p.).

The animals were observed for a 30 days peri-od. Deaths reported and final results were analy-zed by the Mantel-Haenszel test, using the GBstat software.

Results

1. Study on the phagocytosis of the peritoneal macrophages treated with bee venom

The results were obtained in absorbance form (A), at a wavelength of 540 nm, and can be found on tables 1 and 2.

We could observe, in relation to the animals from the control group, an increase in the pha-gocytary activity of macrophages in the group of mice treated with bee venom. No difference was observed among the animals treated with 0.7 mg/kg in relation to the ones treated with 1.0 mg/kg.

The animals which were treated with 0.4 mg/kg of weight presented a significant difference in the phagocytosis of the peritoneal macrophages in relation to those of the control group.

Table 1. Absorbencies obtained through spectrophotometric analysis of the neutral red phagocytosis of macrophages in mice treated with bee venom and saline solution (SS)

Animals Control Group (SS) Bee Venom 1.0 mg/kg Bee Venom 0.7 mg/kg Bee Venom 0.4 mg/kg1 0.107 0.153 0.156 0.0782 0.079 0.085 0.185 0.0913 0.085 0.160 0.128 0.1274 0.053 0.184 0.187 0.1045 0.098 0.179 0.118 0.084

Mean ± SD 0.084 ± 0,02 0.155 ± 0,03* 0.152 ± 0,04* 0.081 ± 0.02** p < 0.01 in relation to the control group. SD = standard deviation

Table 2. Survival time of Ehrlich tumor-bearing mice treated with saline solution (ss) and bee venom

DaysControl Group (SS) Bee Venom Group 0.7 mg/kg Bee Venom Group 1.0 mg/kg

Deaths Total Number of Living Mice Deaths Total Number of

Living Mice Deaths Total Number of Living Mice

6 0 10 0 10 0 107 0 10 1 9 1 98 0 10 1 8 0 99 1 9 0 8 2 710 0 9 0 8 0 711 0 9 1 7 3 412 0 9 2 5 1 313 0 9 2 3 0 314 1 8 1 2 0 315 1 7 0 2 1 216 0 7 0 2 0 217 4 3 1 1 1 118 1 2 0 1 0 119 2 0 0 1 0 120 0 0 0 1 0 121 0 0 1 0 0 1

512



2. Evaluation of the survival time of Ehrlich tumor-bearing mice treated with bee venom

The results obtained can be found in table num-ber 2.

The statistical analysis of the survival time of Ehrlich tumor-bearing mice did not show signi-ficant alterations between those treated with bee venom or saline solution.

Discussion

The immunotherapy applied to neoplastic dise-ases is based on the observation that malign tumor cells and normal cells in corresponding tissues have different membrane antigens. In the afferent immune system the macrophage plays a key role as the antigen-presenting cell and it may exert a direct cytoxic activity (16,17,18,19,20). Tumor cell remains are phagocytosed, processed and pre-sented to the specific immune system. The natural macrophagic antitumor activity is low, but it incre-ases considerably when activated by lymphokines, especially IFN-gamma and endotoxins among ot-her substances (21). However, other studies have shown a negative activity of the macrophages over the tumor evolution (22,23,24,25). Cytokines li-berated by the tumor may alter the action of the macrophages which would act by decreasing the T-cells activity and the natural killer cells (NK ce-lls) response. (26,27,28) Therefore, the increase in the macrophages activity will not always result in a better immune response against the tumors.

Bee venom has high molecular weight com-pounds which can stimulate the immune system, specially the macrophagic cells. Therefore, it may be used as a immunostimulant (29). A great num-ber of works show remarkable results of the action of bee venom on inflammatory diseases (30). Ani-mals treated with bee venom presented an increase in the peritoneal macrophages activity in the dose of 0.7 to 1.0 mg/kg. Despite this immunostimulant effect, the increase in the survival time of Ehrlich tumor-bearing mice treated with the venom was not statistically significant. In other hand, the gro-up treated with bee venom has presented a 10% life expectancy over the control group. Conside-ring the assay, it can be suggested that the use of

bee venom in cancer patients can be effective to increase it in a mild expectancy. However, the use of bee venom associated with anticancer drug the-rapy can override this life expectancy more than we have detected. In vitro and in vivo studies show the bee venom antitumoral effects in mice inoculated with mammary carcinoma and melano-ma cells (31,32). Those inoculated with melano-ma cells used up to 9 mg/kg doses (31), high abo-ve the doses we used. The mice inoculated with mammary cells developed a smaller number of lung metastases when the bee venom was endove-nously administrated. No reduction was observed when the drug was subcutaneously injected (32). Recent studies show that bee venom induces the apoptosis through caspase-3 activation in synovi-al fibroblasts (33) and the inhibition of the cyclo-oxygenase 2 (COX2) in human tumor cells (34). Another recent study showed that bee venom and melittin induce the apoptosis in vessel muscle ce-lls through the NF-k beta factor suppression, the Akt activation and the Blc-2 down regulation (35).

Therefore, new studies need to be performed to better identify effective doses for tumor inhibition and the mechanisms involved in the process.



References

1. Baiochi E, Bigonha JG, Heymann RE et al. Estró-geno em Tumor de Ehrlich: estudo da sobrevida e avaliação da resposta imunológica Arq.Med.ABC 1985; 9(1-2):22-7.

2. Ngwenya BZ, Fiavey NP, Mogashoa MM. Anti-neo-plastic action of peritoneal macrophages following oral administration of ether analogues of lysophos-pholipids. Eur J Cancer. 1992; 28A(10):1637-42.

3. D.J. Son, J.W. Lee, Y.H. Lee, H.S. Song, C.K. Lee and J.T. Hong, Therapeutic application of anti-arthritis, pain-releasing, and anti-cancer effects of bee venom and its constituent compounds, Pharma-col. Ther. 115 (2007), pp. 246–270

4. M.S. Lee, M.H. Pittler, B.C. Shin, J.C. Kong and E. Ernst, Bee venom acupuncture for musculoskeletal pain: a review, J. Pain 9 (2008), pp. 289–297.

5. K. Ghabili, M.M. Shoja and M. Parvizi, Bee venom therapy: a probable etiology of aneurysm formation in aorta, Med. Hypotheses 73 (2009), pp. 459–460.

6. R.M. De Abreu, R.L. Silva de Moraes and M.I. Camargo-Mathias, Biochemical and cytochemi-cal studies of the enzymatic activity of the venom glands of workers of honey bee Apis mellifera L. (Hymenoptera, Apidae), Micron 41 (2010), pp. 172–175.

7. J. Ying, W.X. Chen, X. Sun, Study on the stability of injection Apis mellifera by purified, Chin. J. Bio-chem. Pharm. 15 (1994) 275–276.

8. Lee, G.L, Hait WN. Growth inhibition of C6 astro-cytoma cells by inhibitions of calmodulin. Life Sci. 1985; 36: 347–354.

9. Lariviere WR, Melzack R. The bee venom test: a new tonic-pain test. Pain 1996;66:271–7.

10. Hait WN, Cadman E, Benz C, Cole J, Weiss B. Inhibition of growth of L1210 cyclic leukemic cells by inhibistors of nucleotide phosphodieste-rase and calmodulin. Proc. Am. Assoc. Cancer Res.1983; 2: 5–9.

11. Hait WN, Grais L, Benz C, Cadman, EC,. Inhibi-tion of growth of leukemic cells by inhibitors of calmodulin: phenothiazines and melittin. Cancer Chemother. Pharmacol. 1985; 14:202–205.

12. Orsolic N, Sver L, Verstovsek S, Terzic IS. Basic Inhibition of mammary carcinoma cell prolifera-tion in vitro and tumor growth in vivo by bee ve-nom. Toxicon, 2003; 41: 861-70.

13. Kwon, Y.B., Kim, H.W., Ham, T.W., Yoon, S.Y., Roh, D.H., Han, H.J., Beitz, A.J., Yang, I.S., Lee, J.H., 2003. The anti-inflammatory effect of bee ve-nom stimulation in a mouse air pouch model is mediated by adrenal medullary activity. Journal of Neuroendocrinology 15, 93–96.

14. Rothlein, R, Springer TA. Complement receptor type three-dependent degradation of opsonized erythrocytes by mouse macrophages; J. Immunol, 1985; 135 (4): 2668-72.

15. Qi-zhen CAO, Zhi-bin LIN. Antitumor and anti-angiogenic activity of Ganoderma lucidum po-lysaccharides peptide Acta Pharmacol Sin 2004 Jun; 25 (6): 833-838.

16. Herberman R B, Holden HT, Djeu JY, Jerrells TR, Varesio L, Tagliabue A, White S L, Oehler JR, Dean JH. Macrophages as regulators of im-mune responses against tumors. Adv. Exp. Med. Biol.1980;121B: 361–379.

17. Fidler IJ, Schroit AJ. Recognition and destruction of neoplastic cells by activated macrophages: dis-crimation of altered self. Biochim. Biophys. Acta 1988; 948:151–173.

18. Bonta IL, Ben-Efraim S. Involvement of inflamma-tory mediators in macrophage antitumor activity. J. Leukoc. Biol. 1993; 54: 613–626.

19. Lariviere WR, Melzack R. The bee venom test: a new tonic-pain test. Pain 1996;66:271–7.

20. Hait WN, Cadman E, Benz C, Cole J, Weiss B. Inhibition of growth of L1210 cyclic leukemic cells by inhibistors of nucleotide phosphodieste-rase and calmodulin. Proc. Am. Assoc. Cancer Res.1983; 2: 5–9.

21. Hait WN, Grais L, Benz C, Cadman, EC,. Inhibi-tion of growth of leukemic cells by inhibitors of calmodulin: phenothiazines and melittin. Cancer Chemother. Pharmacol. 1985; 14:202–205.

22. Orsolic N, Sver L, Verstovsek S, Terzic IS. Basic Inhibition of mammary carcinoma cell prolifera-tion in vitro and tumor growth in vivo by bee ve-nom. Toxicon, 2003; 41: 861-70.

23. Bonta IL, Ben-Efraim S. Involvement of inflamma-tory mediators in macrophage antitumor activity. J. Leukoc. Biol. 1993; 54: 613–626.

24. Sunderkotter C, Steinbrink K, Goebeler M, Bhar-dwaj R, Sorg C. Macrophages and angiogenesis. J. Leukoc. Biol. 1994; 55: 410–422.

514



25. Parajuli P, Singh SM. Alteration in IL-1 and ar-ginase activity of tumor-associated macrophages: a role in the promotion of tumor growth. Cancer Lett. 1996; 107:249–256.

26. Elgert KD, Farrar WL. In vitro immune blastoge-nesis during contact sensitivity in tumor-bearing mice. I. Description of progressive impairment and demonstration of splenic suppressor cells. Cell. Immunol.1978; 40: 356–364.

27. Aoe T, Okamoto Y, Saito T. Activated macropha-ges induce structural abnormalities of the T cells receptor-CD3 complex. J. Exp.Med. 1995; 181: 1881–1886.

28. Aso H, Tamura K, Yoshie O, Nakamura T, Kiku-chi S, Ishida N. Impaired NK response of cancer patients to IFN-a but not to IL-2: correlation with serum immunosuppressive acidic protein (IAP) and role of suppressor macrophage. Microbiol. Immunol.1992; 36:1087–1097.

29. Mantovani AP, Araújo ES, Brandeburgo Mal-con AM. Efeito do veneno de abelhas A. melli-fera no desenvolvimento de tumor; Biosci. J. 2002;18(2):83-85.

30. Park HJ, Lee SH, Son DJ, Oh KW, Kim KH, Song HS, et al Antiarthritic effect of bee venom: inhibi-tion of inflammation mediator generation by su-ppression of NF-κB through interaction with the p50 subunit. Arthritis Rheum 2004; 50:3504–15.

31. Liu X, Chen D, Xie L, Zhang R. Effect of honey bee venom on proliferation of K1735M2 mou-se melanoma cells in vitro and growth of muri-ne B16 melanomas in vivo. J Pharm Pharmacol 2002;54:1083–9.

32. Orsolic N, Sver L, Verstovsek S, Terzic S, Basic I. Inhibition of mammary carcinoma cell prolife-ration in vitro and tumor growth in vivo by bee venom. Toxicon 2003;41:861–70.

33. Hong SJ, Rim GS, Yang HI, Yin CS, Koh HG, Jang MH, et al. Bee venom induces apoptosis through caspase-3 activation in synovial fibrobla-sts of patients with rheumatoid arthritis. Toxicon 2005;46:39–45.

34. Jang MH, Shin MC, Lim S, Han SM, Park HJ, Shin I, et al. Bee venom induces apoptosis and inhibits expression of cyclooxygenase-2 mRNA in human lung cancer cell line NCI-H1299.J Phar-macol Sci 2003;91:95–104.

35. Son DJ, Ha SJ, Song HS, Lim Y, Yun YP, Moon DC, et al. Melittin inhibits vascular smooth musc-le cell proliferation through induction of apopto-sis via suppression of NF-κB and Akt activation and enhancement of apoptotic protein expression. J Pharmacol Exp Ther 2006;317:627–34.

Corresponding author Fernando Luiz Affonso Fonseca, Universidade Federal de São Paulo Campus Diadema, Brasil, E-mail: [email protected], [email protected]



Abstract

Aim: Good communication is associated with improved health of patients and empathy is a cor-nerstone of physician–patient communication. Medical education seems to be ineffective in hel-ping students to maintain or increase their empa-thy. Some of benefits of Problem Based Learning (PBL) are about communication and interpersonal skills. This study aims to determine the effect of a PBL scenario on attitudes towards communicati-on skills, the empathic tendency and the empathic skills of 1st year medical students.

Materials and Methods: Attitude changes af-ter the PBL scenario were evaluated via Commu-nication Skills Attitude Scale (CSAS), Empathic Tendency Scale (ETS) and Empathic Skill Scale (ESS).

Results: The positive attitude change was si-gnificant for male students (p=0.03). The means of ETS scores were 68.42±8.28 and 69.18±8.53 (p=0.36) and the means of ESS scores were 131.16±17.28 and 133.30±18.35 in the pre and post-tests, respectively (p=0.22). The ESS scores of male students both in pre and post tests were significantly higher than female students (p=0.00). A significant negative correlation between NAS and ETS and a positive correlation between PAS and ETS in both tests were determined.

Conclusion: This scenario significantly incre-ased positive attitudes (PAS) of students towards communication skills. There was also an increase in empathic tendency and skills.

Key words: Empathy, Communication, Edu-cation, Medical, Preclinical, Problem Based Le-arning.

Introduction

Co-partnership of professional changes and increased patient expectations is urging doctors to be skilled communicators (1). Outcomes of a good communication such as trust, mutual under-standing, adherence, social support and self-effi-cacy are associated with improved health of pati-ents (2). Communication is an interactive process (3). The empathic response is essential for a good communication and should include effectiveness in eliciting information about patient beliefs and feelings, and conveying respect and caring (4). Empathy is defined as the capability to share and understand another’s emotion and feelings and is one of the cornerstones of the physician–patient relationship (5,6).

Although medical students enter medical school with a desire to care for people in need as a result of challenges they faced particularly during their clini-cal training they become less empathic toward their patients (7,8). Consequently, major task of medical educators which is to help maintain and increase empathy for patient becomes ineffective (7). It is important for entry-level students to draw connec-tions between the communication skills and perfor-mance quality in clinical practice (4).

Communication skills, empathy, and altruism are also believed to improve besides the percei-ved intellectual benefits of PBL such as problem definition, problem identification, data gathering, problem solving, or critical analysis etc. Learners supposed to acquire a broader perspective and an ability to integrate psychosocial, ethical, and le-gal aspects of medicine (9,10). Problem-based learning supports communication, interpersonal

Looking for winds of change with a PBL scenario about communication and empathy Nazan Karaoglu, Muzaffer Seker

Medical Education and Informatics Department, Selcuk University, Meram Medical Faculty, Konya, Turkey

516



skills teamwork and profession-specific methods (11,12). But there is not an available data on the effect of PBL scenarios on attitudes towards co-mmunication and empathic tendency and skills. Firstly, this study aims to determine the effect of a PBL scenario written uniquely for this aim on atti-tudes towards communication skills, the empathic tendency and the empathic skills of 1st year me-dical students’. Secondly, the correlation between attitudes towards communication skills, empathic tendency and empathic skills and gender differen-ce were aimed to be analyzed.

Methods

Setting: This study was carried out in Selcuk University in 2009.

The Scenario: The curriculum of our faculty of medicine has three scenarios consisting of three sessions for first year students each year. For one of the PBL scenarios Medical Education and In-formatics Department planned to schedule a sce-nario mainly depending on communication and empathy. Faculty wrote a scenario documenting patient-doctor, doctor-doctor, doctor-health care personnel, doctor-patient relatives and health per-sonnel-patient relatives’ conversations with their own words mimicking real life. There were bad manners and communications; bad conversations even slang expressions, unprofessional behaviors besides family problems, stress at work or burn-out etc. Within the scenario step by step more de-tails about personal lives of every character were given and some apologies for their behaviors were claimed. For example; a resident with lots of work to do and in burn out and a very passive patient even not asking what her problem was etc. were described and students asked to discuss the situa-tion from the residents’ and patients’ view. There was nothing in the scenario mentioned as correct or wrong. It only mimicked the real life with some words and reactions depending on scenario wri-ters’ personal experiences and media news about hospitals or other health care facilities.

Scales

The Communication Skills Attitude Sca-le (CSAS): It was designed to measure medical students’ attitudes towards communication skills learning (13). The scale consists of 26 items with two subscales, each with 13 items. The first subs-cale represents positive attitudes (PAS) and the se-cond subscale represents negative attitudes (NAS) towards communication skills learning. All the 26 items are accompanied by 5-point Likert scales ranging from 1 (strongly disagree) to 5 (strongly agree). Two scores can be determined from the CSAS: the total positive attitude scale (PAS) score and the total negative attitude scale (NAS) score (13). The validated Turkish version of the CSAS was used for this study (14).

Empathic Tendency Scale (ETS): Ustun Do-kmen; the designer of the scales noted that empathy has mainly two parts; 1-cognitive (imaginative), 2- affective (emotional/vicarious). Cognitive empathy defined as “understanding the others’ feelings” whi-le affective empathy defined as “feeling the others’ feelings”. ETS mostly evaluates affective part of empathy. In other words ETS evaluates the potenti-al of a person about being empathic in daily life. It generally depends on our natural characteristics and individual experiences (5). The scale is in Turkish and reliability and validity of the scale was made by the designer5. This self reported 5-point Likert scale consists of 20 items. Eight items need to be rever-sed while calculating the score. Scores of the scale range from 20 to 100, with higher scores indicating higher empathic tendency.

Empathic Skill Scale (ESS): ESS is about the cognitive part of empathy. ESS evaluates the empa-thic responses of individuals in daily life with some sentences from daily life events. It has six defined situations from daily life and has 12 responses for each problem (5). In the scale situations are repor-ted from a house wife, a friend, a close friend, a teen age, a young girl and a student. After the situation described for these persons 12 responses are given for each situation. And the respondents choose four of the responses given among 12.

There is also an unrelated response which shows that the respondent chose the response hap-hazardly. Unrelated response in the scale gives occasion to the elimination of the questionnaire of



that respondent. To sum up for six situations 24 responsive sentences should be chosen. Reliability and validity of the scale was made by the designer. The scale has a special scoring table. The higher total scores show the higher empathic skill and scores of the scale range from 62 to 219 (5).

Study Design: Five of the first year students were foreign students so they eliminated in the first step because their native language was not Turkish. The other students and tutors were giv-en information about the objectives of the study, anonymity was maintained, and the students were free to either participate or refuse to do so. Af-ter oral informed consent students completed the questionnaire before (pre test) and after (post test) the PBL session. While all data were anonymous, students’ pre- and posttest scores could be com-pared. This study approved by the Ethical Com-mittee of the Faculty.

Statistical Analyses: Data were analyzed using SPSS version 10.0. While categorical vari-ables were presented as numbers and percentages the continuous variables expressed as means with standard deviations. The association of the depen-dent variables (PAS, NAS, ETS and ESS) with the independent variable, gender, was determined. Student t-test was used for comparison of continu-ous variables and correlation analyses were made for the correlation between NAS, PAS, ETS and ESS. All tests were two tailed and p<0.05 accep-ted as statistically significant.

Results

After elimination of five foreign students the questionnaire distributed to all first year students (n=282). In the pre test 272 students (96.4%) and in the post test 259 students (91.8%) participated to the study. But after eliminating haphazardly si-gned questionnaires according to special scoring table of ESS, 215 (76.2%) questionnaires in the pretest and 195 (69.1%) questionnaires in the post test were evaluated. The female ratio was 45.1% and 47.2% in the pre and post tests, respectively. Although there was a significant increase in the PAS scores of the all group (p=0.00), NAS score change was not significant (p=0.16). The mean of ETS scores were 68.42±8.28 and 69.18±8.53 in pre and post tests (p=0.36). There were a non-significant increase in ETS scores of the male students’ (p=0.20). The mean of ESS scores were 131.16±17.28 and 133.30±18.35 in the pre and post-tests, respectively (p=0.22). Gender distribu-tion, NAS, PAS, ETS, and ESS scores are shown in table 1.

While the mean of pre-test ETS score of fe-males was 67.90±7.99, the mean of post-test ETS score was 69.33±8.51 (p=0.97). The ESS scores of male students were significantly higher than females both in pre and post tests (p=0.00). Ta-ble 2 shows the NAS, PAS, ETS and ESS scores according to gender and comparison of scores in pre and post tests.

Table 1. Comparison of negative (NAS), positive (PAS) attitudes towards communication skills, empa-thic tendency (ETS) and empathic skill (ESS) scores of first year medical students in pre and posttests with student t-test

Pre-testn %*

Post-testn %* p

Gender ♂ ♀

118 54.997 45.1

103 52.892 47.2

Negative Attitude Scale (NAS) 24.29±4.56 25.01±5.72 0.16**

Positive Attitude Scale (PAS) 58.30±6.67 60.30±7.20 0.00**

Empathic Tendency Scale (ETS) 68.42±8.28 69.18±8.53 0.36**

Empathic Skill Scale (ESS) 131.16±17.28 133.30±18.35 0.22**

TOTAL 215 100.0 195 100.0*Column percentage** Student t-test

518



Although there were a negative correlation between NAS and PAS and ETS besides a posi-tive correlation between PAS and ETS, there was no correlation between ESS and others. In table 3 the correlations of NAS, PAS, ETS and ESS in pre and post tests are represented.

Discussion

To develop, test, and implement methods of ha-ving real patients gauge to the interpersonal and communication skills of the students and physici-ans is important for educators (15). PBL cases are supposed to improve communication skills, and empathy with a broader perspective of the case (9). But some author claims that the cases used

in PBL may unnecessarily, even unintentionally, encourage student detachment from the messiness of real patients’ lives and emotions by positioning a particular way of seeing, the doctor’s view. Au-thors advised to enrich the case by including mul-tiple voices (16). Similarly, in the scenario we dis-cussed here more detailed stories of the characters were used instead of deepening in the story of the illness. With the aim of changing the perspective of the doctor to perspectives of doctors, colleagu-es, patients, patient’s relatives, nurses’ etc. scena-rio were detailed with their perspectives. In sum we tried to change the doctors’ view to others’ view and let the students to discuss the situations we created in the scenario. Let us give some deta-ils from the scenario; there was a female patient admitted to general surgery outpatient clinic with

Table 2. Comparison of negative and positive attitudes empathic tendencies and empathic skills of first year medical faculty students in respect to gender in pre and post tests

♂Pre-test Post-test p ♀

Pre-test Post-test p PPre-test Post-test

Negative Attitude Scale (NAS) 24.74±4.22 24.96±5.54 0.74 23.74±4.91 25.07±5.94 0.09 0.10 0.88

Positive Attitude Scale (PAS) 57.85±6.71 59.80±7.20 0.03 58.84±6.61 60.47±7.23 0.10 0.28 0.51

Empathic Tendency Scale (ETS) 67.90±7.99 69.33±8.51 0.20 69.06±8.61 69.02±8.59 0.97 0.31 0.80

Empathic Skill Scale (ESS) 134.05±17.43 136.97±17.97 0.22 127.63±16.49 129.19±17.98 0.53 0.00 0.00

TOTAL 118 100.0 103 100.0 97 100.0 92 100.0

Table 3. Correlation between negative/positive attitudes towards communication skills and empathic tendency and empathic skills in pre and post tests

Pre-test Post-testNAS PAS ETS ESS NAS PAS ETS ESS

NAS Pearson correlationp

- - 0.573*

0.000- 0.222*

0.0010.1190.082

- - 0.489*

0.000- 0.256*

0.0000.0290.690

PAS Pearson correlationp

- 0.573*

0.000- 0.200*

0.003- 0.0430.531

- 0.489*

0.000- 0.242*

0.0010.0180.798

ETS Pearson correlationp

- 0.222*

0.0010.200*

0.003- 0.117

0.088- 0.256*

0.0000.242*

0.001- 0.017

0.812

ESS Pearson correlationp

0.1190.082

- 0.0430.531

0.1170.088

- 0.0290.690

0.0180.798

0.0170.812

-

*Correlation is significant at the 0.01 level (2-tailed)



a nodule in her breast. The resident was too busy, tired and ordered the patient to take off her clothes for a biopsy. The patient was afraid of but asked or said nothing but she just cried. Resident wit-hout seeing that she was crying, shouted her to be quick. Husband of the patient was waiting outside and wondered his wife and asked the nurse. The nurse of the policlinic was making a telephone call with the sick mom who was near to die. Harshly she wanted him to wait. Husband shouted, nurse shouted and at the end husband opened the door, saw his wife naked, crying and trying to close her breast with her arms and pounded the resident. And the events go on. In every situation students discussed the matter with the group and tried to understand the feelings of the characters and tri-ed to feel what the characters felt. They mainly did not discuss the medical errors or they did not request to select a right or wrong response. Beca-use empathy doesn’t mean to be empathic just for pain, it means to understand and feel just what the other feels no matter what it is; anger, suffering, tiredness, happiness or jealousy etc. (5).

In a study comparing one PBL and four non-PBL school’s graduates, the majority of the PBL graduates, but less than half of the non-PBL gra-duates, indicated that communication skills had been covered sufficiently during medical training (12). In another study evaluating effects of PBL after graduation showed that the social dimension showed the strongest evidence in support of PBL (11). In a study from Turkey, the total conflict re-solution skills scores and sub-scale (empathy, li-stening skills, requirement-based approach, social adaptation and anger management) scores of the students educated by PBL were significantly hi-gher than those educated by the conventional met-hods (17). In contrary to other studies our study shows the effect of just a scenario in a PBL im-plemented curriculum, not evaluating the whole effect of PBL curriculum and it is unique in this category. The positive attitude change after the scenario, the increase in empathic tendency and empathic skill scores with the scenario were si-milar with the recent studies (11,17). We may say that with PBL scenarios especially in the social di-mensions we can create an atmosphere to discuss the different perspectives before students begin to clinical years.

Although there was an increase in ETS and ESS scores in pre and post-tests the differences were not significant (p>0.05). Especially empathic tendency needs time. It may be attributed to the time limited to PBL session because it is known that empathy couldn’t be thought systematically and it takes time to develop and sustain (5). As mentioned before communication skills education is not encapsulated by a particular span of weeks or readings within the curriculum that highlight this topic (15). The PBL sessions duration is three half days in a week. So it is a very limited time to gain empathic tendency and skills. But in contrast to limited time there was an increase both in em-pathic tendency and skills.

Some authors suggest that empathy decrea-ses after clinical training in medical school while medical students trying to relieve their anxiety of confronting illness and suffering (6,8,18). As an author noted by giving a chance to tolerance and recognition of imperfection in self and others it might be easier to help students understand and accept that we are all wounded, all imperfect. Fee-ling compassion rather than fear against the dif-ficult realities of the human condition may form the core for formulating a deep and lasting em-pathy according to same author (7). In especially preclinical years of education for the students not facing with real patients we have unique teaching times for empathy and communication with PBL scenarios reflecting the real life. Similarly, with this scenario consisting of imperfect and wounded characters we supposed to increase empathy stu-dents’ empathy.

Especially adult education needs volunteer le-arners but unfortunately when it comes to commu-nication skills, studies show that medical students are in doubt of learning communication skills that they saw it ‘non-academic’ and ‘common sen-se’ (19-21). With the scenario we reported herein we gave a social aspect as a problem instead of a medical problem to reinforce them to think about human as a social being in an academic approach. Similarly, negative attitude of females’ increased and negative attitude of males was not changed towards communication skills learning. Some previous studies support that female students have higher positive attitudes and lower negative atti-tudes towards communication skills than males

520



(22,23). In contrary, another study found no gen-der difference in positive attitudes towards com-munication skills learning (24). A cross-sectional study with medical students at Boston University in 2006 showed that females had higher empat-hy scores than males (6). Similarly, in this study empathic tendency of the females were higher but interestingly males had significantly higher empa-thic skills in both tests. What it means? Female students were more easily feeling the others fee-lings from the beginning but they were in lack of showing empathic responses and the scenario con-tributed them not. In contrary, male students were understanding the others’ feelings more although they were feeling the others feelings less and more prone to show empathic responses. These results may also show the difference between emotional and cognitive empathy. One may show empathy although he or she is not feeling the other’s fee-lings. In other words giving empathic responses may not be the result of feeling empathy. As no-ted before cognitive empathy is a skill and can be learnt and taught more easily (5). But there is a lack of literature about this issue to make a com-parison. And it is also apparent in correlation sta-tistics. Although there was a significant negative correlation between NAS and ETS and positive correlation between PAS and ETS in both tests, no significant correlation was present between ESS and NAS, PAS or ETS. As the designer of the ETS and ESS noted ETS mostly evaluates emotional part and ESS mostly evaluates cognitive part of empathy and there was a significant but limited correlation between them (5). But in contrast, a previous study reported a positive association between the empathy score on the empathy scale in medical school and ratings of their empathic be-havior made by residency program director three years later (18). It is important from educational view questioning which part of it we must teach to our students. Similarly, Newton et al. classify em-pathy as vicarious and imaginative and note that undergraduate medical education significantly de-creases students’ vicarious empathy (25). Is medi-cal education changing students to actors who are getting various characteristics for their roles but not feeling the characters deeply? Is it possible to show empathy to a mother crying for the death of her baby without feeling the mothers’ sorrow? Is it

humanistic? May be these are the questions to be discussed and responded in future studies.

Teaching a patient-centered interview, listening patient’s concerns were the main advices suggested for establishing empathy and humanism (26). The importance of interesting training sessions pointing out the importance of communication skills for a fu-ture medical career was mentioned before (24). We think that this study should be evaluated as one of the examples of these interesting training sessions.

In conclusion, the effect of this PBL scenario seemed significantly in PAS scores although there were increase in ETS and ESS. The significant in-crease in PAS scores of male students in post test and significantly higher ESS scores of males in both pre and post tests were the main findings new for the literature and should be investigated further.

References

1. Hargie O, Dickson D, Boohan M, Hughes K. A sur-vey of communication skills training in UK Schools of Medicine: present practices and prospective pro-posals. Med Educ 1998; 32: 25-34.

2. Street Jr. RL, Makoul G, Arora NK, Epstein RM. How does communication heal? Pathways linking clinician–patient communication to health outco-mes. Patient Educ Couns 2009; 74: 295-301.

3. Van Dalen J, Bartholomeus P, Kerkhofs E, Lulofs R, Van Thiel J, Rethans J, et al. Teaching and asse-ssing communication skills in Maastricht: the first twenty years. Med Teach 2001; 23: 245-51.

4. Winefield HR, Chur-Hansen A. Evaluating the out-come of communication skill teaching for entry-le-vel medical students: does knowledge of empathy increase? Med Educ 2000; 34: 90-4.

5. Dökmen Ü. Empatinin yeni bir modele dayanılarak ölçülmesi ve psikodrama ile geliştirilmesi (in Tur-kish). Ankara Üniversitesi Egitim Bilimleri Fakül-tesi Dergisi 1988;11: 155-90.

6. Chen D, Lew R, Hershman W, Orlander J. A cross-sectional measurement of medical student empathy. J Gen Intern Med 2007; 22: 1434–8.

7. Shapiro J. Walking a mile in their patients’ shoes: empathy and othering in medical students’ educati-on. Philosophy, Ethics, and Humanities in Medici-ne 2008; 3:10.



8. Rosenfield PJ, Jones L. Striking a balance: training medical students to provide empathetic care. Med Educ 2004; 38: 927–33.

9. Amin Z, Khoo HE. Basics in medical education. Singapore: World Scientific Publishing Co. Pte. Ltd.; 2003.

10. Mete S, Gerçek E. The examination of empathic tendency and skills on nursing students who are educated with PBL method (in Turkish). C.Ü. Hemşirelik Yüksek Okulu Dergisi 2005; 9: 11-7.

11. Koh GC-H, Khoo HE, Wong ML, Koh D. The ef-fects of problem-based learning during medical school on physician competency: a systematic re-view. CMAJ 2008; 178: 34-41.

12. Prince KJ, van Eijs PW, Boshuizen HP, van der Vleuten CP, Scherpbier AJ. General competencies of problem-based learning (PBL) and non-PBL graduates. Med Educ 2005; 39: 394-401.

13. Rees C, Sheard C, Davies S. The development of a scale to measure medical students’ attitudes towards communication skills learning: the Co-mmunication Skills Attitude Scale (CSAS). Med Educ 2002; 36: 141-7.

14. Harlak H, Dereboy C, Gemalmaz A. Validation of a Turkish translation of the Communication Skills Attitude Scale with Turkish medical students. Edu-cation for Health 2008; 21: 1-11.

15. Makoul G. Communication skills: How simulati-on training supplements experiential and huma-nist learning Acad Med 2006; 81:271–4.

16. Kenny NP, Beagan BL. The patient as text: a challenge for problem-based learning. Med Educ 2004; 38: 1071–9.

17. Seren S, Ustun B. Conflict resolution skills of nursing students in problem-based compared to conventional curricula. Nurse Educ Today 2008; 28: 393-400.

18. Hojat M, Mangione S, Nasca TJ, Gonnella JS, Magee M. Empathy scores in medical school and ratings of empathic behavior in residency training 3 years later. J Soc Psychol 2005; 145: 663–72.

19. Rees CE, Sheard CE, McPherson AC. A quali-tative study to explore undergraduate medical students’ attitudes towards communication skills learning. Med Teach 2002; 24: 289-93.

20. Rees CE, Garrud P. Identifying undergraduate medi-cal students’ attitudes towards communication skills learning: a pilot study. Med Teach 2001; 23: 400-6.

21. Dereboy C, Harlak H, Gürel S, Gemalmaz A, Eskin M. Tıp eğitiminde eşduyumu öğretmek. Turk Psikiyatr Derg 2005; 16: 83-9.

22. Rees C, Sheard C. The relationship between me-dical students’ attitudes towards communication skills learning and their demographic and educa-tion-related characteristics. Med Educ 2002; 36: 1017–27.

23. Cleland J, Foster K, Moffat M. Undergraduate students’ attitudes to communication skills lear-ning differ depending on year of study and gender. Med Teach 2005; 27: 246–51.

24. Shankar RP, Dubey AK, Mıshra P, Deshpande VY, Chandrasekhar TS, Shivananda PG. Student atti-tudes towards communication skills training in a medical college in western Nepal. Education for Health 2006; 19: 71- 84.

25. Newton BW, Barber L, Clardy J, Cleveland E, O’Aullivan P. Is there hardening of the heart du-ring medical school? Acad Med 2008; 83: 244-9.

26. Benbassat J, Baumal R. What is empathy, and how can it be promoted during clinical clerkships? Acad Med 2004;79: 832-9.

Corresponding author Nazan Karaoglu, Medical Education and Informatics Department, Selcuk University, Meram Medical Faculty, Turkey, E- mail: [email protected], [email protected]

522



Abstract

Purpose: This pilot study investigated the ef-fects of functional electric stimulation (FES) on the hemiparetic hand in children with cerebral palsy.

Methods: The participants were 13 children with spastic hemiparesis (mean age 5.92, SD 1.32). All children received functional electric stimulation of the wrist extensor muscles for 3 weeks during their physical and occupational the-rapy sessions. Children were assessed at baseline and at three weeks, one and three months after the treatment. Quality of Upper Extremity Skills test (QUEST) has been used for assessing hand functi-on. The testing sessions before and after treatment included wrist extension measurement.

Results: A significant improvement (p<0.001) in wrist extension range of motion was found with an average gain of 11.92 degrees. The QUEST scores showed progress for all the children after the stimu-lation period (p<0.05) and persisted to the follow-up one and three months later (p<0.01, p<0.05).

Conclusion: The results of this study do suggest that FES may be a useful physical therapy tool in improving hand function in children with CP.

Key words: cerebral palsy, functional electri-cal stimulation, upper limb

Introduction

Prevalence of cerebral palsy (CP) is two to three cases per 1000 births (1,2) and about half of these have upper limb impairment (3) that may in-clude spasticity, decreased strength and impaired motor control. The stereotypical posture of wrist

flexion and ulnar deviation, coupled with finger and thumb flexion into the palm, hinders grasp and release (4).

Children with early acquired motor deficits of-ten have difficulty producing selective movements in an affected extremity and it has been suggested that this is due to a form of developmental apraxia caused by defective motor planning in early infancy (5) Stimulation provides feedback to the brain abo-ut the muscles that are activated during therapy. The feedback information facilitates motor learning (6).

Various rehabilitation strategies including physiotherapy, casting, surgery and medication could not always improve motor functioning of the impaired upper extremity (7). Therefore interest in the area of cerebral palsy and electrical stimula-tion continues to grow because it has a potential as a non-invasive, painless, home-based therapy, causes minimal side effects, which is claimed to result in gains strength and motor function (7,8,9).

Electric stimulation applied in a task specific manner, in which a muscle is stimulated when it should be contracting during a functional activity, the stimulation is referred to as functional electri-cal stimulation (FES) (8). It is usually applied as an adjunct to physical therapy in the management of children with neuromuscular impairment to reedu-cate and strengthen muscle and improve gait (10).

Atwater et al. (1991) first published the report on functional electric stimulation of wrist extensor muscles in two children with CP. No significant improvements were found (11).

Case studies by Carmick (1993, 1999) descri-bed increased awareness and spontaneous use of the impaired hand, as well as improved hand grasp and release abilities (12,13).

Functional electric stimulation of children with Cerebral Palsy: a pilot studyCila Demesi-Drljan¹, Aleksandra Mikov¹, Rastislava Krasnik¹, Dea Karaba-Jakovljevic², Karmela Filipovic³, Snezana Tomasevic-Todorovic4

¹ Institute of Children and Youth Health Care of Vojvodina, Faculty of Medicine, Novi Sad, Serbia,² Department of Physiology, Faculty of Medicine, Novi Sad, Serbia,³ Hospital for Rheumatic Diseases, Novi Sad, Serbia,4 Clinic for Medical Rehabilitation, Clinic Center of Vojvodina, Novi Sad, Serbia.



Wright and Granat used FES on the upper limb of children with hemiplegic CP in order to inve-stigate the effect of cyclic FES on the wrist exten-sor muscles. The results of this study suggested improvements in hand function and active wrist extension (7).

Thus, there is a suggestion that FES could be a useful therapy for children with hemiplegic CP.

The aim of this study was to investigate the ef-fects of FES on the hemiparetic hand in children with CP.

Methods

Participant

Thirteen children (eight males, five females), aged four to eight years with spastic hemiparesis participated in this study. The inclusion criteria were the following: hemiplegic CP, no visual or cognitive impairments (ability to cooperate during therapy and testing sessions), impaired voluntary wrist extension, no previous hand surgery, infor-med consent of the children’s parents. Seven chil-dren did not make the last assessment that took place 3 months after the FES treatment, therefore “long term effects” will be analysed on 6 patients.

Stimulation protocol/Intervention

The participants were recruited at the Clinic for Children’s Habilitation and Rehabilitation, Insti-tute for Child and Adolescent Health Care of Voj-vodina, University of Novi Sad.

The study consisted of a treatment (3 weeks) and a follow-up (3 months) period. During the tre-atment children received FES as an additional the-rapy during their therapy sessions which included individually set occupational therapy and physi-otherapy based on neurodevelopmental therapy principles.

All children received functional electric sti-mulation of the wrist extensor muscles for 15-30 minutes per day, 5 days a week for 3 weeks, for a total of 15 sessions. The FES was applied with two channel of the four channel stimulator (“Acti-Grip”) and three surface disposable electrodes (2

active and 1 inactive). The inactive electrode was placed just above the wrist on the ventral surface of the forearm. One of the active electrode was placed on the lateral border of the dorsal surface of the forearm (near the elbow) while the other active electrode took place above the wrist on the dorsal surface of the forearm. The pulse duration, frequ-ency and pulse amplitude were set to minimize discomfort yet provide externally assisted grasp. The intensitiy of stimulation ranged from 10mA to 40mA, frequency 50Hz, pulse width T 300us.

The FES was combined with movements of re-placing objects of different size and shape (easier to more complicated). The whole movement from taking to releasing the object lasted 20 seconds fo-llowed by a 40 seconds pause. The m. extensor digitorum communis and m. extensor pollicis lon-gus were stimulated just before grasping and du-ring releasment of the object. (Picture 1.)

Picture 1. The electric stimulation of wrist exten-sor muscles before grasping an object (first week of treatment)

Measurement

The Manual Ability Classification System (MACS) has been used to classify how children with CP use their hands when handling objects in daily activities (level 1- best manual ability, level 5- worst manual ability) (14). The Modified As-hworth Scale has been used for assessment of spa-sticity (15).

The evaluation took place before and after the treatment, then 1 month and 3 months after the treatment. At each session the Quality of Upper

524



Extremity Skills (QUEST) test has been used for assessing hand function. The testing sessions be-fore and after treatment included wrist extension measurement as well. It was performed by a stan-dard goniometer.

QUEST measure components of hand function as well as quality of movement. It provides infor-mation related to movement and postural responses. This measure evaluates quality of upper extremity function in four domains: dissociated movement, grasp, protective extension and weight bearing. The QUEST was designed so that scoring is rela-ted to severity of disability irrespective of age. This allows for a young and mild child to score well or an old and severe child to score poorly (16).

Results

Thirteen children meeting the inclusion criteria were enrolled in the study. The baseline characteri-stics of the study group are shown in Table 1. The study group consisted of eight boys (61.54%) and five girls (38.46%), mean age 5.92 years (SD 1.32), eight of them with right hemiparesis (61.54%), five with left hemiparesis (38.46%). Most of the chil-dren (53.85%) were classified as level 1 according to MACS, while others achieved level 2 (23.07 %) and 3 (23.07%). Twelve of thirteen subjects had grade 1 according to Modified Ashworth Scale.

The program of FES was effective in increa-sing wrist extension range of motion (Fig.1) with an average increase of 11.92 (SD 6.62). The im-provement was very significant, p<0.001.

Figure 1. Wrist extension range of motion for thirteen subjects prior to initiation of FES proto-col and after the treatment. (3 weeks later)

Figure 2. The QUEST scores of the thirteen chil-dren throughout the study

The QUEST scores showed progress for all the children immediately after the stimulation period, and this progress persisted to the follow-up one and three months later (Fig. 2).The most prono-unced and significant improvement was observed

Table 1. Basic characteristics of children with hemiparetic CP included in FESParticipant Gender Age Hemiparesis Ashworth MACS

12345678910111213

MMFMMMFMFMMFF

5876667458465

LeftRightRightLeftLeft

RightRightLeft

RightLeft

RightRightRight

1111111121111

1211111132323



one month after treatment as compared to befo-re treatment (p<0.01). It should be noted that the difference was also significant (p<0.05) after the treatment and three months later. However, half of the children did not attend the last assessment se-ssion (3 months after) therefore these results pre-sent only half of the study group.

Anecdotal comments

Parents reported spontaneously that their chil-dren became more aware of his/her hand and that their performance of many typical daily activities had improved and more relaxed upper extremity as well.

Discussion

This study describes the effect of functional electrical stimulation on the paretic hand in chil-dren with CP. The treatment and testing of young children always presents a difficulty, as cooperati-on is expected to be very limited (9). In the present study we managed to encourage cooperation des-pite the young age of subjects by setting the pulse duration, frequency and pulse amplitude to minimi-ze discomfort. The parents high motivation for the children extending wrist and fingers by stimulation was a significant contribution to the lack of dropo-uts from the study during the treatment period.

In our study mean age for all children was 5 years and 9 months. There is an upper age limit of eight years for the QUEST. On the other hand yo-unger children appeared to benefit more markedly from FES (6). The age effect may be explained by the fact that older children have shortened musc-les, which is less amenable to therapy.

The use of electrical stimulation has been shown to produce therapeutic effects: decreased spastici-ty (17), increased movement range and increased muscle strength. (18) Our results showed that the majority of children did demonstrate improvement in wrist extension range of motion following the electrical stimulation program which is in agree-ment with previous studies (4,6,7,19,20,21).

Wright and Granat (2000) suggested that FES of wrist extensors increased the strength of the

muscle and flexibility of the soft tissue around the joint thereby increasing range of motion (ROM) (7). However Kamper et al (2006) did not detect any changes in passive joint resistance. The im-provement was most likely associated with redu-ced coactivation of flexor antagonists as a result of increased reciprocal inhibition (4). Hara (2008) recognized that cerebral blood flow in the sensory motor cortex area on the injured side was increa-sed during the power- assisted FES session. This suggests sensory components as a possible mec-hanism for motor improvement with FES (21).

In our study the QUEST scores measuring hand function and quality of movement showed progress for all children after the stimulation peri-od, and this progress persisted three months later. The results of the present study are in line with the findings of other studies (4,7,12,18,19,20) which demonstrated that FES improved the function of the impaired upper limb. Previous studies sugge-sted that improvement in wrist extension impro-ved hand function, possibly by enabling the use of a better biomechanical position for grasping (7,12, 19). Improvements in hand function may partially result from the increased movement and strength about the wrist (7) or/and the relief of spasticity. Antagonist muscle tone can be decreased by si-multaneous voluntary muscle contraction as well as by reciprocal inhibition of antagonist muscle electrical stimulation (21). Additionally, increased proprioceptive and visual feedback as a result of FES may have contributed to improved hand fun-ction (7,21).

The children may have benefited from renewed focus on the use of impaired hand. Studies promo-ting constraint-induced therapy in young children with CP have reported improvement in function (22,23). While our treatment session lasted only 30 min per day, this training might have promp-ted greater use of the affected limb outside of tre-atment (4).

Our finding that the effects of the treatment pe-riod did last for 3 months may support the fact that stimulation did not work only local or spinal level. Popovic et al. (2002) hypothesize that FES gene-rates activity-dependent changes within the CNS when applied during appropriate motor tasks. This follows the findings that the brain possesses the capability to reorganize itself in such way to allow

526



neighboring cortical regions to expand into terri-tories normally occupied by input of other organs. The FES most likely manipulates with the sensory input, thus modulating the magnitude of cortical response and modulating motor pathway excitabi-lity, and thereby produces a mixture of excitation and inhibition at supraspinal levels (18).

Conclusion

The results of this study do suggest that FES may be a useful physical therapy tool in impro-ving hand function in children with CP. However this research is a pilot study therefore further inve-stigation are recommended for assessing how well these results apply generally in this population.

Acknowledgements

The authors would like to acknowledge their gratitude to the Provincial Secretariat for Science and Technological Development of Vojvodina,which supported Project number 114-451-01302/2007-02. Special thanks to Marijana Delic, occupational therapist.

References

1. Himmelmann K, Hagberg G, Wiklund LM, Eek MN, Uvebrant P. Dyskinetic cerebral palsy: a populati-on based study of children born between 1991 and 1998. Dev Med Chil Neurol 2007; 49: 246-251.

2. Winter S, Autry A, Boyle C, Yeargin-Allsop M. Tren-ds in the prevalence of cerebral palsy in a populati-on based study. Pediatrics 2002; 110: 220-225.

3. Himmelmann K, Hagberg G, Beckung E, Hagberg B, Uvebrant P. The changing panorama of cerebral palsy in Sweden IX. Prevalnce and origin in the bir-th year period 1995-1998. Acta Paediatr 2005; 94: 287-294.

4. Kamper DG, Yasukawa AM, Barrett KM, Gaebler-Spira DJ. Effects of neuromuscular electrical sti-mulation treatment of cerebral palsy on potential impairment mechanisms:a pilot study. Pediatr Phys Ther 2006; 18: 31-38.

5. Brown T, Cubido C, Scarfone H, Pape K, Galea V, McComas A. Developmental apraxia arising from neonatal brachial plexus palsy. Neurology 2000; 55: 24-30.

6. Maenpaa H, Jaakkola R, Sandstrom M, Wendt L. Electrostimulation at sensory level improves functi-on of the upper extremities in children with cerebral palsy: a pilot study. Dev Med Child Neurol. 2004; 46: 84-90.

7. Wright PA, Granat MH. Therapeutic effects of fun-ctional electric stimulation of the upper limb of eight children with cerebral palsy. Dev Med Child Neurol. 2000;42: 724-27.

8. Kerr C, McDowell B, McDonough S. Electrical sti-mulation in cerebral palsy: a review of effects on strength and motor function. Dev Med Child Neu-rol. 2004;46: 205-13.

9. Katz A, Tirosh E, Marmur R, Mizrahi J. Enhance-ment of muscle activity by electrical stimulation in cerebral palsy: a case-control study. J Child Neu-rol. 2008;23: 259-67.

10. Angela HO, Mandy DAI. Use of electrical sti-mulation under the principles of conductive education:a case study in a child with spastic di-plegic cerebral palsy. Brainchild 2003;4: 14-17.

11. Atwater SW, Tatarka ME, Kathrein JE, et al. Electromyography-triggered electrical muscle sti-mulation for children with cerebral palsy: a pilot study. Pediatr Phys Ther. 1991;3: 190-99.

12. Carmick J. Clinical use of electrical stimulation for children with cerebral palsy, part 2:Upper Extremity. Phys Ther 1993; 73: 514-27.

13. Carmick J. Use of neuromuscular electrical sti-mulation and dorsal wrist splint to improve the hand function of a child with spastic hemiparesis. Phys Ther 1997; 77: 661-71.

14. Eliasson AC. Manual Ability Classification Sy-stem for children with cerebral palsy. Instructio-nal Course at the European Academy of Childho-od Dysability Annual Meeting, Zagreb, Croatia, Jun 2008. Dev Med Child Neurol. Suppl. 114, 2008; 50:37.

15. Damiano D, Quinlivan J, Owen B, Payne P, Nel-son K, Abel M. What does the Ashworth scale re-ally measure and are instrumented measures more valid and precise? Dev Med Child Neurol. 2002; 44: 112-118.



16. DeMatteo C, Law M, Russel D,Pollock N, Ro-senbaum P, Walter S.The reliability and validity of Quality of Upper Extremity Skills Test. Physi-cal and Occupational Therapy in Pediatrics 1993;13:1-18.

17. De Kroon JR, van der Lee JH, Ijzerman MJ, Lan-khorst GI. Therapeutic electrical stimulation to improve motor control and functional abilities of the upper extremity after stroke: a systematic revi-ew. Clin Rehabil 2002; 16: 350-60.

18. Popovic MB, Popovic DB, Sinkjaer T, Stefanovic A, Schwirtlich L. Restitution of reaching and gras-ping promoted by functional electrical therapy. Artif Organs 2002; 26: 271-275.

19. Scheker L, Chesher S, Ramirex S. Neuromuscular electrical stimulation and dynamic bracing as a treatment for upper-extremity spasticity in chil-dren with cerebral palsy. J Hand Surg. (Br) 1999; 24: 226-32.

20. Kamper DG. Therapeutic effects of functional electric stimulation in children with cerebral pal-sy. Ohio State University, 1992. Thesis.

21. Hara Yukihiro. Neurorehabilitation with new functional electrical stimulation for hemiparetic upper extremity in stroke patients. J Nippon Med Sch. 2008; 75 (1)

22. Taub E, Landesman Ramey S, et al. Efficacy of constraint-induced movement therapy for chil-dren with cerebral palsy with asymmetric motor impairment. Pediatrics 2004; 113: 305-312.

23. Willis JK, Morello A, Davie A, et al. Force use treatment of childhood hemiparesis. Pediatrics 2002;110: 94-96.

Corresponding author Cila Demesi-Drljan, Clinic of Children and Youth Health Care of Vo-

jvodina, Serbia, E-mail:[email protected]

528



Abstract

Background: Acute respiratory distress syn-drome (ARDS) is a frequent respiratory distur-bance in preterm newborns. Preceding investiga-tions evaluated chronic physiotherapy effects on newborns with different lung diseases; however, no study analyzed acute physiotherapy treatment on premature newborns with ARDS. In this study we aimed to evaluate the acute effects of chest and motor physiotherapy treatment on hemodynamic variables in preterm newborns with ARDS.

Methods: We evaluated heart rate (HR), respi-ratory rate (RR), systolic (SAP), mean (MAP) and diastolic arterial pressure (DAP), temperature and oxygen saturation (SO2%) in 44 newborns with ARDS. We compared all variables between six periods in one day: before first physiotherapy tre-atment vs. after first physiotherapy treatment vs. before second physiotherapy treatment vs. after second physiotherapy treatment vs. before third physiotherapy treatment vs. after third physiothe-rapy treatment. Variables were measured 2 minu-tes before and 5 minutes after each physiotherapy session. We applied Anova one way followed by post hoc Bonferroni test.

Results: HR (147.5+9.5 bpm vs. 137.7+9.3 bpm; p<0.001), RR (45.5+8.7cpm vs. 41.5+6.7 cpm; p=0.001), SAP (70.3+10.4 mmHg vs. 60.1+7.1 mmHg; p=0.001) and MAP (55.7+10 mmHg vs. 46+6.6 mmHg; p=0.001) were signifi-cantly reduced after the third physiotherapy trea-tment compared to before the first session. There

were no significant changes regarding temperatu-re, DAP and SO2%.

Conclusion: Chest and motor physiotherapy acutely improves HR, RR, SAP, MAP and SO2% in newborns with ARDS.

Key words: Respiratory Distress Syndrome, Newborn; Infant, Newborn; Physical Therapy (Specialty); Infant, Premature, Diseases.

Introduction

Acute respiratory distress syndrome (ARDS) was reported in approximately 0.5% to 1% of newborns. The incidence and severity are directly related to prematurity degree. It affects around 50% of preterm newborns lighter than 1500 g and deaths associated to the disease; it usually occurs during acute phase of respiratory failure and is largely limited to extremely immature newborns, which weigh is lower than 1000g at birth [1, 2].

Neonatal physiotherapy is a procedure perfor-med between clamping of umbilical cord and 28 days after delivery, which include newborn lung and motor handling [3]. Lung management aims to remove the excess of bronchial secretions. The adverse effect arising from excess secretions and the fact that their removal significantly improves the specific conductance of the airways has been demonstrated in some reviews [4, 5].

Physiotherapy treatment provides stability of hemodynamic variables, such as heart rate (HR) [6-9], the functional maintenance of the newborn

Effects of physiotherapy on hemodynamic variables in newborns with Acute Respiratory Distress SyndromeLuiz Carlos de Abreu1, 3, Vitor E. Valenti3, 4, Adriana G. de Oliveira1, Claudio Leone1, Arnaldo A. F. Siqueira1, Paulo R. Gallo1, Fernando L. A. Fonseca3, Viviane G. N. Simon1, Paulo H. N. Saldiva2

1 Departamento de Saúde Materno-Infantil, Universidade de São Paulo, Brasil,2 Departamento de Poluição, Universidade de São Paulo, Brasil,3 Departamento de Morfologia e Fisiologia, Faculdade de Medicina do ABC, Brasil,4 Departamento de Medicina, Disciplina de Cardiologia, Universidade Federal de São Paulo, Brasil.



cerebral circulation and the maintenance of ai-rways with turbulent flow and with minimal se-cretion, which allow increased permeability and reduced number of intrinsic airway that contribute to increased airway resistance and decrease in gas changes physiological events [3].

There is controversy related to respiratory or chest physiotherapy in the neonatal period. Previ-ous studies showed a reduction in hemodynamic variability of preterm infants and highlighted the beneficial therapeutic effects of interventional procedures of physiotherapy [3]. However, previ-ous studies reported deleterious effects, suggesting that the handling procedures of interventional the-rapy in preterm infants result in hemodynamic in-stability, and therefore it is not indicated [10].

Although the literature has already described chronic chest physiotherapy effects on newborns with different lung diseases [11], no investigation analyzed acute chest and motor physiotherapy tre-atment. Thus, we aimed to evaluate the acute ef-fects of chest and motor physiotherapy treatment on hemodynamic variables in preterm newborns with ARDS.

Methods

Study Population

We evaluated 44 preterm newborns admitted in the Neonatal Intensive Care Unit with ARDS un-der noninvasive mechanical ventilation and treated with exogenous surfactant replacement (bovine type) between August 2000 and June 2002. Their parents or responsible signed a consent form. The protocol study was evaluated and approved by the Ethics Committee in Research of our University.

The concept of prematurity was adopted accor-ding to the World Health Organization, “preterm newborn younger than 37 gestational weeks old (less than 259 days)”. Gestational age was calcula-ted based on reliable date of the last menstrual peri-od, data from the obstetric examination and ultraso-und at the time of prenatal care. After birth we used the method of Capurro et al [12] performed between the first 6 and 24 hours of life in order to determine gestational age. This procedure was carried out by the Neonatologist. Weight was expressed in grams

(g), which was evaluated in the delivery room in all cases immediately after birth.

Inclusion Criteria

We considered the following inclusion criteria: birth weight equal or higher than 1000 g; clinical and radiological diagnosis of ARDS: clinical dia-gnosis was established when the newborn had early respiratory distress (tachypnea, expiratory grunt, flaring nose, chest retraction and cyanosis), early onset and progressive evolution. The radiological diagnosis was based on diffuse reticulogranular in-filtrate (ground glass appearance), homogenously distributed in the lungs and presence of air broncho-gram [13]. It was also considered the classification of ARDS by degrees as follows: grade 1 (fine gra-nule, air bronchogram in the mediastinum and we-ll-defined cardiac shape), grade 2 (evident granule in “ground glass” perihilar air bronchogram and visible cardiac shape), grade 3 (confluence of gra-nule, air bronchogram and slight blurring of cardiac shape, air bronchogram to the periphery of lungs), and grade 4 (opacification of lung areas, blurring of heart shape and diaphragm) and mechanical venti-lation via endotracheal tube [13].

Exclusion Criteria

We excluded preterm newborns who presented congenital anomalies, genetic syndromes, hydrops or congenital infection with clinical manifestati-ons and death before the 3rd day of life.

Hemodynamic Variables

We evaluated the following hemodynamic va-riables: 1) respiratory rate (RR): measured in who-le numbers from the number of breaths during 1 minute (cycles per minute – cpm); 2) Hypother-mia: it was considered as temperature below 36ºC in two consecutive measurements with an interval of at least two hours between measurements. We used a digital thermometer brand Microtherm® for all newborns of the experimental protocol; Arterial pressure was measured by the oscillome-

530



tric method, which uses an oscillometric monitor, oscillations are transmitted to the balloon located inside the pressure cuff and then captured by the device. The detection and quantification of the amplitude of these oscillations during the fall of automatic balloon pressure are transformed into blood pressure measurements by using various al-gorithms. Briefly, we considered systolic arterial pressure (SAP) when the pressure was just above the pressure of the balloon and there was a rapid increase in the amplitude of oscillations. When there was a sharp drop in the amplitude of osci-llations it was considered diastolic arterial pressu-re (DAP). Mean arterial pressure (MAP) was the lowest pressure balloon that still occurred in the oscillations of large amplitudes [14]. The device used to measure blood pressure was a noninvasi-ve blood pressure monitor DIXTAL® brand. The panel showed the values of SAP, DAP, MAP and HR. The variables HR (beats per minute – bpm) and SO2% (%) were measured and compiled by a multiparameter monitor Dixtal, model dx2020.

Protocol Procedures

Newborns received physiotherapy treatment 6 hours after surfactant replacement, regardless of doses administration number. Procedures of neo-natal physiotherapy were applied according to the following protocol: HR, RR, SO2%, SAP, MAP, DAP and body temperature were measured 2 mi-nutes before physiotherapy treatment, chest and motor physiotherapy treatment and the same vari-ables were measured again 5 minutes after physi-otherapy sessions. Each newborn were treated three times in an interval of 2 hours between each

session, each treatment spent a maximum of 20 minutes (it was not included preparation, physical examinations, diagnostic imaging when perfor-med and variables measurement according to the study protocol).

Physiotherapy Procedures

Newborns received chest and motor physiothe-rapy, chest physiotherapy followed the following sequence: pulmonary reexpansion; percussion; vi-brotherapy and; postural drainage. For motor physi-otherapy we used only proprioceptive stimulation.

Statistical Analysis

Data are presented as mean + standard deviati-on of mean. In order to compare variables between the three treatments (1st pre-treatment vs. 1st post-treatment vs. 2nd pre-treatment vs. 2nd post-trea-tment vs. 3rd pre-treatment vs. 3rd post-treatment) we used analysis of variance (one way ANOVA) for repeated measures followed by Bonferroni post test. Differences were considered significant when the probability of a type I error was lower than 5% (p < 0.05).

Results

The newborns did not receive supplemental oxygen before, during or after physiotherapy pro-cedures. Inspired oxygen fraction (FiO2 ventila-tor) remained constant throughout the time elap-sed physiotherapy treatment.

Table 1. Mean, median, standard deviation, minimum and maximum values of HR (bpm) at rest measu-red before (Pre) and after (Post) the first (1st), second (2nd) and third (3rd) physiotherapy session. N=44. *p < 0.05; Different of 1st pretreatment. HR: Heart rate

HR Minimum Median Mean Maximum Standard Error1st Pretreatment 127.0 148.0 147.5 164.0 9.51st Posttreatment 124.0 144.0 144.7 168.0 10.92nd Pretreatment 110.0 146.0 145.1 166.0 11.32nd Posttreatment 123.0 142.0 141.6 170.0 10.23rd Pretreatment 128.0 145.0 145.1 160.0 8.1

3rd Posttreatment* 120.0 138.5 137.7 160.0 9.3



Most of the newborns received up to two do-ses of exogenous surfactant. Those who received great part of the surfactant weighed less than 1500 g. Those with higher body weights received only one dose.

We compared all variables before and after each physiotherapy treatment. HR was significantly (p<0.001) reduced after the third physiotherapy treatment compared to before the first session (Ta-ble 1). It is possibly due to the difference between pre and post physiotherapy treatment. In relation to RR, we observed that it significantly (p<0.05) decreased after the third physiotherapy session compared to before the first session (Table 2).

With respect to arterial pressure, we noted that SAP (Table 3) and MAP (Table 4) significantly reduced after the third session compared to befo-re the first session, while there was no significant change regarding DAP (Table 5).

We also evaluated oxygen saturation (Table 6) and temperature (Table 7) and it was not verified significant changes concerning these variables.

Discussion

This investigation was undertaken to evaluate the acute effects of chest and motor physiothera-py on hemodynamic variables in newborns with ARDS. As a main result, we found that physiot-herapy treatment acutely reduced RR, HR, SAP and MAP. After the third physiotherapy session these variables were significantly decreased com-pared to before the first treatment. These sessions demonstrated gradual effects of chest and motor physiotherapy. Our study evidences a physical re-source which contributes to reduce the hemodyna-mic instability in newborns with ARDS.

At the end of 3 physiotherapy sessions we re-ported significant reduction of HR, SAP and MAP in newborns with ARDS. It supports the hypothesis that physiotherapy treatment immediately improves newborns hemodynamic status, which diminishes cardiovascular instability and hence, decreases the likelihood of other lung diseases development in newborns. Park et al [15] also reported HR reducti-on during lung volume recruitment maneuvers on-set in adult patients with ARDS aged approximately 59 years old. The decrease in HR reported by them and the evidence in our investigation could have been caused by increased vagal tone and Valsalva maneuver like mechanisms [10]. However, there is difference between newborns and adults regarding their physiological responses [16].

We reported that RR decreased after the third physiotherapy session, which indicates clinical improvement of newborns due to physiotherapy treatment three times daily, at intervals of 2 hours between each clinical session. Conversely, SO2% was not changed after physiotherapy treatment. Bernard-Narbonne et al [10] reported that chest physiotherapy increased SO2% and tidal volume in children with acute bronchiolitis, which was linked to the improvement of bronchial sputum clearan-ce. A previous investigation observed no improve-ment of lung function in children with exacerbated bronchial asthma who received chest physiothera-py [17]. The difference between those data may be explained by the type of disease and age of the pa-tients. Other relevant factor that may be involved in this difference is the physiotherapy procedure, we used chest associated to motor physiotherapy. A va-riety of physiotherapy procedures is reported in the literature [18]. The most widely used and evaluated is the bronchial hygiene maneuver: chest (or per-cussion), vibration/vibrocompression maneuvers

Table 2. Mean, median, standard deviation, minimum and maximum values of RR (ipm) at rest measu-red before (Pre) and after (Post) the first (1st), second (2nd) and third (3rd) physiotherapy session. N=44. *p<0.05; Different of 1st pretreatment. RR: Respiratory Rate

RR Minimum Median Mean Maximum Standard Error1st Pretreatment 24.0 46.0 45.5 62.0 8.71st Posttreatment 28.0 44.0 43.7 60.0 7.62nd Pretreatment 28.0 47.0 47.9 93.0 11.62nd Posttreatment 34.0 42.0 44.4 96.0 11.53rd Pretreatment 36.0 44.0 44.5 56.0 5.5

3rd Posttreatment* 30.0 41.0 41.5 58.0 6.7

532



Table 3. Mean, median, standard deviation, minimum and maximum values of systolic arterial pressure (mmHg) at rest measured before (Pre) and after (Post) the first (1st), second (2nd) and third (3rd) physio-therapy session. N=44. p=0.001; Different of 1st pretreatment

Systolic Arterial Pressure Minimum Median Mean Maximum Standard Error1st Pretreatment 53.0 68.0 70.3 99.0 10.41st Posttreatment 50.0 66.0 67.7 104.0 11.42nd Pretreatment 58.0 68.5 69.8 94.0 9.52nd Posttreatment 52.0 63.0 65.0 89.0 8.83rd Pretreatment 54.0 66.0 66.0 82.0 8.8

3rd Posttreatment* 46.0 60.0 60.1 76.0 7.1Table 4. Mean, median, standard deviation, minimum and maximum values of mean arterial pressure (mmHg) at rest measured before (Pre) and after (Post) the first (1st), second (2nd) and third (3rd) physio-therapy session. N=44. p=0.001; Different of 1st pretreatment

Mean Arterial Pressure Minimum Median Mean Maximum Standard Error1st Pretreatment 33.0 54.0 55.7 80.0 10.01st Posttreatment 38.0 51.0 52.6 76.0 9.62nd Pretreatment 41.0 54.0 55.2 77.0 8.62nd Posttreatment 36.0 48.5 50.5 72.0 8.33rd Pretreatment 36.0 48.0 49.7 62.0 7.9

3rd Posttreatment* 35.0 44.5 46.0 60.0 6.6Table 5. Mean, median, standard deviation, minimum and maximum values of diastolic arterial pre-ssure (mmHg) at rest measured before (Pre) and after (Post) the first (1st), second (2nd) and third (3rd) physiotherapy session. N=44

Diastolic Arterial Pressure Minimum Median Mean Maximum Standard Error1st Pretreatment 27.0 41.0 43.4 63.0 8.31st Posttreatment 26.0 41.5 43.6 99.0 13.72nd Pretreatment 31.0 40.5 42.8 60.0 7.12nd Posttreatment 29.0 38.5 39.2 59.0 6.63rd Pretreatment 31.0 38.5 40.6 54.0 6.43rd Posttreatment 29.0 36.5 37.5 51.0 5.5

Table 6. Mean, median, standard deviation, minimum and maximum values of oxygen saturation (%) at rest measured before (Pre) and after (Post) the first (1st), second (2nd) and third (3rd) physiotherapy session. N=44

Oxygen Saturation Minimum Median Mean Maximum Standard Error1st Pretreatment 90.0 94.5 94.3 99.0 2.31st Posttreatment 88.0 94.5 94.4 97.0 2.02nd Pretreatment 42.0 94.5 92.9 98.0 9.82nd Posttreatment 94.0 98.0 97.7 99.0 1.33rd Pretreatment 92.0 98.0 97.9 99.0 1.63rd Posttreatment 92.0 98.0 97.9 99.0 1.6

Table 7. Mean, median, standard deviation, minimum and maximum values of body temperature (ºC) at rest measured before (Pre) and after (Post) the first (1st), second (2nd) and third (3rd) physiotherapy session. N=44

Oxygen Saturation Minimum Median Mean Maximum Standard Error1st Pretreatment 32.8 36.6 36.4 37.0 0.71st Posttreatment 36.2 36.7 36.7 37.3 0.22nd Pretreatment 36.0 36.7 36.6 37.1 0.22nd Posttreatment 36.1 36.7 36.6 37.1 0.33rd Pretreatment 35.9 36.6 36.6 36.9 0.33rd Posttreatment 36.2 36.8 36.7 36.9 0.2



with an Ambu bag (bag-squeezing), aspiration and airway intubation, cough stimulation on posture and positioning of drainage and exercises respira-tory liabilities in preterm infants [18].

In our procedures we associated chest physio-therapy to motor physiotherapy and we observed improvement of basal HR, RR, SAP and MAP in premature newborns with ARDS. Bronchial hygi-ene maneuvers are used to mobilize and remove secretions in airways in order to improve lung fun-ction. However, there are researches which suggest that these procedures may be malefic to preterm newborns [19]. There are investigations which do not indicate bronchial hygiene maneuvers for premature newborns weighting less than 1500 g in the first 3 days of life. They believed that it increa-ses the possibility of cerebral bleeding [18]. Other reports suggest that bronchial hygiene maneuvers, especially clapping, may cause adverse effects in newborns, such as hypoxemia [20], ribs fracture and cerebral injuries [21]. In view of those works, some studies tend to report clapping with adverse events in newborns [22]. It was demonstrated that the use of clapping is deleterious due to the fragili-ty and little size of newborns thorax, hence, it may increase the mechanical effects of clapping when compared to older subjects [22]. Nevertheless, our investigation contradicts this suggestion.

Our findings propose that chest and motor physiotherapy is able to stabilize cardiorespiratory parameters in newborns with ARDS. Aspiration is a procedure often performed in order to keep airways permeability, especially in patients which do not cough regularly, as the newborn [23]. It is a procedure that requires extreme care in its imple-mentation due to side effects that it may cause due to physiological changes induced by aspiration, such as hypoxemia and sympathetic hyperactivity [24] which may lead to peripheral vasoconstricti-on, increased blood pressure and bradyarrhythmia, as well as changes in cerebral blood flow and ele-vated intracranial pressure [24]. Other effects are described, such as lesions of the tracheobronchi-al mucosa, bronchial perforation by suction cat-heter (secondary pneumothorax), atelectasis (due to excessive negative pressure) and in addition to respiratory tract infections [23].

During the physiotherapy treatment we did not used Trendelenburg position, since it is not indica-

ted in newborns as a result of increased intracra-nial pressure and gastroesophageal reflux, which increases the risk of pneumonia [30].

We demonstrated that physiotherapy mane-uvers such as clapping or vibration followed by suction and postural drainage and/or vacuum im-proved hemodynamic variables in newborns with ARDS. Physiotherapy treatment has received attention regarding preterm newborns with res-piratory disorders, such as aspiration syndromes, respiratory distress syndrome, pneumonia, ate-lectasis and in those preterm newborns on mec-hanical ventilation. There are also indications of physiotherapy procedures in cases of airways se-cretion in newborns with negative prognostic [3]. Physiotherapy performed pre-and post-extubation showed improvement of pulmonary symptoms with reduced incidence of lung atelectasis after extubation [3]. Physiotherapy results in lung mec-hanical effects, providing optimal respiratory fun-ction in order to facilitate gas exchange and adjust ventilation-perfusion adequacy of respiratory su-pport, to prevent and treat pulmonary complicati-ons, to provide good maintenance of airways and to facilitate weaning from mechanical ventilation and oxygen therapy [25].

We provide important data, since preventing disease development in newborns will avoid dise-ase manifestations in childhood [26, 27].

In conclusion, chest and motor physiotherapy treatment were able to acutely improve basal HR, RR, SAP and MAP in newborns with ARDS. Thus, we recommended performing chest and motor physiotherapy in critically ill newborns with ARDS.

References

1. Wu XM, Wang HY, Li GF, Zang B, Chen WM. Do-butamine enhances alveolar fluid clearance in a rat model of acute lung injury. Lung 2009;187:225-31.

2. Gregorakos L, Markou N, Psalida V, Kanakaki M, Alexopoulou A, Sotiriou E, Damianos A, Myrian-thefs P. Near-drowning: clinical course of lung injury in adults. Lung 2009;187:93-7.

3. Lewis JA, Lacey H, Herderson-Smart DJ. A re-view of chest physiotherapy in neonatal intensi-ve care units in Australia. J Pediatr Child Health 1992;28:297-300.

534



4. Karapolat H, Atasever A, Atamaz F, Kirazli Y, El-mas F, Erdinç E. Do the benefits gained using a short-term pulmonary rehabilitation program re-main in COPD patients after participation? Lung 2007; 185:221-5.

5. Puente-Maestu L, Luisa Sánz M, Sánz P, de Oña RJ, Arnedillo A, Casaburi R. Long-term effects of a maintenance program after supervised or self-mo-nitored training programs in patients with COPD. Lung 2003;181:67-78.

6. Cox NJ, Hendricks JC, Binkhorst RA, van Herwaar-den CL. A pulmonary rehabilitation program for pa-tients with asthma and mild chronic obstructive pul-monary diseases (COPD). Lung 1993;171:235-44.

7. Pavia D. The role of chest physiotherapy in mucus hypersecretion. Lung 1990;168:614-21.

8. Shim C, Santos GH, Zelefsky M. Percutaneous dra-inage of lung abscess. Lung 1990;168:201-7.

9. Pfleger A, Theissl B, Oberwaldner B, Zach MS. Self-administered chest physiotherapy in cystic fi-brosis: a comparative study of high-pressure PEP and autogenic drainage. Lung 1992;170:323-30.

10. Bernard-Narbonne F, Daoud P, Castaing H, Ro-usset A. Effectiveness of chest physiotherapy in ventilated children with acute bronchiolitis. Arch Pediatr 2003;10:1043-7.

11. Barros Delgadillo JC, Alvarado Méndez LM, Gorbea Chávez V, Villalobos Acosta S, Sánchez Solís V, Gaviño Gaviño F. Perinatal results in pre-gnancies obtained with embryo transfer in vitro fertilization: a case-control study. Ginecol Obstet Mex 2006;74:626-39.

12. de Carvalho RC, Campos Hde H, Bruno ZV, Mota RM. Predictive factors for pregnancy hypertensi-on in primiparous adolescents: analysis of prena-tal care, ABPM and microalbuminuria. Arq Bras Cardiol 2006; 87:487-95.

13. Halliday HL. Surfactants: past, present and futu-re. J Perinatol 2008;28:S47-56.

14. Chemla D, Teboul JL, Richard C. Noninvasive assessment of arterial pressure. Curr Opin Crit Care 2008;14:317-21.

15. Park KJ, Oh YJ, Chang HJ, Sheen SS, Choi J, Lee KS, Park JH, Hwang SC. Acute hemodynamic effects of recruitment maneuvers in patients with acute respiratory distress syndrome. J Intensive Care Med 2009;24:376-82.

16. Creuwels LA, van Golde LM, Haagsman HP. The pulmonary surfactant system: biochemical and clinical aspects. Lung 1997;175:1-39.

17. Asher MI, Douglas C, Airy M, Andrews D, Tren-holme A. Effects of chest physical therapy on lung function in children recovering from acute severe asthma. Pediatr Pulmono 1990;l 9:146-151.

18. Lee HK. The effect of infant massage on weight gain, physiological and behavioral responses in premature infants. Taehan Kanho Hakhoe Chi 2005;35:1451-60.

19. Martin K, Thomas H. Chest physiotherapy in me-chanically ventilated children: a review. Crit Care Med 2000;28:1648-51.

20. Fox WW, Schwartz JB, Shaffer TH. Pulmonary physiotherapy in neonates: physiologic changes and respiratory management. J Pediatr 1978;92 977-81.

21. Wood BP. Infant ribs: generalized periosteal reac-tion resulting from vibrator chest physiotherapy. Radiology 1987;162:811-2.

22. Bertone N. The role of physiotherapy in a neonatal intensive care unit. Aust J Physiother 1988;34:27-34.

23. Wagener JS, Headley AA. Cystic fibrosis: current trends in respiratory care. Respir Care 2003; 48: 234-45.

24. Perrotta C, Ortiz Z, Roque M. Chest physiothe-rapy for acute bronchiolitis in paediatric patients between 0 and 24 months old. Cochrane Database Syst Rev 2007;24:CD004873.

25. Argent AC, Morrow BM. What does chest physio-therapy do to sick infants and children? Intensive Care Med 2004;30:1014-6.

26. Hasanbegovic E, Sabanovic S. Infections like complications of treatment childhood leukemia. HealthMED 2009;3:123-7.

27. Zvizdic S, Kudumovic M, Rodinis-Pejic I, Avdic-Kamberovic F, Bektas S, Sokolovic L, Tufekcic M. Etiologic-epidemiologic characteristics of acute diarrheal diseases in pre-school children. Heal-thMED 2009;3:245-53.

Corresponding author Luiz Carlos de Abreu, Departamento de Morfologia e Fisiologia, Faculdade de Medicina do ABC, Brasil, E-mail: [email protected]



Abstract

Tissue regeneration and repair have been observed among eukaryotes such as sponges, hy-dras, planarians and amphibians, but this ability is rare among mammals. In stem cells, the expre-ssion of the Oct4 gene inhibits the p21 gene and initiates cell division. In the ear cells of experi-mental mouse, signs of repair appear 48 hours after sustaining an injury. In cultured cells, em-ploying RT-PCR (Reverse Transcriptase-PCR) and western blotting, Oct4 gene expression met-hods were observed at both the transcriptional and translational levels. Also, Oct4 gene sequencing was ascertained, which was consistent with sequ-encing registered in National Center for Biotech-nology Information (NCBI). Studying the bands that resulted from RT-PCR reveals Oct4 gene expression in blastoma cells, and the result of we-stern blotting demonstrates the translation of Oct4 protein in these cells. This article reveals the role of Oct4 genes in auricle blastoma cells of mouse in addition to the contribution of stem cells make to tissue regeneration in this animal. This raises hopes that, following sustained sores or the loss of a limb, inducing factors may be released in mice and other mammals that have the ability to tran-sform the cells around a wound to stem cells. This research yields results that may help cure diseases such as leprosy and gangrene.

Key words: Oct4, Tissue Regeneration, Mus musculus, Blastoma cells

Introduction

Ten years ago, Dr. Elen Heber Katz detected ear canal repair of a mouse among his lab animals (7). Since that time, she and other molecular bi-ologists have been attempting to determine why and how this occurred (7, 25). In order for a limb/organ to be repaired, an undifferentiated structure must be created in which the undifferentiated cells are capable of being transformed into various ti-ssues in the damaged limb, such as blood vessels, cartilage, and skin.

p21, which is a tumor suppressor and potent cyclin-dependent kinase inhibitor that provides the opportunity to repair DNA in a dividing cell, has attracted the attention of many researchers and its silencing can initiate cell-division among adult-cells (2, 10). Silencing of the p21 gene has resul-ted in repair in MRL mouse ear (2). Although p21 and p53, which participate in the repair of dama-ged DNA and limit cell division, are good options to study to gain a better understanding of how the repair and regeneration of a damaged organ/limb occurs, finding the relationship between stem cells and the regeneration process is a better option.

Stem cells can be found in many tissues and or-gans of animals, and, despite the fact that they are undifferentiated and possess the ability to multiply limitlessly, they can be induced and differentiated under specific physiologic circumstances and fac-tors (28). The ability of stem cells to transform va-ries for various cells.

In a mouse Oct4, octamer binding transcription factor 4, which contains 352 amino acids and is expressed by the POU5F1 gene of chromosome

A new cell line detected in Mus musculus: Oct4 gene expression in mouse ear blastoma cellParham Jabbarzadeh1, Mohammadsadegh Amiri1, Mehrdad Jalalian2,3

1 Department of Biology, Payam Nour University, Iran,2 Department of Community Health, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Malaysia,3 Research Center of Iranian Blood Transfusion Organization, Khorasan-e Razavi Blood Center, Iran.

536



17, is known as a stem cells marker (23, 24). In embryo cells, Oct4 gene is expressed sequentially in morolla cells, Inner Cell Mass (ICM), epiblast, and germ stem cells whose expression drops gra-dually with tissue differentiation (14, 19). This gene is not expressed in differentiated tissues (16). Since Oct4 is a transcription factor, it intervenes in the regulation of many genes whose expression results in the creation and maintenance of the stem characteristics of many cells (26). As for repair of the organs of mammals, the concept of dedifferen-tiation is not relevant since adult stem cells, de-pending on the need, provide the ability to repair (30). It has been observed that, during the embryo development process and somatic cell lines pro-duction, cells lose Oct4 expression, while cells that maintain Oct4 expression remain pluripotent and acquire the ability to transform to generating cells (18).

Since stem cells with a permanent expression of Oct4 gene maintain their pluropotency (18), tracking this gene can help improve the coopera-tion of stem cells in the repair process. Success in identification of the most important gene involved in tissue regeneration can help us employ gene expression inducers in order to help cure patients who suffer from the loss of a limb/organ or dise-ases, such as gangrene and leprosy, with its over expression.

Creating a 3-mm diameter hole in a mouse auricle and filling the hole in a short time raises the question, “Which factors result in quick repair of this mammal?” Are adult stem cells of the ear with a high ability to repair and multiply involved in the process, or is a mechanism similar to that of the tailed amphibians involved? Since Oct4 main-tains cell division activity with a decrease in p21 gene expression (10), we intend to identify Oct4 gene expression among cultured blastoma cells of mouse-ear origin to confirm/prove the role of stem cells in tissue repair.

Methods and materials

The mice were 18 months old when they were purchased from the Razi Vaccine and Serum Insti-tute of Mashhad. For microscopic studies, an Ol-ympus SKX31 inverted microscope was used. An RNA extraction kit was purchased from the Sinage-ne Company (Iran). A M-MuLV Buffer 5X reverse transcriptase was bought from Promega Company (USA). For cDNAs Oct4 and beta-actin, primers designed by Fukashi et al. were employed (Table 1). For β-actin, The length of the PCR fragment anticipated by HBF and HBR primers is 838 base pairs. As for Oct4 primers, the area with the ability to multiply with this pair of primers ranges from nucleotide 65 to 381 of cDNA of Oct4 of mouse with the length of 404 base pairs. The resulting fra-gment is 316 nucleotide pairs long.

Extraction of blastoma cells

Forty-eight hours after piercing the ear, we made a hole at the same place again. The result of the two holes was a small ring with a diameter of 3 mm. After washing, this ring was transferred to a culturing environment. As a result of cell division, cells were gradually disconnected from the ring and released into the environment. To culture the cells, we used culturing environment RPMI 1640 with a 10% fetal bovine serum, 1 x 105 U/L peni-cillin, and 0.1 g/L streptomycin at a temperature 37 oC with 10% CO2 and 100% relative humidity.

Extracting RNA and tracking Oct4 with RT-PCR

The procedures were performed according to the instructions provided in the Trizol RNA Extrac-tion Kit, and the quality assessment of the extracted RNA for the presence of 18S and 28S rRNA was

Table 1. Forward (F) and reverse (R) primers used in RT-PCRPrimer Sequence Primers cDNA

5’- ATCTGGCACCACACCTTCTACAATGAGTGCG -3’ F (HβF) β-actin5’- CGTCATACTCCTGCTTGCTGATCCACATCTGC -3’ R (HβR) β-actin5’- GGAAAGGTGTTCAGCCAAACC -3’ F (HOF) Oct45’- GCCGGTTACAGAACCAACACA -3’ R (HOR) Oct4



conducted with a spectrophotometer and agarose gel electrophoresis. The presence of the bands for 18S and 28S rRNAs demonstrated the efficiency of the RNA extraction process. If such bands had not been observed for the above-mentioned RNA, the RNA sample would have broken down by RNAs in 50 microliters of DEPC-treated water. The circum-stances of RT-PCR were as follows:

Pre-denaturation at 94 oC for 2 min; primer connection temperature and number of cycles used for the beta-actin gene were 62 oC and 28 cycles, respectively, and, for Oct4, these values were 53 oC and 33 cycles, respectively. Expansion of the fragment was conducted for 90 seconds at 72 oC, and the final expansion of the fragment was con-ducted for 5 min at 72 oC. The enzyme M-MuLV was used to make cDNA.

Extracting total protein and detecting Oct4 by western blotting

The solution RIPA buffer 200X, including PMSF 200X for cell lysis, was used to extract the total protein of the cells. This solution was stored in ice for 30 minutes for total lysis of the cells. The sample was then centrifuged (13000 g, 4 oC, 60 min), and the supernatant was kept as the total protein of the cells. The proteins were separated in denaturing condition by Tris-Glycin SDS/PAGE and were transferred to a PVDF membrane.

Stacking Gel (Tris-Glycine buffer, pH 6.8, 3 to 4% acrylamide) and Resolving gel (Tris-Glyine buffer, pH 8.8, 5 to 20% acrylamide) were used. Acrylamide monomers in the presence of bisa-crylamide forms transversal bridges, and, in the presence of ammonium persulfate and TEMED catalyst became polarized and formed polyacryla-mide gel. Electrophoresis was performed with a voltage of 80 V to detach the samples from the Stacking Gel and with a voltage of 100 V to de-tach the samples from the Resolving Gel. It took two hours for the blue color of Bromophenol Blue to reach the end of the gel.

Next, to observe the bands, the Silver Staining method was performed. The gel was exposed to fixator solution (40% methanol, 10% acetic acid, 50% deionized water) for 1 h. After washing with ethanol, the gel was immersed in 0.02% sodium

thiosulphate solution for 1 min. Then, in darkne-ss, the gel was exposed to AgNO3 solution for 30 min. Finally, after washing, the gel was immersed in Stop Developer solution for 5 min.

In order to track Oct4 gene, the technique of Western Blotting was used. After SDS-Page, the unstained gel was paled in standard transfer buffer for 10 min. Next, the membrane was washed with 15 mL of TBS and subsequently washed by bloc-king solution “TBS + Tween 20 + gelatin.” After washing by TBS for a second time, 10 microliters of serum containing primary antibodies (Goat anti OCT-3/4 polyclonal antibody: SC-8629, Santa Cruz) with a density of 1 pg/mL in TBS was used. After the solution was incubated at room tempera-ture and subsequently washed, the secondary anti-body (HRP-Anti mouse IgG: A4416, Sigma) was incubated at room temperature for approximately 30 min. After washing for 10 min, 10 microliters of Substrate solution were added. To identify the protein “Ponceau S 0.1%,” stain was used. Also, a PVDF membrane was used. The treatment durati-on of the membrane with the stain was 1 h. For a more detailed analysis, Oct4 protein was studied by the dot blotting method. In this method, a ce-lery sample was used as a negative control.

Results

Cell culturing

Some significant characteristics of these cells are their high ability to grow and multiply blasto-ma cells obtained from repaired wounds in mouse ear cells, the ease of working with them due to their high ability to attach to the bottom of the cul-turing vessel, and their appropriate resistance aga-inst environmentally difficult circumstances, such as temporary losses of CO2 or nutrients and their passage ability (15 times or more). The morpholo-gy of the cells was observed by using an inverted microscope, which is shown in Figure 1. The mor-phology of these cells resembled that of fibroblast cells with protracted teeth and appendages. During the first stages when the cells were falling in at the bottom of the 6-well plate, it was observed that, for a few of the cells, their appendages lengthened to be able to connect to nearby cells.

538



Figure 1. Morphology of blastomal cells. Scale: 50μm

Bands resulting from RT-PCR

In order to ensure that the RNA extracted from the cells did not decompose, the quality of the RNA sample was studied by agarose gel electrop-horesis. The results of the investigation of 18S and 28S rRNAs are shown in Figure 2. The results of the electrophoresis demonstrate that the extracted RNA could be confidently used for the next stages of the research.

Figure 2. Bands of 18S and 28S rRNAs. To study the state of activity of the extracted RNA, rRNA activation was investigated with Agarose Gel Electrophoresis. Both routes 1 and 2 relate to to-tal RNA of blastoma cells

In order to investigate probable variations in the level of Oct4 gene expression in blastoma ce-lls regarding increased occurrences of cell passa-ge, their expression was studied in passages 6 and 12 by RT-PCR, and no meaningful change was observed. RT-PCR results are illustrated in Figure 3. Lane 1 relates to passage 6, and lane 2 relates to passage 12. According to Figure 3, the level of gene expression is almost the same for both pas-sages.

Figure 3. Comparison between the level of Oct4 gene expression is illustrated in passage 5 (lane 1) and passage 12 (lane 2). Lane 3 demonstrates the marker, and each band shows 100 base pairs

Final RT-PCR

After determining the exact levels of the den-sities of the substances and the relevant tempera-tures to connect primers, the final RT-PCR were conducted. The results of the final RT-PCR are



illustrated in Figure 4. Sample number 4 is the marker with 100 bp molecular weight difference between two consecutive bands. Sample number 3 relates to the beta-actin gene that has been con-sidered to be an internal controller that determi-nes the accuracy of the PCR reaction. When the primers were placed in their positions, a 316 nuc-leotide fragment was expected with the forward primer on nucleotides 65 to 85 and the reserve pri-mer on nucleotides 23 to 42 from the end of the fragment reported in NCBI (404 nucleotide). The bands observed in the position of 316 base pairs in lane 2 were related to the mouse Oct4 gene in the studied cells.

Figure 4. Results of final RT-PCR

On the other hand, the presence of the resul-tant band was probably due to including genome DNA rather than the presence of cDNA during the total RNA extraction process. To settle this ambi-guity in lane number 1 (Figure 4) 4 microliters of RNA were used instead of cDNA. The fact that no band formed in the lane indicated that the extrac-

ted mRNA does not have genome DNA. In sample number 1, the extracted RNA was added instead of adding cDNA for PCR so that, in case of no appropriate band formation, it could be concluded that the resulting band in lane number 3 is related to cDNA, or better to say mRNA, and not genome DNA. As the Figure reveals, lane 1 has no band. The position of lane 3 (beta-actin) was at the anti-cipated length (838 base pairs).

In order to ensure the accuracy of PCR and acquire confirmation of the relationship between the resulting band in lane 2 (Figure 4) and the Oct4 gene of the mouse and no other gene in case of an unexpected primer connection, 15 microli-ters of PCR product, of which 8 microliters had been used in electrophoresis and had clearly for-med the expected single band, was used to decide sequencing. Consequent results were 95% con-sistent with the expected sequencing reported in NCBI data bank.

Dot Blotting

As illustrated in Figure 5, the positive control, blastoma, and the negative control sample taken from Celery is negative with regard to Oct4 detec-tion. This method is an initial confirmation for the existence of Oct4 protein in blastoma cells.

Figure 5. Result of Dot blotting

Western blotting results

In order to confirm the results of dot blotting, Oct4 gene expression was investigated at the pro-tein level. The results of western blotting are illu-strated in Figure 6. In sample number 1, a 38 kDa

540



single band, which was consistent with the expec-ted size of the Oct4 protein, was determined using the exclusive antibody for Oct4 protein using the chemiluminescence method (EC Advance). In lane 2, related to the Celery negative ontrol, as ex-peted, no band was observed.

Figure 6. Result of Western blotting.

Discussion

The best interval between the first and second punch (piercing) was 48 hours. The cells accumu-lated at the place of the sore were differentiated cells of mouse ear and due to the punch effect and the signal applied, similar to the repair effect of amphibians, the differentiation occurred consequ-ently and then converted to blastoma. Blastoma cells have the ability to convert to other mouse ear cells. Generally speaking, active genes in blasto-ma cells at the time of injury or loss of an organ/limb are the very genes related to the period of embryal development. Developmental factors, such as sonic Hedgehog, Hox genes, msx, and growth factors, such as FGF, are activated again at the time of blastoma cells repair. In relation to the source of blastoma cells, some comments have been made that must be investigated more thoro-ughly. Some researchers have suggested that bla-stoma cells originate from dedifferentiated cells that existed in the implanted tissue before the cut and, now, due to their need, begin to divide and differentiate. On the other hand, other researchers have suggested that they originate from pre-vas-cular cells that are present at blood-vessel walls. These cells can acquire the ability to repair due to the received signal (30). We believe the best su-ggestion on the origin of the cells possessing the

Oct4 gene is that dedifferentiation occurs in the cells of the implanted tissue in the proximity of the place of the cut, and, as a result, cells of this tissue convert to blastomas.

The morphological study of blastoma cells also has revealed their similarity to fibroblasts. Beca-use blastoma cells produced appendages during their initial stages and, during the course of the next stages in the culturing environment, became totally confluent, their appendages decreased. In contrast, fibroblasts, under the best of circumstan-ces, are able to generate cartilage and bone and are different from blastoma pluripotent cells in this re-gard. As a result, the idea of a fibroblast origin for mouse is disregarded.

Conclusions

It is deduced that the band illustrated in Figu-re 3 is precisely consistent with the reported fra-gment; in addition, the resulting band is the pro-duct of the performance of the effect of the pri-mers on the fragment of cDNA synthesized from total RNA. With this finding, it can be claimed that the gene Oct4 is transcribed in the studied cells, which reveals the role of Oct4 gene in the repair of the mouse ear injury. After total cellular pro-tein extraction with the aid of RIPA solution and its vertical electrophoresis, the size of the single band (38 kDa) that resulted from western blotting is consistent with Oct4 protein in the mouse; also, the absence of a distinct band in the negative con-trol sample indicates the presence of this protein in the cells. Oct4 gene, by activating some genes and deactivating others, creates the pluripotential characteristic of blastoma cells. Oct4 gene activity plays a key role in the process of repair and rege-neration. As for the next stages, we are looking for the inducers in the stem cells and their effects on the activity and the rate of multiplication in the mouse auricle blastoma cells.

With the discovery of such cells and extending this research to other mammals and even to hu-mans, there is hope that tissue damage repair can be promoted in other mammals as it was in the mo-use. Identification of new sources of adult stem ce-lls is one of the main objectives of research efforts in the field of cell and molecular biology. Identi-



fication of these cells in the ear of experimental mouse can become a vanguard in presenting the equivalent of these cells in other mammals. Fin-dings that reveal the similarities between stem cells and the cells that result from dediffertiation could lead to identification of the molecules in-volved in the differentiating process and could be valuable for curing various diseases. Creation of pluripotent primary cells in mammals and compa-ring them with the dedifferentiation phenomenon of the amphibians provide us with valuable infor-mation, and this comparison, at molecular levels, can lead to better knowledge and understanding of stem cells and the dedifferentiation phenomenon.

Acknowledgements

We thank the research commitee of Payam Nour University, Khorassan Razavi Campus. We also thank Dr Seyed Reza Mirhafez (Center of Science and Technology, Islamic Azad University, Tehran, I.R.Iran) and miss Safa Sabaghi (Depar-tment of Biology, Payam Nour University, Mash-had, I.R.Iran) for providing us technical supports.

Funding

This work was supported by the Payam Nour University Research Program funded by the Mini-stry of Science, Research and Technology, I.R.Iran [grant number 08/1/482].

References

1. Alex J.L., Sarathi D.P., Goel S., & Kumar S. (2005) Isolation and characterization of a Mouse embryo-nic stem cell line that contributes efficiently to the germ line. Current Science, 88:1167-1169.

2. Bedelbaeva, Kh. , Snyder, A., Gourevitch, D., Clark, L., Zhang, XM, Leferovich, J., Cheverud, JM, Lie-berman, P., and Heber-Katz, E. (2010) Lack of p21 expression links cell cycle control and appendage regeneration in mice, http://www.pnas.org/con-tent/107/13/5845.

3. Blau H.M., Brazelton T.R., & Weismann J.M. (2002) The evolving concept of a stem cell. Cell, 105:829-841.

4. Cameron J.A. (2002) Cell and developmental bio-logy: Cellular & molecular mechanisms that con-trol amphibian limb regeneration.

5. Chambers I, Smith A. (2004) Self- renewal of tera-tocatrcinoma and embryonic stem cells. Oncogene, 23:7150-7160.

6. Chen S, Zhang Q, Wu X, Schaltz PG, Ding S. (2004) Dediffrentiation of lineage committed cells by a small molecule. Am. Chem. Soc, 126: 410-411.

7. Clark, L. D. Clark, R. K, Heber-Katz, E. (1998) A New Murine Model for Mammalian Wound Repair and Regeneration, Clinical in Immunology & Im-munopathology, Vol. 88, No. 1, July, pp. 35–45.

8. Desquenne Clark,L., Clark, R., and Heber-Katz, E. (1998). A new model for mammalian wound repair and regeneration. Clin.imm. and Immunopath. 88: 35-45.

9. Fukashi I., Junichi M., & Katsuhiro O. (2006) Dif-ferences in gene expression patterns between soma-tic cell nuclear transfer embryos constructed with either Mouse granulose cells or their derivatives. Anim. Rep. Science, 93:76-87.

10. Jungwoon, L., Yeorim, G., Inyoung, K., Yong-Mahn, H., & Jungho, K. (2010) Oct-4 controls cell-cycle progression of embryonic stem cells, Biochem. J. 426, 171–181.

11. Lee K., Nichols J., & Smith A. (1996) Identificati-on of a developmentally regulated protein tyrosi-ne phosphatase in embryonic stem cells that is a marker of pluripotential epiblast and early meso-derm. Mech Dev, 59:153-164.

542



12. Metcalfe, A.D., Bartlett, J.P, Beare, A.H. & Fer-guson, M.W.J (2005) Characterising Mechanisms of Regeneration for Future Applications in Tissue Engineering, European Cells and Materials Vol. 10. Suppl. 2: 16.

13. Okamoto K. (1990) A novel octamer binding tran-scription factor is differentially expressed in Mou-se embryonic cells. Cell, 60:461-472.

14. Ovitt C.E., & Scholer H.R. (1998) The molecular biology of Oct-4 in the early Mouse embryo. Mol. Hum. Rep , 4:1021-1031.

15. Palmier S.L., Peter W., Hess H., & Scholer H.R. (1994) Oct-4 transcription factor is differenti-ally expressed in the Mouse embryo during esta-blishment of the first two extra embryonic cell lineages involved in implantation. Dev. Biol, 166:259-267.

16. Palmieri S.L., Peter W., & Hess H. (1994) Oct-4 transcription factor is differentially expressed in the Mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation. Dev Biol, 166:259-267.

17. Pelton T.A., Sharma S., schulz T.C., Rathjen J., & Rathjen P.D. (2002) Transient pluripotent cell populations during primitive ectoderm formation: correlation of in vivo and in vitro pluripotent cell development. Cell. Sci, 115:329-339.

18. Pesce M., Gross M.K., & Scholer H.R. (1998) In line with our ancestors : Oct-4 and the mammali-an germ. Bioessays, 20:722-732.

19. Pesce M., & Scholer H.R. ) 2001) Oct4: gatekee-per in the beginnings of mammalian development. Stem cells, 19:271-278.

20. Pesce M., Wang X., Wolgemuth D.J., & Scholer H. (1998) Differential expression of the Oct-4 transcription factor during Mouse germ cell dif-ferentiation. Mech. Dev,71:89-98.

21. Rosner M.H. (1990) A POU- domain transcripti-on factor in early stem cells and germ cells of the mammalian embryo. Nature, 345:686-692.

22. Sawada R., Ito T., & Tsuchia T. (2006) Changes in expression of genes related to cell proliferation in human mesenchymal stem cells during in vitro culture in comparison with cancer cells. Artif Or-gans, 9:179-184.

23. Scholer H. (1990) Oct-4: a germ line specific transcription factor mapping to the Mouse t-com-plex. EMBO J, 9:2185-2195.

24. Scholer H. (1990) New type of POU doma-in in germ line- specific protein Oct-4. Nature , 334:435-439.

25. Seitz, A., Aglow, E., and Heber-Katz, E., (2002) Recovery from spinal cord injury: A new transec-tion model in the C57Bl/6 mouse. J. Neuroscience Research 67: 337-345.

26. Tai M.H. (2005) Chang C.C., Olson L.K., & Tro-sko J.E. Oct4 expression in adult human stem ce-lls: evidence in support of the stem cell theory of carcinogenesis. Carcinogenesis, 26:495-502.

27. Takeda J., Seino S., & Bell G.I. (1992) Human Oct3 gene family: cDNA sequences, alternative splicing , gene organization chromosomal locati-on , and expression at low levels in adult tissues. Nucleic Acids Res, 20:4613-4620.

28. Thomson J.A., Itskovitz-Eldor J., Shapiro S.S., Waknitz M.A., Swiergiel J.J., Marshal V.S., & Jo-nes J.M. (1998) Embryonic stem cell lines derived from human blstocysts. Science, 282:1145-1147.

29. Tonis P.A. (2004) Regeneration in vertebrates. Dev Biol, 221:273-284.

30. Tonis P.A. (2002) Regenarative biology: The emerging field of tissue repair and regeneration, Differentiation.70:397-409.

31. Toto P.D., & Annoni J.D. (1963) Histogenesis of newt blastema. Loyal university school of Denti-stry, Chicago, Illinois.

Corresponding author Parham Jabbarzadeh, Department of Biology, Payam Nour University, Iran, E-mail: [email protected]



Abstract

Objective: This paper was to examine the role of anxiety in mammography screening. Breast can-cer screening with mammography has been shown to be effective for preventing breast cancer death. However mammography screening can be harmful to women. One of the major problems is anxiety or lack of peace of mind in mammography screening.

Methods: This study was conducted between November 3, 2007, and December 30, 2007, in Ordu Maternity and Childbirth Hospital. 93 wo-men participated in the study. A 23-item questi-onnaire and the 20-item State Anxiety Inventory, developed by Spielberger et al. were completed by the participants. All numerical values were gi-ven as average ± standard deviation; p<0.05 was accepted for level of significance.

Results: The average age of the partici-pants was 47.83±7.50, the average age at marri-age was 20.03±4.18, the average birth number 2.91±1.21, and the average age at menopause was 46.10±4.70. The average anxiety level was found to be 46.20±4.9. Significant differences (p<0.05) were found between education level, age at marri-age, status of doing breast self examination, sta-tus of having a mammography for a breast-related complaint, and the number of mammograms done.

Conclusions: It was determined that women who had mammography had a moderate level of anxiety.

Key words: mammography, anxiety, screening test

Introduction

Breast cancer is the most common type of can-cer in women after skin cancer. Breast cancer is

also the second leading cause of death from cancer in women, following lung cancer [1]. In previous studies conducted in the US it has been predicted that approximately one in every eight women will be diagnosed with breast cancer in their lives and one it every 30 women will die from breast cancer [1,2,3,4,5,6,7,8]. As with many other types of can-cer when breast cancer is found at an early stage du-ring commonly used screening for lumps, when it is small and has not yet spread, there is an increase in survival and decrease in mortality [9]. Mammo-graphy is the most effective diagnostic method for breast cancer screening in the early stage [10].

Illness is a source of stress whatever the age. Everyone who has a health problem experiences anxiety, which is a normal response when facing danger. Anyone who comes to a health care faci-lity with any health problem may be anxious for many reasons, such as, being in an unfamiliar en-vironment, having to relate with strangers, being spoken to with medical terminology by health care personnel, seeking diagnosis and a cure [2,8,9].

Undergoing certain diagnostic procedures, such as mammography, may cause some people to think about serious results and increase their anxiety. It has been shown that women who had recently felt tense and nervous or had a fear of breast cancer diagnosis had higher anxiety levels. Mammography is the most reliable method to di-agnose breast cancer. When used alone, its relia-bility is 90%; used with clinical examination it is 95%. It can be used to diagnose breast cancer at an early stage. The American Medical Center recom-mends that women with no symptoms have their first mammogram at the age of 40 (earlier if they have a positive family history for cancer), and that they have a mammogram once every one to two years (per physician’s recommendation) between

Determination of the Anxiety Level of Women Who Present for MammographyNurgül Bölükbaş, Nülüfer Erbil, Azize Nuran Kahraman

Ordu University, Ordu Health School, Department of Nursing, Turkey

544



the age of 40 and 50, then once a year after age 50 [11,12]. Factors associated with screening mam-mography use are multiple and complex. Histori-cally, socioeconomic barriers have been described as having a major impact on utilization [13,14]. Other factors, such as access to screening, breast disease history lifestyle issues, and personal beli-efs, have also been associated with mammograp-hy use in the literature but are less well studied [15,16,17,18].

One of the important reasons for patients’ anxi-ety is a lack of knowledge about the method and how it diagnoses illness. Sakan and colleagues pointed out that it is necessary to inform patients about diagnostic procedures to prevent patients from worrying unnecessarily. Anxiety has been determined to be a common problem during all kinds of medical diagnosis, treatment and care. Although it is known that patients have the right to be informed about diagnostic procedures and treatment modalities, education is often ignored. It is important to inform patients to reduce their anxiety level and to prevent them from develo-ping negative defenses [19]. For this reason, when patients are prepared for special procedures like mammography, it is important to determine their anxiety level and influential factors.

Methods

Sample

This cross-sectional descriptive study was con-ducted between November 3, 2009, and Decem-ber 30, 2009, at Ordu Maternity Hospital Mam-mography Unit, with 59 women who had appoin-tments to have mammography.

Data Collection

A 23-item questionnaire and the 20-item State Anxiety Inventory, developed by Spielberger et al. were used for data collection. They were comple-ted by the participants using a face to face intervi-ew method. On the questionnaire form there are 10 questions about their opinions about mammo-graphy. The State Anxiety Inventory determines

individuals’ feelings in certain conditions and at that moment. Its translation into Turkish and re-liability and validity study was done by Öner and Le Compte in 1989. On this inventory there are 40 statements about how the individual feels. The first 20 items measure the situation-related anxi-ety level with 4 choices. These choices are: None (1), Some (2), A lot (3), Always / Completely 20. In this section there are direct and reversed state-ments. By subtracting the points of reversed state-ments from direct statements a value is obtained and added to 50 (constant value) to obtain the state anxiety score. The results are interpreted as having no anxiety for a score of 0-19, mild anxiety for a score of 20-39, moderate anxiety for 40-59, severe anxiety for 60-79, and in need of professional help for a score 80 or higher[20].

To evaluate the resulting data the Statistical Package for the Social Sciences (SPSS), versi-on 11.5, was used. Percentage, arithmetic avera-ge, Mann-Whitney U test and Kruskall-Wallis test were used to analyze the data. All numbers were given as average value ± standard deviation; p<0.05 was accepted for level of significance.

Results

The average age of the women who came to have mammography was 47.83±7.50, their age at marriage was 20.03±4.18, and their age at meno-pause was 46.10±4.70. A statistically significant difference was found between their age at marria-ge and their anxiety level (p<0.05). Their number of abortions was determined to be 1.47±0.61 and number of births was 2.91±1.21. Half (51.67%) of the women had graduated from primary school, 90% of them were married. A statistically signi-ficant difference was found between educational level and anxiety level (p<0.05)

Of the women who breastfed their children 34.4% did so for 0-6 months and 27.8% for 7-12 months. More than half (64.8%) did not take hor-mone replacement therapy in menopause. In this study 11.8% of the women’s close relatives had breast diseases, 62.4% did breast self examina-tions (BSE), and 46.2% had a breast complaint. There was a statistically significant difference between BSE status and anxiety (p<0.05)



Of the women presenting for mammography 58.1% came at their physician’s request, 41.8% on their own; 46.2% had knowledge about mam-mography and had received this information from their friends. In this study 37.6% the women thou-ght that the radiation from mammography could be harmful to them. In response to the question about what was diagnosed with mammography, 45.2%

had no idea and 43.0% thought that tumors were diagnosed. More than half (54.5%) of the women were having their first, and 34.4% their second mammogram. Statistically significant differences were found among the information sources about mammography, the illnesses that are diagnosed by mammography, the number of mammography and anxiety (p<0.05)

Table 1. Comparison of anxiety level with sociodemographic characteristics of the women about to have mammography

Sociodemographic Characteristics X±SD R P.Age 47.83±7.50 .156 .136.Age at Marriage 20.03±4.18 .-212 .041.Age at Menopause 46.10±4.70 .137 .300.Birth number 2.91±1.21 .-017 .871.Abortion number 1.47±0.61 .-031 .861

Number % X±SD pEducationLiteratePrimary schoolSecondary schoolHigh schoolUniversity

2648 7 9 3

28.051.6 7.5 9.7 3.2

48.69±4.3744.97±4.8645.42±5.3144.44±4.50 42.33±2.51

df=4 .007

Marial statusMarriedSingle

90 3

96.8 3.2

46.23±5.00 45.33±0.57

MW-U123.500

.802

Table 2. Comparison of influential factors for breast diseases and anxiety level of women who had a mammography

In Breast Diseases Effecting Factors Number % X±SD P.Duration of breastfeeding*– 0 – 6 months– 7 – 12 months– 13 – 18 months– 19 – 24 months

31251519

34.4 27.8 13.724.1

44.93±4.1645.52±5.8747.26±4.0448.05±4.80

df=5 .142

Took hormone replacement therapy in menopause*– Yes– No

2138

35.2 64.8

45.23±3.747.51±5.72

MW-U320.000

.164

.Had close relative with breast disease– Yes– No

1182

11.888.2

48.00±3.0347.51±5.72

MW-U302.500

.Did Breast Self examination– Yes– No– Irregularly

582115

62.421.5 16.1

46.53±4.1944.25±6.53 47.53±4.67

df=2 .035

.Had a breast-related medical complaint – Yes– No

4350

46.253.8

t=.-496

.621

546



Table 3. Comparison of mammography-related information with average anxiety levelMammography-related information Number % X±SD p

.Mammography recommendation – On own – Physician’s suggestion

3954

41.958.1

46.84±4.9045.74±4.93

t=1.069 .288

.Knowledge about having mammography – Informed – Not informed – Partly informed

5241 9

46.244.1 9.7

46.37±5.1346.09±2.3045.88±3.91

df=2 .878

.Information resources about mammography – Physician – Nurse – Television – Experts – Friends

838222

18.67.018.64.751.2

49.00±5.0743.33±2.3042.00±5.07 52.00±0.0046.86±4.58

df=6 .027

.Opinions about radiation received mammography – Yes, has an effect – No effect – Partly affects

353424

37.6

36.625.8

45.97±4.4047.47±5.09 44.75±5.13

df=2 .124

Opinions about diseases that are diagnosed from mammography – Cancer, tumor – Cyst – Menopause – No answer

405642

43.05.46.545.2

47.00±4.4044.60±4.0342.25±4.31 42.20±5.53

df=4 .047

.Number of mammograms done – 1 – 2 – 3 – 4 – 5

42321045

45.234.410.84.3 5.4

45.09±3.7646.90±6.0446.00±4.29 50.00±6.16 48.20±4.66

r=.216 .038

The average anxiety for women having a mam-mogram in this study was found to be 46.20±4.92, which is a moderate level of anxiety.Table 4. The average anxiety level of the women who had a mammogram

Anxiety MeanX±SD

46.20±4.92

Discussion

Mammography is an ideal method for regular screening programs for early diagnosis of breast cancer. These screening programs are known to lengthen survival and decrease mortality [2,3,4,5]. To be able to get positive results from screening programs it is necessary to have a high rate of participation. However some women avoid these

types of screening programs because they consider mammography to be a painful and uncomfortable method or are afraid that they will be diagnosed with breast cancer [21,22,23]. It was determined in our study that 53.8% of the women did not have a breast-related complain, 58.1% came for mam-mography at their physician’s recommendation, 43.0% were afraid that a breast mass would be found in the mammography results and that these women had a higher anxiety average score. In a study conducted by Alimoğlu et al. it was determi-ned that participants’ being more concerned abo-ut themselves recently and being afraid of being diagnosed with breast cancer were factors which increased the state anxiety level. Similar findings have been obtained in other studies [1,21,22,24].

Because breast cancer is so significant of a pro-blem in women it is very important that women over 40 years of age get a mammogram once a



year for early diagnosis. Women have to request to have this screening test. However 58.1% of the women participating in our study came from ma-mmography at the recommendation of their physi-cian. For this reason it is necessary to explain the importance of this procedure to women with edu-cational programs [5,6,21,22,23].

The level of anxiety about mammography screening was found to be higher in women with low educational levels and this difference was fo-und to be statistically significant. Similar results were reported in the study by Brunton and collea-gues [1,22,23].

Women with a family history of breast cancer in this research were more likely to report higher levels of worry about breast cancer than those wo-men without a family history of breast cancer, but the difference between the two groups was not fo-und to be statistically significant. Similar results were reported in the study by Brunton and collea-gues [22,23].

As the number of mammograms done increased the anxiety level increased and this difference was found to be statistically significant. The reason for this may be that physician’s recommending that women have regular mammography screening may have made the women think that this was be-ing done because there was a suspicion of cancer [1,21,22,23]. Because high levels of worry abo-ut breast cancer may already be prevalent in the at risk population regardless of whether they are currently undergoing screening mammography, and this may deter some women from attending, further research is required to identify specific and appropriate interventions to deal with this anxiety.

Conclusion

From the results of this study it has been de-termined that women having mammography have a moderate level of anxiety. Statistically signifi-cant differences were found for age at marriage, education level, status of doing BSE, information resources, knowledge about the illnesses that ma-mmography detects, and the number of mammo-grams (p<0.05).

We did not find any significant differen-ces between the anxiety scores of the informed

(41.4+7.9) and uninformed (40.9+7.7) women, but the pain level was significantly lower in the in-formed group (16.5+22.4) than in the uninformed group (24.5+28.1). There was no statistically si-gnificant relationship between the anxiety and pain levels.

Overall, however, contrary to suggestions from other researchers, this study does not demonstrate that screening mammography raises the ongoing le-vel of anxiety in this population of women. The re-verse had been shown. The majority of women felt reassured following their mammogram, and levels of anxiety about breast cancer were diminished.

Nurses can play a significant role in breast can-cer screening programs. They can evaluate parti-cipants’ level of anxiety at an early stage and offer appropriate support. They can also ensure the fo-llow up and personalized support required while a patient awaits a diagnosis.

Acknowledgement

We wish to thank all women who so willingly participated in this study. We should like to thank Sheryl Jackson for their help and suggestion Eng-lish translation.

References

1. Alimoğlu E, Alimoğlu MK, Kabaalioğlu A, Çeken K, Apaydın A, Lüleci E. Mamografi çekimine bağlı ağrı ve kaygı (Pain and anxiety associated with ma-mmography). Türk Tanısal ve Girişimsel Radyoloji Dergisi, 2004;10:213-217

2. Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2007.CA Cancer J Clin 2007;57:43-66

3. Smith-Bindman R, Kerlikowske K, Gebretsadik T, Newman J. Is screening mammography effective in elderly women? Am J Med 200;108:112-119

4. Humphrey LL, Helfand M, Chan BK, Woolf SH. Breast cancer screening: A summary of the eviden-ce fort he U.S. Previntive Services Task Force. Ann Intern Med 2002;137-347-360

5. Tabar L, Dean PB. Mammography and breast cancer. The new era. Int J Gynaecol Obstet 2003; 82:319-326

548



6. Nystrom L, Anderson I, Bjurstam N, Frisell J, Nor-denskjold B, Rutqvist LE. Long-term effects of ma-mmography screening: Updated overview of the Swedish randomized trials. Lancet 2002;359:909-919

7. Humphrey LL, Helfand M, Chan BKS, Woolf SH. U.S. preventive services task force breast cancer screening: a summary of the evidence.

8. http://www.ahcpr.gov/clinic/3rduspstf/breastcan-cer/brcansum.pdf.

9. American Cancer Society. Cancer facts&figures 2004. http://www.cancer.org/downloads/STT/CAFF_finalPWsecured.pdf

10. American Cancer Society. Bresats cancer facts&figures 2003-2004. http://www.cancer.org/downloads/STT/CAFF2003BrFPWSecured.pdf.

11. Keemers-Gels ME, Groenendijk RP, Van den Heu-vel JH, Boets C, Peer PG, Wobbes TH. Pain expe-rienced by women attending breast cancer scree-ning. Breast Cancer Res Treat. 2000;60:235-240

12. Mandelblatt JS, Yabroff KR. Breast and cervical cancer screening for older women: Recommen-dations and challenges fort he 21st century. J Am Med Womens assoc 2000;55:210-215

13. O’Malley MS, Earp JA, Hawley ST, Schell MJ, Mathews HF, Mitchell J. The association of race/ethnicity, socioecomic status and physician reco-mmendation for mammography: Who gets the me-ssage about breast cancer screening? Am J Public Health 2001;91:49-154

14. Kagay CR, Quale Q, Smith-Bindman R. Screening mammography in the American elderly. Am J Prev Med 2006;31:142-149

15. Hsia J, Kemper E, Kiefe C, et al. The importan-ce of health insurance as a determinant of cancer screening: Evidence from the Women’s Health Ini-tiative. Prev Med 2003;37:475-484

16. Sambamoorthi U, McAlpine DD. Racial, ethnic, socioecomomic, and Access disparities in the use of preventive services among women. Prev Med 2003;37:475-484

17. Andersen MR, Smith R, Meischke H, Bowen D, Urban N. Breast cancer worry and mammograp-hy use by women with and without a family history in a population-based sample. Cancer Epidemiol Biomarkers Prev 2003;12:314-320

18. West D, grene P, Kratt P et al. The impact of a family history af breast cancer on screening prac-tices and attitudes in low-income, rural, African american women. J Womens Health 2003;12:779-787

19. Austin LT, Ahmad F, McNally MJ, Stewart DE. Breast and cervical cancer screening in Hispanic women: A literature review using the health belief model. Womens Health Issues 2002;12:122-128

20. Sakan BB, Belet Ü, Akan H, Şahin AR, Sunter AT. Kontrast madde bilgi formlarının hasta ank-siyetisi üzerine etkisi. Türk Tanısal ve Girişimsel Radyoloji Dergisi, 2003;9:10-13

21. Öner N, Le Compte A. Süreksiz durumluk/Sürekli kaygı envanteri, 2. basım. İstanbul, Boğaziçi Üni-versitesi Yayınevi, 1998

22. Mainiero MB, Schepps B, Clements NC, Bird CE. Mammography-related anxiety: effect of prepro-cedural patient education. Women’s Health Issues 2001; 11:110-115

23. Brunton M, Jordan C, Campbell I. Anxiety befo-re, during, and after participation in a populati-on-based screening mammography programme in Waikato Province, New Zealand. The New Zea-land Medical Journal 2005;118(1206)

24. Brunton MA, Thomas D. Privacy or life: How do women find out about screening mammo-graphy services? New Zealand Medical Journal 2002;115(1161)

25. Schueler KM, Chu PW, Bindman RS. Factors associated with mammography utilization: Asy-stematic quantitative review of the literature. Jo-urnal of Women’s Health 2008;17:1477-1498

Corresponding author Nurgül Bölükbaş, Ordu University, School of Health, Turkey, E-mail: [email protected]



Abstract

The direct immunofluorescence test (DIF) for proving Chlamydia trachomatis antigens in endo-cervical smear (by means of monoclonal antibo-dies), the ELISA test for proving IgG antibodies against Chlamydia trachomatis in sera and the com-plement fixation test (CFT) for proving antibodies against group Chlamydia-antigen were applied to test 288 women (aged 19-67), who had undergone thorough clinical examination and whose history data had been analyzed in details. Chlamydia trac-homatis induced infection was found in 29.51% of the cases, equally distributed through all age groups. The authors analyzed the frequency of Chlamydia positive findings according to the clinical diagno-ses, parity, relevant data from their gynecological history as well as the results of vaginal secretion tests and Papanicolaou smear findings.

Key words: Sexually transmitted diseases, Chlamydia trachomatis

Introduction

Sexually transmitted diseases are getting more and more common both in the world and in our country. Consequently, there are more and more studies in the literature, particularly in the last 10 year, dealing with these problems, and reporting Chlamydia trachomatis as the most frequent cau-se of sexually transmitted diseases in England (3), the USA (4), Scandinavian countries (5), France (6) as well as in our country (7,8,9,10,11).

Chlamydiae form a specific group of prokaryo-tic microorganisms, adapted to the obligated intra-cellular parasitism. This group of microorganisms

is clearly defined by their morphology, the unique procreation cycle, with formation of characteristic cytoplasmatic inclusions, antigen structure, meta-bolic activity and sensitivity to antibiotics, which also make them different from all other prokaryo-tes. Today they are classified into the species of Chlamydiales, the family of Chlamydiaceae, the genus of Chlamydia (1,2,3).

Chlamydiae possess the common, group-spe-cific antigen and type-specific ones, characteristic of each Chlamydia.The group-specific antigen is used as the antigen in the complement fixation test (CFT). The type-specific antigen stimulates the production of neutralizing antibodies. It can be proved by the test of indirect immunofluorescence (IIF), the DIF test as well as the ELISA test.

Chlamydia trachomatis causes non-gonococcal urethritis, epididymitis and acute proctitis in men; while in women it causes cervicitis, bartholinitis, endometritis, salpingitis, inflammation of organs in the pelvis minor (3,7,8,12,13,14,15) and pne-umonia and inclusion conjunctivitis in newborns (3). Inclusion conjunctivitis may appear in all age groups, in both sexes if the infection is transmitted into the eye (3).

Chlamydia trachomatis can have an important role in inducing sterility in women (9,12,15) and extra-uterine pregnancies (12,15). Chlamydia in-duced infections in pregnancy are non the less important because of possible complications at delivery and in peurperium (3,9,15). The infected pregnant women are at a higher risk of having a pre-term delivery, spontaneous miscarriage, po-stpartal endometritis, as well as pre-term rupture of the amniotic sac (13,15).

There are no certain clinical signs suggesting an infection induced by Chlamydia trachomatis.

Chlamydia Trachomatis – infections in womenVera Jerant Patic1, Vesna Milosevic1, Ivana Hrnjakovic Cvjetkovic1, Aleksandra Patic1, Mirjana Bogavac2, Deana Medic1, Vera Gusman1, Jelena Radovanov1, Zelimir Eric3

1 Institute of Public Health of Vojvodina, Novi Sad, Serbia,2 Clinical Center of Vojvodina, Novi Sad, Serbia,3 Faculty of Medicine, University of Banjaluka, Banjaluka, RS, BiH.

550



Most Chlamydia trachomatis induced infecti-ons are localized on the mucous membranes (in-volving predominantly the cylindrical and transi-tional epithelium), which results in the absence of a stronger antigen stimulation with the subsequent rather low humoral immune response. Specific an-tibodies may sometimes be proved only by very sensitive serological tests, such as the immunoflu-orescence and the ELISA test. Chlamydia tends to stay among the cells in the organism for a long time after the primary infection, thus resulting in a long-lasting latent infection. Elementary cor-puscles (infectious agents) may be found outside the cells, even in the presence of a high blood antibody titre. Therefore, these infections require energetic and long-lasting treatment (1,2).

The etiological diagnosis of C.trachomatis in-duced infections cannot be made clinically, be-cause clinical signs are different and uncertain, even absent in some cases. The diagnosis can be made in laboratory by the direct demonstration of the presence of inclusions in the epithelial cells of the conjunctiva or genital mucous membranes (by Gimzi staining technique, by staining with iodine, and the immunofluorescence technique), by the isolation and identification of causative agents from the patient’s material, usually in the cell culture (Hela 229, or Mc Coy) having previ-ously been given radiation or treated with 5-iodi-ne-2-dioxyuridine i.e. cytochalasine B. After the infection, cyclohexamide is added to the cells, as the inhibitor of the protein synthesis of the host cells. In the cell culture, Chlamydiae are identifi-ed by demonstrating the presence of inclusions by some of the above mentioned techniques. Chla-mydia induced infections can also be diagnosed by techniques for the direct detection of Chlamy-dia antigens in the patient’s samples by means of monoclonal antibodies (usually the fluorescence microscopy tests or the ELISA test) as well as by methods for demonstrating specific antibodies in patients’ sera (IIF, ELISA, CFT) (1,12,15). While doing so, it is of the primary importance to detect the causative agent or the antigen of the agent in the patient’s material, and serology itself is com-plementary (3,7).

The purpose of this prospective controlled study was to examine random samples of pregnant and non-pregnant women in order to determine not only

the frequency of the genital infections induced by Chlamydia trachomatis in women but also the level of the immune response to the presence of Chla-mydia in the examined women. Another purpose of this study was to use our own samples to analyze diagnostic possibilities of methods applied in ma-king etiological diagnoses of these infections along with the recommendation for the choice of diagno-stic procedures which would provide the best re-sults in routine detection of Chlamydia trachomatis induced infections in our country.

Patients and Methods

The random sampling method was applied to choose 288 women, aged from 19 to 67, who were then thoroughly clinically examined and their hi-story data analyzed over the period of one year. The mean age of the examined women was 32.8 years. Of 288 examined women, 16 (5.56%) were pregnant, 27 (9.38%) had the diagnosis of the pri-mary or secondary sterility, while the others came to the gynecological surgery for the examination or check-up under the diagnosis of cervicitis, col-pitis, erytroplakia portio vaginalis cervici uteri, acute and chronic adnexitis, myoma uteri, tumor ovarii, etc. Of 288 women, 22 (7.64%) had com-plications in previous pregnancies. Only 8 women (2.78%) were free of any subjective discomforts or pathologic findings at examination.

Fifty-six women (19.44%) had more than 3 ar-tificial abortions in their history, and 37 (12.85%) had an intra-uterine device. The examined women were from Novi Sad and its surrounding.

The following diagnostic methods were used at the same time to detect Chlamydia trachomatis induced infections: the technique of fluorescent microscopy for direct detection of Chlamydia an-tigen in the patients’ sample by means of monoc-lonal antibodies; the immuno-enzymatic (ELISA) test for demonstrating specific antibodies of IgG class against Chlamydia trachomatis and the com-plement fixation test for detecting antibodies in the serum, by group Chlamydia-antigen.

Endocervical smears to be examined for the presence of Chlamydia trachomatis antigen by the fluorescent microscopy were taken at the gyne-cological surgery by the original smear from the



“Chlamydia set” according to the manufacturer’s instructions and were immediately put on the plate to be examined by the fluorescent microscopy te-chnique (Chlamyset-monoclonal antibodies – Ori-on Diagnostica, Finland). The blood samples were also taken at the same time to detect antibodies in the patients’ sera. Serological reactions for de-monstrating antibodies against Chlamydia tracho-matis were used to examine the even sera of the patients and/or the sera taken after the applied the-rapy. The following techniques were applied: the ELISA test (micro-method) for the determination of the IgG antibodies against Chlamydia tracho-matis (Orion Diagnostica, Finland); the IgG class antibody titre was determined by spectro-photo-metry by the photometer “Stripreader Micro-elisa System, Orion”. The manufacturer’s instructions were followed to determine the borderline titre of IgG antibodies as well as the negative, slightly po-sitive and positive ones.

The complement fixation test was performed as a macro-method by the group soluble Chlamydia-antigen made by the procedure according to Terin et al. (27, 28). When the titre antibodies finding was ½ and over it was considered to be positive.

The serological reactions with the even sera of the patients were performed at the same time.

Statistical significance was calculated by the X2 test, Yate’s reaction and Fisher’s exact test.

Results

Table 1. shows that Chlamydia trachomatis in-duced infection was detected in 85 (29.51%) out of 288 examined women. It should be noted that all three applied diagnostic methods were positi-ve in 20 examined women (6.94%), two methods were positive in 26 (22 + 4 – 9.03%) and in 39 examined women (25 + 14 – 13.54%) Chlamydia induced infection was proved according to one po-sitive out of three applied diagnostic tests.

Out of 85 women who were found to have Chlamydia trachomatis induced infection, 24 wo-men (28.24%) had antibodies in the serum, along with the positive finding in the endocervical sme-ar; in 36 women (42.33%) only the serum antibo-dies were found; and in 25 women (29.41%) only the endocervical smear examined by the DIF test was positive while the antibodies were not proved

Table 1. Frequency of Chlamydia positive findings in 288 examined womenNumber of + / Number of examinees % +

ELISA +, RVK + (CFT +), Endocervical smear + 20/288 6,94ELISA +, Endocervical smear + 4/288 1,39ELISA +, RVK + (CFT +) 22/288 7,64Endocervical smear + 25/288 8,68ELISA + 14/288 4,86Total number: 85/288 29,51

Table 2. Frequency of Chlamydia positive findings in examined women by their ageAge 19-29 30-39 40-49 50 and older

Chlamydiatrachomatis +

19/66(28,78)

32/99(32,32)

18/74(24,32)

16/49(32,65)

Number of + / Number of examinees( ) = % +

Table 3. Frequency of Chlamydia positive findings by the groups of vaginal secretion (VS)Chlamydia trachomatis +

V.S. (group) Number of examinees Number %II 35 9 25,71III 154 46 29,87

III A 46 14 30,43V 14 3 21,43VI 39 13 33,33

552



in the serum. Therefore, the specific antibodies were proved in the serum of 60 women (70.59%) out of 85 women who were found to have Chla-mydia induced infection.

Table 2. representing the frequency of Chla-mydia positive findings by the age of the exami-ned women, shows that a significant percentage of Chlamydia induced infections was found in all age groups. Slightly more infections were detected in women younger than 40, but that difference is not statistically significant. However, it can be seen that a very high percentage of Chlamydia induced in-fections was found in women over 50 years of age.

Table 3. representing the frequency of Chlamy-dia positive findings by the groups of vaginal secre-tion of the examined women, shows that a conside-rable percentage of those women who were found to have the III, IIIA, V and particularly VI group of vaginal secretion had Chlamydia induced infection at the same time. It also shows that out of 35 exa-mined women who were found to have the II group of vaginal secretion (a normal finding), 9 women (25.71%) had Chlamydia induced infection.

Table 4. representing the frequency of Chla-mydia positive findings by Papanicolaou groups,

shows more Chlamydia induced infections in wo-men having the II and III Papanicolaou group. Out of 6 examined women having Papanicolaou group III, as many as 5 had Chlamydia induced infection. Since the sample included only a small number of women, this datum is of less significan-ce than when having a larger sample. However, it does attract attention.

Table 5. shows that Chlamydia induced infec-tions were more frequent in nulliparae than in ot-her women, but the difference is not statistically significant.

Table 6. representing the frequency of Chlamy-dia positive findings by clinical diagnoses, shows that Chlamydia induced infections were found much more frequently in women diagnosed as ha-ving sterility than in all other examined women (X2 = 11.10). In addition, Chlamydia positive fin-dings were much more frequent in women having various inflammations, such as colpitis, cervicitis, adnexitis, etc. than in women with other diagnoses (X2 + 7.20). In comparison with other inflamma-tory processes, Chlamydia positive findings were much more frequent in women with diagnosis of cervicitis and/or erythroplakia portio vaginalis

Table 4. Frequency of Chlamydia positive findings by Papanicolaou groupsChlamydia trachomatis +

PA (group) Number of examinees Number %I 74 16 21,62II 205 63 30,73III 6 5 83,33

NB: Papanicolaou examination was performed in 285 women (but not in 3) out of 288

Table 5. Frequency of Chlamydia positive findings in women by parityChlamydia trachomatis +

Parity Number of examinees Number %One or more birth 202 56 27,72

Nulliparae 86 29 33,72

Table 6. Frequency of Chlamydia positive findings by clinical diagnosesChlamydia trachomatis +

Clinical diagnoses Number of examinees Number %Colpitis 80 21 26,25Cervicitis, Eryth. PVU 43 15 34,88Colpitis, Cervicitis, Eryth. PVU 40 16 40,00Adnexitis 37 8 21,62Sterility 27 16 59,25Other 61 9 14,75



cervicis uteri, as the single diagnosis or associated with colpitis (X2 = 3.80).

Out of 22 women having the history of patho-logical pregnancies and deliveries, as many as 9 were Chlamydia positive (40.9%). It is interesting to note that Chlamydia trachomatis induced infec-tion was detected in 2 out of 8 women who were free of any subjective discomforts and objective findings. Out of 16 pregnant women included in this study, only 3 were Chlamydia positive.

Table 7. shows that out of 85 women found to have Chlamydia trachomatis infection, 70.59% had positive ELISA test; 57.65% had positive en-docervical smear and the CFT finding was positi-ve in 49.41%.

Table 8. shows diagnostic possibilities when using two of the applied diagnostic methods. The best result in the detection of Chlamydia tracho-matis induced infection (100%) was achieved by the combination of the ELISA-test and the DIF-test, whereas the combination of the CFT and DIF test applied to examine the endocervical sme-ar gave the diagnosis of Chlamydia infection in 83.53% of cases. The poorest results in the detec-tion of Chlamydia trachomatis induced infection were obtained by the application of the ELISA and CFT tests (70.59%).

Discussion

The percentage of Chlamydia positive women hereby determined to be 29.51 emphasizes both the presence and the relevance of this problem in our country. The analysis of data regarding Chla-

mydia positive findings by the age of the examined women has not suggested any special age groups to be at risk, since the percentage of women in-fected by Chlamydia trachomatis was significant in all age groups, even in women over 50 years of age. However, bearing in mind possible con-sequences resulting from these infections (sterili-ty, complications during pregnancy and delivery) it should be said that women of the reproductive age are certainly at special risk.

The obtained results point out to the fact that the clinical signs of Chlamydia infection may be diffe-rent, even absent in some cases. (Two women, free of any subjective discomforts and with no objecti-ve clinical finding, were Chlamydia positive. Nine women with normal finding of the vaginal secretion were Chlamydia trachomatis positive). The above data emphasize the necessity of having to introdu-ce the detection of Chlamydia induced infections into the routine examination, on one hand and on the other one they corroborate the attitude that these infections cannot be diagnosed clinically.

Hereby determined percentage of Chlamy-dia positive women, being 29.51 is in accordance with data found in the world literature (4,7,19,21). Some authors have reported higher percentage of Chlamydia positive women (3,4,5,6,7,29); where-as some have reported lower percentage (8,10,30). The results vary in countries in which studies have been performed (related to customs, habits, promis-cuity, sexual freedom), they depend on the sample (adolescents, women with diagnosed sterility and cervicitis, etc) as well as on the methods applied to demonstrate these infections (direct or indirect se-rological methods, their sensitivity and specificity).

Table 7. Frequency of Chlamydia positive findings by the applied diagnostic method in 85 Chlamydia positive women

Number + with specific test / Total number + % + with specific testELISA + 60/85 70,59%RVK + (CFT +) 42/85 49,71%Endocervical smear + 49/85 57,65%

Table 8. Review of diagnostic possibilities when applying two diagnostic methodsELISA + Endocervical smear 85/85 (100)ELISA + RVK (CFT) 60/85 (79,59%)RVK (CFT) + Endocervical smear 71/85 (83,53)

No.Chl.+ by applying a certain combination of methods/ total Chl. +( ) = % Chl. + by applying a certain combination of methods

554



The choice of the diagnostic method is of the utmost importance. Thus, for example, if only the ELISA test had been applied in this study, the per-centage of Chlamydia positive women would have been 20.83%; had only endocervical smear been examined by the DIF test, the percentage would have been 17.01 and if only the CFT method had been used, the percentage of Chlamydia positive women would have been 14.58%. The analysis of diagnostic possibilities of the applied methods have shown that the ELISA test was positive in 70.59% of Chlamydia positive women; the CFT was posi-tive in 49.41% and the results of the endocervical smear obtained by the DIF test were positive in 57.65% of Chlamydia positive women. The com-bination of the ELISA test and the DIF test for the examination of the endocervical smear gave the best results in the detection of Chlamydia trachomatis induced infection. Somewhat worse results were obtained by the combination of the CFT and DIF test for the determination of Chlamydia trachoma-tis antigen in the cervical smear. The poorest results were obtained by the combination of the ELISA test and the CFT, which can be explained by the fact that both tests demonstrate the antibodies of IgG class (the ELISA test) or predominantly of IgG class (the CFT) against Chlamydia trachomatis in the patients’ sera. Thus, the acute infections remain undetected.

Out of the total number of women with demon-strated Chlamydia trachomatis infection , 70,59% were found to have specific antibodies in their sera. The level of humoral immune response to the pre-sence of Chlamydia trachomatis infection hereby demonstrated is in accordance with the statements of a certain number of authors (2,3,6,7,26), but it is considerably higher than the results reported by some other authors (9), stating that only 43.6% of the infected women were found by the ELISA test to have specific antibodies in the sera.

The fact that specific antibodies in the serum were proved in 70.59% of women diagnosed as ha-ving Chlamydia trachomatis infection in this study suggests the conclusion that, in order to improve diagnosing of these infections, it is necessary to combine serological tests for the determination of specific antibodies in the serum with the methods for the detection of the causative agent or the agent antigen in patients’ material. This is the way to de-tect the entirely acute Chlamydia trachomatis indu-

ced infection as well as those infections in which, due to the absence of a stronger antigen stimulation, as stated in the literature (1,2,3), the humoral immu-ne response gets very low. At the same time, such a combination of methods minimizes the possibility of not proving Chlamydia in the patients’ material (material taken in an inappropriate manner or tran-sported inadequately, errors in the interpretation of the obtained results, particularly of those obtained by the DIF test, leaving the possibility of a certain subjectivity in the assessment of results).

The results obtained in this study indicate that Chlamydia trachomatis induced infections were most frequent in women diagnosed as having pri-mary or secondary sterility as well as that a very high percentage of Chlamydia positive (40.91%) women was found among those having had patho-logical pregnancies and deliveries in their history. These data are in accordance with the data reported by a great number of authors both from our coun-try and abroad (3,9,16,18,19,20,21). In comparison with other inflammatory processes, infections indu-ced by Chlamydia were most frequently diagnosed in women having changes at the cervix (cervicitis and erythroplakia). These results are in accordance with those of other authors (3,8,10,29) and corro-borate the fact that the cervical changes (an inflam-mation and erythroplakia) should lead the gyneco-logist into examining the patient for the presence of Chlamydia trachomatis. The same holds true for the cases in which previous routine examination of the vaginal secretion proved the VS group indicating the presence of a certain infection, since the simul-taneous infection induced by Chlamydia trachoma-tis has been proved in a considerable percentage of women (particularly those having the VI group of the vaginal secretion).

The reference method in diagnosing Chlamy-dia trachomatis induced infections is the isolation of Chlamydia on Mc Coy cell culture, since this procedure identifies (after the reproduction) living and vital Chlamydiae; and as the preparation is free of any admixture and ingredients, the possi-bility of a false interpretation (either false positive or false negative) is minimized. The necessity to spend several days waiting for the cytopathogenic effect to appear on the cell culture (due to the re-production of Chlamydia in the cell culture) may be overcome by detecting Chlamydia trachomatis



in the culture by, e.g., the DIF test using the mo-noclonal antibodies prior to the occurrence of the cytopathogenic effect. Contrary to the cell culture in which only living and vital Chlamydiae can be proved, the technique of hybridization of Chlamy-dia trachomatis nucleic acid, alone or associated by the PCR method, show the presence of sub-minimal amounts of Chlamydia nucleic acid even when it is not living or vital, if it is bound with an-tibodies, i.e. when it is present in quite small amo-unts in the taken material, which does not suggest the infection, since the infection implies a great number of certain causative factors.

Conclusions

The percentage of Chlamydia positive women found in our study to be 29.51% indicates the ne-cessity to introduce such diagnostics into routine examination in our country.

No age groups are at a specific risk as regar-ds the frequency of Chlamydia positive findings. However, bearing in mind the consequences resul-ting from these infections (sterility, complications in pregnancy and delivery), women of the repro-ductive age are certainly at a high risk.

Clinical signs of Chlamydia induced infection may be different, even absent in some cases, and therefore these infections cannot be diagnosed cli-nically.

The choice of diagnostic method is of the utmost importance, since the infections induced by Chla-mydia trachomatis are most frequently localized on the mucous membranes, which is the reason for the absence of a stronger antigen stimulation, so the hu-moral immune response is often low.

The best results in the detection of Chlamydia trachomatis induced infections have been obtained by the combination of the ELISA test for demon-strating specific antibodies and the DIF test for the examination of the endocervical smear against Chlamydia trachomatis antigen.

The cervical changes (an inflammation and erythroplakia) should lead the gynecologist into examining the presence of Chlamydia trachomatis in women diagnosed as having primary and se-condary sterility and those having had pathologi-cal pregnancy and deliveries.

References

1. Schachter J.: Chlamydiae (Psittacosis-Lymphogra-nuloma Venereum-Trachoma Group). In: Lennette E.H. (ed.): Manual of Clinical Microbiology, 4th ed., Washington, American Society for Microbiolo-gy, 1995, pp. 856-62.

2. Moulder J. W., Natch T. P. et al.: Chlamydia. In: Bergey’s Manual of Systematic Bacteriology. Balti-more, Williams and Wilkins, 1994, pp. 729-39.

3. Schachter J.: Chlamydia infections. N Engl J Med, 298-8, 428.35, 2008.

4. Wallis C.: Chlamydia: the silent epidemic. Time, 4:2, 35.5, 2005.

5. Mardh P.A.: Medical Chlamydiologa-a position pa-per (eds.). Scand J Infect Dis, suppl. 32, 3-8, 2002.

6. Siboulet A., Bohbot J. M. et al.: Chlamydia uret-hro-genital infections in France. In: Mardh P.A., Holmes K. K. et al. (eds.): Chlamydial infections. Amsterdam, Elsevier Biomedical Press, 2002, pp. 429-32.

7. Punda V., Galinović-Weisglass M. i dr.: Učestalost Chlamydia trachomatis i imuni odgovor u bole-snika s infekcijama genitalnog trakta. Liječ Vjesn, 110:8, 262-5, 1998.

8. Buković D., Oreščanin M. i dr.: Klamidija trahoma-tis u žena s endocervicitisom. Jugost Ginekol Peri-natol, 29:1-2, 25:7, 1999.

9. Jevremenović M., Vidaković B. i dr.: Klinički i imu-nološki aspekti hlamidijalnih infekcija kod infertil-nih žena. Med. pregled, 42:1-2, 25-8, 1999.

10. Tomljenović M., Vujaković N. i dr.: Učestalost kla-midije trahomatis u adolescentica. Jugosl. Gine-kol Perinatol, 28:3-4:57-9, 1998.

11. Lugović B.: Chlamydiae - kratak pregled. Liječ Vjesn, 105:10, 422-5, 2003.

12. Mardh P. A.: An overview of infectious agents of salpingitis, their biology, and recent advances in methods of detection. Am J Obstet Gynecol, 2000, 138:7 (Pt2), 933-1, 2000.

13. Oriel J. D.: Infections of the male genital tract. In: Mardh P. A., Holmes K. K. et al. (eds.): Chlamy-dial infections. Amsterdam, Elsevier Biomedical Press, 2002, pp. 93-107.

14. Quinn T. C., goodell S. E. et al.: Chlamydia tra-chomatis proctitis. N Engl. J Med, 305:4, 195-200, 2001.

556



15. Westrom L., Mardh P. A.: Genital chlamydial in-fections in the female. In: Mardh P. A., Holmes K. K. et al. (eds.): Chlamydial infections. Amster-dam, Elsevier Biomedical press, 2002, pp. 121-39.

16. Schachter J., Grossman M. et al.: Infection with Chlamydia trachomatis: involvement of multiple anatomic sites in neonates. J Infect Dis, 139:2, 232-4, 1999.

17. WHO Scientific Group. Nongonococcal urethri-tis and other celected sexual transmitted diseases of public health importance. WHO Tech Rep Ser, 660, 11-20, 2001.

18. Moller B. R., Freundt E. A. et al.: Experimental pelvic inflamatory disease provoked by Chlamy-dia trachomatis and Mycoplasmahominis, in griv-et monkeys. Am J Obstet Gynecol, 138-7 (Pt2), 990-5, 2000.

19. Punnonen R., Terho P. et al.: Chlamydial serology in infertile women by immunofluorescence. Fetil Steril, 31:6, 656-9, 1999.

20. Weström L.: Effect of acute pelvic inflammatory disease on fertility. Am J ObstetGynecol, 121:5, 707-13, 2005.

21. Dražančić a., Žalud J. i dr.: Klamidijska infekcija i njeno lečenje u žena sa spontanim pobačajima i prijevremenim porodima. Jugosl. Ginekol Perina-tol, 28:3, 67-71, 1998.

22. Schachter J.: Immunodiagnosis of sexually trans-mitted diseases. Yale J Biol Med, 58:5, 443-52, 2005.

23. Stamm W. E, Harrison H. R. et al.: Diagnosis of Chlamydia trachomatis infections by direct im-munofluorescence staining of genital secretions. A multicenter trial. Ann Intern Med, 101:5, 638-41, 2004.

24. Yoder B. L., Stamm W. E. et al.: Microtest pro-cedure for isolation of Chlamydia trachomatis. J Clin Microbiol, 13:6, 1036-9, 2001.

25. Jones R. B., Katz B. P. et al.: Effect of blind passage and multiple sampling on recovery of Chlamydia trachomatis from urogenital specimens. J Clin Microbiol, 24:6, 1029-33, 1996.

26. Schwidt B. L.: Diagnostik der Chlamydien Infek-tion. Wien Klin Wochenschr, 99:13, 445.8, 1997.

27. Terzin A., Matuka S. et al.: Preparation of group-specific, bedsonia antigens for use in complement fixation reactions. Acta Virol, 3_2, 78-85, 1971.

28. Terzin A. L., Bordjoški M. N. et al.: Some viral, rickettsial and leptospiral infections diagnosed in Serbia. J Hyg 52:3, 129-50, 1974.

29. Bell T. A., Grayston J. T.: Centers for disease control guidelines for prevention and control of Chlamydia tracomatis infections. Ann Intern Med, 104:4, 524-6, 2006.

30. Smith J. W., Rogers R. E. et al.: Diagnosis of Chlamydial infection in women attending ante-natal and gynecologic clinics. J Clin Microbiol, 25:5, 868-72, 2007.

Corresponding author Vera Jerant-Patic, Institute of Public Health of Vojvodina, Center of virusology, Serbia, E-mail: [email protected]



Abstract

Background: Chinese started their insurance business almost over three decades. A burgeoning and distinctive professional group of Chinese in-surance employees has emerged in China. In this study, occupational stress (OS) and quality of life (QOL) were systematically investigated from Chinese insurance workers. It is to find the impact factors that cause OS under the current economic situation and management system. And in parti-cular, to explore the impact factors on QOL from occupational stress factors of the Chinese insuran-ce practitioners. The preventive measures and a theoretical basis for reducing OS and improving QOL will be developed indeed, herewith for in-formation.

Methods: A cross-sectional investigation used random cluster sampling and parallel control. The sample population consists of 599 Chinese insu-rance practitioners, who working in 9 districts in Chongqing, China. Demographic questionnaires, the 36-item Short-Form Health Survey and the Occupational Stress Inventory Revised Edition, were applied to collect demographic variables and to assess OS and QOL. K-means clustering met-hod was used to evaluate QOL comprehensively.

Man-Whitney U, 2c -test and spearman correla-tion methods were used for studying the relation between QOL and OS.

Results: In the OS survey, the scores of the Occupational Role Questionnaire (ORQ), the Per-sonal Strain Questionnaire (PSQ), and the Personal Resources Questionnaire (PRQ) are 168.4±26.6, 103.6±29.1 and 120.0±17.2, respectively. ORQ and PSQ scores are all higher than those in the

Chinese general professional populations’, howe-ver, PRQ is lower. There are significant differen-ces in scores between vary demographic groups of each ORQ, PSQ, and PRQ. Particularly, the salesmen take higher OS and lower PRQ (the sco-res are: ORQ 171.5±26.6, PSQ 107.6±29.2, and PRQ 118.3±17.1). In QOL survey, the physical component summary (PCS) and the mental com-ponent summary (MCS) scores are 69.6±9.0 and 58.9±9.9. These scores are both higher than those in general professional populations’. The spear-man correlation analyses demonstrate that there is a highly negative correlation between PCS and ORQ (PSQ), by contrast a highly positive corre-lation between PCS and PRQ. The similar results were found in MCS. Finally, findings indicate that the group with very low QOL and very high OS consisted of salesmen, who aged 40-50 and edu-cational level being high school.

Conclusions: In China, insurance practitio-ners have higher OS but lower QOL than Chinese general professional population; especially tho-se lowest positioned salesmen are suffering even worse, due to the overloaded work, the conside-rable vocational strain and relaxing ability shor-tage. Therefore, insurance employees should be paid such attention to ameliorate their QOL and well-being, and focus on salesmen even more. Ad-ditionally, to reduce their OS, we need to change the current management systems and release the-ir mind of suffering, calling for public supports. Meanwhile, Psychological counseling service and wholesome promotion should be strengthened for those staffs defending OS.

Key words: Occupational stress, quality of life, insurance practitioners, investigation study.

An investigation study on occupational stress and quality of life among the Chinese insurance practitionersLing Liu1, Baojiang Chen1, Pinyi Chen1, Kunlin He1, Yazhou Wu1, Yanqi Zhang1, Xiaohua Zhou2, Dong Yi1

1 Department of Public Health, Third Military Medical University, Chongqing, China2 Department of Biostatistics, School of Public Health and Community Medicine, Seattle, WA, USA

558



Background

April 1979, Chinese government decided to recover the domestic insurance business [1]. By the end of 2004, the insurance market had grown from the single China life insurance company to 44 domestic insurance companies, 41 foreign in-surance companies, and more than 1200 insurance intermediaries. As of January 2005, the total assets of insurance industry were up to $1.72 hundred billion [2]. With the rapidly developing, amount of insurance practitioners is dramatically increasing. By the end of 1998, national insurance employees were 1.95 hundred thousand totally, and reached nearly 2.56 million to late 2008. They are beco-ming a very large working group [3].

In China, the insurance business has a very short history. People lacked knowledge of insu-rance and doubted its benefit, which caused lower insurance rates. As a result, insurance marketing is improving slowly and the insurance workers’ income is in the low level. At the end of 2008, the insurance practitioner’s average income was $219 per month. Compared to the general professio-nal population, insurance practitioners have poor working conditions, unfixed income, and without basic occupational health protection. Recently, the world economic crisis has had a great impact in-surance business, inducing financial difficulty in selling insurance in China. In summary, these fac-tors bring on increased OS and the mental pressu-re. Insurance has been reported as one of the most stressful occupations in China [4-8].

Researchers started to use Occupational Stress Scale (OSS) and QOL Scale to assess the heal-th status in different populations and to discover impact factors [9-11]. However, only few studies have been reported about insurance practitioners. In particular, many differences exist between the Chinese insurance employees and those in other countries. In this study, we systematically inve-stigated Chinese insurance practitioners’ occupa-tional stress and QOL to find the impact factors and explore the impact factors in current situation. Finally, to create a preventive measures and a the-oretical basis for insurance staffs to reduce occu-pational stress and boost QOL.

Methods

Study population: According to research objec-tives, this study used cross-sectional and random cluster sampling methodology [12]. The sample size is calculated to be 650, in accordance with the pre-survey on insurance OS, compared to that from Chinese general professional population [13-14]. The inclusion criteria are comprised of: (1) conti-nuous engagement in an insurance company over 2 years; (2) no mental or physical diseases.

Sampling Method: A cross-sectional study was conducted using random cluster sampling. According to the above criteria, data that were used in this study, which sampled from three lar-ge-scale companies (9 branches allocated in 9 dis-tricts) in Chongqing, including Chinese Life Insu-rance, Chinese Ping An Life Insurance, and Sino Life Insurance from January to June 2009. Inve-stigators are graduate students from Third Military Medical University and trained together for the survey before the investigation. With cooperation of managers and staff in the insurance companies, all of the participants were thoroughly informed in person about the content and the aim of the questi-onnaire. 650 copies of the questionnaires handed to all the participants by investigators.

Data collection: To reduce the risk of bias and error, as well as to ensure data accuracy and relia-bility, the quality control methods were implemen-ted, they are including: (1) immediate checking and correction after the questionnaire; (2) appro-priate data management by specialists, including double-blind entry, aggregation, calculation, chec-king and logical troubleshooting. Subjects whose questionnaires have more than 5% missing items or have chosen the same option for every question were removed. The finalized sample size is 599.

Questionnaires: Three questionnaires are used in this study: the demographic questionnaire, the Occupational Stress Inventory Revised Edition (OSI-R), and the 36-item Short-Form Health Sur-vey (SF-36). The demographic details itemized by gender, age, education level and work position [15-18].

The grading criterion of occupational stress: Based on the normal of occupational stress among Chinese population, the stress scores of the sample was transformed into T-scores [19]. So the grading



criterion was established based on the T-score. For the ORQ and PSQ, score at or above 70T revea-led extremely high level of maladaptive stress and strain, in the range of 60T to 69T suggested high level of maladaptive stress and strain, and from 40T to 59T indicated normal level of stress and strain, rest below 40T showed a relative absence of maladaptive occupational stress and strain. Ba-sed on the grading criterion, the population can be divided into four groups of different levels of stre-ss and strain.

Also, for the PRQ scales, a score below 30T in-dicated very low amounts of coping resources, in the range of 30T to 39T suggested low amounts of coping resources, from 40T to 59T indicated nor-mal amounts of coping resources, others, at or abo-ve 60T showed high amounts of coping resources.

The k-means clustering method for QOL: To our knowledge, there is no grading criterion for QOL, especially for people in Southwest China; therefore we will use k-means clustering method in this study [20]. In statistics and machine learning, k-means clustering is a method of cluster analysis which aims to partition n observations into k clu-sters in which each observation belongs to the clu-ster with the nearest mean [21]. This method can find the centers of natural clusters in the data.

In previous study, only the total score of QOL was used to divide the samples into different groups by grades of QOL. As we know, QOL consists of eight different health dimensions, as the total score of the sample cannot describe the levels of health exactly. It might be huge differences between any two people with the same total score of QOL. K-means clustering method can divide all samples into different groups in accordance with eight different dimensions of QOL. Hence, it can find the natural clusters according to similarity in 8 dimensions. In other words, it is not sufficient for two samples to reach a similar total score to be considering similar. Also, they must belong to the same cluster obtained by K-means clustering method.

Statistical analysis: Student’s t-test was for the sample and Chinese general professional popula-tion comparison in OS and QOL; One-way-ANO-VA was used to compare different groups within

the study samples; Man-Whitney U, 2c -test and spearman correlation methods were to analyze the

relation between QOL and stress; K-means cluste-ring method classified the samples into different groups with several QOL grades.

Data input and management were implemen-ted using EpiData3.0. Statistical analysis worked through SPSS18, and a two-tailed probability va-lue of less than 0.05 was considered to be statisti-cally significant.

Results

Description of demographic characteristics

In accordance with the effective standards of the questionnaire, 599 cases are valid, which yi-elds response rate of 92.2% (599/650), indicating that effective analysis of the data can be imple-mented.

Table 1 lists the basic composition of the sample: Male 267 (44.6%), female 332 (55.4%); 86 subjects of age <30 (14.4%), 169 of 30≤age <40 (28.2%), 330 of 40≤age <50 (55.1%), 14 of age ≥ 50 (2.3%), indicate that the subjects are mainly between aged 40 to 50, 67 subjects are Office staff (11.2%), 40 are marketing managers (6.7%), and 492 are salesmen (82.1%). Office staff is in charge of the company’s internal running. Marketing managers are responsi-ble for supervising the salesmen. Obviously, a ma-jority of the sample are salesmen. The percentages effectively correspond to those of general Chinese insurance practitioners [3].

Occupational stress and sociodemographic characteristics

In Table 1, according to demographic charac-teristics, occupational stress was compared from three aspects ORQ, PSQ and PSQ in all categories of samples, and also compared with those in ge-neral professional populations. It shows that the-re is significant difference for occupational stress between insurance practitioners and Chinese ge-neral professional population (ORQ: insurance practitioners 168.4 ± 26.6, general 162.9 ± 27.0, p<0.05; PSQ: insurance practitioners 103.6 ± 29.10, general 120.0 ± 17.2, p<0.05; PSQ: insu-rance practitioners 91.0 ± 17.2, general 129.2 ±

560



Table 1. Sociodemographic characteristics and occupational stressVariables n ORQ PSQ PRQ

GenderMale 267(44.6%) 174.0±25.7▲▲a 108.9±28.7▲▲a 119.5±16.9▲▲a

Female 332(55.4%) 163.9±26.6b 99.3±28.8▲▲b 120.4±17.5▲▲a

Age(years)<30 86(14.4%) 172.6±26.5▲▲a 107.4±28.7▲▲a 115.8±17.0▲▲a

<40 169(28.2%) 167.2±25.4▲b 104.5±28.5▲▲b 118.9±15.1▲▲b

<50 330(55.1%) 167.9±27.6▲▲b 102.9±29.7▲▲b 121.3±18.3▲▲b

≥50 14(2.3%) 167.1±14.9b 85.6±16.9b 127.4±10.8c

Educational levelBachelor 121(20.2%) 178.1±24.8▲▲a 114.7±27.9▲▲a 115.7±14.1▲▲a

High school 375(62.6%) 168.9±27.8▲▲a 103.7±29.4▲▲b 119.9±17.9▲▲b

Junior high school 103(17.2%) 162.5±20.9b 90.3±23.6c 125.5±16.6▲c

Position in companyOffice Staff 67(11.2%) 149.4±24.5▲▲a 84.8±22.8▲a 132.1±15.2a

Marketing Managers 40(6.7%) 161.8±12.8b 85.9±15.7a 120.5±13.6▲a

Salesmen 492(82.1%) 171.5±26.6▲▲c 107.6±29.2▲▲b 118.3±17.1▲▲b

Total Insurance 599(100%) 168.4±26.6▲▲ 103.6±29.1▲▲ 120.0±17.2▲▲

Note: When compared in the same category, there is no significant difference between the groups if they have the same letter a or b or c. ▲P<0.05 t-test vs. General population (in table 2, the last column);▲▲P<0.01 t-test vs. General population.

Table 2. Detailed occupational stress scores for each working position

Variables

Insurance PractitionersGeneral population

(n=4278)Salesman(n=492)

Office staff and marketing managers

(n=107)Total

(n=599)

ORQ 171.5±26.6*▲ 154.1±21.7▲ 168.4±26.6▲ 162.9±27.0RO 34.6±7.3* 28.8±4.9 33.6±7.3▲ 29.0±5.8RI 30.5±5.7*▲ 28.5±5.4▲ 30.1±5.7 30.3±6.9

RA 25.9±6.8*▲ 22.2±6.4▲ 25.2±6.9▲ 28.2±10.6RB 27.1±7.2*▲ 22.6±6.5▲ 26.3±7.3 24.8±5.1

R 28.8±5.9▲ 29.4±5.6▲ 28.9±5.9▲ 24.7±6.3PE 24.7±5.4*▲ 22.5±5.2▲ 24.3±5.4 25.9±7.4

PSQ 107.6±29.2*▲ 85.2±20.4▲ 103.6±29.1▲ 91.0±17.2VS 26.0±9.2*▲ 19.1±5.2 24.8±9.0▲ 20.0±5.1

PSY 28.3±9.1*▲ 21.5±7.1▲ 27.1±9.2▲ 23.7±6.0IS 26.7±5.8*▲ 23.4±5.2▲ 26.1±5.8 25.4±4.4

PHS 26.6±8.3*▲ 21.3±6.5 25.6±8.3▲ 22.0±5.5PRQ 118.3±17.1*▲ 127.8±15.6 120.0±17.2▲ 129.2±17.7

RE 26.3±5.0▲ 26.7±4.6 26.4±4.9 27.4±5.5SC 28.5±5.7*▲ 30.4±4.7 28.9±5.6 29.5±5.7SS 31.3±8.1*▲ 36.3±6.4 32.2±8.1 36.6±6.5RC 32.2±6.8*▲ 34.4±6.9 32.6±6.9 35.7±6.0

Note: Office staff and marketing managers are counted together.* P <0.05, t-test vs. office staffs;▲P<0.05 t-test vs. General population.



17.7, p<0.05). We conclude that insurance practi-tioners have higher levels of stress and strain, and lower levels of developed coping resources, the data from Chinese general professional population refer to [15]. We need do some further research to find the reasons.

As in Table 1, most of the samples come from salesmen. Regarding to stress, there is significant difference between salesmen and the other two positions (office staff and general professional population). So in Table 2, we carried out a de-tailed comparison of occupational stress of the 14 sub-items. It shows that there is significant differ-ence among those sub-items except Responsibility (R) when comparing salesmen to office staff and the general professional population. So the sales-men need particular care to reduce work stress.

QOL and demographic characteristics:

Table 3 lists the results for quality of life based on the evaluation of physical health (PCS) and the mental health evaluation (MCS). According to de-mographic characteristics, PCS and MCS scores were compared among all categories of samples and also to the general professional population. It shows that there is significant difference in QOL between insurance practitioners and the Chinese general professional population.

As in Table 4, the comparison of QOL was ba-sed on the 8 sub-items, that there is significant di-fference among sub-items compared to office staff and the general professional population except RP. Most importantly, QOL needs to be improved for salesmen in every possible way.

Clusters of QOL by K-means method

According to the 8 dimensions of QOL, all samples were divided by K-means method into 3 clusters, which are referred to the Very Low, Low and High QOL section. As shown in Table 5, we believe that this result of classification is reaso-nable: (1) QOL scores of the first and the second groups were lower than it is in General group, in contrasted to the third group. We defined these groups into Very Low, Low and High group, res-

pectively; (2) In the Very Low group, seven di-mensions of QOL are far lower than other groups’ except General Health Perception (GH) which is a little higher than in the Low group. (3) There is a large difference between the Low group and the General group in MCS; (4) the overall QOL of High groups’ is better than it is in General group, as seen mainly in MCS. In short, the clustering re-sult reflects the actual situation reasonably.

The grades of QOL and sociodemographic characteristics

In Table 6, there is no obvious difference in QOL between genders; people of age 40-50 are mainly concentrated in the Low group. In educa-tion categories, most samples from high school level are in the Low group, and salesmen are all staying very low level at the end of QOL classifi-cations, demonstrated from work position part. As a result, there is a large difference between sale-smen and other groups.

The relationship between QOL and occupa-tional stress

In Table 7, there is a close relation between QOL and OS. In ORQ and PSQ, most of the sam-ples whose scores are high or very high and nor-mally score lowly in QOL, indicating that there is a negative correlation between ORQ and QOL (rs=-0.427, P=0.000), and also a negative correla-tion between PSQ and QOL (rs=-0.543, P=0.000). In PRQ, all samples who are in Very High group have high QOL, it suggests that there is a positive correlation between ORQ and QOL (rs=0.320, P=0.000). Thus, it is confirmed that QOL associa-te with occupational stress and strain, and that co-ping resources could enhance physical and mental health problem.

562



Table 3. QOL and sociodemographic characteristicsVariables n PCS MCS

GenderMale 267(44.6%) 70.5±8.0▲▲a 58.9±10.4▲▲a

Female 332(55.4%) 69.0±9.5▲▲a 59.1±9.4▲▲a

Age(years)<30 86(14.4%) 68.8±8.1▲▲a 61.2±13.4▲▲a

<40 169(28.2%) 69.9±9.3▲▲a 60.9±11.3▲▲a

<50 330(55.1%) 70.4±8.1▲▲a 57.7±7.3▲▲a

≥50 14(2.3%) 55.4±12.9▲▲b 50.9±8.1▲▲b

Educational levelBachelor 121(20.2%) 70.6±6.6▲▲a 60.7±13.4▲▲a

High school 375(62.6%) 71.1±7.1▲▲a 58.7±8.6▲▲a

Junior high school 103(17.2%) 63.4±13.2▲▲b 57.9±9.0▲▲a

Position in companyOffice Staff 67(11.2%) 77.6±3.7▲▲a 75.9±8.5▲▲a

Marketing managers 40(6.7%) 73.3±5.9b 70.0±8.6b

Salesmen 492(82.1%) 65.3±8.9▲▲c 55.8±6.5▲▲c

Total Insurance 599(100%) 69.7±8.9▲▲ 58.9±9.8▲▲

▲P<0.05 t-test vs. General population (in table 4, the last column); ▲▲P<0.01 t-test vs. General professional population.

Table 4. Detailed QOL scores for each by working position

VariableInsurance Practitioners General Population

(n=4278)Salesman(n=492)

Office Staff(n=107)

Total(n=599)

PCS 68.3±8.9* 75.9±5.1 69.7±8.9▲ 75.4±23.4PF 78.3±7.4*▲ 84.4±9.3 79.4±8.1▲ 82.8±19.7RP 73.3±18.3▲ 74.3±4.9▲ 73.5±16.7▲ 81.5±33.2BP 65.9±17.4*▲ 74.1±10.9▲ 67.3±16.7▲ 82.2±20.1GH 55.9±7.4*▲ 71.1±12.8▲ 58.6±10.4 57.6±19.2

MCS 55.8±6.5*▲ 73.7±8.9 59.0±9.8▲ 72.1±22.7VT 50.4±7.2*▲ 56.3±10.4▲ 51.5±8.2 52.2±20.6SF 59.1±9.9*▲ 80.7±16.5 63.0±14.1▲ 83.3±17.8RE 64.6±21.3*▲ 82.2±5.1 67.7±20.5▲ 84.4±32.4MH 49.1±7.3*▲ 75.7±13.7▲ 53.8±13.5▲ 72.1±19.8

▲ P<0.05 t-test vs. General professional Population; * P <0.05, compared to office staffs.

Table 5. Three groups classified by the 8 diemensions of QOL scores

VariablesThree Groups

General PopulationVery Low(n=248)

Low(n=264)

High(n=87)

PF 75.3±8.7 80.8±5.7 86.6±6.1 82.8±19.7RP 59.9±15.5 85.8±8.7 75.2±4.4 81.5±33.2BP 56.2±14.1 76.4±14.6 71.7±9.7 82.2±20.1GH 58.6±8.4 53.3±6.0 74.4±9.9 57.6±19.2VT 52.0±7.8 48.4±6.3 59.1±8.5 52.2±20.6SF 56.9±10.8 60.8±8.8 86.8±10.8 83.3±17.8RE 45.7±9.7 83.4±9.1 83.0±4.3 84.4±32.4MH 49.74±8.9 49.20±6.2 79.6±11.2 72.1±19.8Total 113.6±9.3▲ 134.5±7.3▲ 154.1±7.1▲ 143.5±21.9

▲1 t-test vs. General Professional Population.



Table 6. The distribution of sociodemographic characteristics among the QOL groups.

Very Low n (%) Low n (%) High n (%) Man-WhitneyU P-value

gendermale 127 (47.6) 98 (36.7) 42 (15.7)

-0.655 0.513female 121 (36.4) 166 (50.0) 45 (13.6)

age

<30 46 (53.5) 7 (8.1) 33 (38.4)

287.184 0.000<40 73 (43.2) 54 (32.0) 42 (24.8)<50 123 (37.3) 195 (59.1) 12 (3.6)50≤ 6 (42.9) 8 (57.1) 0 (0.0)

eduBachelor 66 (54.6) 13 (10.7) 42 (34.7)

299.386 0.000High school 132 (35.2) 205 (54.7) 38 (10.1)Junior high school 50 (48.5) 46 (44.7) 7 (6.8)

workOffice Staff 0 (0.0) 10 (14.9) 57 (85.1)

555.005 0.000Marketing Managers 1 (2.5) 9 (22.5) 30 (75.0)Salesmen 247 (50.2) 245 (49.8) 0 (0.0)

Table 7. The distribution of QOL groups based on levels of occupational stress.

Variables DegreeDegree of QOL

Statistics P-valueVery Low n (%) Low n (%) High n (%)

ORQ

low 0 0.0 53 20.1 17 19.5CHI=153.999 0.000

normal 130 52.4 181 68.6 68 78.1High 115 46.4 25 9.4 2 2.4

rs=-0.427 0.000Very High 3 1.2 5 1.9 0 0.0

PSQ

low 12 4.8 70 26.5 32 36.7CHI=254.999 0.000

normal 31 12.5 125 47.4 51 58.7High 41 16.5 33 12.5 2 2.3

rs=-0.543 0.000Very High 164 66.2 36 13.6 2 2.3

PRQ

lowest 9 3.6 11 4.2 2 2.3CHI=88.848 0.000

low 125 50.4 54 20.2 10 11.5normal 113 45.6 168 63.6 64 73.6

rs=0.320 0.000Very High 1 0.4 31 12.0 11 12.6

Table 8. The group with very low QOL and very high stress.Count %

gendermale 154 51.7female 144 48.3

age

<30 50 16.8<40 88 29.5<50 154 51.750≤ 6 2.0

eduBachelor 77 25.8High school 166 55.7Junior high school 55 18.5

workOffice Staff 6 2.0Marketing managers 3 1.0Salesmen 289 97.0

564



Sociodemographic characteristics of the group with very low QOL and very high stress

Table 8 describes the sociodemographic cha-racteristics of the Very Low group. The so-called the worst group means it has the very low QOL and very high stress reversely. In total, 48.2% (289/599) of insurance practitioners, approxima-tely, half of workers in the industry belong to the worst group and the majority people in the group are salesmen (97.0%), aged 40-50 (51.7%), and with high-school educated level (55.7%). Hence, the urgent intervention is targeting on salesman.

Conclusions

The random sampling and parallel controlling were applied in this study. Levels of OS between the different groups of sociodemographic charac-teristics were compared, and the comparison was made with the general professional population. In addition, QOL was contrasted with different cate-gories of levels of occupational stress, so the re-lation between QOL and occupational stress was analyzed. Thus, the group which needs urgent he-alth intervention was found among the insurance practitioners [21-22].

As mentioned in the results previously, the le-ast fortunate group consists mainly of salesmen, aged 40-50, with high-school educated. Further study shows concrete causations presented below.

1) Social factors, poor working conditions, unfixed income, and without basic occupational health protection as strong stress factors that affect the health problems of insurance practitioners.

2) Salesmen are apart of contract employees of insurance companies in China. Therefore, insurance companies do not provide for salesmen the basic salary, even any labor insurance, welfare or notional insurance. The only income source for most salesmen is the bonus that based on their sales; nevertheless, excessive competition creates a state disordered in this industry. Salesmen, who continuously overburdened working, placed under great psychological

stress meanwhile their occupational stress increased [23].

3) The insurance business has been running a very short time in China; people even have no sense of insurance properly, which causes low insurance sale rates. Our investigation indicates insurance sale career is difficult to move forward even a tiny step that is the reason why the insurance practitioners’ income is very low, as a result.

4) Because of unsuitable management system and shortage public awareness of insurance mentioned above, salesmen mislead consumers to make contract frequently in order to achieve the rigorous examination requirements from their company [24-25]. Once the misleading activity is revealed, the salesman will take a heavy disciplinary and punishment as a cheating behavior by their company. Furthermore, most of the clients are their relatives and friends, thus, they must undergo the contempt from these closely related people. In this way, salesmen normally suffer from deep concern and anxiety, which increase their long-term psychological stress [26-27].

5) The people under age 30 bear the greatest amount of work pressure. However, their QOL is not belonging to the lowest level, due to their youth and their labor is around at top at the peak. Chinese traditions, people of age 40-50 have absolute responsibility to support their families, include children and parents. In this way, they have to tolerate lots of pressure from society and family. Additionally, they show signs of physiological declining. This great pressure leads to the lowest QOL index among all groups.

In summary, in China, insurance practitioners, especially positioned at salesman, they have ta-ken higher occupational stress and lower quality of life to general Chinese professional population. Evidence provided to support assertions made in previous studies, showing that impaired QOL is associated with occupational stress and strain, and that coping resources could enhance physical and mental health problem [22]. Therefore, insurance



practitioners should be given more help and co-unseling to ameliorate their QOL and well-being. The main emphasis, aid efforts should pay more attention on salesmen and assist those individu-als to adapt their stress. Furthermore, we need to improve and innovate the current management sy-stems to reduce their stress. Meanwhile, to release OS and attain social supports, public should get a far better understanding and recognition of insu-rance. Also, psychological counseling service and wholesome promotion are worth achieving their self-improvements and self-adjustments, thus it may raise the QOL, and a brand-new insurance industrial era might come soon.

Authors’ contributions

All authors (LL, BC, PC, KL, XZ, and DY) participated in the planning and conception of the research questions and the study design. DY and LL were the principal investigators of the study and primarily conceptualized the research. LL, BC and YZ were responsible for retrieving the data, DY, YZ and KL were responsible for anal-yzing the data. DY and PC wrote text. XZ contri-buted with revising the paper. All authors read and approved the final manuscript.

Acknowledgements

The study was supported by two grants from the National Natural Science Foundation of China (No.30872184, No.30901242). We appreciate the help from three large-scale companies in Chon-gqing, including Chinese Life Insurance, Chinese Ping An Life Insurance, and Sino Life Insurance. We would like to thank Professor Ziyuan Zhou and Weiqun Shu for their revising the paper. We would also like to express our thanks to the gradu-ate students from Third Military Medical Univer-sity who participated in the study for generously giving their time and energy to complete the in-terviews.

References

1. The brief development history of new china in-surance 2007-06-05 [http://blog.sina.com.cn/s/blog_44832c2b0100096c.html]

2. Chinese statistics yearbook 1999, [http://www.stats.gov.cn/yearbook/indexC.htm]

3. Life insurance salesman: legal position blurs lower economic status and social status, unbalanced po-sition with contribution 2009-11-3, [http://www.mdrtchina.com/news_show.asp?id=238.html]

4. Zhu JS: The pursuit of profits behind over sa-les 2010-6-12, [http://finance.sina.com.cn/roll/ 20100612/01488108251.shtml]

5. Stansfeld S, Candy B: Psychological work envi-ronment and mental health–a meta-analysis review. Scand J Work Environ Health 2006, 32:442-462.

6. Babazono A, Mino Y, Nagano J, Tsuda T, Araki T: A prospective study on the influences of wor-kplace stress on mental health. J Occupy Health 2005,47:490-495.

7. Maslach C, Schaufeli WB, Leiter PM: Job burnout. Annul Rev Psycho 2001,53:397-422.

8. Schaufeli WB, Greenglass ER: Introduction to spe-cial issue on burnout and health. Psycho Health 2001,16:501-510.

9. Lazarus RS: Toward better research on stress and coping. Am Psycho 2000,55:665-673.

10. Hobfoll SE, Shirom A: Conservation of resources theory-Applications to stress and management in the workplace. In Handbook of organizational behavior. Edited by Golembiewski RT. New York: Dekker; 2000:57-81.

11. Forcella L, Di Donato A, Coccia U, Tamellini L, Di Giampaolo L, Grapsi M, et al: Anxiety, job stress and job insecurity among teachers with in-definite or definite time contract. G Ital Med Lav Ergon 2007, 29(Suppl 1):683–9.

12. Xiong YH, Dong Y: Medical research methods - the design, measurement and evaluation. 1 s t edition. Edited by Hong G. Beijing: People’s Me-dical Press; 2009:121-122.

13. He KL, Jiang ZQ, Zheng DY, Liu R, Yi D: Corre-lation of occupational stress and life quality in in-surance practitioners. Acta Academiae Medicinae Militaris Tertiae 2009,31(23):134-136

566



14. Dong Y: Military Medical Statistics. 2nd edition. Edited by Han L. Beijing: Military Medical Scien-ces Press; 2009:156-157.

15. X. Yang, C. Ge, B. Hu, T. Chi, L: Wang. Relation-ship between quality of life and occupational stre-ss among teachers. Public Health 2009;123:750–755

16. Addley K: Occupational Stress-a Practical Appro-ach [M]. Oxford Press: Butter-worth-Heinemann; 1997:1-3.

17. Osipow SH: Occupational Stress Inventory Re-vised Edition (OSI-R). Odessa: In Psychological Assessment Resources 1998, 1–10.

18. Li J, Wang H: Evaluation on reliability and vali-dity of SF-36 Scale (Version 2) in urban residents’ quality of life in Chongqing. Journal of the Fourth Military Medical University 2009,30(14):1342-1344.

19. Yang X., Wei, LZ., Pang XH., et al: Study of the Occupational Stress Norm and its Application in Southwest China. Chinese Mental Health Journal 2007,21(14):233-236.

20. Aloise D, Deshpande A, Hansen P, Popat P: NP-hardness of Euclidean sum-of-squares clustering. Machine Learning 2009,75:245-249.

21. So Kumtang C, Tungau W, Schwarzer R: Mental health outcomes of job stress among Chinese tea-chers – role of stress resource factors and burno-ut. J Organ Behav 2001,22:887-901.

22. Rout. Stress Management for primary health care professionals. New York, Klluwer cademic /Ple-num publishers, 2002;17-39.

23. Brisson C, Larocque B, Boutbonnais R, et al: Im-pact of occupational stress on health status in Ca-nada. Can. J. Public Health 2001,92 (6):460-471.

24. As the most serious misleading in insurance sa-les, Guangdong Insurance Regulatory Bure-au take comprehensive treatments to control, [http://finance.sina.com.cn/money/insurance/bxdt/20100315/11427566107.shtml].

25. China Life Insurance Salesman conceal the loss of withdraw of insurance, how to mislea-ding customers in insurance sales. [http://www.china-insurance.com/news-center/newslist.asp?id=152095]

26. The risk and harm in insurance sales and its causes. [http://money.eefoo.com/bx/200911/12-1681102.html].

27. Establishment of excitation policy for salesmen. [http://www.21cbr.com/html/magzine/200602018/agenda/200812/05572.html]

28. Yu SF, Zhang R, Ma LQ, Gu GZ, Yang Y, Li KR: Effect of occupational stress on mental health. Chinese journal of industrial hygiene and occu-pational diseases 2003,21(1):78-84.

Corresponding author: Dong Yi, Department of Public Health, Third Military Medical University, China, E-mail: [email protected]



Abstract

Aim. This paper reports a study designed to assess the psychometric properties (validity and reliability) of a Turkish version of the Australian Parents’ Fever Management Scale (PFMS).

Background. Little is known about childho-od fever management among Turkish parents. No scales to measure parents’ fever management practices in Turkey are available.

Design. This is a methodological study Methods. Eighty parents, of febrile children

aged six months to five years, were randomly se-lected from the paedaitric hospital and two com-munity family health centers in Sakarya, Turkey. The PFMS was back translated; language equiva-lence and content validity were validated. PFMS and socio-demographic data were collected in 2009. Means and standard deviations were calcu-lated for interval level data and p values greater than 0.05 were considered statistically significant. Unrotated principal component analysis was used to determine construct validity and Cronbach’s coefficient alpha determined the internal consi-stency reliability.

Results. The PFMS was psychometrically so-und in this population. Construct validity, con-firmed by confirmatory factor analysis [KMO 0.812, Bartlett’s Specificity (χ² = 182.799, df=28, P < 0·001)] revealed the Turkish version to be com-prised of the eight original PFMS items. Internal consistency reliability coefficient was 0.80 and the scale’s total-item correlation coefficients ranged from 0.15 to 0.66 and were significant (p<0.001). Interestingly parents reported high scores on the

PFMS 34.52±4.60 (range 8-40 with 40 indicating a high burden of care for febrile children).

Conclusion. The PFMS was as psychometri-cally robust in a Turkish population as in an Au-stralian population and is, therefore, a useful tool for health professionals to identify parents’ prac-tices, provide targeted education thereby in redu-cing the unnecessary burden of care they place on themselves when caring for a febrile child.

Relevance to clinical practice. Testing in di-fferent populations, cultures and healthcare sy-stems will further assist in reporting the PFMS usefulness in clinical practice and research.

Key words: parent fever management scale, Turkey, febrile children, parents practices, com-munity, instrument construct validity

Introduction

Fever, a rise in body temperature greater than normal diurnal daily variation (1), indicates a fe-brile response to an invading organism has been activated (2). It is an important sign of altered health most frequently indicating an infectious process, in children this is most commonly a self-limiting viral illness (3. 4). However, fever may be the presenting feature of severe illnesses such as meningitis, septicemia, urinary tract infecti-ons and pneumonia (5). Fever can also be a result of malignancies, medications, transfusions, and allergies (6). In children less than 5 years of age fever is a common occurrence and an important symptom to alert parents to an underlying disease (7.8). Some parents believe (incorrectly) that fever

Psychometric properties of the parents’ fever management scale in a Turkish populationİnsaf Altun1, Nursan Dede Cınar2, Anne Walsh3

1 Kocaeli University High School of Health Department of Fundamentals in Nursing, Turkey,2 Sakarya University High School of Health Department of Child Health Nursing Sakarya, Turkey,3 School of Nursing and Midwifery, Institute of Health and Biomedical Innovation, Queensland University of Technology, Australia

568



is harmful to children; it causes febrile convulsi-on, discomfort and stupor; however, they correctly believe dehydration, increased work of breathing and tachycardia to be a result of fever (9-12).

Fewer than 5% of children have a febrile con-vulsion/seizure and many of these actually have a genetic predisposition to febrile convulsions (13). This should not be a cause of concern when a child is febrile. However, the increased metabo-lic demands associated with the febrile response generate increased insensible fluid loss, tachycar-dia and increased respirations. Dehydration sho-uld be the major concern for parents and health professionals (14). Dehydration can increase core temperature (13). Children with marginal cardiac or cerebral vascular supply and/or pre-existing respiratory diseases may be further disadvantaged by the additional burden of disease due to increa-sed metabolic demands (9.15). In these children fever should be reduced. In most children fever is harmless and does not require reducing. However, pain must be treated.

Care of a febrile child is difficult. There is con-fusion in the literature and clinical settings as to the temperature indicating fever and when/if a fever needs to be reduced (16). Actions of anti-pyretics (fever reduction and analgesia) can cre-ate confusion in parents who after administering and antipyretic/analgesic (paracetamol or ibupro-fen) find their child’s temperature reduced and the child happier; they may perceive temperature re-duction as the reason for the improvement rather than pain reduction. This then leads to the overuse of antipyretics.

Today, despite the general acceptance of body temperature as a range rather than a fixed tempera-ture (17) as 98.6°F (37°C) and 100.4°F (38°C) are still considered as the norm, worldwide, to repre-sent normal body temperature and fever respec-tively (17). Many parents are unaware that body temperature has a protective self-limiting mecha-nism and in response to a febrile illness, does not usually go above 106°F (41.1°C) (17) due to the actions of endogenous (naturally-occurring) anti-pyretics which prevent temperatures from infecti-on greater than 41.70C (18).

The care of a febrile child is one of the most co-mmon problems faced by parents and health pro-fessionals, both in hospital and primary healthcare

settings (11.13.19). Despite the fact that childhood fever management is receiving increasing attenti-on regarding its prominent role in healthcare little is known about Turkish parents’ childhood fever management. Additionally, there are no instru-ments available in Turkish to measure parents’ fever management practices. The original Parent’s Fever Management Scale (PFMS) was developed in Australia by Walsh et al. (20) in response to the lack of a tool to measure parents’ fever manage-ment practices; practices based on phobic beliefs. These unnecessary practices can significantly in-crease parents’ burden of care when caring for a febrile child. Psychometric testing of the PFMS found item reliability within limits of agreement (Bland-Altman mean difference ± 2 SD) (21) and Cronbach alpha 0.70 (19). Adaptation of the PFMS to a Turkish setting will not only allow Turkish pa-rents fever management practices to be identified, it will as also enable comparisons of parents’ fever management practices between different popula-tions. The purpose of this paper is to report the psychometric properties, including internal relia-bility, item-total correlation, and construct validity of the PFMS in a Turkish sample.

Method

The aim of the study was to assess the psyc-hometric properties of the Turkish version of the PFMS. A cross-sectional study was carried out among parents in the state of Sakarya, Turkey, between September and October 2009.

Sample and procedures

The study was conducted with a sample of 80 Turkish using simple random and stratified wei-ghted sampling methods at the pediatric hospital and two community family health centers in cen-tral of Sakarya, Turkey This needs to be explained in more detail so readers know exactly how the sample were randomly selected. The sample was recruited from parents who presented at these cen-ters with a febrile child aged between six months and five years. Following triage as non-emergent, eligible parents were approached and asked to



participate in a short interview. Participation was voluntary and ethical approval gained. Eligibility criteria were: parents of a febrile child of Turkish ethnicity who were able to read and write in Tur-kish and aged 18 years or older and the primary caregiver of a febrile child aged between 6 months and 5 years. Participant’s consent was obtained to use the findings for the purpose of this study.

Data collection

Data were collected through one-to-one inter-views conducted by the second author (NDC) in a quiet environment. Interviews ranged from 10 to 15 minutes in length; parents’ were contented with this process.

Instrument

A questionnaire was developed to obtain sociodemographical information, such as the respondent’s age, sex, marital status, number of children, the geographical location of their home, their years of education and teaching and heal-thcare insurance coverage. This was combined with the Turkish version of the Parents’ Childho-od Fever Management Scale (PFMS) originally developed by Walsh et al. (20), Cronbach’s alpha 0.70; Cohen’s Kappa ranging from 0.55 (on one item) to 1.00. This instrument explores parents’ practices when their child is febrile on a 5-point Likert scale (1 = Never, 2 = Rarely, 3 = Someti-mes, 4 = Mostly, 5 = Always). Practices measured were, for example, checking on the child during the night, taking the child’s temperature regularly, and waking a child for an antipyretic (20),

Language adaptation

The back-translation method was used to ensu-re that the scale was accurately translated into Tur-kish. The PFMS was first translated from English to Turkish separately by three academic nurses whose native language is Turkish. Subsequently, it was translated back from Turkish to English by three experts whose native language is English.

All translators worked independently and were not associated with the research in any other way. Once these forward and backward translations were completed, the original and back translations of both English and Turkish versions were care-fully compared. The translated version was then evaluated by three teaching staff (a Professor of Paediatrics (MD), an Associate Professor in Pe-diatric Nursing and an Associate Professor in the Fundamentals of Nursing) and by 10 parents for language equivalence and finally adapted accor-ding to the suggestions made.

Data analysis

The Statistical Package for Social Sciences (SPSS v15.0) was used to compute frequency and descriptive statistics related to demographic data. Factor analysis using principal component extrac-tion was conducted. Mean and standard deviati-on (SD) were calculated for interval level data. Chronbach’s α was calculated to evaluate internal consistency of the total PFMS. Principal compo-nent analysis with varimax rotation was used to determine construct validity and Cronbach’s co-efficient alpha determined the scale’s internal consistency reliability. The Kaiser–Meyer–Olkin (KMO) test was used to measure sample adequ-acy and the Test of Bartlett’s Sphericity (BS) was used to examine the correlation matrix. Statisti-cal significance was set at p<0.05. Reliability was assessed using the internal consistency approach; Cronbach’s alpha coefficient was calculated to assess the degree of internal consistency and ho-mogeneity between the items. The analysis was in accordance with the original analysis by Walsh et al. (20).

Results

Demographics

All participants (80) were a parent of the febri-le child aged between six months and five years. Most (88%) were the mother and more than half (58%) were younger than 30 years and had two children (53%). Fathers were more likely to have

570



a university education (15% versus 5%) and more mothers reported primary school as their highest level of education (51% versus 39%). Of interest is that most had healthcare insurance (78.8%) and lived in a village or small town compared with a city or major city (56.2% versus 43.8%). See Ta-ble 1 for a more detailed description of participant demographics. Table 1. Participant demographics (N = 80)

n %GenderMotherFather

7010

87.512.5

Age30 and under31-4546-5051-5556 and above

4627511

57.533.86.31.21.2

Number of children1234 and above

2242124

27.052.515.05.5

Gender of childrenFemaleMale

3446

42.557.5

Geographical locationVillageSmall townCityMajor city

18272312

22.433.828.815.0

Education of mother Primary school (5 year)Middle school (8 year)Lysee (11 year)High school or university (13 or 15year)

4119164

51.323.720.05.0

Education of father Primary school (5 year)Middle school (8 year)Lysee (11 year)High school or university (13 or 15year)

32211512

38.926.318.815.0

Healthcare insuranceYesNo

6317

78.821.2

Employment statusNot working at presentFull-time work

728

90.010.0

PFMS

The eight items of the PFMS were reported on 5-point Likert scales (1 = Never, 2 = Rarely, 3 = Sometimes, 4 = Mostly, 5 = Always) with a potential range of 8 to 40. Higher scores indicate more frequent or higher levels of these practices representing a higher parental burden when caring for a febrile child. The PFMS is presented in Table 2. No items were removed from the original eight item scale and the scale was considered internally consistent with an alpha of 0.80.

Validity analyses

To ensure content validity of the Turkish versi-on, the final Turkish language version, of the in-strument was examined by three experts in the fi-eld a Paediatrician, an Academic Paediatric Nurse and an Academic Expert in Fundamental Nursing. In accordance with their suggestions minor chan-ges were made to in original the scale items (Table 2). The scale was then trialed with 10 parents, not included in the main study, for ease of understan-ding, and was found satisfactory.

Construct/convergent validity were confirmed through confirmatory factor analysis. Data were considered appropriate for factor analysis through the KMO measure of sampling adequacy value of 0·812 and a statistically significant Bartlett’s sphe-ricity (χ² = 182.799, df=28, P < 0·001). Pearson’s correlation coefficient matrix for the eight PFMS items is shown in Table 2. All items have signifi-cant positive correlations.

An unrotated Principal Component Analysis (n = 80) was performed using the 8 items proposed for criteria that influence parents’ fever manage-ment practices and confirmed that all eight items loaded onto one single factor. PFMS items, in the unrotated Principal Component Analysis, ranged in value between .514 (item 6) and .766 (item 2). Item communalities ranged in value between .459 (PFMS 6) and .735 (PFMS 1). All items show positive, nontrivial loadings on the first unrota-ted principal component. Thus, all factors in the measurement model had adequate reliability and convergent validity (the correlation among items which make up the scale).



Reliability analyses

The total mean item score was 34.52 ± 4.60, with item 3 having the lowest mean score (3·92 ± 1·00) and item 5 the highest (4·60 ± 0·70). The total-item correlation ranged between 0·15 and 0·66. Item 8 had the lowest total-item correla-tion (0·15) while item 2 had the highest (0·66). To-tal-item correlation coefficients were statistically significant (P < 0·001). Cronbach’s alpha coeffici-ent (internal reliability) for the general scale was 0·80.

Table 2. Parent Fever Management Scale (PFMS) N = 80When my child has a fever I generally

1c 2c 3c 4c 5c 6c 7c 8c CommonalitiesUnrotated Principal

componentMean SD

1 Take their temperature 1.00 0.735 0.761 4.42 0.89

2 Like to know what their temperature is

0.66 1.00 0.678 0.766 4.57 0.68

3 Make sure they have plenty to drink

0.44 0.37 1.00 0.542 0.544 3.92 1.00

4 Use over the counter medication to reduce the fever

0.25 0.26 0.17 1.00 0.526 0.588 4.33 0.81

5 Check on them during the night

0.45 0.50 0.29 0.46 1.00 0.619 0.750 4.60 0.70

6 Sleep in the same room as them

0.23 0.32 0.05 0.24 0.43 1.00 0.459 0.514 4.32 0.97

7 Wake them up during the night for medication to reduce their fever

0.54 0.50 0.37 0.38 0.36 0.27 1.00 0.568 0.737 3.95 1.10

8 Take them to the doctor 0.22 0.18. 0.15 0.38 0.37 0.29 0.29 1.00 0.525 0.519 4.42 0.83

aPFMS mean 34.52, SD 4.60, range,17 to 40, potential range 8 to 40; scale α =0.80, cCorrelation matrix for scale items 1= Never 2= Rarely 3=Sometimes 4=Mostly 5 =Always

Discussion

In this study the investigators translated and tested, in a Turkish population, a previously de-veloped instrument (PFMS) identifying parents’ practices when caring for a febrile child. Findings indicate that the PFMS is a valid and reliable tool for measuring fever management practices in both Turkish and Australian (20) parent populations. Use of this tool will assist clinicians to assess the unnecessary burden parents place on them when caring for a febrile child. The PFMS is an appro-

572



priate platform for intercultural comparisons and a basis for discussions by clinicians with parents about the evidence-based care of febrile children. Improving parents understanding of febrile illne-sses and appropriate care will lead to a reduction of parents’ overuse of health services for self-limi-ting viral illnesses.

Scale validity

Confirmatory factor analysis was appropriate for this study to determine whether the eight items correctly measured the construct of parents’ bur-den of care when caring for a febrile child (21). Sample adequacy is an important issue when con-ducting a factor analysis. The KMO measure of sampling adequacy is an index which examines the appropriateness of factor analysis and should be at least 0.50, closer to 1.0 is preferred. This measure of sampling adequacy compares the magnitude of the correlations with the magnitude of their parti-al correlation coefficients. Smaller values indicate the correlations cannot be explained by other va-riables, and factor analysis may be inappropriate (22.23). The KMO measure of sampling adequacy was found to be 0·812 with a statistically signifi-cant BS (χ² = 182.799, df=28, p < 0·001), therefo-re, the data were suitable for factor analysis.

The PFMS was developed and initially tested for validity and reliability in an Australian popu-lation (20). In our study, the PFMS mean item score was 34.52 ± 4.60 (possible range 8 - 40); each item had a potential range from one to five. In the Australian study the mean PFMS item score was 17.20 ± 4.44. The correlation coefficients of the items had positive, moderate to strong corre-lations between variables, ranging from 0·15 to 0·66 (Table 2). When the correlations between the items and total scores for the scale were anal-ysed they were found to be statistically significant (p < 0·001). All items demonstrated a moderate or strong correlation with the total score.

Scale Reliability

A Cronbach’s α value of 0.7 or higher is ge-nerally considered sufficient to demonstrate in-

ternal consistency (25.26). The Turkish PFMS Cronbach’s alpha coefficient was 0·80 indicating that items correlated with each other and served the whole measuring instrument with equal wei-ght. When the scale was developed the Cronbach’s alpha coefficient was 0·70 (20). It was thus deter-mined that the scale reliability coefficient in our study incorporating all eight items demonstrated similarities with the findings of Australian study in which seven items were included.

When undertaking a factor analysis, factor lo-adings greater than 0.4 are generally considered to support the factor construction on a particular dimensions (25.26). Judged by this criterion, our factor analysis results indicated that items in the PFMS scale accorded generally with the theoreti-cal construction of the scale. Correlation analysis indicated that each of the eight items was highly correlated with the hypothesized dimension, while relatively low correlations were observed between the items and other dimensions. Therefore, we may conclude that PFMS was acceptable and applicable for evaluating the fever management practice of parents in Turkey. The results of this study showed that the mean scores of all dimensi-ons of PFMS were lower than 70. The total mean item score was 34.52 ± 4.60, with item 3, Make sure they have plenty to drink, having the lowest mean score (3·92 ± 1·00) and item 5, Check on them during the night, the highest (4·60 ± 0·70). The total-item correlation ranged between 0·15 and 0·66. Item 8, Take them to the doctor, had the lowest total-item correlation (0·15) while item 2, Like to know what their temperature is, had the highest (0·66). Total-item correlation coeffi-cients were statistically significant (p < 0·001). Cronbach’s alpha coefficient (internal reliability) for the general scale was 0·80.

Cross-cultural comparison

The high PFMS mean score in the Turkish sample (34.52 ± 4.60) suggests the Turkish pa-rents surveyed were very active childhood fever managers. They liked to know what the child’s temperature was and to reduce it with medicati-ons; they slept in the same room as their febrile child, checked on them during the night and took



the febrile child to the doctors. These behaviors indicate Turkish parents were very concerned abo-ut childhood fever and were unnecessarily over-burdening themselves during febrile episodes. Though the sample was small the findings indicate the need for further exploration in a Turkish popu-lation. Australian parents, though having a lower total mean score (15.89±4.33) had similar varian-ce around the mean demonstrated by the standard deviations in both samples being 4.60 and 4.33 respectively.

Interestingly, Turkish parents were more li-kely to report that they ‘Sleep in the same room as them´ than Australian parents (4.32±0.97 ver-sus 3.00±1.33) (20). An important finding was that Turkish parents were more likely to ‘Make sure they (their children) had plenty to drink’ than Australian parents (3.92±1.00 versus 1.32±0.55) (Walsh unpublished data). Would climate make a difference to this? The Turkish sample were from a cold mountainous region and the Australian from a tropical hot humid environment? In the Austra-lian study this item was removed due to correlati-ons less than 0.17 across all items and communa-lity extraction of 0.52. The Turkish study found moderate correlations between encouraging fluids and items targeting knowing the temperature and waking the child during the night for medications 0.37 to 0.44, these behaviours indicate a concern with fever and the need to reduce it. This item con-tributed moderately to the total item score. This current study highlighted the need to include this item in the PFMS for testing in different cultures and climates.

Implications for research and clinical practice

Childhood fever is an emotionally, physically and financially expensive time for parents (27). Parents’ continual focus on temperature and fear of harm from fever can have a significant impact on their health, and the health and wellbeing of others in the home, during episodes of childhood febrile illnesses of which there are many (20.28.29). The PFMS has been found reliable and valid instru-ment in two very different cultures and climates highlighting the unnecessary burdensome behavi-ours of parents of febrile children. This highlights the need to identify parents fever management be-

haviours and target education accordingly. Educa-tion must be evidence-based and consistent across settings and health professionals. There may be a need to explore both parents and health professio-nals’ knowledge and beliefs about fever and fever management to ensure parents receive consistent information based on the latest scientific informa-tion. It is essential that primary health care provi-ders target parent education to reduce the parents’ unnecessary burden of care and promote eviden-ce-based care of febrile children.

Guidelines have been developed by the Nati-onal Institute of Clinical Education (30) report it unnecessary to always reduce fever and that an-tipyretics do not prevent febrile convulsions, the major reason parents report for using antipyretics (20.28.29). It is timely for the introduction of a brief instrument into primary health care to iden-tify the additional emotional and physical burden parents unnecessarily embrace when their child is febrile.

Conclusion

Our results suggest that the Turkish version of the PFMS is a valid and reliable instrument for me-asuring the fever management practices of parents in Turkey. However, it will be necessary to test its validity and the reliability with larger Turkish samples to explore its generalisability. There must be the further validation of this instrument in other countries and cultures. Use of a simple instrument such as the PFMS can assist health professionals to identify and reduce parents’ unnecessary activi-ties when their child is febrile. Educating parents about the benefits of fever, encouraging parents to push fluids when their child is febrile and monitor the child’s interaction with themselves and their environment, a more accurate indication of how most children are faring, will reduce their concern and assumed burden of care.

Acknowledgements

The authors would like to thank the staff at the recruitment places, and the parents who voluntee-red to participate in this study.

574



Contributions

Study design: IA, NDC, AW, data collection: NDC and analysis: IA, AW, NDC and manuscript preparation: IA, AW, NDC.

References

1. Beard RM, Day MW. Fever and hyperthermia: le-arn to beat the heat. Nursing 2008; 38: 28-31.

2. Blatteis CM. Endotoxic fever: new concepts of its regulation suggest new approaches to its manage-ment. Pharmacol Ther 2006; 111:194-223.

3. Siddiqui FJ, Haider SR, Bhutta ZA. Endemic den-gue fever: a seldom recognized hazard for Paki-stani children. Journal of Infection in Developing Countries 2009; 3: 306-312.

4. Caviness AC, Demmler GJ, Almendarez Y, Selwyn BJ The prevalence of neonatal herpes simplex virus infection compared with serious bacterial illness in hospitalized neonates. Journal of Pediatrics 2008; 153:164-9.

5. BMJ Group. When the child has a fever. Drug The-rapy Bulletin 2008; 46: 17-21.

6. Oborilová A, Mayer J, Pospísil Z, Korístek Z. Symp-tomatic intravenous antipyretic therapy: efficacy of metamizol, diclofenac, and propacetamol. Journal of Pain Symptom Management 2002; 24: 608-15.

7. Crocetti M, Moghbeli N, Serwint J. Fever phobia revisited: have parental misconceptions about fever changed in 20 years? Pediatrics 2001; 107:1241-6.

8. Richardson M, Lakhanpaul M. Assessment and ini-tial management of feverish illness in children yo-unger than 5 years: Summary of NICE guidance. British Medical Journal 2007; 334: 1163-1164.

9. Chandra J, Bhatnagar SK. Antipyretics in children. Indian Journal of Pediatrcis 2002; 69: 69-74.

10. Al-Nouri L, Basheer K. Mother’s perceptions of fever in children. Journal of Tropical Paediatrics, 2005; 52: 113-116.

11. Kolahi AA, Tahmooreszadeh S. First febrile con-vulsions: inquiry about the knowledge, attitudes and concerns of the patients’ mothers. European Journal of Pediatrics 2009; 168: 167-71.

12. Betz MG, Grunfeld AF. ‘Fever phobia’ in the emergency department: a survey of children’s ca-regivers. European Journal of Emergency Medici-ne 2006; 13: 129-33.

13. El-Radhi AS.Why is the evidence not affecting the practice of fever management? Arch Dis Child 2008; 93: 918-20.

14. Walsh A, Edwards H. Management of childhood fever by parents: literature review. Journal of Ad-vanced Nursing 2006; 54: 217-27.

15. Chiappini E, Principi N, Longhi R, Tovo PA, Be-cherucci P, Bonsignori F, Esposito S, Festini F, Galli L, Lucchesi B, Mugelli A,de Martino M. Management of fever in children: summary of the Italian Pediatric Society guidelines. Clinical The-rapeutics 2009; 31: 1826-43.

16. Walsh A, Edwards H, Fraser J. Influences on pa-rents’ fever management: beliefs, experiences and information sources. Journal of Clinical Nursing 2007; 16: 2331-40.

17. Sund-Levander M, Grodzinsky E. Time for a chan-ge to assess and evaluate body temperature in cli-nical practice. International Journal of Nursing Practice 2009; 15: 241-249.

18. Mackowiak P, Boulant J. Fever’s glass ceiling. Clinical Infectious Diseases 1996; 22: 525–536.

19. Boivin JM, Weber F, Fay R, Monin P. Manage-ment of paediatric fever: is parents’ skill appropri-ate? Archives of Pediatrics 2007;14: 322-9.

20. Walsh A, Edwards H, Fraser J. Parents’ childhood fever management: community survey and instru-ment development. Journal of Advanced Nursing 2008; 63: 376–388.

21. Hair J. Multivariate data analysis (6th ed.). Upper Saddle River: Pearson Prentice Hall. 2006

22. Bland JM, Altman DG. Statistical methods for assessing agreement between two methods of cli-nical measurement. Lancet 1986; 1: 307-310.

23. Bowling A. Research methods in health: investi-gating and health services. Philadelphia: Univer-sity Press, Mainhead, 2009: pp. 133–16.

24. Franchignoni F, Tesio L, Ottonello M, Benevolo E. Life Satisfaction Index: Italian version and valida-tion of a short form. American Journal of Physical and Medical Rehabilitation 1999; 78: 509-15.



25. Walter SD, Eliasziw M, Donner A. Sample size and optimal designs for reliability studies. Stati-stics in Medicine 1998; 17: 101-10.

26. Nunnally JC, Bernstein IH. Psychometric Theory. New York, NY: McGraw-Hill, Inc. 1994

27. Stagnara J, Vermont J, Dürr F, Ferradji K, Mege L, Duquesne A, Ferley JP, Kassaï B. Parents’ atti-tudes towards childhood fever. A cross-sectional survey in the Lyon metropolitan area (202 cases). Presse Medicale 2005; 34: 1129-36.

28. Karwowska A, Nijssen-Jordan C, Johnson D, Davies HD. Parental and health care provider understanding of childhood fever: a Canadian perspective. Canadian Journal of Emergency Me-dicine 2002; 4: 394-400.

29. Wright BA, Roberts CS, Seligson D, Malkani AL, McCabe SJ. Cost of antibiotic beads is justified: a study of open fracture wounds and chronic osteo-myelitis. Journal of Long Term Effects of Medical Implants 2007; 17: 181-5.

30. National Collaborating Centre for Women’s and Children’s Health. Feverish illness in children. London: UK; Royal College of Obstetricians and Gynaecologists (ROGC Press) http://guidance.nice.org.uk/CG47/guidance/pdf/English 2007.

Contact author Insaf Altun, Kocaeli University, High School of Health, Department of Fundamentals in Nursing, Turkey, E-mail: [email protected]

576



Abstract

While opening a box of tropical fruit (avoca-do), which had been transported by air from Bra-zil, a 38 year old employee of a hotel restaurant in Prague (Czech Republic) was bitten on the right forearm by the spider Loxosceles rufescens (Dufo-ur, 1849). The man killed the spider and approxi-mately one and a half hours after being bitten he arrived at the Emergency Unit of the 2nd Clinical Department of Internal Medicine of the Third Fa-culty of Medicine, Charles University in Prague. Upon admission, oedema and ill-defined erythema approximately 13 cm in diameter and with cen-tral decolouration were visible on the right outer forearm. The described method of treatment, in-volving corticotherapy and the administration of antihistamines, meant that the feared systemic manifestations of loxoscelism and dermonecrotic lesions did not develop at the bite site. This is the first case of loxoscelism to have been described and documented not only in the Czech Republic, but in the whole of Central Europe. Due to the globalization of trade and the transport of goods across continents, it is necessary to be prepared for new forms of arachnidism and this threat should certainly not be underestimated.

Key words: loxoscelism, arachnidism, alien spiders

Introduction

Currently, 40,700 spider species belonging to 3,733 genera and 109 families are known (1). Al-most all spiders use toxins, produced by the activi-

ty of a pair of poison glands located in the proso-ma, to subdue, immobilize and paralyze their prey. Fast immobilization is considered to be the pri-mary function of the poison, while the lethal effect is only secondary (2, 3). Toxins are injected into the body of the prey via the chelicerae, i.e., the first appendages of a spider’s prosoma (Figures 1 and 2). Each chelicera consists of two parts, a sto-ut basal segment and a movable articulated fang. Normally the fang rests in a groove of the basal segment. When the spider bites, the fangs move out of their groove and penetrate the prey (3). At the same time, poison is injected through a tiny opening at the tip of the fang (Figures 3 and 4). In terms of chemical composition, spider venom is highly heterogeneous and comprises a mixture mostly of large, neurotoxic polypeptides (molecu-lar weight 5,000 – 13,000), proteolytic enzymes, and smaller biogenic amines and amino acids (3, 4, 5). Spiders of the genus Loxosceles Heineken & Lowe, 1832 belong to the family Sicariidae and, like the other species of this family, have potent tissue-destroying venoms containing the dermo-necrotic agent sphingomyelinase (4, 5). Differen-ces in expression of proteins, glycoproteins and sphingomyelinase activity were observed between venom from male and female spiders and venom from the two species Loxosceles laeta (Nicolet, 1849) and Loxosceles intermedia Mello-Leitao, 1934. Loxoscelism is the clinical condition caused by envenomation by any one of the 101 spider spe-cies (1) belonging to the genus Loxosceles and can be observed as two well-defined clinical variants: cutaneous loxoscelism and systemic or viscerocu-taneous loxoscelism, which occur in around 83.3% and 16.7% of cases respectively (5). Clinical signs

The first documented case of loxoscelism in Central Europe - Case reportJan Hajer1, Jaromír Hajer2, Eva Plísková1

1 Charles University, Third Faculty of Medicine, 2nd Clinical Department of Internal Medicine, Czech Republic,2 Department of Biology, Faculty of Science, J.E. Purkinje University in Ústí nad Labem, Czech Republic.



associated with the bites of these spiders involve dermonecrotic lesions (necrotic arachnidism) and an intense local inflammatory response, besides systemic manifestations such as intravascular ha-emolysis, thrombocytopenia, disseminated intra-vascular coagulation and acute renal failure (6, 7). Pain, oedema and liveloid plaque, which develops into a necrotic scar, are predominant local mani-festations of cutaneous loxoscelism. In the event of systemic or viscerocutaneous loxoscelism, hae-maturia and haemoglobinuria are always observed (6, 8). Although systemic loxoscelism is less com-mon than the cutaneous form, it is the main cause of death associated with envenomation by spiders of the genus Loxosceles. Necrotic ulcers are often difficult to heal and can require skin grafting or amputation of the bitten appendage (8). Current therapies are not effective, often not based on sci-entific research and can even be detrimental (7).

Case presentation

On 20th September 2009, a 38 year old man arrived at the Admissions Unit of the 2nd Clinical Department of Internal Medicine of the Third Fa-culty of Medicine, Charles University in Prague. The man, an employee of one of Prague’s ho-tel restaurants, said that he had been bitten by a spider as it ran out of its hiding place in a box of avocados, which the man was opening and which had been delivered to Prague from Brazil by air. The man’s response to the painful bite was very prompt; he killed the spider and brought it to the hospital with him. The length of time between the bite and admittance to the hospital was approxi-mately 1.5 hours. According to the patient, the re-ason why he decided to seek medical assistance was strong local pain and increasing oedema.

A photograph of the dead spider was immedi-ately sent via e-mail to the Arachnological Labo-ratory at the Department of Biology, Faculty of Science of the J.E. Purkinje University in Ústí nad Labem (Czech Republic), where it was unequivo-cally identified by a professional arachnologist as being of the genus Loxosceles Heinken & Lowe, 1832. The following day, the spider was identifi-ed as being an adult female Loxosceles rufescens (Dufour, 1820). The voucher specimen is stored

at the above-mentioned university’s arachnologi-cal laboratory, where original photo documentati-on (with the exception of Figure 5), which is part of this article, was taken. Figures 2, 3, 4, 7 and 8 were taken using an XL 30 ESEM Environmental Scanning Electron Microscope. Photographs ta-ken using the stereomicroscope (Figures 1 and 6) were taken with a Canon Power Shot S50 camera. Figure 5 was taken in the hospital.

At the time of the patient’s admission to the Ad-missions Unit the dominant manifestation was the local reaction at the bite site, which took the form of significant oedema and erythema with central decolouration on the right outer forearm (Figure 5). The efflorescence was 13 cm in diameter at the time of admission. At the bite site the patient was experiencing both pain on palpation and pain at rest, was nauseous and, in his own words, felt hot.

Dyspnoe, palpitation, febricity and neurolo-gical symptoms (paresthesia, dysesthesia, verti-go) were not present. Other dyspeptic symptoms, apart from the above-mentioned nausea, did not manifest themselves in the patient.

At the time of admission to the Admissions Unit, the patient’s blood pressure was 145/90, his pulse rate was 90 beats per minute, his respira-tory rate was 16 breaths per minute and his oxy-gen saturation, measured using a pulse oximeter, was 98%. The man suffered from chronic arterial hypertension and was on a daily dose of 2.5 mg of Ramipril H (hydrochlorothiazide). He stated no allergies to medication, nor was he allergic to in-sect bites.

The patient was immediately fitted with a cen-tral venous line and basic laboratory tests (com-plete blood count with the blood differential test, mineralogram, screening of hepatic transamina-ses, bilirubin, cholestasis markers and the lactic acid test) were done. The results of these tests were without any pathological findings.

Corticosteroid therapy – the intravenous appli-cation of 500 mg of Solu-Medrol (Methylpredni-soloni natrii succinas) in 100 ml of saline solution – was initiated at the Admissions Unit. The anti-histamines – 1 mg of Dithiaden (Bisulepini hy-drochloridum) and 10 ml of Calcium gluconicum 10% – were then administered intravenously and followed by an infusion of 1000 ml of pure saline solution. To relieve the pain, the patient was given

578



50 mg of Tramadol (Tramadoli hydrochloridum) intravenously. A cold compress was applied to the bite site.

Following initial treatment at the Admissions Unit the patient was admitted to the Metabolic Unit for observation and further medical care, while vital bodily functions were monitored conti-nually. Throughout monitoring blood pressure was between 120/75 and 140/90 and the pulse rate was between 65 and 99 beats per minute. Throughout observation the patient showed no signs of dispno-ea or oxygen desaturation, and hourly diuresis did not reveal any anomalies. At the Metabolic Unit, the patient was given another dose of Solu-Medrol – 250 mg after eight hours.

Gradually, the local manifestations experienced by the patient, including pain at the bite site, dimi-nished significantly. The patient did not develop the anticipated, or rather possible systemic mani-festations or necrosis at the site of the bite. After 24 hours of observation at the Metabolic Unit, the patient was discharged from hospital without any health problems. A haematoma, fading in colour and approximately 5cm in diameter, was visible at the bite site at the check-up 72 hours after the bite. Follow-up laboratory tests did not reveal any ano-malies, which could be attributed to loxoscelism.

Discussion and Conclusion

The experience gained from the treatment of one documented case with mild sequelae can-not, of course, be generalized. The progression of the reaction to the bite and envenomation was positively influenced not only by the patient’s prompt arrival at hospital, but also by the fact that he brought the dead spider with him, which enabled its reliable identification and the prompt commencement of comprehensive treatment in-cluding corticotherapy. In this case, the patient did not develop the feared systemic manifestations of loxoscelism or dermonecrotic lesions. The local inflammatory response at the bite site was mild and after 24 hours in hospital the patient could be discharged. According to Forks (8), many bites are asymptomatic. On the basis of their research, Car-doso et al. (9) reached the conclusion that most probably some reported cases of necrotic lesions

attributed to spider bites may in fact represent mis-diagnoses of serious conditions such as infections by Streptococcus group A or Methicillin resistent Staphylococcus aureus. Catalán et al. (10) isolated tetracycline- and penicillin-resistant Clostridium perfringens from the fangs and venom glands of Loxosceles laeta and reached the conclusion that antibiotic therapy of Loxosceles poisoning should be re-evaluated. A lack of understanding of the mechanism of the action of the Loxosceles spider venom has thus far prevented the development of effective therapies (7).

Early species identification and specific man-agement can prevent most serious sequelae of spi-der bites (11). The identification of spiders requires experience as the main identification features are their copulatory organs. For this reason it is dif-ficult to identify young and subadult specimens in particular. Problems in identifying and misidenti-fying the genus Loxosceles have been described by Vetter (12,13), who also compiled a list of spider species of several families (12), whose ap-pearance, colouring and habitat preference can be the cause of misidentification. The colouring of immature spiders, however, is not usually a suf-ficiently distinct feature to be used for the reliable identification of a species. Important morphologi-cal features which aid the reliable identification of the genus Loxosceles include the characteris-tic violin marking on the prosoma (Figure 6), six eyes, arranged in three diads forming a strongly recurved row (Figures 1 and 6), basally fused che-licerae, connected by a membrane (Figure 2), and the finger-like, muscular colulus (Figures 7 and 8), with which these spiders fluff up the silk webbing of their webs, giving them their unusual appear-ance characteristic of loxoscelids. The colulus is situated in front of the three pairs of spinnerets (Figure 7), at the end of which the spinning glands in the opisthosoma are terminated in an outlet.

The described case is related to a very impor-tant phenomenon – the introduction of new, non-aboriginal species both in Europe and other parts of the world. This tendency will grow with in-creasing global trade, shorter transportation times, and more trade connections. This issue has been the long-term subject of the work of Kobelt and Nentwig (14), who, based on current trends, pre-dict the arrival of at least one additional alien spi-



der species per year in Europe in the near future, with the major part of introductions still coming from the eastern Palearctic and the Indomalay-an regions. The above-mentioned authors have reached the conclusion that with increasing eco-nomic growth in Latin America and Africa, these areas might also increasingly contribute to the composition of alien spiders in Europe. For exam-ple, the medically important spiders Cheiracan-thium furculatum Karsch, 1879 (sac spider) and Latrodectus geometricus C. L. Koch, 1841 (brown widow) are found in and around grape vineyards in South Africa. At harvest time, these spiders are inadvertently packed with the grapes. Live spi-ders exported with the grapes are a cause of great concern when they emerge alive from containers on arrival in overseas countries (15). Many alien spiders have come from synanthropic habitats and this trend will probably continue. Potentially, this includes many species such as Loxosceles sp., Te-genaria sp., Latrodectus sp., Atrax sp., Phoneutria sp., Heteropoda sp., Steatoda sp., Zoropsis sp. and others just to mention the best documented gen-era (14, 16, 17, 18, 19, 20), which are of medical importance to humans and which live in or near buildings. Kobelt and Nentwig (14) also predict that the import frequency of alien spiders poten-tially harmful to humans will increase. A high im-port rate is usually considered a precondition for the establishment of a viable population. The dis-tribution of spiders of the genus Loxosceles ranges from temperate South Africa to the Mediterranean Region, southern Europe and tropical zones in both North and South America (1, 20). Spiders of this genus are mostly ground-dwelling or wan-dering. Some species can live in houses with hu-mans and are readily transported. Eggs are laid in sparsely woven cocoons in the web. In an anthrop-ic environment the dispersion of Loxosceles is highly facilitated as it is cryptozoic. One fertilized female which escapes notice during the handling of goods is undoubtedly capable of laying several dozen eggs and establishing a new population. The native South American Loxosceles laeta is the brown spider species of greatest medical impor-tance and is synanthropic. In Brazil it inhabits ur-ban and periurban ecotopes (21). As a result of the globalization of trade and the transport of goods across continents, this species has spread, or rather

has been introduced into both North and Central America, Australia and Finland (16). As for Loxo-sceles rufescens, the Mediterranean recluse spider, is now considered to be cosmopolitan (1); large numbers have been found in southern USA, for example, and recently in New York (20). The easy introduction of spiders of the genus Loxosceles is facilitated by a high resilience, their ability to survive for several months without food and by scavenging, a quality which is very rare among spiders. Sandidge (22) discovered that this spider prefers dead, scavenged prey to live prey. How-ever, during their research on Loxosceles reclusa Vetter and Barger (23) discovered that the brown recluse and its relatives are not very aggressive and huge populations have been found in houses where the human inhabitants remained unbitten after years of cohabitation.

With the influx of new spider species it is nec-essary to be prepared for new forms of arach-nidism and this threat should certainly not be underestimated. A current example of such a medically important species in the Czech Repub-lic is the triangulate household spider Steatoda triangulosa (Walckenaer, 1802), belonging to the family Theridiidae (comb-footed spiders), which includes the northern Mediterranean species La-trodectus tredecimguttatus (Rossi, 1790), known also as the black widow. Clinical manifestations of envenomation have included local signs together with systemic neurological symptoms resembling low-grade latrodectism i.e., black widow enveno-mation (24). As recently as 1971, this species was unknown on the territory of the Czech Republic (25) and even 30 years later it was considered a rare species (26). At present, however, the number of these spiders living synanthropically in build-ings heated in the winter in the Czech Republic can be considered very abundant (27).

580



Figure 1. Adult female Loxosceles rufescens killed by the patient. P – prosoma, E – eyes, CH – chelicerae. The actual size of the spider (prosoma + opisthosoma) is 11 mm

Figure 2. Chelicerae of L. rufescens adult fema-le – ventral view. BS – Chelicera: basal segment, F – movable articulated fang, BF – fusion of the basal parts of the chelicerae, M – mouth

Figure 3. Detail of a chelicera. The arrow indi-cates the venom gland outlet through which the toxin is transferred to prey when bitten

Figure 4. Detail of the terminal part of the fang with poison gland outlet. The opening is filled with the solidified toxin – T

Figure 5. The patient’s forearm 3 hours after the bite. Oedema and erythema had developed aro-und the site of the bite marked by an arrow



Figure 6. Detail of the dorsal side of the proso-ma – P with the marking in the shape of a violin – V. E – eyes, O – opisthosoma

Figure 7. The spinning apparatus of a female L. rufescens, comprising three pairs of spinnerets and a colulus. The finger-like colulus does not have the opening of spinning glands but is used to fluff up silk webbing. ALS, PMS, PLS – ante-rior lateral, posterior median, posterior lateral spinnerets

Figure 8. Detail of the colulus

Acknowledgements

The authors acknowledge suggestions made by the reviewers and the editor to improve the ma-nuscript.

The images used in this article were created using scanning electron microscopes in the labo-ratory of the Department of Biology, J.E. Purkinje University in Ústí nad Labem, supported by the Grant Agency of the Czech Republic; grant con-tract number 206/08/0378.

References

1. Platnick N.I. (2010) The World Spider Catalog, Version 11.0. New York: American Museum of Na-tural History. Available at http://research.amnh.org/iz/spiders/catalog/COUNTS.html

2. Friedel T., Nentwig W. (1989) Immobilizing and let-hal effects of spider venoms on the cockroach and the common mealbeetle. Toxicon 27, 305-316.

3. Foelix R. (1996) Biology of Spiders, 2nd ed. New York: Oxford University Press.

4. Tambourgi D.V., Paixao-Cavalcante D., de An-drade R.M.G., Fernandes-Pedrosa M.D., Magnoli F.C., Morgan B.P., van den Berg C.W.(2005) Loxos-celes sphingomyelinase induces complement-de-pendent dermonecrosis, neutrophil infiltration, and endogenous gelatinase expression. J. Invest. Der-matol. 124, 725–731.

5. Ferrara G.I.D., Fernandes-Pedrosa M.D, Junqu-eira-de-Azevedo I.D.M., Goncalves-de-Andrade R.M., Portaro F.C.V., Manzoni-de-Almeida D., Mu-

582



rakami M.T., Arni R.K., van den Berg C.W., Ho P.L., Tambourgi D.V.( 2009) SMase II, a new sphingo-myelinase D from Loxosceles laeta venom gland: Molecular cloning, expression, function and struc-tural analysis. Toxicon 53(7-8), 743-753.

6. Manriquez J.J., Silva S. (2009) Cutaneous and vis-ceral loxoscelism: A systematic review. Rev. Chil. Infectol. 26(5), 420 – 432.

7. Tambourgi D.V., Goncalves-de Andrade R.M., van den Berg C.W. (2010) Loxoscelism: From basic re-search to the proposal of new therapies. Toxicon DOI: 10.1016/j.toxicon.2010.01.021

8. Forks T.P. (2000) Brown recluse spider bites. J. Am. Board Fam. Pract. 16(6), 415-423.

9. Cardoso P., Almeida A.P.G. (2010) Spider poiso-ning in Portugal. Fact or Myth? Acta Med. Port. 23(1), 33-38.

10. Catalán A., Espoz M.C., Cortéz W., Sagua H., Gonzáles J., Araya J.E. (2010) Tetracycline and penicillin resistant Clostridium perfringens isola-ted from the fangs and venom glands of Loxosceles laeta: Its implications in loxoscelism treatment. Toxicon DOI: 10.1016/j.toxicon.2010.06.012

11. Diaz J.H., Leblanc K.E. (2007) Common spider bites. Am. Fam. Physician 75(6), 869-873.

12. Vetter R.S. (1999) Identifying and Misidentifying the Brown Recluse Spider. Dermatology Online Journal 5(2), http://dermatology.cdlib.org/DOJ-vol5num2/index.html

13. Vetter R.S. (2008) Spiders of the genus Loxosceles (Araneae, Sicariidae): A review of biological, me-dical and psychological aspects regarding enve-nomations. J. Arachnol. 36(1), 150-163.

14. Kobelt M., Nentwig, W. (2008) Alien spider intro-ductions to Europe supported by global trade. Di-vers. Distrib. 14, 273-280.

15. Craemer C. (2006) Spiders a problem on export grapes. Plant Protection News 67, 10.

16. Huhta V. (1972) Loxosceles laeta (Nicolet) (Ara-neae, Loxoscelinae), a venomous spider estabi-lished in a building in Helsinki, Finland, and no-tes on some other synanthropic spiders. Ann. Ent. Fen. 38, 3.

17. Baird C.R., Stoltz R.L. (2002) Range expansion of the Hobo spider, Tegenaria agrestis, in the nort-hwestern United States (Araneae, Agelenidae). J. Arachnol. 30, 201-204.

18. Knoflach B. (2002) Zoropsis spinimana (Doufour, 1820): an invader into Central Europe? Nwsl. Br. arachnol. Soc. 95, 15.

19. Isbister G.K., Seymour J.E., Gray M.R., Raven R.J. (2003) Bites by spiders of the family The-raphosidae in humans and canines. Toxicon, 41, 519–524.

20. Ubick D., Paquin P.E., Cushing P.E., Roth V. (eds.). (2005) Spiders of North America: an iden-tification manual. American Arachnological Soci-ety.

21. Silveira A.L. (2009) First synanthropic record of Loxosceles laeta (Nicolet, 1849) (Araneae: Sica-riidae) in the municipality of Rio de Janeiro, State of Rio Janeiro. Rev. Soc. Bras. Med. Trop. 42(6), 723-726.

22. Sandidge J.S. (2003) Arachnology: Scaven-ging by brown recluse spiders. Nature 426,30 doi:10.1038/426030a

23. Vetter R.S., Barger D.K. (2002) An infestation of 2,055 brown recluse spiders (Araneae: Sicari-idae) and no envenomations in a Kansas home: implications for bite

24. diagnoses in non-endemic areas. J. Med. Ento-mol. 39, 948-951.

25. Pommier P., Rollard C., de Haro L. (2006) Ste-atoda spider envenomation in southern France. Presse Med. 35(12), 1825 – 1827.

26. Miller F. (1971) Řád Pavouci – Araneae (Spiders – Araneae). In Daniel. M.& Černý V. (eds). Klíč zvířeny ČSSR IV (Key to the fauna of Czechoslo-vakia IV). Academia Praha, pp. 51 – 306 (in Cze-ch).

27. Buchar J., Růžička V. (2002) Catalogue of Spiders of the Czech Republic. Praha, Peres.

28. Hajer J. (2007) Steatoda triangulosa (Walckena-er, 1802) (Araneae: Theridiidae ) - vzácný, nebo hojný druh? Steatoda triangulosa (Walckenaer, 1802) (Araneae: Theridiidae) – a rare or abun-dant spider species? Fauna Boh. Septentr. 32, 192-196 (in Czech).

Corresponding author Jan Hajer, Charles University, Third Faculty of Medicine, 2nd Department of Internal Medicine, Czech Republic, E-mail: [email protected]



Abstract

Introduction: horseshoe kidney is the most co-mmon renal fusion anomaly whose complications must be considered as an important clinical entity. High insertion of ureter, as well as variations of artery and venous blood vessels, individually or in combination, leads to stasis of urine or urine infec-tion, which consequently creates calculosis.

Case report: complications of surgical trea-tment of calculosis of the left horseshoe kidney were shown: significant bleeding with massive compensation of volume and immune supersive effects of massive transfusion. Presence of in-fective compound as a local infection, as well as previously mentioned, developed hard sepsis with dysfunctions of main body’s systems.

Conclusion: Review of this patient suggests that any massive bleeding where the losses are lar-ge and more than 70% of cardiovascular volume, and substitution is performed with blood products in a short time period, represents a problem of ma-ssive transfusion and it is in tight connection with the appearance of immunosuppression and pose-bility development of septic syndrome.

Key words: horseshoe kidney; calculosis; he-minefrectomia; bleeding; septic syndrome; infec-tions;

Introduction

The horseshoe kidney is the most common re-nal fusion abnormality. It appears in one out of 400 cases. It is more common in men and in many ca-ses associated with other congenital abnormaliti-

es. In 95% of horseshoe kidney cases, lower poles of the kidneys are fused. In some cases, isthmus which is localized near L3 or L4 vertebra, below the coming out of the lower mesenteric artery and under big blood vessels, has a significant volumen with the functional parenchyma. That leads to stra-ightening of kidney axis and malformation of kid-ney pelvis, so the ureter may have an abnormally high attachment. Although, in 33% of cases it is asymptomatic, certain complications of secondary characteristics appear, the most often connected to obstructive uropathy, such as: hydronephrosis, lit-hiasis and infection. Significant bleeding and uri-nary fistula are the most important complications during the surgery on the horseshoe kidney (1,2).

Case report

A female patient, 60 years of age, underwent urology examination, because of exhaustion and bothering pain in the left lumbar region. There were no data, about the previous kidney disease, nor abo-ut the existence of kidney abnormality. Laboratory analysis showed only increased sedimentation rate and mild decrease of hemoglobin concentration. Microbiological urine finding was sterile.

During the urology examination, the following was performed: Multislice Computerized Tomo-graphy (MSCT) of the kidneys, which showed that the kidneys were connected by the lower poles (horseshoe kidney). In the area of the left kidney up to the connection to the right kidney, there was a suppurative formation with levels of fluid and stag-horn stone in the left kidney, as well as signs of the suspecious retroperitoneal disease (Figure 1.).

Partial resection of the horseshoe kidney because of Urolithiasis – perioperative complicationsSvetlana Pavlovic1, Jablan Stankovic2, Slađana Zivkovic3, Vladimir Milic1

1 Center for anesthesiology and reanimation, Clinical center Niš, Serbia,2 Clinic for Urology, Clinical center Niš, Serbia,3 Urology Department, Surgery, Military Hospital Niš, Serbia.

584



Figure 1. Staghorn stone in the left part of the horseshoe kidney. Dilatation of the renal pelvis and calyces and perirenal supurative mass

Arteriography of the abdominal aorta was per-formed by the right femoral ascending approach, and after that descenting selective angiograp-hy (DSA) of the left kidney, as well. During the examination in arterial parenchymal and venous phase, horseshoe kidney was confirmed, which is vascularized by three main arteries, i.e. right kid-ney, parenchymal bridge and the left kidney are vascularized by one artery, each one of the regular shape. In the parenchymal phase in the left kidney, staghorn stone was identified, as well as the exi-stence of ovoid avascular zone (hydronephrosis or huge inflammatory processes (abscess).Intraveno-us urography confirmed, the existence of the regu-lar passage of the contrast fluid through the right ureter. Left ureter is not shown. The bladder is of regular shape (Figure 2).

After the urology examination and the conclu-sion that the suppurative destruction of the kidney exists, indication for the surgery treatment was absolute. Anaesthesiology examination assessed the degree of the anaesthetic risk according to ASA classification, the patient was assessed as ASA II. Pprophylaxis of thromboembolic disease by low molecular heparin/reviparin sodium in the dosis of 3436 IU, as well as empiric antimicrobe therapy by cephtazidim 1 g every 8 hours, metro-nidazol 500 mg every 8 hours, before the surgery, and immediately after the surgery a single dose Amikacin 1 g was administered. After introdu-cing in general balanced endotracheal anaesthesia, the surgery was performed: left nephrectomy and isthmal resection. Histopathology finding: Chro-nic Purulent Pyelonephritis. Chronic Perinephritis adherent capsule renal fibrosis. Microbiological finding: Escherichia colli.

The patient was hemodynamically stable du-ring the surgical treatment, although blood loss was significant and assessed as more than 70% of the blood volume. Blood loss was because of the fibrous reaction in the perirenal area and because of the big kidney mass. Inflammatory perirenal ti-ssue, during the surgical treatment can cause, even the surgeon is very cautious, significant bleeding from fragile blood vessels, as well as parenchy-mal bleeding. Intrasurgical autologus transfusion was performed on the apparatus Cell – Saver V, where 9113 ml of blood was processed, and then reinfunded 1830 ml of autologus washed erythro-cyte. Because of the great loss during the surgi-cal treatment, the patient got 5 units of alogenous displasma erythrocyte, three doses of fresh frozen plasma, as well as 100 ml 20% of human albumin. This significant acute loss of the blood volume, beside the above mentioned, was compensated with crystaloids and Ringer lactate of 8500 ml, Sodium-B-carbon 8,4% in the amount of 40 ml, then with colloid solution Hetasorb 6% 1000 ml and HES-Voluven 1000 ml.

Lost blood which could not be processed,through the apparatus, because of objective reasons, were assessed to about 3360 ml (aspirator, small and big gauze). Mechanical ventilation with biphasic positive pressure (BIPAP) was applied to the pa-tient after the surgical treatment, with inspiring concentration of oxygen FiO2 0,7% with gradual



decrease to 0,4 eight hours to stabilisation of both hemodynamic and acidobase parameters. Arteri-al blood pressure (AT) was in the range of 85/64 mmHg to 112/86 mmHg. Heart rate (Hf) was 105 to 72 per minute, saturation of hemoglobin by oxy-gen (SpO2) was 99% and acidobase parameters (blood Ph) 7,18, standard bcarbonates (HCO3) 12 mmoll/l up to stabilization. Blood Ph, before sepa-ration from mechanical ventilation, was 7,31 and HCO3 was 24mmol/l. Average value of diuresis per hour was 150 ml.

The patient had nutritional parenteral support (three-component Kabiven in the amount of 1440 ml per day, and from the second after surgical day, she also had enteral support (Ensure plus), beside the intensive treatment with antimicrobial therapy (cephthazidim, amikacin, metronidazol) and he-matological supstitution (crioprecipitate, frozen, fresh plasma (FFP) displasma erythrocites, AT III),. Enteral support was administered through the regime of bolus doses in the amount of 20-70 ml every two hours, for six days. Very quickly, the patient was mobilized out of bed.

On the seventh day after the surgery, worsening of the health state appeared, febrile state develo-ped, with the body temperature of 39,4ºC, leuko-

cytosis 10x10, lymphopenia 1,1 and hemoglobin 106 g/l, procalcitonin (PCT) 3,29 and C-reactive protein (CRP) 340,6. Clinically the patient little worsened, diuresis per hour became decreased to 80 ml per hour, pulse frequency increased, SpO2 was in the range of 95 to 98 and hemoglobin was 85g/l. The smear from the surgical wound was taken for the microbiological analysis, and then MSCT was performed, where regular right kidney and “clean“ retroperitoneal left area, were noticed (Figure 3).

Worsening of the health state is maintained, be-side intensive therapy, and paralytic ileus as well as wound dehiscence occured. On the eight day after the surgery, re-do surgery was performed: Vound suture , abdominal and retroperitoneal revi-sion and drainage of the Duglas space as well. An-tibiotic therapy in addition to surgery was mainta-ined (meropenem 1 g every eight hours and metro-nidazol 500 mg every eight hours (microbiology finding: Klebsiella spp, Immunological support is continued (immunoglobulin 24 g at once), in ad-dition hematology monitoring, Crioprecipitate in 20 doses is administered. The patient’s health state was followed up through hemoglobin, coagulati-on and factor coagulation screening, biochemical

Figure 2. Angiography of the horseshoe kidney. Right kidney, isthmus and left kidney vascularized with the single artery. Avascular areas correspond to the abscess or hydronephrosis

586



parameters, PCT CRP, hemoglobin and clinical parameters (cardiovascular, gastrointestinal and renal, as well). (Table 1 and 2). The patient’s re-covery was good, so she was discharged from the Clinic on the tenth day after the second surgery treatment, in good health state.

Graph 1. Perioperative hemoglobin values

Graph 2. Perioperative values of procalcitonine. PCT

Figure 3. MSCT of the kidney after nephrectomy. Clear retroperitoneal space. With massive gas co-llections in the bowel



Discussion

Urolithiasis is the most common complication of the horseshoe kidney. It appears with variable frequency from 21 to 60% (3). Damaged kidney and impairment of urine passage are the most co-mmon cause of the stone formation in the horses-hoe kidney (4,5).

Available therapeutic modalities for the stone disease are: ESWL (Extracorporeal Shock Wave Lithoripsy), open surgery, PCNL (Percutaneous Nephrolithotomy) and laparoscopy surgery, as well (6,7). Because of the appearance and size of the left kidney calculosis, followed by pionephrosis, open surgery treatment was chosen in this case.

Bleeding was one of serious complications du-ring the surgical treatment. The kidney is a paren-chymatous organ, so bleeding during the surgical treatment of the kidney, is a very significant pro-blem in urology and it has a role both in morbidity and mortality in urology patients. In pionephrosis, changes in perirenium and intimate adhesions with the surrounding tissue, make nephrectomy very di-fficult and with high risk of bleeding and harming nearby organs. The enlarged pionephrotic kidney with inflammatory perirenal tissue, regardless of surgeon’s caution, leads to significant bleeding, as well as parenchymal bleeding during the process of separating from the surrounding tissue. Spacious area of surgery, can leave behind, secondary infec-tive process (abscess), after removing the essential infective focal point (pionephros). As a result, ge-neralization of the inflammation and difficult sep-ticaemia with the appearance of paralytic ileus and dehiscence of the wound, can appear. In addition to those risk factors and massive loss of circulating volume, supplementation of blood volume is an additional risk factor, which may lead the patient to multiorgan disfunction (MODS), because of the immunodepression. Although, autologus transfusi-on was applied, i.e. intra surgical saving of blood in the apparatus during the surgical procedure, the blood loss was significant, and it was over 70% of the circulating volume. The response of the orga-nism to acute bleeding is the activation of the four main physiological systems: neuroendocrine, car-diovascular, kidneys (uropoietic) and hematologi-cal system, as well. Acute bleeding, where the loss is significant and it is above 20% of the volume,

affects the oxyform blood capacity and makes cell hypoxia (8). In the hypoxic cell, transport proce-sses responsible for electrolyte homeostasis beco-mes damaged. Re-establishing of the blood flow and additional supply with oxygen into the hypoxic cell, may result into the reperfusion damage, with formation of oxygen free radicals (9). Cell functi-on damage causes hypofunction of both tissues and organs and detoxication of the substances which appear in the ischemic tissue is decreased, that le-ads to hypoperfusion especially the red one (me-senteric blood vessels). Red bacteria propagate, and their toxin passes into the blood and lymph. Liver reticuloendotelial system is suddenly loaded with numerous toxins which cause release of the number of mediators of various effects: some of them acts against inflammation, while the other act pro-infla-mmatory. Severe septicemia appears, as a result, as well as dysfunction of the organ systems (10).

On the other hand, supplying of the lost circula-ting volume by both autologus and alogenic blood, where the loss was greater than one circulating vo-lume, carries the risk of massive transfusion. Su-pplementation, because of the acute hemorrhage, must be quick. There are data about the immuno-suppressive effects of the alogenus transfusion, that the most infections are autochthonous, nosocomial and far from the injury (11). A similar immunosu-ppressive effect of alogen blood transfusion is re-ported, even in patients with various malignancies (12). Sometimes, it is necessary to perform additi-onal surgical treatment because of bleeding in the surgery of horseshoe kidney (13, 14).

In our patient, development of severe septice-mia, as well as therapy effects of supportive thera-py was followed up through numerous biochemical and hematological parameters, after surgery and the most significant were hemoglobin (Hgb) and pro-kaciltonin (PCT) (Table 1, 2). Values of these para-meters, presented on Tables, show that the therapy procedure was adequate, that resulted in favorable recovery during the postoperative period.

Conclusion

Severe septicemia could be caused by both local infective focal point and surgical bleeding where the blood loss is massive, even more than

588



70% of the circulating volume. Supplementati-on of blood volume in the short period of time, from 4 to 24 hours, is a problem of massive tran-sfusion which causes potential risks presented by immunosuppression. Successful administration of adequate antimicrobial therapy and by medica-mentous support of the vital organs function, both complications were overcome.

References

1. Garcia AA, Burgos RM, Sanchez BC, Perales JN, Almodovar RB, Cacha GL. Renal carcinoma in the isthmus of a horseshoe kidney. Case report. Actas Urol Esp 2008; 32 (2): 249 – 252.

2. Bauer SB. “Anomaias del tracto urinario superi-or“, “Campbell Urologia“ 8a edicion. Ed. Pana-mericana – Buenos Aires 2004; 2080 - 2084.

3. Johannes P and Smith DA. The endourological ma-nagement of complications associated with horses-hoe kidney. J Urol 2002; 168: 5-8.

4. Smith JE, Van Arsdalen KN, Hanno PM, Pollack HM. Extracorporeal shock wave lithotripsy trea-tment of calculi in horseshoe kidneys. J. Urol 1989; 142:683-686.

5. Hoenig DM, Shalhav Al, Elbahansy AM, McDoug-hall EM, Clayman RV. Laparascopic pyelolithomy in pelvic kidney: a case report and review of the literature. J Laparascopic Surg 1997; 1 :163-165.

6. Ng LG, Yip SK, Wong MY, Lau TN. (2001) Clini-cs in diagnostic imaging. Hydronephrotic horses-hoe kidneys with multiple calculi. Singapore Med J 2001; 42:540 – 544.

7. Raj GV, Auge BK, Weizer AZ, Denstedt JD, Watter-son JD, Beiko DT et al Percutaneous management of calculi witin horseshoe kidneys. J Urol 2003; 170: 48 – 51.

8. Landry DW, Oliver JA. Insights into shock. Sci AM 2004; 290: 36-41.

9. Filip Dellinger R, Parillo JE. Mediator modulation therapy of severe sepsis and septic shock: Does it work? Crit Care Med 2004; 282-286.

10. Lichtenstern C, Schmidt J, Knaebel HP, et al. Po-stoperative bacterial/fungal infections: a challen-ging problem in critically ill patients after abdo-minal surgery. Dig Surg 2007; 24:1-11.

11. Taseski J, Balint B, Matković D. Mass transfusion syndrome. Beograd: Association ART Yugoslavia 1997.

12. Agarwall N, Murphy JG, Cauteum CG, Stall WM: Blood transfusion increases the risk of infection after trauma. Arch.Surg 1993; 128:171.

13. Symons SJ; Ramachandran A; Kurien A; Baiysha R; Desai MR: Urolithiasis in the horseshoe kid-ney: a single-centre experience. BJU Internatio-nal [BJU Int] 2008 Dec; Vol. 102 (11), pp. 1676-80. Date of Electronic Publication: 2008 Sep 08.

14. A. M. Dajani: Horseshoe kidney: a review of twenty nine cases; British journal of urology, vo-lume 38, issue 4, pages 388 – 402, published on-line: 5 dec 2008

Corresponding author Svetlana Pavlovic, Center for anesthesiology and reanimation, Clinical center Niš, Serbia, E-mail: [email protected]



Abstract

Setting: Duzce city, a rural area in the nort-hwest part of Turkey.

Objectives: To examine the effects of two sequ-ential earthquakes on sociodemographic and disea-se related features of tuberculosis (TB) patients.

Methods: The present study was conducted among newly diagnosed smear positive (from Oc-tober 1998 to October 2002) 112 pulmonary TB patients based on a specific questionnaire. Patients were divided into 3 groups regarding the time of diagnosis and the period from the initiation to the end of the treatment (pre, peri and post-earthquake periods).

Results: Although the present study has not fo-cused on the factors that influence the adherence of patients to TB therapy, no major changes were observed regarding socio-economical parameters that have an effect on the fate of TB. Patients were frequently hospitalized in pre-earthquake period while patients were ambulatory in peri and post-earthquake period (p<0.005). Patients were signi-ficantly controlled once a month in peri-earthquake period (p<0.001). Patients were mostly followed by the same doctor in post-earthquake period.

Conclusion: It can be stated that the earthqu-akes had very little impact on the TB during and after earthquakes in Duzce. Further studies inclu-ding whole Marmara region are needed to inter-pret the effect of earthquake on TB control.

Key words: tuberculosis, earthquake

Introduction

Natural disasters impact on large numbers of people throughout the world. Earthquakes are among the most important natural disasters that cause mass emergencies and unexpected disrup-tion to procedures and protocols. Depending on the nature and location of such disasters, various infections have caused problems in the past (1, 2).

Catastrophic incidents, such as earthquake, have placed new scrutiny on disaster preparedne-ss for a host of organizations, especially primary health care in patients with tuberculosis. Natural disasters introduce new and heightened forms of uncertainty to caregivers in attempting to protect patients and to maintain continuity of care and pa-tient safety. Uncertainty exists when details of si-tuations are ambiguous, complex, unpredictable or probabilistic; when information is unavailable or inconsistent; and when people feel insecure about their own state of disease. Uncertainty threatens optimal healthcare organizations and reduces the quality of patient care (3).

Natural disasters are shocks to both the supply and demand of health services. On the supply side, natural disasters can profoundly affect the delivery of services; facilities may experience diminished staff levels and capacity because of damaged buil-dings and supplies. Demand side shocks from na-tural disasters can either increase or decrease de-mand for care. Disasters can increase disease and injury incidence and acute levels of distress (4).

The effects of Two Sequential Earthquakes on Tuberculosis Patients: An Experience from Duzce EarthquakeOner Balbay1, Ege Güleç Balbay2, Peri Arbak1, Ali Nihat Annakkaya1, Cahit Bilgin3

1 Düzce University, School of Medicine, Department of Chest Diseases, Turkey,2 Duzce Atatürk State Hospital, Turkey,3 Hendek State Hospital, Turkey.

590



On 17th August and 12th November 1999, two earthquakes occurred in the northwest part of Turkey, the country’s most densely populated re-gion and industrial heartland, including cities of Kocaeli, Yalova, Sakarya, Duzce and Bolu. The first measured between 7.4 and 7.8 on the Richter scale. According to official statistics published by the Turkish government, 17,480 victims died and 43,953 were wounded (5). Approximately 66,000 buildings were severely damaged or destroyed. The second quake, which rated 7.2 on the Rich-ter scale, shook the city of Duzce and the town of Kaynasli, some 100 km to the first epicentre. The confirmed death toll was 845, with 4948 peo-ple injured, nearly 40,000 homes either damaged or collapsed. Almost half of the buildings were destroyed or severely damaged. Most homeless people were accommodated in tents and caravans (later in prefabricated dwelling units). Many pe-ople were constrained to live crowded temporary or improvised accommodation from disaster to the end of 2001 (5).

The city of Duzce affected by these two ear-thquakes remarkable diverse in its geography and living conditions. This study reflected the effects of two sequential earthquakes on TB patients in Duzce city.


Patients

This study was conducted among newly diagno-sed smear positive (between October 1998-Octo-ber 2002) 112 pulmonary TB patients treated and followed at the Chest Department of Duzce Facul-ty of Medicine and Duzce TB Dispensary placed in a rural area in the northwest part of Turkey. Fa-culty of Medicine was established in 1997 and cli-nical services were started in April 1998. Relapse, failure, default and chronic cases were excluded. All patients were cured or completed treatment (6). The details of demographic factors such as age, gender, the place of residence, the site of dise-ase, symptoms of disease, bacteriology, histology, roentgenogram, drug treatment, alcohol and ciga-rette consumption data, the previous TB history and family history were available for all patients.

Clinical and demographical data were obtained from several sources: medical records, clinical la-boratories, Duzce Bureau of Tuberculosis Control. Reviews of medical records were evaluated by the same trained investigators and physicians.

Definition of patients’ groups

Patients were divided into 3 groups regarding the time of diagnosis and the period from the initi-ation to the end of the treatment.

The patients who were diagnosed and comple-ted treatment between April 1998-17 August 1999 were defined as “pre-earthquake group”.

The patients who were diagnosed and comple-ted treatment between 17 August 1999-17 May 2000 were defined as “peri-earthquake group”.

The patients who were diagnosed and comple-ted treatment between 17 May 2000-October 2002 were defined as “post-earthquake group”.

Questionnaire

To analyze the effects of two earthquakes on TB patients, a specific questionnaire was prepa-red and performed between January 2004-April 2007. The education level, occupation, marital status, the mean values of household and children, the mean monthly income, the presence of soci-al security, house, toilet, bathroom, transportation facilities, hospitalization, regularity of therapy, fa-mily history of TB, the type of the therapist (pul-monologist, general practitioner etc.), the place of diagnosis, the period of TB controls, referring to dispensary and family screening for TB were asked in a face to face interview manner.

Statistics

Descriptive statistics were performed with SPSS 10.0 for Windows. Pearson chi square (for categorical variables) and one way ANOVA vari-ance analysis (for continuous variables) were used to make comparisons between groups. A p value less than 0.05 was considered as statistically si-gnificant.



Results

The demographic and socioeconomic characte-ristics of groups are shown in table 1 and table 2.

The mean age of patients diagnosed and cu-red in pre-earthquake (50.50±18.05) period was significantly higher than that of peri-earthqua-ke (36.26±13.77) and post-earthquake periods (41.34±17.22). No significant difference between groups regarding to gender, the place of the resi-dence, smoking status and alcohol consumption was found. Most of the study group was predomi-nantly male, residing in village, nonsmokers and nonalcoholic patients.

In study group most patients were primary sc-hool educated and predominant occupations were unemployed, housewife and tradesman, respecti-vely. No significant difference among TB groups (pre, peri and post earthquake periods) was found.

Unmarried and divorced patients in peri and post-earthquake periods were significantly higher than those of preearthquake period (p=0.009).

The number of household and monthly income in the peri-earthquake period was low but it does not reach statistically significant level among TB groups.

The number of children per patient in peri-ear-thquake period was lower than that of pre and post earthquake periods (p=0.027).

In study group most patients had social security, their own home. No significant difference was shown between 3 groups regarding to these parameters.

Transporting facilities among patients in post-earthquake period (28/44) were more limited than those in pre and peri-earthquake periods (p=0.042).

The features of TB therapy are shown in Table 3.Patients were frequently hospitalized in pre-

earthquake period while patients were ambulatory in peri and post-earthquake period (0.005).

During earthquake 10 of 56 patients were skip-ping treatment but no significant difference among 3 groups was present.

There was no family TB history in most of pa-tients.

Most of patients were diagnosed by pulmono-logist and in hospital but no statistically signifi-cant difference between TB groups was shown.

Even though there was no statistically signifi-cant difference between groups most of patients underwent family screening and referred dispen-sary where treatment was free of charge.

Patients were significantly controlled once a month in peri-earthquake period (0.001).

Patients were mostly followed by the same doctor in post-earthquake period.

Discussion

The relationship between infectious diseases and social, political, and economic change from the earliest times to the present has been well do-cumented. Natural disasters such as earthquakes,

Table 1. The demographic characteristics of the patients

Demographic Characteristics Pre-earthquaken=12

Peri-earthquaken=56

Post-earthquaken=44 p

Age (mean±SD) 50.50±18.05 36.26±13.77 41.34±17.22 0.014GenderMale n=72Female n=40

102

3422

2816

0.330

ResidenceCity n=29Village n=83

66

1244

1133

0.120

Smoking statusCurrent smoker n=52Nonsmoker n=60

84

2828

1628

0.132

Alcohol consumptionYes n=14No n=98

111

947

440

0.519

592



Table 2. The socioeconomical features of the patientsSocioeconomic features

(n)Pre-earthquake

n=12Peri-earthquake

n=56Post-earthquake

n=44 p

EducationIlliterate (19)Primary school (57)Secondary-high school (27)University (9)

38

1-

628

166

1021

103

0.657

OccupationUnemployed (31) Farmer (14)Housewife (24)Employee (15)Tradesman (16)Retired (11)

2222-4

15613895

1469572

0.307

Marital statusMarried (77)Unmarried (30)Divorced (5)

12--

3917-

26135

0.009

Household (mean±SD) 5.16±3.04 4.51±1.76 4.81±2.47 0.598

Number of children (mean±SD) 3.66±2.30 1.64±1.85 2.27±2.94 0.027

Monthly income (mean±SD) 430.00±359.51 376.96±255.18 454.65±495.36 0.588

Social securityYes (90)No (22)

12-

4511

3311

0.155

Home ownership Yes (77)No (35)

93

3620

3212

0.891

ToiletYes n=99No n=13

111

506

386

0.841

BathroomYes n=101No n=11

111

515

395

0.905

Transporting facilitiesAutomobile (24)Others (bicycle, motorcycle, etc) (20)None (68)

3

27

1112

33

106

28

0.042

floods, and famine and manmade conflicts such as wars, civil conflicts, and political unrest may have similar consequences. Earthquakes may lead to conditions such as crowding, inadequate and/or contaminated food supplies and malnutrition, un-safe water, poor sanitation, stress, exposure, and aerolization of microorganisms in dust (7).

Although earthquakes are among the most co-mmon and devastating natural disasters, relatively little attention has been paid to control of tubercu-losis patients.

Previous studies dealing with the earthquake disaster related health problems and the manage-ment of health services have generally focused on



acute infectious diseases that could be explored in various disasters, the organization of emergency and intensive care services and crush syndrome (1, 5, 8, 9). The present study discussed the fate of TB during and post-earthquake period and might reflect the aspects of the health services for disea-ses requiring regular follow up.

The properties that can influence the adheren-ce to TB treatment such as education, occupation, marriage status, the number of household, mon-thly income, social security in usual cases were studied in several reports and the results have been found controversial and yielded a lot of unintegra-ted findings about single determinants (10-14).

A few studies showed no association between educational level and default from therapy (11, 15) whereas the others revealed higher rates of adheren-ce in highly educated patients (12, 13) In our study group most patients were primary school educated and no difference was found among patients dia-gnosed and treated in pre, peri and post-earthqua-ke periods. In a study from a rural area of Nigeria, types of occupation seemed to have no effect on the rate of compliance to TB therapy (16). In the present study, the predominant occupations were unemployed, housewife and tradesman, respective-ly. But, no significant difference among TB groups (pre, peri and post earthquake periods) was found.

Table 3. The features of TB therapyFeatures of therapy

(n)Pre-earthquake

n=12Peri-earthquake

n=56Post-earthquake

n=44 p

Type of therapyHospitalized (45)Ambulatory (67)

102

1937

1628

0.005

Regularity of therapyRegular usage (100)Skipping <2weeks (8)Skipping >2weeks (4)

12--

4673

4211

0.173

Family history Yes (30)No (82)

39

1145

1628

0.171

Who diagnosedPulmonologist (82)General practitioner (19)Others (11)

12--

40115

3086

0.524

The place of diagnosis Dispensary (26)Hospital (78)Private doctor (8)

-102

15374

11312

0.622

Followed by same DrYes (65) No (47)

75

2729

3113

0.082

ControlMonthly (87)Bimonthly (7)Irregular (18)

6-6

4952

32210

0.001

Referring to DispensaryYes (108)No (4)

12-

542

422

0.440

Family screeningYes (91)No (21)

102

479

3410

0.686

594



Risk factors associated with TB control inclu-ded change in household income and loss of job, a new illness or a new injury in the household, reliance on healthcare services since the earthqu-ake, and managing TB. Findings indicate a need for rapid TB screening with at-risk groups and the need to educate the entire community to treatment and increase public awareness (17). In our study, the number of household and monthly income in the peri-earthquake period were low but it does not reach statistically significant level among TB groups. The disaster area had a long tradition of emigration and many residents migrated to join relatives established abroad or elsewhere in Tur-key. This might explain the lower number of hou-sehold and children in the peri-earthquake period.

We expected that earthquake and physical dis-location would lead to the destruction on the fami-ly ties. Significantly higher unmarried and divor-ced patients in peri and post-earthquake periods might be due to this particular case.

A few studies about the factors affecting the TB treatment have shown the importance of tran-sporting facilities on the adherence to TB trea-tment especially in rural areas. A long home to clinic distance has been a well-recognized risk for non-compliance (15, 18). In the present study, transporting facilities were found limited in the post-earthquake period. We thought that relative-ly good transporting facilities in peri-earthquake period were the result of the efforts made by go-vernmental and nongovernmental organizations. This result led a speculation that an earthquake in a rural area might cause an impairment in the ma-nagement of chronic diseases by interrupting the transportation in long term.

Although the present study has not focused on the factors that influence the adherence of patients to TB therapy, no major changes were observed regarding socio-economical parameters that have an effect on the fate of TB.

Delivery of TB treatment, which patients sho-uld take for at least 6 months, is difficult in unsta-ble situations including civil wars and earthquakes. Furthermore, TB requires a longer commitment to treatment than do most acute medical conditions. Alexander showed that there were very few cases of increase in the incidence of communicable di-seases during earthquake period compared with

the rates for similar months in previous years and the incidence rate of TB did not appear to be signi-ficantly greater than in previous years in a study from Southern Italy (19).

Although the incidence rate for TB was not evaluated in the present study, we compared the aspects of the treatment of TB with some questi-ons. The rate for skipping treatment among three groups did not differ significantly in the present study. Most of the patients were diagnosed by pulmonologist and in hospital in pre, peri and post-earthquake periods. There was no differen-ce among groups according to the referring to dispensary and undergoing family screening for TB. Surprisingly, patients were controlled once a month- the advice of Turkish Tuberculosis Com-mittee- especially in peri-earthquake period. Even if hospitalization, despite the disruption of work and social life, appeared to enhance compliance of patients in some studies (20, 21) contrary to one (22), higher hospitalization rate in pre-earthquake period of Duzce was thought to be due to educa-tional priority rather than compliance of patients.

In conclusion, it can be stated that the earthqu-akes had very little impact on the TB during and after earthquakes in Duzce. Further studies inclu-ding whole Marmara region are needed to inter-pret the effect of earthquake on TB control.

References

1. Vahaboglu H, Gundes S, Karadenizli A, Mutlu B, Cetin S, Kolayli F, Coskunkan F, Dündar V. Transi-ent Increase in Diarrheal Diseases after the Deva-stating Earthquake in Kocaeli, Turkey: Results of an Infectious Disease Surveillance Study. Clinical Infectious Diseases 2001;31:1386–9.

2. Kokai M, Fujıı S, Shınfuku N, Edwards G. Natural disaster and mental health in Asia. Psychiatry and Clinical Neurosciences (2004), 58, 110–116.

3. McCaughrin WC, Mattammal M. Perfect Storm: Organizational Management of Patient Care Un-der Natural Disaster Conditions. Journal of Heal-thcare Management. 2003; 48: 295-308.

4. Domino ME, Fried B, Moon Y, OlinickJ, Yoon J. Disasters and the Public Health Safety Net: Hurri-cane Floyd Hits the North Carolina Medicaid Pro-gram. Am J Public Health 2003; 93: 1122-1127.



5. Keven K, Ateş K, Sever MS, Yenicesu M, Canba-kan B, Arınsoy T, Ozdemır N; Duranay M, Altun B, Erek E. Infectious Complications after Mass Disa-sters: The Marmara Earthquake Experience. Scand J Infect Dis 2003; 35: 110-113.

6. (World Health Organization (2005): Global Tuber-culosis Control. Surveillance, Planning, Financing. Communicable Diseases. 349, Geneva., Global tu-berculosis control: surveillance, planning, finan-cing. WHO report 2005. Geneva, World Health Or-ganization (WHO/HTM/TB/2005.349).sayfa 14).

7. Felissa R. Lashley, Factors contributing to the oc-currence of emerging infectious diseases. Biol Res Nurs. 2003 Apr;4(4):258-67.

8. Halpern P, Rosen B, Carasso S, Sorkine P, Wolf Y, Benedek P, Martinovich G. Intensive care in a field hospital in an urban disaster area: Lessons from the August 1999 earthquake in Turkey. Crit Care Med 2003; 31: 1410-1414.

9. Erek E, Sever MS, Serdengecti K, Vanholder R, Akoglu E, Yavuz M, et al. Turkish Study Group of Disaster. An overview of morbidity and mortality in patients with acute renal failure due to crush syn-drome: the Marmara earthquake experience. Nep-hrol Dial Transplant 2002; 17: 33-40.

10. Balbay O., Annakkaya A. N., Arbak P., Bilgin C., Erbas M. Which patients are able to adhere to tuberculosis treatment? A study in a rural area in the northwest part of Turkey. Jpn J Infect Dis. 2005 Jun;58(3):152-8.

11. Barnhoorn, F. and Adriaanse, H. (1992): In se-arch of factors responsible for noncompliance among tuberculosis patients in Wardha District, India. Soc. Sci. Med., 34, 291-306.

12. McDonnell, M., Turner, J. and Weaver MT. (2001): Antecedents of Adherence to Antitubercu-losis Therapy. Public. Health. Nurs., 18, 392-400.

13. Hovell, M., Blumberg, E., Gil-Trejo, L., Vera, A., Kelley, N., Sipan, C., Hofstetter, CR., Marshall, S., Berg, J., Friedman, L., Catanzaro, A. and Moser, K. (2003): Predictors of adherence to treatment for latent tuberculosis infection in high-risk La-tino adolescents: a behavioral epidemiological analysis. Soc. Sci. Med., 56, 1789-96.

14. Dick, J., Schoeman, JH., Mohammed, A. and Lombard C. (1996): Tuberculosis in the community:Evaluation of a volunteer health wor-ker programme to enhance adherence to anti-tu-berculosis treatment. Tuber. Lung. Dis., 77, 274-9.

15. Van Der Werf, TS., Dade, GK. and Van Der Mark, TW. (1990): Patient compliance with tuberculosis treatment in Ghana: factors influencing adheren-ce to therapy in a rural service programme. Tu-bercle., 71, 247-252.

16. Erhabor GE, Aghanwa HS, Yusuph M, Adebayo RA, Arogundade FA, Omidiora A. Factors influen-cing compliance in patients with tuberculosis on directly observed therapy at Ile-Ife, Nigeria. East Afr Med J. 2000 May;77(5):235-9.

17. Woersching JC, Snyder AE. Earthquakes in El Salvador: a descriptive study of health concerns in a rural community and the clinical implica-tions: Part III-Mental health and psychosocial effects. Disaster Manag Response. 2004 Apr-Jun;2(2):40-5.

18. Teklu D. Reasons for failure in treatment of pul-monary tuberculosis in Ethiophians. Tubercle 1984; 65: 17-21.

19. Alexander D. Disease Epidemiology and Ear-thquake Disaster: The Example of Southern Italy After The 23 November 1980 Earthquake. Soc. Sci. Med. 1982; 16: 1959-1969.

20. Menzies R, Rocher I, Vissandjee B. Factors asso-ciated with compliance in treatment of tuberculo-sis. Tubercle and Lung Disease 1993; 74: 32-37.

21. Kocabas A, Burgut R, Kibaroglu E, et al. Fate of smear positive pulmonary tuberculosis patients in Turkey. Tubercle Lung Dis 1995; 76 (Suppl 2): S79.

22. Chuah SY. Factors associated with poor patient compliance with antituberculosis therapy in Nor-thwest Perak, Malaysia. Tubercle. 1991; 72: 261-4.

Corresponding author Oner Balbay, Düzce University, School of Medicine, Department of Chest Diseases, Turkey, E-mail: [email protected]

596



Abstract

A 35-year-old male patient was admitted with the chief complaint of right abdominal pain wi-thout any reasons and was brought to an emer-gency room.Since abdominal contrast enhanced dual source computerized tomography (CT) sca-nning revealed a spherical hyperdense mass near the right-side renal hilum and its diameter was 8.5cm,be suspected as hematoma. However,after one month stayed in bed at home,the secondary contrast enhanced dual source computerized to-mography (CT) scanning revealed that the he-matoma was disappear and it became a bilateral ureteropelvic junction obstruction .Therefore, a Pyeloplasty was perfomed.This phenomenon was very interesting,and finally it was considered as autogenous hemorrhage of a ureteropelvic juncti-on hydronephrosis.

Introduction

UPJO often causes hydronephrosis,but hematu-ria, abdominal Pain and abdominal mass are not co-mmonly seen,especially autogenous hemorrhage.1-4

Case report

In nov.3 2009, a 35-year-old male patient was admitted with the chief complaint of right abdominal pain two days and with hematuria one day,without any reason,such as a history of trauma,anticoagulant use,dialysis,renal transplan-tation and so on.No flank mass was be found in Physical examination but a pressing pain was be found in right-side flank.

Contrast enhanced dual source computerized tomography (CT) sacn of the abdomen and the pelvis (Nov.3 2009) demosnstrated a 8.5-cm sp-herical mass without enhanced near the right-side renal hilum which be suspected as hematoma and right-side hydronephrosis because of compression of this mass (Figure 1-2).

Figure 1. Unenhaced CT shows a huge mass near the right-side kidney

Figure 2. Enhanced CT shows a huge mass near the right-side kindy without apparent enhanced,and no extensive extravasated contrast material surrounding the kidney

Perirenal hematoma became bilateral ureteropelvic junction obstruction after one month later:a case reportLuo Yang, Xiang Li, Kun Jie Wang

Department of Urology, West China Hospital of Sichuan University, China



The rasialogist could not give a accurate dia-gnosis and not reveal ureteral stricture or rupture sited in the ureteropelvic tract. Contrast enhanced color Doppler imaging (Nov.3 2009) revealed a 9-cm diameter of the right ureteral superior se-gment with a confused echo which was considered as hematoma, while it found left-side hydronep-hrosis without any reason, such as ureterostenosis, ureteric stone or others. The patient’s blood pre-ssure, heart rate and body temperature were nor-mal, while the hemoglobin was 85g/l and white blood cell was 8.83*10^9/l, red blood cell in urine was (++++) without white blood cell.

By these information, a accurate diagnosis co-uld not be made, a expectant treatment was perfor-med for this patient. Why there was a hematoma, where it came from and what the reason caused blooding? In order to exclud angioneoplasm and figure out the cause of disease and to make a clear dignosis, there were three suggestions for the pa-tient, the patient was advised to do magnetic reso-nance imaging (MRI) scan or digital subtraction angiography(DSA),or chosen a surgical explora-tion, or chosen expectant treatment and back to examine one month later. The patient chosen the last one, the secondary contrast enhanced dual so-urce computerized tomography (CT) scanning af-ter stayed in bed at home one month later revealed that the hematoma was disappear, and became a bilateral hydronephrosis which caused by uretero-pelvic junction obstruction (Figure 3).

Figure 3. The secondary Enhanced CT shows bi-lateral hydronephrosis, a stenosis can be seen site in the right-side ureter (white arrow)

The followed retrograde pyelography prefera-bly demosnstrated bilatera ureteropelvic junction obstruction and hydronephrosis with the right-side severely (Figure 4-5). Then a Pyeloplasty was per-fomed for the right-side first, and no other diease was found in the operation.

Figure 4. Retrograde pyelography shows bilate-ra ureteropelvic junction obstruction

Figure 5. Retrograde pyelography shows the right-side hydronephrosis and stenosis of uretero-pelvic junction

Discussion

Hemorrhage of a ureteropelvic junction hydro-nephrosis was rare been seen,and it was often with a history of abdominal trauma. 1-3Majority of the hemorrhage cases could find a rupture of the renal

598



pelvis in CT,but this case was not.According to the history and indications of the imagings, the hema-toma of this case was considered as spontaneous hemorrhage,this phenomenon was first seen in our hospital.Contrast-enhanced CT and Color Doppler Imaging have a high sensibility and specificity in the diagnosis of ureteropelvic junction obstruc-tion with or without rupture.5,6 Contrast-enhanced CT often obtained a depicts extensive extravasa-ted contrast material surrounding the kidney with ureteropelvic junction ruputure or urinoma.7But there were no extravasated contrast material and ureteral stricture find in Contrast-enhanced CT in this case,and no renal trauma or crossing vessels were found in both Contrast-enhanced CT and Co-lor Doppler Imaging,just a huge mass in there.Be-cause of the imagings were not characteristic and the attention was attracted by the mass,so excre-tory urography was not consider to perform and no accurate diagnosis was made at the first time of admission to hospital. Ureteropelvic junction dis-ruption secondary to blunt trauma continues to be diagnosed late in a large proportion of cases, ad-dition of delayed CT of the kidney 5 to 8 minutes or longer after contrast material injection (during the excretory phase) may increase the probabili-ty of extravasation being demonstrated and, thus, reduce the possibility of missing a ureteropelvic junction disruption,and some missed diagnosed cases could be provided the correct diagnosis by the intravenous pyelography.8In order to reduce the possibility of missing a ureteropelvic juncti-on stenosis,a additional intravenous pyelography or retrograde pyelography should be considered performing when Contrast-enhanced CT and Co-lor Doppler Imaging could not provide a acurrate diagnosis,such as there was a hematoma near the renal hilum with unknown aetiology and without a history of blunt tramua or renal pelivs rupture.If all the imageings can not provide a acurrate diagnosis,it also can perform a laparoscopy.6If there are no condition to do those, strictly watch for waiting also is a choice although it will delay in providing the diagnosis.

References

1. Obara, W. Ohuchi, A. Sugimura, J. Tokunaga, H. Tanji, S. Fujioka, T.A case of congenital hydronep-hrosis suffering from rupture of the renal pelvis due to trauma. Hinyokika Kiyo - Acta Urologica Japo-nica2001;47(6):425-7.

2. Ashebu SD, Dahniya MH, Aduh P, Ramadan S, Bo-paiah H, Elshebiny YH.Rupture of the renal pelvis of a ureteropelvic junction hydronephrosis after blunt abdominal trauma. Australasian Radiology 2004; 48(2):256-8.

3. Sebastia, M C. Rodriguez-Dobao, M. Quiroga, S. Pallisa, E. Martinez-Rodriguez, M. Alvarez-Ca-stells, A. Renal trauma in occult ureteropelvic jun-ction obstruction: CT findings. European Radiolo-gy 1999; 9(4):611-5.

4. Frederick A.Gulmi,Diane Felsen,E.Darracott Vau-ghan Jr.Pathophysiology of Urinary Tract Obstruc-tion. Campbell’s urology.(8th ed).Philadelphia, Sa-unders, 2002; 411.

5. ELNahas A.,Abo EL-Ghar M.,Shoma A.,Eraky I.,EL-Kenawy M.,EL-Kappany H.Role of multip-hasic helical CT in planning surgical treatment of ureteropelvic junction obstruction.European Uro-logy Supplements 2003;2(1):145.

6. Michael Mitterberger, Germar M.Pinggera, Richard Neururer et al. Comparison of Contrast-Enhanced Color Doppler Imaging (CDI), Com-puted Tomography(CT),and Magnetic Resonance Imaging (MRI) for the Detection of Crossing Vessels in Patients with Ureteropelvic Junction Obstructi-on (UPJO). European Urology 2008;53:254-262.

7. Akira Kawashima, MD.Carl M.Sandler, MD.Joseph N. Corriere, Jr, MD.Brian M.Rodgers, MD. Stan-ford M.Goldman Ureteropelvic Junction Injuries Secondary to Blunt Abdominal Trauma. Radiology 1997; 205: 487-492.

8. Mulligan JM, Cagiannos I, Collins JP, Millward SF. Ureteropelvic junction disruption secondary to blunt trauma: Excretory phase imaging (delayed films) should help prevent a missed diagnosis. Jo-urnal of Urology1998, 159 (1): 67-70.

Corresponding author Kun Jie Wang, Department of Urology, West China Hospital of Sichuan University, China, E-mail: [email protected]



Abstract

Introduction: Alcoholic polyneuropathy (AP) is relatively common among alcoholics. Disulfi-ram polyneuropathy (DP), since 1948. year (when this therapy was introduced in alcoholics trea-tment), was relatively rare registered in alcoholi-cs. AP and DP together are classified in a group of toxic neuropathies, but the electromyoneurograp-hic (EMNG) differentiation between them was not precisely defined yet.

Aims of research: To compare EMNG findin-gs in two similar age groups of patients with AP and DP and to define differences between them.

Patients and methods: We analysed EMNG of 60 patients with AP, average age 42.2 (42.2±8.9) years, and 20 patients with DP, average age 39.3 (39.3±9.4) years. All 20 patients with DP had EMNG examination before disulfiram treatment onset and no signs of neuropathy were registered. Patients in both groups (with AP and DP) were males. For electroneurografic (ENG) examinati-on we used surface electrodes, and we registered motor (MCV) and sensory conduction velocities (SCV) values (in m/s) of peroneal (PN) and tibi-al nerves (TN), their distal latencies (DL-PN and DL-TN) values (in ms) and minimal F-wave (F-PN and F-TN) latencies (in ms) after 40 repetiti-ve stimulations of those nerves. SCV of PN and TN was determined by antidromic techique. Af-ter ENG examination, electromyographic (EMG) examination of legs muscles, with coaxiale needle

electrodes was performed. We used t-test and Pe-arson bivariate correlation (sig. 2-tailed) for stati-stical analysis.

Results: In 14/60 (23.33%) patients with AP and 20/20 (100%) patients with DP we registe-red signs of denervation activity (fibrillations, positive denervation waves etc.) in feet musc-les. In 4/60 (6.67%) patients with AP and 5/20 (25%) patients with DP we registered motor and/or sensory nerve impulse conduction absence in distal segments of PN and/or TN. DL-PN, DL-TN and F-PN values were statistically significant higher in patients with DP versus AP (p<0.001), but MCV-PN, SCV-PN, MCV-TN and SCV-TN values were statistically significant lower in pa-tients with DP versus AP (p<0.001). Correla-tion between MCV-TN and F-TN values, and between MCV-PN and F-PN values was statisti-cally significant (p<0.001) only in patients with AP, but not in patients with DP.

Conclusion: We registered electrophysiological signs of severe lesions of PN and TN motor and sensory axons in majority of patients with DP, and signs of denervation activity in feet muscles in all analyzed patients with DP, what is about four times more frequent in patients with DP versus AP. Signs of nerve impulse conduction absence in distal parts of PN and/or TN we registered in one fourth of analyzed patients with DP, what is about four times more frequent than in patients with AP. Different EMNG findings in patients with DP and AP indica-te that those forms of neuropathy represent different

Comparative analysis of Electromyoneurographic findings in Alcoholic and Disulfiram PolyneuropathyZoran Peric1, 2, Irina Stojanovic3, Gordana Manic4

1 Department of Neurology, Medical Faculty University of Niš, Serbia,2 Clinic for neurology, Clinical Centre of Niš, Serbia,3 Clinic for mental health protection, Clinical Centre of Niš, Serbia,4 Faculty of health studies, University of Sarajevo, Bosnia and Herzegovina.

600



subtypes of axonopathy, DP- distal axonopathy and AP- chronic sensorimotor axonal neuropathy.

Key words: alcohol, disulfiram, polyneuropat-hy, electromyoneurography

Introduction

Alcoholic polyneuropathy (AP) is relatively co-mmon among alcoholics and the incidence ranges from 9% to 30% among hospitalized alcoholics, and up to 90% of ambulatory alcoholics who have electrodiagnostic evidence of neuropathy (1). Disul-firam polyneuropathy (DP), since 1948. year (when this therapy was introduced in alcoholics treatment), was relatively rare registered in alcoholics. AP and DP together are classified in a group of toxic neuro-pathies, AP secondary to alcohol abuse and DP se-cundary to drug use/ iatrogenic neuropathy (2), but the electromyoneurographic (EMNG) differentiati-on between them was not precisely defined yet. In li-terature there are many articles about characteristics of EMNG findings at alcoholics with AP (3, 4) and mainly casuistic cases reports with presentations of DP development in alcoholics who used disulfiram (5, 6). We didn’t find article in literature about com-parative analysis of EMNG findings in AP and DP. In our previous research with different study con-cept and smaller group of patients we initiated this problem (7). It is important to consider EMNG cha-racteristics of AP and DP, because cessation of trea-tment with disulfiram is needed in patients with DP.

Objective of the study

We analysed two similar age (with no signifi-cant difference) groups of patients with AP and DP. The aim of this study is to compare EMNG findings and to define differences between them.

Methods

We analysed EMNG of 60 patients with AP, average age 42,2 (42,2±8,9) years, and 20 pati-ents with DP, average age 39,3 (39,3±9,4) years. All 20 patients with DP had EMNG examination before disulfiram treatment onset and no signs

of neuropathy were registered. Patients in both groups (with AP and DP) were males. For elec-troneurografic (ENG) examination we used sur-face electrode, and we registered motor (MCV) and sensory conduction velocities (SCV) values (in m/s) of peroneal (PN) and tibial nerves (TN), their distal latencies (DL-NP and DL-NT) values (in ms) and minimal F-wave (F-PN and F-TN) la-tencies (in ms) after 40 repetitive stimulations of those nerves, using standardised methods (1, 8, 9). SCV of PN and TN was determined by antidromic techique. After ENG examination, electromyo-graphic (EMG) examination of legs muscles, with coaxiale needle electrodes, was performed; feet skin temperature was maintained at 320 C. From this study we excluded all patients with diabetes, uremia, systemic illness and on medicament tre-tment with drugs which can cause neuropathy.

Statistical evaluation

We evaluated registered data by statistical anal-ysis using the computer program SPSS. We used t-test and Pearson bivariate correlation (sig. 2-tailed). All tests and analyses are considered statistically significant on the level of significance of p<0.05. Results we obtained will be presented on the tables.

Results

1. Frequency (%) of denervation activity in feet muscles

In 14/60 (23.33%) patients with AP and 20/20 (100%) patients with DP we registered signs of denervation activity (fibrillations, positive dener-vation waves etc.) in feet muscles.

2. Frequency (%) of motor and/or sensory nerve impulse conduction absence in distal segments of PN and/or TN

In 4/60 (6.67%) patients with AP and 5/20 (25%) patients with DP we registered motor and/or sensory nerve impulse conduction absence in distal segments of PN and/or TN.



Table 1. The mean values (X±SD) of analysed electrophysiologic parameters

Num-ber

Patients(numberanalysed)

Nerve(numberanalysed)

Electro-physiologicalparameters

Alcoholic polyneuro-

pathy(X±SD)

Patients(numberanalysed)

Nerve(numberanalysed)

Disulfiram Poly-

neuropathy(X±SD)

p

1. 60 Peroneal 20 Peroneal92 DL-PN 4.56±1.19 28 5.29±1.43 <0.001***112 MCV-PN 41.95±5.93 28 38.83±7.03 <0.001***50 F-PN 56.64±6.81 6 62.07±10.16 <0.001***38 SCV-PN 37.65±4.05 19 33.74±6.26 <0.001***

2. Tibial Tibial111 DL-TN 5.85±2.08 27 7.89±3.07 <0.001***112 MCV-TN 40.19±5.65 28 37.57±5.30 <0.001***64 F-TN 61.86±8.58 22 57.27±2.39 <0.001***107 SCV-TN 37.49±5.48 25 31.39±6.88 <0.001***

nss = not statistical significant, * = p<0.05, ** = p<0.01, ***= p<0.001 DL-PN - distal latency registered after stimulation of PNMCV-PN - motor conduction velocity of PNF-PN - F-wave registered after stimulation of PN SCV-PN - sensory conduction velocity of PN DL-TN - distal latency registered after stimulation of TN MCV-TN- motor conduction velocity of TN F-TN - F-wave registered after stimulation of TN SCV-TN- sensory conduction velocity of TN

Table 2. Pearson correlation (r) (sig. 2.-tailed) between MCV-PN and MCV-TN with other analysed electrophysiological parameters

Nu-mber

Electrophysio-logical

parameter

Electrophysio-logical

parameterr

Alcoholic polyneuropathy

(p)r

Disulfiram polyneuropathy

(p)1. MCV-PN DL-PN -0.31 0.02* -0.46 0.018*

SCV-PN +0.48 0.02* +0.81 <0.001***F-PN -0.65 <0.001*** nssDL-TN -0.32 0.016* nssMCV-TN +0.53 0.001** +0.62 0.004**F-TN -0.52 <0.001*** nssSCV-TN +0.30 0.049* nss

2. MCV-TN DL-TN -0.43 <0.001*** nssSCV-TN +0.51 <0.001*** nss F-TN -0.68 <0.001*** nssSCV-PN nss +0.80 <0.001***DL-PN nss nssF-PN -0.65 <0.001*** nss

nss = not statistical significant, * = p<0.05, ** = p<0.01, ***= p<0.001 DL-PN - distal latency registered after stimulation of PNMCV-PN - motor conduction velocity of PNF-PN - F-wave registered after stimulation of PN SCV-PN - sensory conduction velocity of PN DL-TN - distal latency registered after stimulation of TN MCV-TN- motor conduction velocity of TN F-TN - F-wave registered after stimulation of TN SCV-TN- sensory conduction velocity of TN

602



3. The mean values (X±SD) of analysed electrophysiologic parameters

DL-PN, DL-TN and F-PN values were statisti-cally significant higher in patients with DP versus AP (p<0.001), but MCV-PN, SCV-PN, MCV-TN and SCV-TN values were statistically significant lower in patients with DP versus AP (p<0.001).

4. Pearson correlation (r) (sig. 2-tailed) between electrophysiologic parameters in patients with AP and DP

The correlation between MCV-PN and DL-PN values was statistically significant in patients with AP (p=0.002) and DP (p=0.018), it was also sta-tistically significant between MCV-PN and F-PN values in patients with AP (p<0.001) and between MCV-PN and SCV-PN values in patients with DP (p=0.023). Correlation between MCV-TN values and DL-TN, F-TN and SCV-TN values was stati-stically significant (p<0.001) only in patients with AP, but not in patients with DP.

Discussion

We registered in all analyzed patients with DP signs of denervation activity in feet muscles. It is about four times more frequent than in patients with AP. We maintained feet skin temperature at 320 C and that is important because with temperature re-duction fibrillations could be reduced and disappe-ar. Temperature also has influence on amplitude of sensory nerve potential and compound muscle (motor) potential, and their reduction is basic fin-ding in axonal neuropathy. We registered amplitude reduction of sensory nerve and compound musc-le potentials in all analyzed patients according to expectations, but we didn’t present those results in this paper. Fibrillation potentials typically develop within 2-3 weeks of an acute axonal neuropathy (1), and in chronic axonal neuropathy that reflects acti-vity of pathological process.

We registered signs of nerve impulse conduc-tion absence in distal parts of peroneal and tibi-al nerves in one fourth of analyzed patients with DP, what is about four times more frequent than

in patients with AP. Some authors classified DP in group of predominantly motor axonal neuropathy and AP in group of sensorimotor axonal polyneu-ropathy. Disulfiram treatment is associated with a progressive, predominantly motor neuropathy and onset of weakness is sometimes abrupt and mimics Guillain-Barre syndrome. In those cases the elec-trodiagnostic findings may be indistinguishable from those of the axonal form of Guillain-Barre syndrome (8). Alcohol related chronic axonal po-lyneuropathy is a well known, but alcohol related acute axonal polyneuropathy is less well recogni-zed. Some autors described 5 chronic alcoholics who developed ascending flaccid tetraparesis and areflexia within 14 days and it’s distinction from Guillain- Barre syndrome is important because of the necessity for different management (10).

Our ENG findings in patients with DP and AP are very interesting. We registered more prolon-ged DL and more reduced MCV and SCV values of PN and TN in patients with DN versus AP, and this finding is not typical for axonopathy. Some authors described mild MCV slowing as one of the characteristic findings in DP (11). We explain our findings by large diameter motor and sensory axons loss in those forms of neuropathy, which is more pronounced in DP. Results of sural nerve morphometric study in a patients with DP indica-ted preferentially loss of large myelinated fibres with degeneration of unmyelinated fibres too. Same authors described also a signs of segmental demyelination and remyelination (12), but others showed scattered focal perinuclear neutral lipid deposits in sural nerve biopsy finding without evi-dence of demyelination (5).

Our correlation study of ENG parameters in-dicated significant correlation between MCV-PN and F-PN values and between MCV-TN and F-TN values in patients with AP, but not in patients with DP. This indicates slowing down of nerve impulse conduction along the whole length of PN and TN fibers in AP. Electrophysiological findings in DP indicated predominantly distal distribution of pat-hological changes. Some authors classified DP in a group of toxic neuropathy presenting as a motor or motor greater than sensory neuropathy, witho-ut conduction slowing and AP in a group of toxic neuropathy presenting as a sensory neuropathy or neuronopathy, without conduction slowing (13),



but our EMNG finding in patients with DP and AP don’t support some aspects of this classification. Also, classifying DP in a group of predominantly sensory neuropathy (2) does not correspond with our EMNG findings.

Conclusion

1. We registered electrophysiological signs of severe lesions of motor and sensory axons of peroneal and tibial nerves in majority of patients with DP, and signs of denervation activity in feet muscles in all analysed patients with DP.

2. We registered signs of denervation activity (fibrillations, positive denervation waves ect.) in feet muscles about four times more frequent in patients with DP versus AP.

3. Signs of nerve impulse conduction absence in distal parts of peroneal and/or tibial nerves, we registered in one fourth of analysed patients with DP, what is about four times more frequent than in patients with AP.

4. Different EMNG findings in patients with DP and AP indicate that those forms of neuropathy represent different subtypes of axonopathy, DP- distal axonopathy and AP- chronic sensorimotor axonal neuropathy.

References

1. Bashar K. Electromyography in clinical practice. Mosby – Elsevier, Philadelphia, 2007: 387-396.

2. Grogan MP, Katz SJ. Toxic Neuropathies. Neurol Clin 2005; 23: 377-396.

3. Perić Z., Vukašinović P, Disić V. Correlation as-pects of cerebral atrophy and polyneuropathy in toxicomanic alcoholism. Acta Medica Medianae 1987; 4: 67-77.

4. Monforte R, Estruch R, Valls-Sole et al. Autonomic and Peripheral Neuropathies in patients with Chro-nic Alcoholism. Ann Neurol 1995; 52: 45-51.

5. Olney KR, Miller GR. Peripheral neuropat-hy associated with disulfiram administration. Muscle&Nerve 1980; 3:172-175.

6. Dupuy O, Flocard F, Vital C et al. Toxicite du dis-ulfirame (EsperalR). A propos de trois observations originales. Rev Med Interne 1995; 16: 67-72.

7. Perić Z., Živković M, Spasić M. Electrophysiologi-cal differentiation of alcohol and disulfiram polyne-uropathy. Acta Medica Medianae 1995; 5: 11-21.

8. Aminoff M. Electrodiagnosis in clinical neurolo-gy. Elsevier – Churchill Livingstone, Philadelphia, 2005: 781-811.

9. Perić Z. Clinical Electromyoneurography. Prosve-ta, Niš, 2003: 1-340 (in serbian).

10. Wohrle CJ, Spengos K, Streinke W et al. Alcohol- Related Acute Axonal Polyneuropathy. Arch Neu-rol 1998; 55: 1329-1335.

11. Herskovitz S, Scelsa NS, Schaumburg HH. Pe-ripheral neuropathies in clinical practice. Oxford University Press, New York, 2010: 171-300.

12. Nukada H, Pollock M. Disulfiram neuropathy-A morphometric Study of Sural Nerve. J Neurol Sci 1981; 51: 51-67.

13. Albers WJ, Teener WJ. Toxic neuropathies. In: Handbook of Clinical Neurophysiology. vol. 7. Peripheral Nerve Diseases. Kimura J. (Ed), Else-vier, Amsterdam, 2006: 669-694.

Corresponding author Zoran Peric, Department of Neurology, Medical Faculty University of Niš, Serbia, E-mail: [email protected]

604



Abstract

Introduction: Amoebiasis is an acute or chro-nic disease characterized by a clinical range of asymptomatic to symptomatic extraintestinal le-sions of distant organs and tissues, caused by the protozoa Entamoeba histolytica. It is primarily localized in colon (intestinal amoebiasis), and se-condarily, it is localized in other organs (extraco-lonial amoebiasis) – in lungs, liver (amoebic hepa-titis), brains, spleen, skin. Amoebiasis is one of the most frequent protozoan infections, which mostly occurs in areas characterized by poor sanitary cir-cumstances. It occurs as a consequence of redu-ced natural resistance of organism, since protozoa exist as commensals in colon lumen, or they are transmitted by fecal-oral route or by contaminati-on of hands, food and water. It has been debated for years that protozoa include two genetically and biologically distinct species; a pathogenic one, E. Histolytica, and the other, nonpathogenic species, E. dispar. The first one is pathogenic, causing both intestinal and extraintestinal defects (mostly in li-ver), while the other one is a commensal in human organism and does not cause any kind of defects or symptoms.

Material and methods: Results of parasitolo-gical examination of 304 stool samples collected from 234 individuals in the period 01/01/2008 – 12/31/2008 at the Microbiological Laboratory of the Public Health Institute in Sarajevo Canton are presented in this paper.

Results: Cystic form was found in a total of 166 (54.6%) of microscopically examined sam-

ples. Vegetative form was found in a total of 234 microscopically examined stool samples. Ve-getative form of E. histolytica was found in 161 (68.8%) samples, while vegetative form of E. hi-stolytica with ingested erythrocytes was found in 73 (31.2%) samples.

Conclusions: Results confirm the existence of cyst-bearing E. histolytica and indicate the impor-tance of preventive actions that imply improve-ment of sanitary conditions of living and nutrition, in order to thus reduce the possibility of cysts tran-smitting as infective forms of E. histolytica.

Key words: Entamoeba histolytica, vegetative form, cystic form, cyst-bearer.

1. Introduction

E. histolytica is the only species of amoebas that is potentially pathogenic for humans, who represent a primary reservoir of histolytic amoe-bas. Asymptomatic parasite-bearers are the main source of the infection. It has been recently pro-ven by molecular biology methods that the amo-eba that was being morphologically identified as E. histolytica for years actually represents two bi-ochemically and molecularly completely distinct, stable species. Two species of zymodemes were identified by electrophoresis of several glycolitic enzymes. Zymodeme is defined as a population of amoebas that has specific enzymes different than a similar population of amoebas and represents a stable genetic feature. Pathogenic zymodeme is one of them, found in all invasive isolates and de-

Microscoping method in microbiological diagnostic of amoebiasis and cyst-bearing Entamoeba histolyticaSadeta Hamzic, Edina Beslagic, Ines Rodinis-Pejic, Fadila Avdic-Kamberovic

Medical Faculty of the University of Sarajevo, Bosnia and Heregovina,Public Health Institute of Sarajevo Canton, Bosnia and Heregovina.



fined as the species E. histolytica. It is potential causal agent of amoebic colitis and extraintestinal amoebiasis. The other zymodeme is nonpathoge-nic, found in noninvasive isolates and defined as the species E. dispar (1, 2).

Entamoeba histolytica occurs in 2 forms: vege-tative form (trophozoit) and cystic form. It moves using pseudopodia (fake legs) that are formed as endoplasm flows towards ectoplasm. External part of Entamoeba histolytica is made of ectoplasm that ensures breathing, nutrition and movement, while the internal part is represented by endoplasm that ensures digestion, which is proven by residues of undigested glucose (3). Amoeboid trophozoit is the only form that exists in tissues. It is also found in liquid stool in case of amoebic dysentery. Cysts exist only in colon lumen and in soft or solid stool. Cyst represents a transient form of protozoa and occurs in unfavorable conditions, such as the loss of water in distal parts of colon. Cysts are excreted into outer environment through feces (4, 5).

Humans are infected with cysts by oral route. Incubation is quite long, 3 to 6 weeks, sometimes even longer. Disease starts with pains in abdomen, fatigue, loss of appetite, meteorism and irregular stools (diarrhea followed by opstipation or vice-versa). Temperature is usually not increased. Sto-ols are soft, foul-smelling, with traces of mucus and blood. Infected person increasingly manife-sts general disorders (paleness, exhaustion, loss of weight and apathy). Disease tends to become chronic, getting worse occasionally, which can last for months (6).

The aim of the treatment of amoebiasis is to cure the invasive form of disease and to comple-tely eradicate amoeba from colon. Anti-amoebic medications vary according to the site of action; there are either luminal or tissue amoebicides. Lu-minal amoebicides affect trophozoits in intestinal lumen and on the mucous surface, while the tissue amoebicides actively affect the tissues, including intestinal wall. Luminal amoebicides meet the requirements for treatment of amoebic colitis and cyst-bearing. Beside the medications, the therapy of amoebiasis implies diet nutrition, as well as compensation for water and electrolytes in acute forms of intestinal amoebiasis (7).

2. Material and methods

Results of parasitological examination of 304 stool samples collected from 234 individuals in the period 01/01/2008 – 12/31/2008 at the Micro-biological Laboratory of the Public Health Institu-te in Sarajevo Canton are presented in this paper.

Microbiological diagnosis of amoebiasis was established by finding of vegetative or cystic forms of E. histolytica in stool. Bloody-mucous part of the stool is emulgated in physiological solution for mi-croscopic examination of native preparation. A drop of the sample prepared is then put on the microscope slide, covered with a slip and microscopically exa-mined under the middle magnification. Vegetative forms of amoebas are searched for. Amoebic mo-tions are the most active at 37oC. This temperature is achieved in an adequate chamber or by putting the microscope near a heat source. E. histolytica usually moves fast across the field of view, while nonpathogenic amoebas are quite inert. Staining the stool preparations with Lugol makes it possible to find amoebic cysts more easily. Stool is emulgated in physiological solution, a drop of the emulsion is put on the microscope slide and a drop of Lugol’s solution is added. The preparation is covered with a slip and microscopically examined. Under the middle magnification on microscope, no more than four nuclei can be seen in E. histolytica cyst.

3. Results

In the period 01/01/2008 – 12/31/2008, a total of 304 stool samples collected from 234 tested in-dividuals were parasitologically examined at the Microbiological Laboratory of the Public Health Institute in Sarajevo Canton.

Out of a total of 234 examined individuals with confirmed amoebic infection, there were 111 (47.4%) women and 123 (52.6%) men. (Table 1 and Chart 1)Table 1. Gender structure of individuals examined

GenderIndividuals examined

Number %Female 111 47.4Male 123 52.6Total: 234 100.0

606



Chart 1. Gender structure ratio of individuals examined

Results of the presence of the cyst-bearing, po-tentially pathogenic form of E. histolytica in rela-tion to the overall sample tested are presented in the Table 2 and Chart 2. It is evident that positive finding of cyst-bearers was found in 166 (54.6%) samples.Table 2. Results of the presence of cyst-bearing E. histolytica in relation to the overall sample tested

Results of the finding of E. histolytica cystic form

Individuals examinedNumber %

Positive 166 54.6Negative 138 45.4

Total: 304 100.0

Chart 2. Ratio of the presence of cyst-bearing E. histolytica

Vegetative form was found by microscopic examination in a total of 234 stool samples. Ve-getative form of E. histolytica was detected in 161 (68.8%) samples, while vegetative form of E. hi-stolytica with ingested erythrocytes was found in 73 (31.2%) samples. (Table 3)Table 3. Results of detection of vegetative forms of E. histolytica

Species Number %E. histolytica 161 68.8

E. histolytica with ingested erythrocytes 73 31.2

Total: 234 100.0

Results of examination of intestinal flora in the individuals tested suggest that intestinal flora was normal in 139 (47.8%) findings and reduced in 152 (52.2%) findings. (Table 4) Table 4. Overview of results of the analysis of in-testinal flora in the individuals examined

Intestinal floraIndividuals examined

Number %Normal 139 47.8Reduced 152 52.2

Total: 291 100.0

Results of analysis of the presence of free and ingested erythrocytes suggest that free erythro-cytes were present in 159 (98.8%) tested samples, while the ingested ones were present in 2 (1.2%) samples. (Table 5)Table 5. Results of analysis of the presence of free and ingested erythrocytes

ErythrocytesIndividuals examinedNumber %

Free 159 98.8Ingested 2 1.2

Total: 161 100.0

4. Discussion

Entamoeba histolytica causes 50 million infec-tions all over the world and leads to 100 000 death cases per year (8).

Asymptomatic carrier state is a consequence of infections with histolytic amoeba in 90-99% of in-fected individuals. Beside the epidemiological im-portance, it also implies the importance for bearers themselves, since cyst-bearing can be transformed into invasive disease under certain conditions. In most of the infection cases, amoebiasis is a Third World disease that occurs in the population with low socio-economic standard, living in poor sani-tary conditions. Despite this fact, various studies carried out all over the world have suggested that amoebiasis is also a disease of developed coun-tries of the world. The infection is transmitted by fecal-oral route, usually by food, contaminated water, vegetables, with the possibility of transmi-tting by direct contact as well. Humans are infec-ted by cysts that form trophozoits colonizing the



intestinal mucus and causing the symptoms usu-ally manifested in stomach pains, flatulence, loss of appetite, with several soft stools per day, which contain traces of mucus.

During the World’s Water Fair in Chicago in 1933, over 1200 individuals suffering from amo-ebiasis were registered; 58 cases led to lethal results. Contaminated drinking water from the sewage network caused the occurrence of amoe-biasis (9). In 1988, 46 tourists from Great Britain and France were infected with amoebiasis in Ca-iro. The tourists got the infection by consuming the water from public water-supply in a hotel they stayed in during their vacation, since nobody re-commended them to purchase bottled water (10).

Results of parasitological examination of 304 stool samples are presented in our paper. Positive finding of cyst-bearing Entamoeba histolytica was confirmed in 166 (54.6%) cases. Out of a total of 234 examined individuals with confirmed amoe-bic infection, there were 111 (47.4%) women and 123 (52.6%) men. Vegetative form was found by microscopic examination in a total of 234 stool samples. Vegetative form of E. histolytica was detected in 161 (68.8%) samples, while vegeta-tive form of E. histolytica with ingested erythro-cytes was found in 73 (31.2%) samples. Results of examination of intestinal flora in the individuals tested suggest that intestinal flora was normal in 139 (47.8%) findings and reduced in 152 (52.2%) findings. Results of analysis of the presence of free and ingested erythrocytes suggest that free erythrocytes were present in 159 (98.8%) tested samples, while the ingested ones were present in 2 (1.2%) samples.

The study that was carried out in the period from January 2007 to December 2007 at Bahaud-din Zakariya University in Pakistan suggests that 295 of 1360 examined individuals were infected with E. histolytica, with the prevalence of 21.69%. The study suggested that there were more men in-fected (22.36%) than women (20.9%). The study also suggested that the infection was more frequ-ent in the group aged 1 to 15, with the prevalence of 30.82%, compared to the group aged 31 to 45, with the prevalence 17.34% (11).

In North Africa, the province of Limpopo, the frequency of occurrence of E. histolytica was stu-died among 257 HIV-positive patients and 117

HIV-negative patients, using ELISA test. Out of 374 individuals, 34% (36.1% of women and 28.1% of men) were seropositive to E. histolytica. The most of seropositive patients were registered in the group aged 50 – 59, with the prevalence of 69.2%. The presence of amoebic infection was hi-gher in HIV-positive patients (42.8%), compared to HIV-negative patients (14.5%) (12).

In the ten-year study (1999 – 2009) carried out at the UMMC (University Malaya Medical Cen-ter), Kuala Lumpur, Malaysia, the sample invol-ved 34 individuals. Liver abscess was registered in 22 (64%) individuals, while the remaining 12 (35%) individuals suffered from amoebic dysen-tery. More men were infected than women, 24 (71%). Most of the individuals belonged to the group aged 40 – 49, 8 (23%) were aged 60 or ol-der than 60, while 20 (60%) individuals belonged to the population aged 20 – 50. After an adequate medicamentous treatment, all patients recovered, except for a 69-year-old patient, who deceased be-cause of consequences of the liver abscess (13).

The results of our study confirm the existence of cyst-bearing Entamoebae histolytica and indi-cate the importance of preventive actions that im-ply improvement of sanitary conditions of living and nutrition, in order to thus reduce the possibi-lity of cysts transmitting as infective forms of E. histolytica.

5. Conclusions

1. Out of a total of 234 examined individuals with confirmed amoebic infection, there were 123 (52.6%) men and 111 (47.4%) women.

2. Out of a total of 304 stool samples examined, the presence of cystic form of Entamoeba histolytica was confirmed in 166 (54.6%).

3. Vegetative form of E. histolytica was detected in 161 (68.8%) samples, while vegetative form of E. histolytica with ingested erythrocytes was found in 73 (31.2%) samples.

4. Intestinal flora was normal in 139 (47.8%) cases and reduced in 152 (52.2%) cases.

5. Free erythrocytes were present in 159

608



(98.8%) cases and the ingested ones were present in 2 (1.2%) cases.

6. Results of the study confirm the existence of cyst-bearing Entamoeba histolytica and indicate the need and importance of preventive actions.

6. References

1. Charles R., Sterling M., Rodney D., Adam K. The Pathogenic Enteric Protozoa- Whorld Class Pa-rasites, Clinic for Enteric Diseases Boston USA 2005; 2:275-276.

2. Uzunović-Kamberović Selma. Medical Microbiolo-gy, Zenica, 2009:1035-1038.

3. Bešlagić Edina et al. Medical Microbiology. Medi-cal Faculty of the University of Sarajevo, Sarajevo, 2010:362-366.

4. Monica Cheesbrongh. Diagnosis of Entamoeba histolytica. Medical manual for tropical diseases, WHO/ICT Cambridge Institute UK, Third Edition 1991; 14:467-478.

5. Abram S. Control of Communicable Diseases in Man. American Public Health Association 1995; 4:154-157.

6. Pinjo F., Mehanić S., Hadžiosmanović V., Topalović J. Intestinal amoebiasis in pre-war, war and post-war period. The 2nd Congress of Infectologists in B&H with international participation, Acta Medica Saliniana, 2002; Vol31 (Supplement):1-166.

7. Petterson L. Amoebic Dysentery. Division of Para-site Diseases. National Center for Zoonotic, Vec-tor-Borne and Enteric Diseases, Washington, 2001; 12:178-189.

8. Ramos F, P. Moran, E. Gonzales, G. Gracia, M. Ra-miro, A. Gomez, C. de Leon Mdel, E. I. Melendro, A. Valadez. Entamoeba histolytica and Entamoeba dispar: prevalence infection in a highly endemic rural population. Exp. Parazitol, 2005.

9. Korletz BI-When We Should Look for Amoebae in Patients with Inflammatory Bowel Disease? Infla-mmatory Bowel Diseases – Public Health Institute Cambridge 1989; 4(1):178-181.

10. LS Diamond Clark CG. Amebiasis – The Journal of Microbiology – Clinic for Gastroenterology Harlow University 2002; 14:96-111.

11. www.ncbi.nlm.nih.gov/pubmed/2056645



Corresponding author Sadeta Hamzic, Medical Faculty of the University of Sarajevo, Bosnia and Herzegovina, E-mail: [email protected]



Abstract

Objective: The study was conducted in order to detect the relationship between being exposed to mobbing and levels of assertiveness.

Methods: The study was conducted as a des-criptive study. It was conducted in Erzurum Re-gional Education and Research Hospital and Ata-türk University Faculty of Medicine Yakutiye Re-search Hospital between the dates of 15 February 2010 and 30 April 2010. 218 nurses who accepted to be involved in the study were got into contact. In the collection of data, survey form which deter-mines socio-demographic features; Rathus Inven-tory of Self-assertive (RAE) and Mobbing Scale which we have developed for nurses were used. Percentage distribution, averages, Pearson corre-lation analysis, cronbach alpha coefficient were used in the evaluation of data.

Results: 17.4% of those who have participated in the research and got above 204 score are detec-ted to have been exposed to mobbing according to mobbing scale. 54.1% of them were detected to be passive according to Rathus Assertiveness Inven-tory. There is a negative relationship between Mo-bbing scale and assertiveness inventory (p<0.01). As the assertiveness level increase the rate of be-ing exposed to mobbing decrease.

Conclusions: As a result, it was found out that the possibility of nurses being exposed to mobbing is high and the real reason for their being exposed to mobbing is their passive behavior. It is sugge-sted that institutional awareness should be raised; the problem experienced in the institution should be revealed and nurses should be given education about assertiveness and communication skills.

Key words : Mobbing, Assertiveness, Nurse

Introduction

The term “mobbing” is defined as the presen-ce of unethical and antagonistic behavior appli-ed on a person by one or more individuals [1,2]. According to Leymann, psychological violence is a psycho-terror. It can be caused by disaccord of thought and belief, jealousy and gender discrimi-nation and means threatening, bullying and intimi-dation [3,4]. It is accepted that mobbing is experi-enced nearly in every workplace in the world [5]. Mobbing which is one of the most important rea-sons of decrease in performance and failure today is observed in many public and private foundati-ons in the World and in Turkey [6].

It was detected that mobbing events are related with job satisfaction, performance and permanency [7]. The aim of mobbing is to urge people to quit working creating systematic pressure on employers and eliminating their performance and strength power with unethical behavior. Mobbing is generally applied by senior managers but at the same time by the colleagues, inferiors or by a group. It is asserted that people who apply mobbing have the persona-lity of over-monitoring, coward, neurotic, and have desire for power and that their behaviors arise from diffidence, jealousy that arises from fear and envy [4,8,9]. It was found that nurses are exposed to verbal violence by doctors, managers, colleagues, inferiors, patients and relatives of patients [10].

It is expressed in literature that healthcare wor-kers is the group who seriously have the risk of being exposed to psychological violence behaviors [11,12,13]. It was detected with many studies that psychological violence is experienced by nurses compared with other occupations within healthca-re workers [4,8,13,14,15,16,17]. When the reasons of nurses’ being exposed to mobbing are obser-

The Relationship between mobbing and assertiveness in nursesAyşe Okanli1, Sibel Asi Karakaş2, Hava Özkan3

1 Atatürk University, Faculty of Health Science, Department of Psychiatric Nursing, Erzurum, Turkey,2 Erzurum Regional Education and Research Hospital, Turkey,3 Atatürk University, Faculty of Health Science, Department of Midwifery, Erzurum, Turkey.

610



ved; it was expressed that their problem of com-munication and expressing themselves is effective [16,18,19,20]. Therefore the issue of assertiveness in nursing has become contemporary and attention towards this issue has increased especially in the field of psychology and in nursing [21]. Assertive-ness is the way of individual’s expressing his thou-ghts, emotions and beliefs directly, honestly, suita-bly and regarding others’ rights [22,23,24]. Asserti-veness may empower communication within group members, consider and analyze possible mobbing conditions and arguments that can be experienced by the group actively [16, 25, 26]. Although there are many studies that are carried out with nursing students [18, 21, 27]; studies that observe asserti-veness level of nurses who conduct this work ac-tively are very limited. Moreover it was detected that mobbing is an important issue to be dealt with and that when the literature is observed only a few studies have been conducted on this side of nursing [17]. Detecting whether the nurses, who compose important and vast majority of healthcare group, are exposed to mobbing or not is very important in the sense of healthy human power, peace at workpla-ce, cost and efficiency of healthcare [19]. Moreover new studies to be carried out are thought to be ne-cessary in order to find an effective solution for this harmful behavior and eliminate it.

It was detected that mobbing behaviors are wi-despread in many sectors such as automotive, to-urism, bank primarily being health and education [28,29]. However since the issue of mobbing kept secret and it was not taken into eye to bring it to light; not much study was conducted on the issue of mobbing. That the mobbing is widespread, gi-ves physical and psychological harm to working life made it necessary to carry out study for the prevention of it [6].

The study was conducted in order to detect the relationship between being exposed to mobbing and levels of assertiveness.

Methods

Designe and sample

The study was conducted as a descriptive study. It was conducted in Erzurum Regional Training and

Research Hospital and Atatürk University Faculty of Medicine Yakutiye Research Hospital between the dates of 15 February 2010 and 30 April 2010.

Universe of the study was composed of nurses (209) who work at Erzurum Regional Training and research hospital and nurses who works at Atatürk University Faculty of Medicine Yakutiye Research Hospital (200). There was no choice of sampling in the study; the entire universe was cho-sen to be the sampling. 218 nurses who accepted to be involved in the study were got into contact.

Data Collection

In the collection of data, survey form which de-termines socio-demographic features; Rathus In-ventory of Self-assertive (RAE) and Mobbing Sca-le which we have developed for nurses were used.

Questionnaire Form

It was composed of 7 questions including so-cio-demographical and occupational past, age, educational status, marital status; whether s/he has children or not, if s/he has number of the children you have, number of experience year, position, the unit in which s/he works.

Rathus Assertiveness Inventory (RAE)

“Rathus Assertiveness Inventory” (RAE) deve-loped by Rathus was used in order to detect asser-tiveness level of nurses [30]. Validity-reliability study of the scale was carried by Voltan in Turkey [31,32]. Voltan determined alpha coherence coef-ficient of the inventory as (r=0.70) and reliability of test-retest as (r=0.92). Alpha coherence coeffi-cient of the inventory was found to be 0.70.

The inventory that can be applied on adults and teenagers is composed of 30 items. Marks range between -90 and +90. Marks that move towards shyness reach up to -90, marks that move towar-ds assertiveness reach up to +90. Options vary between -3 and +3. If the items 1, 2, 4, 5, 9, 11, 12, 13, 14, 15, 16, 17, 19, 23, 24, 26 and 30 are mar-ked as -3 and +3, the values of these items reverse



in the evaluation. Summing up the minus and plus points one by one and subtracting from each other gives the total point of inventory. Those who get below +10 are accepted as tentative, above +10 are accepted as assertive, +70 are accepted as ag-gressive [31,32].

Mobbing Scale

Öztürk et al. developed a mobbing scale in 2007, and validity and reliability studies were fulfilled. In the sample for this study, the Cronbach alpha value was stated as 0.97 [19]. The scale de-tects mobbing executions and consists of 68 items. The scale consists of positive statements and res-ponses are: I definitely agree, I agree, I’m not sure, I don’t agree and I definitely don’t agree. Mobbing Scale is evaluated between 68 – 340 score interval. Those who get above 204 shows that they have experienced mobbing; those who get below 204 shows that they haven’t [19]. Internal consistency of mobbing was found to be 0.95 in this study.

Statistical Analyses

The evaluation of data obtained as a result of study was conducted with SPSS 17 (Statistical Package for Social Science) package program. Percentage distribution, averages, Pearson corre-lation analysis, cronbach alpha coefficient were used in the evaluation of data.

Ethical Considerations

Ethics committee approval was taken from Er-zurum City Health Department for the study. Tho-se who are volunteers were accepted in the scope of study. After the aim and things to be done were told to the participants they were assured that they were free to be involved to the research and that their personal information would not be revealed to other people.

Table 1. Distribution of Nurses according to Socio-demographic and working characteristics (N=218)Distribution of Nurses who are exposed to mobbing according to Socio-demographic and working cha-racteristics (N=38)

Socio-demographic Features of all nurses (N=218) who are involved in the study

Socio-demographic Features of nurses who are exposed to mobbing(N=38)

Characteristics Number (n)

Percentage (%) Characteristics Number

(n)Percentage

(%)EducationHigh-school AssociateBachelor

7830110

35.813.850.5

EducationHigh-school AssociateBachelor

15221

39.45.255.2

Marital Status MarriedSingle

12989

59.240.8

Marital Status MarriedSingle

1820

47.352.7

Child-bearingYesNo

101117

46.353.7

Child-bearingYesNo

1325

34.265.8

PositionService responsible NurseService Nurse

36182

16.583.6

PositionService responsible NurseService Nurse

533

13.186.9

Unit Internal UnitSurgical UnitIntensive Care

1018334

46.338.115.6

Unit Internal UnitSurgical UnitIntensive Care

2477

63.218.418.4

612



Results

50.5% of participants were graduates of bache-lor degree, 59.2% of them are married, 83.6% of them are service nurses and 46.3% of them were detected to be working in interior unit. Average of age was detected to be 29.77 ± 5.31 and average of years of workings was 8.05 ± 5.98 (Table 1).

Of 38 nurses who are determined to be victims of mobbing for getting 204 points and above at mobbing scale; 55.2% of them were graduates of bachelor degree and 52.7% of them were single. Moreover 86.9% of them are service nurses and 63.2% of them are working in clinics of interior branches (Table 1).

17.4% of those who have participated in the research and got above 204 score are detected to have been exposed to mobbing according to mo-bbing scale. 54.1% of them were detected to be passive according to Rathus Assertiveness Inven-tory (Table 2). Table 3. Relationship between Mobbing Scale and Rathus Assertiveness Inventory

ScalesRathus Assertiveness

Inventoryr

Mobbing Scale -0,353 (**)

There is a negative relationship between Mo-bbing scale and assertiveness inventory (p<0.01). As the assertiveness level increase the rate of be-ing exposed to mobbing decrease (Table 3).

76.3% of the nurses who are exposed to mo-bbing were detected to be passive (Table 4).

Table 4. Assertiveness Level of Nurses who are Exposed to Mobbing

Level of Assertiveness

Number (n) Percentage (%)

Passive 29 76.3Assertive 9 23.7

Aggressive - -

Discussion

In recent years, people who work in the health sector have been increasingly exposed to emotio-nal harassment [1,5]. In this research, according to the mobbing scale, %17.4 of nurses was exposed to mobbing. The rate of being exposed to mobbing was detected to be 70%, 84% and 17% respective-ly in the studies carried about mobbing in our co-untry [19,33,34]. This rate was detected to be 1% and 4% in a study carried out in a foreign country [35]. According to these results, it is thought that nurses’ rate of being exposed to mobbing in our country is higher than world prevalence [16].

When research results carried upon mobbing of health workers in our country are observed; it is revealed that nurses are being exposed to mobbing most among health care crew [36,37].

When nurses’ socio-demographic features and condition of being exposed to mobbing are compared; it was determined that nurses’ marital status, having child or not and their status do not influence mobbing. This results shows similarity with that of Öztürk [19]. In the study, although socio-demographic features do not influence the condition of being exposed to mobbing; it shows that mobbing victims are generally in her thirties,

Table 2. Condition of Participants’ Being Exposed to Mobbing and the Level of Assertiveness (N=218)Number

(n)Percentage

(%)Scale Average Score

X ± SD

Condition of Being Exposed to MobbingWho are exposed to mobbingWho are not exposed to mobbing

38180

17.482.2

155.9 ± 14.7

Level of AssertivenessPassive AssertiveAggressive

118982

54.144.9

1 14.7 ± 18.5



well-educated and have bachelor or doctorate de-gree and this result shows similarity with the study [4,9,12,36].

In the study it was detected that the clinic in which the nurse works influences the possibility of being exposed to mobbing. As a result of the study it was determined that vast majority of the nurses who are exposed to mobbing is working in internal clinics. It was detected in the study of Efe and Ayaz that nurses who are working in intensi-ve care units are exposed to mobbing more [16]. Since there is small supplementary payment, few staff but more patient and doctors cannot spare time for the patients due to policlinic services and operations in the internal clinics of hospitals and as a result nurses are exposed to verbal abuse by the patients; it is thought that vast majority of the nurses who are exposed to mobbing is working in internal clinics.

In the study it was detected that average sco-re of rathus assertiveness scale is 14.7 ± 18.5 and 54.1 % of the nurses show tentative behavi-or. It is expressed that nurses do not react due to not showing assertive behavior and they are less assertiveness in their working life compared with their daily life [38,39,40,41].

When the relationship between Mobbing Scale and Rathus Assertiveness Inventory is observed; it was found that there is a negative statistical relati-onship between each other. As the level of asser-tiveness increases; possibility of being exposed to mobbing decreases. Although there is no exact study about possibility mobbing and level of asser-tiveness in literature; it was asserted in the studies carried about mobbing that; characteristics such as assertiveness and communication skills can influ-ence the possibility of mobbing and in as a result nursing services can be more qualified [16,26].

In the study of Yamagishi et al., it was detec-ted that stress of nursing is high since workload is heavy and they are of a group working with shift and that the stress decrease on condition of using assertive communication skills [20].

When we observe assertiveness level of nurses who are exposed to mobbing it was detected that 76.3% of them have tentative personality accor-ding to rathus assertiveness inventory. It is clearly observed in this finding that as the level of asser-tiveness decrease; possibility of being exposed

to mobbing increase. In the study of Efe it was expressed that passive nurses are exposed to mo-bbing more [16]. It is of great importance to pre-vent intimidation behaviors in workplace that can be experienced in every workplace and is someti-mes performed despotically sometimes with spe-cial tactics both for the employees and institutions.

Conclusion

As a result, it was found out that the possibility of nurses being exposed to mobbing is high and the real reason for their being exposed to mobbing is their passive behavior. It is suggested that insti-tutional awareness should be raised; the problem experienced in the institution should be revealed and nurses should be given education about asser-tiveness and communication skills.

Acknowledgement

No financial support has been given from outsi-de sources for this study.

References

1. Yıldırım D, Yıldırım A. Mobbing in the workplace by peers and managers: mobbing experienced by nurses working in healthcare facilities in Turkey and its effect on nurses Turkish Clinics J Med Sci. 2010;30(2):559-70.

2. Murray JS. Workplace bullying in nursing: a pro-blem that can’t be ignored. Medsurg nursing: Of-ficial journal of the academy of: Medical-Surgical Nurses: 2009;Sep-Oct; 18(5):273-6.

3. Leymann H. Mobbing and psychological terror at workplaces. Violence and victims. 1990;Summer; 5(2):119-26.

4. Çobanoğlu Ş. Mobbing- Emotional Abuse in the Workplace and Methods of Fight. Timaş Series of Psychology 2005.

5. Chappell D, Di Martino V. Understanding violence at work. Violence at Work. ILO Report. 2nd ed. Ge-neva.2006; p.3-24.

614



6. Kırel Ç. Supportive and risk reductive suggestions for many management of organizations. Anatolian University, Journal of Social Sciences, 2007; Volu-me:7 – No:317/334.

7. Simons SR, Mawn B. Bullying in the workplace--a qualitative study of newly licensed registered nur-ses. AAOHN JOURNAL. 2010;Jul;58(7):305-11.

8. Bağ B. Examples of violence in Nursing. Aktif Pu-blishing. Istanbul 2004.

9. Devanport N, Distler Schwartz R, & Pursell Elliott G. (2003) Mobbing, emotional abuse in the Ameri-can workplace. Çev: O.C. Onertoy. Sistem Publis-hing Istanbul 2003.

10. Sofield L, Salmond SW. Workplace violence. A fo-cus on verbal abuse and intent to leave the organi-zation. Orthopedic nursing. 2003;Jul-Aug; 22(4): 274-83.

11. Tekin İ. Violence against emergency staff. Turkish Clinics. J Surg Med Sci;2006; 2(50):68-73.

12. Leymann H. “The Content and Development of Mobbing at Work”. European Journal of Work and Organizational Psychology, 1996;5, 165-184.

13. Delbel J.C. De-escalating workplace aggression, Nursing Management, 2003;34, 30-34.

14. West L.J. The effect of an intervention on the risk of eruptive violence in the emergency department (Ma-ster of Science in Nursing), New Haven, Connecti-cut: Southern Connecticut State University 2003.

15. Hutchinson M, Wilkes L, Jackson D, Vickers MH. Integrating individual, work group and organiza-tional factors: testing a multidimensional model of bullying in the nursing workplace. Journal of nursing management, 2010;Mar 18(2):173-81.

16. Efe SY. Ayaz S. Mobbing against nurses in the workplace in Turkey. International Nursing Revi-ew. 2010;Sep; 57(3):328-34.

17. Khorsid L. & Akın E. Violence of Colleagues in Nursing. Hospital Management, 2006;July – Au-gust- September, 14-18.

18. Buzlu S. Evaluation of Self-assertion in nur-sing students. Journal of Nursing. Volume XIV. 2006;Number: 56. 17-26.

19. Öztürk H, Yılmaz F, Hindistan S. Mobbing Scale for Nurses and Mobbing experienced by the nur-ses. Hospital Management, 2007;11 (1–2): 63–69.

20. Yamagish, M, Kobayash, T, Kobayashi T, Nagami M, Shimazu A, Kageyama T. Effect of web-based assertion training for stress management of Ja-panese nurses. Journal of nursing management. 2007;Sep; 15(6):603-7.

21. Top F, Kaymak E, Göllü Ş, Kaya B. Socio-demo-graphical Evaluation of Self-respect and asser-tiveness levels of students of Medical Sciences Faculty. New Symposium Journal. 2010;Nisan. Volume 4: No 2.

22. Onur N. Relationship between the attachment styles of high-school students and their asserti-veness level. Postgraduate Thesis, Istanbul. Mar-mara University Institute of Educational Sciences, Department of Psychological Counseling and Gu-idance 2006.

23. Kilkus SP. Self-assertion and nurses: A Different Voice. Nursing Outlook, 1990;38: 143-146.

24. Phelps S, Austin N. Self-assertive Woman. Katlan S, translation. Ankara: HBY Publishing 1997.

25. Özkan İ, Özen A. (2008) Research about the relationship between indulgent behaviors of nurses and self-respect /Research Article Kor Hek2008;7(1):53-58.

26. Milutinović D, Prokes B, Gavrilov-Jerkovie V, Fi-lipovic D. Mobbing--special reference to the nur-sing profession. Medicinski Pregled.2009; Nov-Dec; 62(11-12):529-33.

27. Kutlu Y. Effectiveness of Assertiveness education on a group of nurses. Maltepe University. Journal of Nursing Science and Art. 2009;Vol: 2, No: 3.

28. Bilgel N, Aytaç S, Bayram N. A Recent Means of Pressure in Working Life: Mobbing. Project No: T-2003/38), Bursa 2004.

29. Özarallı N, Torun A. Personality of Victims of Mobbing, A Research upon the relationship of Negative Feelings and Intention of Quitting. XV Announcement Booklet of National Management and Organization Congress, Sakarya University I.I.B.F., Sakarya 2007.

30. AS. & Nevid J.S. Rathus, with a psychiatric popu-lation. Behavior Therapy, 8, 393-97. Concurrent validity of the 30-item Assertiveness Schedule 1977.

31. Voltan N. Rathus Assertiveness Inventory, Study of Validity-reliability. Journal of Psychology. 1980;10: 23-25.



32. Öner N. Psychological Tests used in Turkey. 3rd ed. Istanbul: Boğaziçi University Publis-hing.1997; 455-457.

33. Yıldırım A, Yıldırım D. Mobbing The Workplace by Peers and Managers: Mobbing Experienced by Nurses Working in Healthcare Facilities in Turkey And Its Effect on Nurses, Issues In Clinical Nur-sing Journal Of Clinical Nursing,2007; p: 1144-1149

34. Dilman T. Determination of Nurses’ being ex-posed to Emotional Abuse at Private Hospitals, Unpublished, Marmara University Post-graduate Thesis, Istanbul 2007.

35. Einarsen S, Hoel H, Zapf D, & Cooper, C.L. (2003) Bullying and Emotional Abuse in the Wor-kplace: International Perspectives in Research and Practice. Taylor & Francis, London 2003.

36. Özen Çöl S. Psychological Violence in the Wor-kplace: A research carried on Hospital Workers. Working and Society. 2008;No: 4.

37. Karacaoğlu K. & Reyhanoğlu M. Mobbing in Workplace, A research upon the workers of he-alth sector in TRCN. Bingöl D. (Ed.).14. Anno-uncement Booklet of National Management and Organization Congress (pp.171-179). Erzurum: A.U. School of Economics and Administrative Sci-ences Data Processing Unit, AÜİİBF Publishing 2006;No: 222.

38. Ayaz F. Determination of Self-respect and Asser-tiveness of Nurses. Postgraduate Thesis, Marma-ra University Institute of Medical Sciences, Ista-nbul,2002; 24-33

39. Adana F, Aktaş B, Erdağı S, Eliş Alkan H, Ulu-man Ö. Determination of Assertiveness Levels of Nursing Students and Health Officers* Journal of Atatürk University Nursing High-School, 2009;12 (2).

40. Özkan B, Seviğ Ü. Assertiveness level of Nurses. Erciyes Journal of Medicine, 2007;Vol 29. No. 1.

41. Timmins F, Mccabe C. How assertive are nurses in the workplace? A preliminary pilot study. Jour-nal of Nursing Management, 2005;13: 61-67.

42. Suzuki E, Saito M, Tagaya A, Mihara R, Maruya-ma A, Azuma T, Sato C. Relationship between assertiveness and burnout among nurse mana-gers. Japan Journal of nursing Science. 2009;Dec; 6(2):71-81.

Corresponding author Ayşe Okanli, Atatürk University, Faculty of Health Science, Department of Psychiatric Nursing, Turkey, E-mail: [email protected]

616



Abstract

It is well established that demanding training regimes can lead to oxidative stress. In this study we evaluated influence of continuous strength and endurance training program on oxidative stress in male athletes. Total antioxidant activity (TAS) de-creased significantly (p < 0.05) between the initial and final measurements in wrestlers after a 4-week intensive endurance training regimen, however, there were no changes in the measurement of ot-her major markers of oxidative stress including superoxide dismutase (SOD), glutathione reduc-tase (GSH-R), glutathione peroxidase (GSH-Px), catalase (CAT). Our data suggest that athletes un-der endurance training program exhibit low TAS values, but within the reference level, which do not cause negative effect on their sport performan-ce. Data of this research are consistent with previ-ous research (Nielsen et al., 2008) suggesting that no antioxidant supplement (vitamin C and vitamin E) to the diet is needed in athletes undergoing in-tensive endurance training.

Key words: judo, wrestling, antioxidant en-zyme, resistance exercise, endurance exercise

Introducion

Aerobic organisms are daily exposed to acti-on of reactive oxygen species (ROS), whose ef-fects are under control of appropriate antioxidant systems (AOS). Reduced ability to remove and neutralize ROS can lead to a state of oxidative

stress, which may progress to major pathophysi-ological changes (Sjodin et al., 1990). Antioxida-tive system works continuously as a physiological process with the aims to prevent harmful actions of prooxidative factors (Valko et al., 2005, 2006). Antioxidans are molecules that can neutralize free radicals by accepting or donating an electron to eliminate the unpaired condition. Capacity of their production is not only conditioned by genetics and gender, but also with age, nutrition and life habits (Voss and Siems, 2006; Veglia et al., 2006).

Determination of antioxidant status in the body is especially recommended for people who are exposed to increased mental and physical stress, such as professional athletes. Increased intensity of physical activity is accompanied by increased consumption of oxygen throughout the body, es-pecially by skeletal muscle (Astrand and Rodahl, 1986). Much of this oxygen is transformed in mi-tochondria into H2O, while a smaller portion (2–5 %) builds reactive oxygen species, a toxic forms of oxygen.

It is well know that acute aerobic (Davies et al., 1982; Ashton et al., 1998; Chavi et al., 2007) and anaerobic activities (Groussard et al., 2003; Bailey et al., 2004, 2007) have a potential to induce higher production of free radicals, which can or can not lead to oxidative stress. Research has shown that in-tensive physical activity resulting in the appearance of oxidative stress, caused by increasing lipid pe-roxidation (Rietjens et al, 2007; Guzel et al., 2007; Hoffman et al., 2007), protein oxidation (Bloomer et al., 2005), as well as changes in content of reduce glutathione (Vina et al., 2000).

Strength and endurance training does not lead to changes in major markers of oxidative stress Tatjana Trivic1, Patrik Drid1, Miodrag Drapsin2, Sergej Ostojic3, Slavko Obadov1, Izet Radjo4

1 Faculty of Sport and Physical Education, University of Novi Sad, Serbia,2 Medical Faculty, University of Novi Sad, Serbia,3 Faculty of Sport and Tourism, Novi Sad Metropolitan University, Serbia,4 Faculty of Sport and Physical Education, University of Sarajevo, Bosnia and Herzegovina.



So far one publication supports the idea that su-pplementing with inorganic salts, vitamins and nu-tritional complements like glutamin are not needed (Wang Zhong and Zeng Fan, 2007), while lots of athletes take supplements (vitamin C and vitamin E), therefore, this issue remains unsettled, and this study states hypothesizes that no antioxidant su-pplement to the diet is needed. The aim of this re-search was to investigate the effects of strength and endurance training on oxidative stress biomarkers in two groups, as well as to determine physiologi-cal response of organism after applied two different types of training in period of 4 weeks in order to obtain preliminary data on whether supplements are indeed needed in professional athletes.


The sample consisted in 14 male wrestlers (aged 21.9 ± 3.5 years, 11.7 ± 4.0 years of sport history, 176.7 ± 6.6 cm of body height, 79.6 ± 13.5 kg in body weight) and 7 male judokas (aged 20.3 ± 1.9 years, 11.4 ± 2.2 years of sport history, 177.4 ± 3.4 cm of body hight, 84.0 ± 16.9 kg in body weight) from Serbian national team. Tested athle-tes were subjected to a training regime consisting in a minimum 10 hours of work out per week, in the last 4 years. Prior to testing, all subjects were informed about the requirements of the study and gave their consent when accessing the research. All subjects underwent a detailed medical exa-mination during which it was established that all subjects were in excellent health without cardio-vascular, respiratory, endocrine or other disorders.

Blood collection and biochemical analysis

First blood samples were taken from all subjects in the morning at 07.00pm one day before training program. Second blood samples were taken one day after training program, which followed a period of four weeks. The participants were fasting for twelve hours before blood samples were drawn. Athletes had no special nutrition program or supplements during a four weeks training period. Blood samples were taken from the antecubital vein inside of the elbow into plain vacutainer tubes. The site was cle-

aned with germ-killing medicine (antiseptic). The health care provider wrapped an elastic band around the upper arm to apply pressure to the area and made the vein fill with blood. Serum samples were used to determine the activity of the Enzymes: superoxide dismutase (SOD), glutathione reductase (GSH-R), glutathione peroxidase (GSH-Px), catalase (CAT) and total antioxidant activity (TAS). Furthermore, blood samples were collected to measure following parameters: total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), low-densi-ty lipoprotein (LDL), very-low-density lipoprotein (VLDL), aspartate aminotransferase (AST), alani-ne aminotransferase (ALT), lactate dehydrogenase (LDH), natrium (Na) and kalium (K).

Training protocol

Two different training protocols were used in different groups of athletes, in both cases 4 weeks long. The subjects trained three times per week for 4 weeks. The endurance training consisted of a tra-ining program with 60 min of aerobic training in wrestlers group. The intensity varied from 75–85% of Hrmax. Strength training on judokas group was carried out, three times per week. The training pro-gram included 3 sets with 8-12 repetitions in 60 min for the main muscle groups of the body. All training sessions were supervised by certified coach.


All the results were expressed as mean ± SD. Differences between the two measurements for each group were calculated using Wilcoxon’s test. Mann-Whitney U test and ANOVA were used to analyze differences in all parameters between the two groups. In order to process the results of the study, the SPSS statistical program for Windows was used.

Results

Results of study show no statistically signifi-cant differences in the activities of antioxidant enzymes (Table 1), which indicates that there has

618



been no oxidative stress that could lead to functi-onal and morphological changes in researched at-hletes. Although there were no statistically signi-ficant differences in antioxidant enzyme activity, there were some alteration as reflected in statisti-cally significant changes in the TAS. However, TAS was different in compared wrestler and ju-dokas group in relation with applied strength and endurance training regime.

The analysis of oxidative stress parameters and components of antioxidant protection in relation to the type of training applied in the studied at-hletes, statistically significant differences were not obtained in the activities of antioxidant enzymes (SOD, CAT, GSH-R, GSH-Px) as well as the total antioxidant status between groups.

Strength and endurance training did not resul-ted in changes between groups, although there were some alterations. Endurance training indu-ced a statistically significant change in TAS (p < 0.05) in wrestlers group after the final measure-ment, but no differences was found in relation to judo athletes who worked on the development of strength in period of 4 weeks.

After applied training treatment, which was ba-sed on endurance training, there was a decrease in TAS, but within the reference values, so that this phenomenon could adversely affect the perfor-mance and health of wrestlers.

Discussion

For athletes it is very important to establish whether enzymes activities (SOD, CAT, GSH-R, GSH-Px, TAS) as a primary antioxidant protection against ROS appear altered upon intense training protocols (McCord and Fridovich, 1969). Greater rate of flow of electrons through the mitochondrial electron transport chain caused by increased oxy-gen consumption during aerobic exercise could in-crease free radical production. During endurance exercise there is a 10- to 20-fold increase in whole body oxygen consumption, and oxygen uptake in the active skeletal muscle increases 100- to 200-fold (Halliwell and Gutteridge, 1999). This ele-vation in oxygen consumption is thought to result in the production of ROS at rates that exceed the body’s capacity to detoxify them. Results of this research indicate that strength and endurance trai-ning in conditions of controlled load after training treatment in period of 4 weeks does not lead to changes in markers of oxidative stress and risk of health damage. Like most defense mechanisms in the body, antioxidant enzyme activity of primary care decreases with age (Di Massimo et al., 2006), which was not the case in this research because the sample consisted of healthy young athletes.

Results of this study are very much consistent with findings reported previously by Nielsen et al. (2008). Nielsen et al indicate that the applied trai-

Tabela 1. Antioxidant enzyme activity and total antioxidant status after applying different training tre-atment in period of 4 weeks

Parameter(reference level) Group Initial measurement Final measurement

SOD (1102-1601 U/gHb)

Wrestling 1240±56 1272±70Judo 1266±60 1234±32

CAT (217-409 kU/gHb)

Wrestling 319±60 332±47Judo 315±62 341±46

GSH-R (4.7-13.2 U/gHb)

Wrestling 11.5±0.9 11.5±0.8Judo 11.8±0.6 11.7±0.8

GSH-Px (27.5-73.6 U/gHb)

Wrestling 70.8±1.3 70.9±0.8Judo 71.1±1.1 71.1±1.4

TAS (1.30-1.77 mmol/L)

Wrestling 1.34±0.05 1.32±0.04 a

Judo 1.36±0.04 1.35±0.04Significance of means differences between initial and final measurement within groups: p < 0.05 a



ning programs for the development of strength and endurance do not require additional supplementa-tion with antioxidants, correlated with a controlled lifestyle and proper nutrition. Several publications suggesting, that antioxidant supplementation my actually be counterproductive (Ji, 2008; Wray et al., 2009). On the basic of obtained results it is evident that influence of strength and endurance training in wrestlers and judokas athletes did not cause significant changes in any of the analyzed biochemical hematological parameters. Although there were some alterations after applied training treatment, negative response to the application of the same was not reported. It appears that regular sport training enhances antioxidant defense sy-stem and it may be an effective intervention for improving overall health by protecting against the oxidative stress. It should be emphasized that pro-grammed physical activity can improve general adaptation to oxidative stress in non active part of population as well. According to data (Miyazaki et al., 2001) the activity of specific antioxidant enzymes (SOD, GPx, CAT) have been shown no changes after applied similar exercise.

Many biochemical parameters respond to physical activity, but in the short term and with a very large homeostatic potential, so that changes are happening during physical activity and retur-ning to the physiological limits in a very short pe-riod (parameters of lipid status, electrolytes). They show acute, short-term alteration (Braunwald et al., 2002), which confirmed the obtained results.

Our data and previous research suggest that the intensity of the resistance and endurance exercise, are not necessarily provoking factors in evoking oxidative stress markers.

References

1. Ashton, T., Rowlands, C.C., Jones, E., Young, I.S., Jackson, S.K., Davies, B., Peters, J.R. (1998). Elec-tron spin resonance spectroscopic detection of oxy-gen-centred radicals in human serum following ex-haustive exercise. Eur J Appl Physiol Occup Physi-ol., 77(6), 498-502.

2. Astrand, P., Rodahl, K. (1986). Physiological basis of exercise. In: van Dalen (ed.) Textbook of work physiology, 170-175. New York: McGraw Hill Book Company.

3. Bailey, D.M., Young, I.S., McEneny, J., Lawrenson, L., Kim, J., Barden, J., Richardson, R.S. (2004). Regulation of free radical outflow from an isolated muscle bed in exercising humans. Am J Physiol He-art Circ Physiol.,287(4), 1689-99.

4. Bailey, D.M., Lawrenson, L., McEneny, J., Young, I.S., James, P.E., Jackson, S.K., Henry, R.R., Ma-thieu-Costello, O., McCord, J.M., Richardson, R.S. (2007). Electron paramagnetic spectroscopic evidence of exercise-induced free radical accumu-lation in human skeletal muscle. Free Radic Res., 41(2), 182-190.

5. Bloomer, R.J., Goldfarb, A.H., Wideman, L., Mc-Kenzie, M.J., Consitt, L.A. (2005). Effects of acute aerobic and anaerobic exercise on blood markers of oxidative stress. J Strength Cond Res., 19(2), 276-285.

6. Braunwald, E., Fauci, A.S., Kasper, D.L.,Hauser, S.L., Longo, D.L., Jameson, J.L. (2002). Harrison’s Manual of Medicine, 15th Ed. New York: McGraw-Hill.

7. Chhavi, L., Pradeep, H.G., Balwant, S. (2007). In-fluence of exercise on oxidant stress products in eli-te Indian cyclists Br. J. Sports Med., 41, 691-693.

8. Davies, K.J., Quintanilha, A.T., Brooks, G.A., Pac-ker, L. (1982). Free radicals and tissue damage produced by exercise. Biochem Biophys Res Com-mun., 107(4), 1198-1205.

9. Di Massimo, C., Scarpelli, P., Di Lorenzo, N., Cai-mi, G., Orio, F., Ciancarelli, M.G. (2006). Impaired plasma nitric oxide availabillity and extracellular superoxide dismutase activity in healthy humans with advencing age. Life Sci., 78, 1163-1167.

10. Groussard, C., Rannou-Bekono, F., Machefer, G., Chevanne, M., Vincent, S., Sergent, O., Cillard, J., Gratas-Delamarche, A. (2003). Changes in blood

620



lipid peroxidation markers and antioxidants af-ter a single sprint anaerobic exercise. Eur J Appl Physiol., 89(1), 14-20.

11. Guzel, N.A., Hazar, S., Erbas, D. (2007). Effects of different resistance exercise protocols on nitric oxide, lipid peroxidation and creatine kinase acti-vity in sedentary males. J Sport Sci Med., 6, 417-417.

12. Halliwell, B, Gutteridge, J.M.C. (1999). Free ra-dicals in biology and medicine, Oxford University Press Inc, New York.

13. Hoffman, J.R., Im, J., Kang, J., Maresh, C.M., Kraemer, W.J., French, D., Nioka, S., Kime, R., Rundell, K.W., Ratamess, N.A., Faigenbaum, A.D., Chance, B. (2007). Comparison of low- and high-intensity resistance exercise on lipid peroxidation: role of muscle oxygenation. J Strength Cond Res., 21(1), 118-122.

14. Ji, L. (2008). Modulation of skeletal muscle an-tioxidant defense by exercise: Role of redox si-gnaling. Free Radical Biology and Medicine. 44, 142-152.

15. McCord, J.M., Fridovich, I. (1969). Superoxide dismutase: an enzymatic function for erythrocu-prein (hemocuprein). J. Biol. Chem., 224, 6049-6055.

16. Miyazaki, H.; Oh-Ishi, S.; Okawara, O. (2001). Strenuous endurance training in humans reduces oxidative stress following exhaustive exercise. Eur J Appl Physiol.,84, 1-6.

17. Nielsen, H.G., Skjunsberg, O.H., Lyberg, T. (2008). Effect of antioxidant supplementation on leucocyte expression of reactive oxygen species in athletes. Scand J Clin Lab Invest., 68(7), 526-533.

18. Rietjens, S.J., Beelen, M., Koopman, R., Van Loon, L.J., Bast, A., Haenen, G.R. (2007). A single se-ssion of resistance exercise induces oxidative da-mage in untrained men. Med Sci Sports Exerc., 39(12), 2145-2151.

19. Sjodin, B., Hellsten Westing, Y., Apple, F.S. (1990). Biochemical mechanisms for oxygen free radical formation during exercise. Sports Med,. 10, 236–254.

20. Valko, M., Morris, H., Cronin, M.T. (2005). Me-tals, toxicity and oxidative stress. Curr Med Chem, 12, 1161-1208.

21. Valko, M., Rhodes, C.J., Moncol, J. (2006). Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact, 160(1), 1-40.

22. Voss, P., Siems, W. (2006). Clinical oxidation para-meters of aging. Free Radic Res., 40, 1339–1349.

23. Veglia, F., Cighetti, G., De Franceschi, M., Zinga-ro, L., Boccotti, L., Tremoli, E. (2006). Age- and gender-related oxidative status determined in he-althy subjects by means of OXY-SCORE, a poten-tial new comprehensive index. Biomarkers., 11, 562–573.

24. Vina, J., Gimeno, A., Sastre, J., Desco, C., Asen-si, M., Pallardo, F.V., Cuesta, A., Ferrero, J.A., Terada, L.S., Repine, J.E. (2000). Mechanism of free radical production in exhaustive exercise in humans and rats; role of xanthine oxidase and protection by allopurinol. IUBMB Life., 49(6), 539-544.

25. Wang Zong, L., Zeng Fang, X. (2007). Study on the Strength of Female Judo Athletes and Nutriti-on Intervene during reducing body weight. J Bei-jing sport Univers, 2007-11.

26. Wray, D.W., Uberoi, A., Lawrenson, L., Bailey, D.M., Richardson, R.S. (2009). Oral antioxidants and cardiovascular health in the exercise-trained and untrained elderly: A radically different out-come. Clinical Science (London). 116, 433-441.

Corresponding author Tatjana Trivic, Faculty of Sport and Physical Education, University of Novi Sad, Serbia, E-mail: [email protected]



Abstract

Purpose: 0-15 years of pediatric patients who were admitted to the emergency clinic sociode-mographic characteristics, reasons for application, the applications from cities and towns in the area of emergency by determining the child to provide better service, we aim to contribute.

Method: Retrospective study is a descriptive qu-alitative study. December 31, 2007 between 1 July and six-month period on the Army and Children’s Hospital emergency clinic nursing home between the ages of 0-15 who were admitted to the pediat-ric patients included in the study were 16851st. The patients sociodemographic characteristics, reason for application, provincial and district from which applications were evaluated.

Results: The most frequent reasons for emer-gency clinic in girls and boys in the first two rows and arthralgia had tonsillitis. Respectively, in girls otitis media, upper respiratory tract infection and acute gastroenteritis , son of otitis media, sinusitis, was followed upper respiratory tract infection first place. The most common reasons for application in the 0-3 age group, otitis media (68%), 4-7 ye-ars, 8-11 years and 12-15 age group has tonsilli-tis. 2751 was off-center application, the 18.02% diagnosed with tonsillitis, 14.54% children were diagnosed as pharyngitis

Conclusions: The results of this study were admitted to the emergency distribution of pediatric patients have been put forward, and primary care staff working in emergency services and hospital units in the training of in-service training programs for emergency cases were admitted to the program for pediatric patients in the guide can do.

Key words: Pediatric emergency, 0-15 age children disease, emergency services

Introduction

In the 2000s, the world’s 1.8 billion populati-on are children. This number constitutes 20% of the world’s population. This number constitutes 20% of the world’s population. In addition to be-ing more than the child population, children adult population, according to accident and illness than impressed. Therefore, the number of pediatric pa-tients who were admitted to the emergency room every day has increased [1,2]. Of the urgent appli-cations made to the statistics made approximately 25-30% in the pediatric age group has been shown to be[3,4]. Child emergencies, creates and almost 30% of all emergency patients seen in pediatric age group, 80% of deaths due to medical problems such as the emergency is an important part. Ba-sed on this information in an emergency room in 2007 in Turkey in the pediatric age group, which has been serving nearly 15,000,000 patient[5]. Ac-cidents and diseases than children to be affected than adults because of the number of pediatric pa-tients who were admitted to the emergency room every day has increased [1].

Any health problems in children sudden emer-ged as a cause for serious concern ebebeynlerin whether the discomfort of the emergency as soon as possible without having to seek help by conta-cting your nearest health facilities are. Therefore emergency diseases of children no matter what level the field in pursuit of every health care faci-lities are [5].

The importance of this issue in developed countries has been noticed in the 1970 and Child-ren in Emergency Department seven days a week, 24 hours a day to do the duties of Children’s emer-gency physicians has become a standard practice. Search the world now the U.S. Canada, Australia,

Ordu Women And Children’s Hospital Emergency Clinic to Applicant Evaluation of Children’s patientsNurgül Bölükbaş

Ordu University, Ordu Health School, Department of Nursing

622



Britain, Israel, including countries such as Sau-di Arabia or even in many developed countries, ‘even in children are official emergency medicine training are provided Minors [5,6].

Emergency transportation and first aid services of the vital life-saving emergency services because hospitals are the most important part of [7,8]. Not only medical and surgical emergency services pe-ople, but also the most intensive psychosocial sup-port needs are places. Patients to the emergency room for many different reasons can apply. Apply in patients with minor injuries, traffic accidents, stress-related problems and infectious diseases are more frequent [9,10]. Purpose of the emergen-cy services, consult the patient and family health problems by severity categories, the problem with appropriate treatment and care services by offe-ring initiatives, jeopardize the patient’s life is to eliminate the causes of [8]. Hospital emergency services to a growing problem due to non-urgent emergency care philosophy apply even though the application regardless of what causes all of the ur-gent application must be considered [2,3].

This study brought to the emergency clinic of pediatric patients age 0-15 demographic charac-teristics, reasons for application, the applications from cities and towns in the area of emergency by determining the child to provide better service is intended to contribute.

Methods

Sample

The data of this study of pediatric patients admitted 16851 the 1 July and December 31, 2007 between 6-month period on the Army and Children’s Hospital, nursing home who were ad-mitted to the emergency clinic patients between the ages of 0-15 backward as a result of the sca-nned files were obtained. Diagnosis of pediatric patients 0-15 years of gender, age group and ge-ography were evaluated according to the number and percentage.

Data Analysis

SPSS Software Program, version 11.5 for Win-dow was used in data analysis. Statistical analyses were based on percentages demographics test.

Ethical considerations

The study were made with the approval of the management and ethics commitee Ordu Women’s and Children’s hospital.

Results

Women’s and Children’s Hospital on the ar-my-examined retrospectively in the 6-month pe-riod (01.07.2007-31.12.2007) a total of 16851 0-15 age group, pediatric patients were admitted to the emergency clinic. Between the ages of 0-15 who were admitted to the emergency clinic 16851 child, who was 8146 total (48%) girls, 8705 (52%) were male. The children were 6822 chil-dren (40%) 0-3 years, 5635 (33%) were 4-7 years group. Of 14 pediatric patients who were admitted to the emergency clinic 14095(84%) were from the city center.Table 1. Distribution of socio-demographic cha-racteristics of children admitted to emergency

Sayı %AGE

0-3 yaş4-7 yaş8-11 yaş

12-15 yaş

6822 40 5635 33 3151 20 1251 7

GENDERGirlsBoys

8144 488705 52

SETTLEMENTCity center

Off-city center14095 842751 16

The most frequent reasons for emergency clinic in girls and boys in the first two rows and pharyn-gitis had tonsillitis. Otitis Media in girls, respec-tively, upper respiratory tract infection and acute gastroenteritis, boys in the otitis media, sinusitis, was upper respiratory tract infection followed.



Table 2. The distribution of diseases reasons for application the emergency unit according to socio-de-mographic characteristics of children’s

DiseasesGırls

Number s %

BoysNumber s %

0-3 AgeNumber s %

4-7 AgeNumber s %

8-11 Age number s %

12-15 AgeNumber s %

Off-cıty center

Number s %

Cıty center Number s %

Total

Asthma 91 42 124 58 85 39 67 31 52 24 11 6 54 25 161 75 215

Tonsıllıtıs 1455 48 1554 52 949 31 1161 38 647 21 250 10 496 17 2511 83 3007

Angına 1069 52 1004 48 718 35 817 39 395 19 143 6 400 19 1673 81 2073

Sınusıtıs 648 46 776 54 174 12 541 37 504 35 205 16 204 14 1220 86 1424

Upper respıratory tract ınfectıon 687 51 660 49 704 52 405 30 174 12 64 6 191 14 1156 86 1347

Lower respıratory tract ınfectıon 461 46 521 54 491 50 335 34 123 12 33 4 152 15 830 85 982

Otitis media 768 48 820 52 1086 68 338 21 130 8 34 3 358 22 1230 88 1588

Nausea vomıtıng 557 46 634 54 478 40 390 32 240 20 91 8 254 21 937 79 1191

Agıtatıon 62 51 58 49 101 84 12 10 4 3 3 2 18 15 102 75 120

Konjonktivitis 52 46 60 54 75 66 26 23 9 8 2 3 31 27 81 73 112

General ınspectıon 35 32 72 68 51 47 41 38 11 10 4 5 42 39 65 61 107

Bıte ınsect 70 45 84 55 59 38 51 33 32 20 12 9 37 24 117 76 154

Poısonıng 21 38 35 62 30 53 16 28 9 16 1 3 11 19 45 81 56

Acute laranjıtıs 98 37 165 63 85 32 147 55 26 10 5 3 34 12 229 88 263

Newborn jaundıce 137 35 254 65 391 100 76 19 315 81 391

Anemıa 64 51 59 49 83 66 20 16 18 14 4 4 19 15 106 85 125

Urtıcarıa 191 58 135 42 136 41 127 38 46 14 17 7 47 14 279 86 326

Abdomınal paın 260 48 279 52 73 13 213 40 173 32 80 15 98 18 441 82 539

Burn 6 27 16 73 16 72 6 28 5 22 17 88 22

Bronchıtıs 300 54 215 46 237 46 135 26 80 15 63 87 41 8 474 92 515

Acute gastro-enterıtıs 653 51 622 49 434 34 400 31 261 20 180 15 107 8 1168 92 1275

Dermatıtıs 90 52 81 48 97 56 52 30 16 9 6 5 14 8 157 92 171

Cough 23 48 24 52 14 29 29 61 4 10 _ 10 21 37 79 47

Pneumonıa 73 53 63 47 45 33 59 43 25 18 7 6 16 11 120 89 136

Fever 140 38 220 62 119 33 150 41 80 22 11 4 3 1 357 99 360

Epılepsy 35 47 39 53 27 36 16 21 20 27 11 16 8 10 66 90 74

Headache 30 51 28 49 4 7 18 31 30 51 6 11 4 7 54 93 58

Bleedıng 28 43 36 57 16 25 32 50 15 23 1 2 64 100 64

Seızures 23 54 19 46 29 69 13 31 7 16 35 84 42

Leukemıa 7 35 13 65 8 40 9 45 3 15 8 40 12 60 20

Hepatıtıs 2 25 6 75 6 75 2 25 1 12 7 88 8

Hypothyroıdısm 2 100 1 50 1 50 2 100 2

Acute abdomınal 10 27 27 73 8 21 7 18 18 48 4 13 5 14 27 86 37

Total 8146 8705 6822 5635 3151 1251 2751 14095 16851* Row percentage was

624



The most common reasons for application in the 0-3 age group, otitis media (68%), 4-7 years, 8-11 years and 12-15 age group has tonsillitis. Appli-cation was off-center 2751, this 18% tonsillitis, 14.54% pharyngitis , 13.01% children diagnosed with otitis media has created. Application was city center 14095, this 17.81% tonsillitis, % 11.87 pharyngitis, 8.7% were diagnosed with otitis me-dia have are children.

Discussion

The study examined the process of applicati-on for pediatric patients in the emergency clinic was 16851. In the United States disease preventi-on and control center (Center for Disease Control and Prevention-CDC) as part of National Hospital Ambulatory Medical Care Survey data, according to the emergency room in 2004 to 20.8% of re-ferred patients children under the age of 15 for-med was stated [7]. Atabek and his friends at work about 25% of all emergency clinic application, Ayvaz and his friends at work, this figure was re-ported as 18.2% pediatric patients [2,6]. Our study was done in Maternity and Children’s Hospital cli-nic for emergency admission in the rate of adult patients have not been evaluated.

In our study, similar to other studies in pediat-ric patients 48% of girls and 52% were male. This case of boys being more active, more to spend time outside the home, more contact with the external environment due to greater exposure to trauma and can be explained by external factors[6, 7].

The pediatric patients were 40% 0-3 years group, 33% of 4-7 age group. Pediatric patients who were admitted to the emergency of the first to be in the 0-3 age group, during infancy, child-hood disease according to the likelihood that more shows. Infancy and early childhood years in low body resistance to disease susceptibility increases [1, 2, 3, 4].

In our study of hildhood accidents and burns to the emergency clinic (22 children), trauma-related hemorrhage (64 children) and poisoning cases (56 children) were found to be in the form of applica-tions. World Health Organization (WHO) world, according to data from falls, burns and poisoning are the most important reason for morbidity and

mortality in domestic accidents, so the entire world, are among the major health problems. Although each age group, household accidents, a major pub-lic health problem for children and the elderly. Our country in the world and home accidents, especially during the pre-school 0-6 years various injuries, can cause injury or death [8]. 0-6 age group of children explore their environment at home, spend most of their time and interests are the learning issues incre-ase the risk of home accidents. The most common types of home accidents among children 0-6 years of falls, burns, poisoning, drowning, foreign aspira-tion, stands out as the pet bites. And respiratory tra-ct foreign bodies in children under one year old to escape drowning, falling between the ages of 1-4, multiplication, scalding water, fire, burning and poisoning are more frequent. Cleaning agents and drugs dropped in the middle ages 2-4, after 5 years if stored in the fridge and high drug poisonings is increasing [14, 15].

The emergency department complaints were otitis media and tonsillitis the age 0-3, tonsillitis and pharyngitis ages 4-7 , tonsillitis and sinusitis 8-11 and 12-15 age group. Ayvaz and colleagues is the most common complaints in the age group of 0-1 upper respiratory infection (25.7%) and gas-troenteritis (4.3%); 1-4 age group, upper respira-tory infection (30%) and trauma (4.1%); 5-9 age group, the incision (% 4.8) and trauma (4%); 10-14 age group, trauma (35.5%), upper respiratory tract infection (22.9%), 15 and over age group, trauma (6.2%) and incision (3.9%) were described [6]. Ayyıldız and colleagues in the emergency de-partment for the first three places among the cau-ses of the diseases of upper respiratory tract infe-ction (31.4%), trauma (11.3%), fever (5.2%) was reported [1]. Atabek et al, Boran and his friends studies, the most common complaints in the 54.84 ‘le infections, 17.8% new-born diseases [2,3]. According to 2006 reports, the CDC admitted to emergency rooms in America in 2004, the most common diagnosis in children under the age of the 14.7% upper respiratory infection, acute oti-tis media and upper respiratory tract infections in children 1-12 years has been [11].

Various sources, emergency services and non-emergency situations due to illness rather than the states that applications made. Sometimes I wanted to get faster service for non-urgent patients, po-



liclinics well as patients who do not want to wait for the owners, as a result of their treatment and control patients before the implementation of the treatment, those who want to use the emergency clinics. [2,3 8,10]. This situation was found in our study. This is because the area was within the pro-vince, except as otherwise explained by the lack of a children’s hospital.

16.0% of pediatric patients’ sI was outside the city center. These results show that the hospital’s settlement affects the application of the distance to hospital. Away from the city center is the first application where primary health care institutions.

The poisoning’s all emergencies cases of rate was 0.33% of. This proportion is expressed 1.8% Ozturk et al study, , 16% Öner and colleagues, Aji and İlter study of 0.9%, 0.2% in Ayvaz and colle-agues [15,16,17,6]. The most common types of home accidents among children 0-6 years of falls, burns, poisoning, drowning, foreign body yutma-ları, stands out as the pet bites. In our study, and other household poisoning in children with low ratio of accidents due to their better-informed pa-rents can tell most of their lives in the city center can be explained by the result.

Conclusion

The distribution of children admitted to emer-gency room patients as a result of this study are introduced, primary care units, emergency servi-ces personnel and hospital training programs in-service training programs for emergency cases admitted to pediatric patients may lead the way in making. In addition, the emergency service required by the vehicle and instrument cases and provide guidance for future improvements that we think this study is to be done. Caused by the use of the emergency service is preferred, the first and second level health services research is needed on the use of efficient.

Acknowledgement

We would like to thank Ordu Women And Children’s Hospital on an emergency unit staff and the archive staff.

References

1. Ayyıldız T, Ocakcı A., Kulakçı H. Bir devlet hasta-nesinin acil servisine başvuran 0-6 yaş grubu çocuk hastaların değerlendirilmesi. (2006) http://www.mi-llipediatril.org.tr/bildiriler/HS-05.htm(05.07.2009)

2. Atabek ME, Oran B, Çoban H ve ark. Çocuk acile başvuran hastaların özellikleri. Selçuk Üniversitesi Tıp Fakültesi Dergisi 1999; 15, 89-92

3. Boran P, Tokuç G, Çoban Büyükkalfa D, Taşkın B, Pişgin B. Çocuk acil servisine başvuran vakaların değerlendirilmesi. Çocuk Dergisi 2008; 8, 114-116

4. Levent H, Yılmaz R. Acil çocuğa yaklaşım. (2006) http://www.pediatriportali.com/Seminer_Goster.asp?ID=137 (23.12.2006)

5. Çocuk Acil Tıp ve Yoğun Bakım Derneği. Türkiye’de ve dünyada çocuk acil tıp hizmetleri. Mevcut durum ve öneriler (2008). http://www.cayd.org.tr/YAYIN-LAR (22.04.2008)

6. Ayvaz A, Güngör N, Topbaş M, Yıldızlar O, Çan E, Akkol N. Trabzon Sürmene Devlet Hastanesi acil polikliniğine başvuran çocuk hastaların özellikle-ri. Cumhuriyet Üniversitesi Tıp Fakültesi Dergisi 2007; 29, 156-162

7. Kılıçaslan İ, Bozan H, Oktay C ve ark. Türkiye’de acil servise başvuran hastaların demografik özelli-kleri. Türkiye Acil Tıp Dergisi 2005; 5, 5-13

8. Cander B, İkizceli İ, Yıldırım C, Baydın A, Dilsiz A, Kaymakçı A. Acil servis hizmetlerinin iyileştirilme-si ve yeniden yapılanması. Akademik Acil Tıp Der-gisi 2008; 7, 9-16

9. Ceylan S, Açıkel CH, Dündaröz R, Yaşar M, Güleç M, Özışık T. Bir Eğitim Hastanesi acil servisine travma nedeniyle başvuran hastaların sıklığının ve travma özelliklerinin saptanması. Türkiye Klinikle-ri Tıp Bilimleri Dergisi 2002; 22, 156-160

10. Edirne T, Edirne Y, Atmaca B, Keskin S. Yüzün-cü Yıl Üniversitesi Tıp Fakültesi acil servis hastalarının özellikleri. Van Tıp Dergisi 2008; 15, 107-111

11. McCaig LF, Nawar EW. National Hospital Am-bulatory Medical Care Survey. 2004 emergency department summary. Adv Data 2006; 372, 1-29

626



12. Gürsoy TŞ, Çiçeklioğlu M, Türk M, Sözbilen M. E.Ü.T.F. Acil Servisine bir yıl içinde başvu-ran hastaların sosyodemografik özelliklerinin ve başvuru zamanlarının değerlendirilmesi. Ege Tıp Dergisi 1999; 38, 109-112

13. Budan K. 0-6 yaş döneminde ev kazalarına di-kkat! (2007) http://www.cayburg.com/communi-ty-59578-0-6-yas-döneminde-ev-kazalarina-di-kkat.html (13.06.2009)

14. Güzel A, Karasalihoğlu S, Küçükuğurluoğlu Y. Çocuk acil ünitemize düşme nedeniyle başvuran travma olgularının değerlendirilmesi. Ulusal Travma Acil Cerrahi Dergisi 2007; 13, 211-216

15. Öztürk YA, Uçar B. Eskişehir bölgesinde ço-cukluk çağı zehirlenmelerinin retrospektif değerlendirilmesi. Çocuk Sağlığı ve Hastalıkları Dergisi 2003; 46, 103-113

16. Öner N, İnan M, Vatansever Ü ve ark. Trakya bölgesinde çocuklarda görülen zehirlenmeler. Türk Pediatri Arşivi 2004; 39, 154-158

17. Aji DY, İlter Ö. Türkiye’de çocuk zehirlenmeleri. Türk Pediatri Arşivi 1998; 33, 25-30

Corresponding author Nurgül Bölükbaş, Ordu University, School of Health, Turkey, E-mail: [email protected]



Abstract

Background: In this study we aimed to evalu-ate the collection time of T3, free T4 and TSH in preterm newborns.

Methods: Prospective study, composed of 85 preterm newborns (PTI) as the gestational age stratified into four groups: Group A: n = 18 (less than 30 weeks); Group B: n = 13 (30 + 1 / 7-32 weeks); Group C: n = 19 (32 + 1 / 7 to 34 weeks) and; Group D: n = 35 (34 + 1 / 7 to 36 weeks). The collections of T3, T4 and thyroid stimulating hormone (TSH) were collected by chemilumines-cence in six stages: 1 - umbilical cord; 2 - 3 days old; 3 - 7 days old; 4 - 14 days old; 5 - 30 days old and; 6 – 60 days old.

Results: We observed significant differences until the dosage of 30 days, for free T4 between groups A and D; for the T3 between A and B groups with C and D groups. In the comparison between the times the time 1 was significantly di-fferent for TSH and T3.

Conclusion: The hormone levels are gradually lower the lower the gestational age and the mini-mum ideal time for the collection of tests is from the 3rd day of life for TSH and the 7th day to the T4 and T3.

Key words: Thyroid Gland; Hormones; TSH (Thyroid Stimulating Hormone); Infant, Newborn.

Introduction

Endocrine dysfunctions are an important event to be studied [1-3]. Postnatal thyroid function of preterm newborns is different compared to term newborns. Impaired postnatal thyrotropin (TSH) surges and low serum T4 levels are frequently

observed in preterm neonates; this is generally re-ferred to as hypothyroxinemia of prematurity [4]. In contrast to typical congenital hypothyroidism, a normal TSH level upon initial screening followed by delayed TSH elevation is observed in some preterm infants [5].

The main factors that influence thyroid functi-on in preterm infants are immaturity of the hypot-halamic-pituitary-thyroid axis, immature thyroid hormone synthesis, immature thyroid hormone metabolism, and systemic diseases. Insufficient or excessive iodine intakes also influence preterm thyroid function [6].

Although the survival rate of very low birth weight infants has increased in recent years [6], guidelines for thyroid function monitoring have not been established for preterm infants. Therefo-re, we aimed to evaluate the collection time of T3, free T4 and TSH in preterm newborns.

Method

Study Population

We investigated 85 preterm newborns, they were born from June 2004 to December 2004. They were separated into four groups based on gestational age: Group A (GA, n = 18) – newborns aged < 30 weeks old, Group B (GB, n = 13) – newborns aged between 30 weeks + 1 day old and 32 weeks old, Group C (GC, n = 19) – newborns aged between 32 weeks + 1 day old and 34 weeks old and Group D (GD, n = 35) – newborns aged between 34 weeks + 1 day old and 36 weeks old. All procedures were approved by the Ethical Co-mmittee in Research of our University.

Collection time of Thyroid hormones and TSH in preterm newborns Simone Holzer de Moraes1, Silvia Espiridião2, Fernando A. Fonseca2, Luiz Carlos de Abreu2, Vitor E. Valenti2, 3, Ricardo Peres do Souto1

1 Disciplina de Bioquímica, Faculdade de Medicina do ABC, Brasil,2 Departamento de Morfologia e Fisiologia, Faculdade de Medicina do ABC, Brasil,3 Departamento de Medicina, Disciplina de Cardiologia, Universidade Federal de São Paulo, Brasil.

628



Inclusion Criteria

We included newborns younger than 36 weeks old after the responsible for each infant sign an agreement of Consent. Gestational age was deter-mined by maternal data: date of the last menstrua-tion and/or ultrasound, and/or by Capurro [7] and New Ballard [8] methods.

Exclusion Criteria

We excluded newborns with severe congenital anomalies, chromosomal abnormalities, those in which there was some indication in the maternal history of thyroid disease or medication with io-dine and non-compliance of family participation in the research.

Laboratory Examination

The levels of TSH (3rd generation), free T4 and total T3 were determined by chemiluminescence of blood samples that ranged between 1 and 2 ml of whole blood. The reference values of these tests for the equipments and Immulite® kit of the DPC Medlab manufacturer used in the study are, respectively, 0.4 – 4 mUI/mL for TSH, 70 – 170 ng/dL for T3 and for free T4 values are 0.65 – 2.3 ng/dL for children aged from one to 12 years old and 0.8 to 1.9 for adults. The values of TSH and T3 do not change in relation to age and to the three tests for differentiation for premature newborns. The samples were collected in six stages: 1st time

– umbilical cord; 2nd time – 3 days old; 3rd time – 7 days old; 4th time – 15 days old; 5th time –30 days old and; 6th time – 60 days old.


We applied Levene and Kolmogorov-Smirnov tests in order to check homogeneity of variances and adherence to the normal curve, respectively. For comparison between the groups we applied the one way ANOVA for parametric distributions and the Kruskal-Wallis for nonparametric variables. When we detected significant differences we ap-plied the Tukey - Honest Significant Differences (HSD) posttest in order to identify in which group there was difference. We used the ANOVA test for repeated measures to compare groups and times at the same time and the multiple comparison test of Newman-Keuls to determine at which time there were difference and the Tukey HSD posttest to verify differences between groups. Differences were considered significant when the probability of a Type I error was less than 5% (p < 0.05).

Results

We evaluated 85 preterm newborns, with a ba-lance between genders and with predominance of appropriate newborns for gestational age. The assessment of vitality at birth performed using the Apgar score of 1 and 5 minutes was similar between the four groups (Table 1).

Table 1. Characteristics of newborns regarding Apgar score at 1 and 5 minutes and gestational age (weeks) in each group

ParametersGroup A

< 30 weeksn (%)

Group B30-31+6/7 weeks n

(%)

Group C32-33 + 6/7 weeks

n (%)

Group D34-36 weeks

n (%)Apgar-1minute µ ± SD

Min - Max

n=176.29 ±2.33

2-9

n=135.07±3.09

1-9

n=197.26±1.85

1- 9

n=347.08±2.17

1-9Apgar-5minuteµ ± SDMin – Max

n=178.29± 1.40

6- 10

n=137.92±1.65

4- 9

n=198.7±1.48

3-10

n=348.8±1.19

5-10Gestational age µ ± SD

Min - Max

n=1827.92±2.08

24-30

n=1330.9±0.44

30.4- 31.86

n=1933.19±0.5632.43- 34

n=3535.25±0.6334- 36.29



We compared the results of hormone levels according to gestational age at the time of collec-tion and the reference values of the supplier of the kit used. In relation to TSH we observed that it progressively increased according to gestational age advancing and in all groups the higher levels were found in umbilical cord dosage where there was significant difference between groups A and C. Moreover, at this time of collection the values in all groups were above the benchmarks set by the manufacturer (0.4 – 4 mIU/ml) and the remaining doses were very close to those limits (Figure 1).

Figure 1. Variations of serum TSH according to the progress of pregnancy and sampling period. Group A (GA, n = 18) - newborns aged less than 30 weeks of gestational age, Group B (GB, n = 13) - newborns between 30 weeks + 1 day and 32 weeks of gestational age, Group C (GC, n = 19) - newborns between 32 weeks + 1 day and 34 weeks of gestational age and Group D (GD, n = 35) - newborns between 34 weeks + 1 day and 36 weeks of gestational age

Regarding the free T4 we found significant dif-ferences between gestational age groups, from the collection of umbilical cord until 60 days, always with newborns younger than 30 weeks old with lower values for 32 weeks old. No difference was observed between the collection times and all va-lues were within the reference set (0.65 – 2.3 ng/dl) (Figure 2).

We observed difference of T3 at doses of 3, 7, 14 and 30 days old, where the newborns with gestatio-nal age younger than 30 weeks old presented lower values than newborns with more than 34 weeks of gestational age. In relation to the collection times, the dosage of cord values was significantly lower than other times. When we performed the compa-

rison with the reference values (70 – 170 ng/dl), we observed that the two smaller groups presented lower levels compared to those established until the collection of the 7th day of life. In the two higher groups the averages were found above the determi-ned at collections of 30 and 60 days old (Figure 3).

Figure 2. Variations of serum free T4 according to the progress of pregnancy and sampling peri-od. Group A (GA, n = 18) - newborns aged less than 30 weeks of gestational age, Group B (GB, n = 13) - newborns between 30 weeks + 1 day and 32 weeks of gestational age, Group C (GC, n = 19) - newborns between 32 weeks + 1 day and 34 weeks of gestational age and Group D (GD, n = 35) - newborns between 34 weeks + 1 day and 36 weeks of gestational age

Figure 3. Variations of serum T3 according to the progress of pregnancy and sampling period. Group A (GA, n = 18) - newborns aged less than 30 weeks of gestational age, Group B (GB, n = 13) - newborns between 30 weeks + 1 day and 32 weeks of gestational age, Group C (GC, n = 19) - newborns between 32 weeks + 1 day and 34 weeks of gestational age and Group D (GD, n = 35) - newborns between 34 weeks + 1 day and 36 weeks of gestational age

630



Discussion

Our findings show that the values of thyroid hormones changed in preterm newborns, in infants below 30 weeks of gestational age it was directly proportional to gestational age. Moreover, the ide-al time of collection by this method for preterm newborns was from the 3rd day of life for TSH and free T4 and from the 7th day of life for T3. Thyroid hormones are essential for adaptation to extraute-rine life, including lung development and control of liquids, thermogenesis and metabolic processes [9-12]. An adequate level of serum T3 and T4 is im-portant for the maturation and functions to stimula-te the growth and development of various tissues, including skeletal, heart, gastrointestinal tract, and especially the central nervous system [13]. Des-pite the knowledge about the formation, function and thyroid dysfunction in the fetus and newborn, it is still difficult to distinguish physiological from pathological conditions due to the peculiarities of thyroid function during this period [14].

It is already well-established the differences of hormone levels between preterm newborns, term newborns and adult, however, the increase in sur-vival of smaller infants with extremely low birth weight and lower gestational age limits has made new reference values for this population. Given this new reality we stratified the premature infants in four gestational age groups and analyzed the levels of TSH, free T4 and T3 from birth to the collection of umbilical cord blood within 60 days. This co-llection period was determined from the analysis of the literature which shows that even for extremely premature infants stabilization of hormonal levels come after 45 days of life [14, 15].

We found levels of T3, free T4 and TSH gradu-ally lower the lower the gestational age. A similar finding was verified by Biswas et al [16], they re-ported significantly lower levels in newborns be-low 30 weeks of gestational age, especially T3 and free T4 compared to term newborn. Furthermore, a recent study showed that infants born with ge-stational age lower than 32 weeks old present high incidence of hypothyroidism [17].

When we analyzed the TSH, we observed that their values increased progressively with advan-cing gestational age in all groups and the highest level of this hormone was found in the cord do-

sage. This peak in the first 30 minutes of life was described by several authors and reflects the res-ponse to cooling. After this initial peak there was a fall in TSH levels that remain similar to the last dose with no significant differences between gro-ups. Additionally, Murphy et al [18] reported si-milar results to ours, they found no statistical dif-ference of TSH values between preterm and term newborns. Williams et al [19] also observed no differences in gestational age, however, the values of cord dosage were higher compared to other co-llection times, which in this study was conducted at 7, 14 and 28 days of life. Williams et al [20] evaluated the hormones only in the dosage of the cord and also found no statistical differences in gestational age by checking only a trend to lower levels at the extremes of gestation (below 27 and above 42 weeks).

Analyzing the values of free T4, we found dif-ferences related to gestational age from the collec-tion of cord until 30 days. The group A (below 30 weeks) always presented lower values compared to those of groups C and/or D (over 32 weeks). By observing the curves we found that for newborns with less than 32 weeks of gestational age, there was decrease of free T4 in dosages of 72 hours and 7 days compared to the dosage of cord, while the opposite occurred with the two higher groups, confirming the review literature and contradicting Van Wassenaer and Kok [15] who described hy-pothyroxinemia of prematurity as the period in which the levels of T3 and total and free T4 are lower, particularly among those with gestational age less than 30 weeks. On the other hand, Cuestas [21], comparing premature infants 30 – 37 weeks of gestational age with term newborns found in both groups higher values of free T4 at doses of 12 and 72 hours compared to those in the dosage of cord, however, with values significantly lower in preterm infants. Confirming our findings, Frank et al [22], using population screening of 1989 – 1993 in Massachusetts found lower levels of free T4 dosage from second to third day until 14 days of life in newborns weighing less than 1500g, howe-ver, in their study the classification of the newborn was made from the weight and not gestational age. Rooman et al [23] also found significantly lower levels of free T4 when collecting in 14 days of life, compared to the first day on gestational age below



31 weeks, while the opposite occurred, i.e. higher values with 14 days in infants with 32 weeks of gestational age. In the analysis between groups, the authors found differences between the values of free T4 in the first days in the group with gesta-tional age below 29 weeks, with all the others with higher gestational age. Williams et al [19] obser-ved a gradually decrease of postnatal free T4 le-vels in newborns aged 31 – 34 weeks and 28 – 30 weeks and markedly lower in infants aged 23-27 weeks but did not find lower values than umbilical cord in either group.

In our study T3 showed parallel curves, accom-panying the increase of gestational age. In our analysis we suggest that for T3, gestational age below 32 weeks results in significantly lower va-lues, a finding not shared by a previous study [21] which found no differences between preterm and term newborns. Williams et al [19] also found a progressive increase in T3 levels from the mea-surement of umbilical cord and the magnitude of this increase was related to gestational age. The authors compared the umbilical cords levels of T3 with 7, 14 and 28 days of life of the preterm newborns and verified statistical difference in all collection times. However, unlike our study, they did not evaluate the differences between groups and within each collection time.

According to our results, comparing them to the benchmark we observed that TSH values in the dosage of the umbilical cord in all groups are far above it, keeping the other times very close to the standard. With these data we may consider that the ideal time of collection is from 72 hours of life.

The free T4 has practically all averages within the reference range, except in Group A that sam-ples of 72 hours and seven days presented values below this standard, supporting the hypothesis of hypothyroxinemia, since this condition is related to newborns below 30 weeks of gestational age and our group presented an average of 28 weeks. Based on levels of free T4 the collection of scree-ning congenital hypothyroxinemia should occur after the 7th day in order to minimize the margin of error. In relation to T3 the ideal time of collection in which gestational age does not change the result is after the first week of life.

Adams et al [24] aimed to establish bench-marks for the technique of equilibrium dialysis

straight to the T4 and TSH immunometric test in premature infants and reported results similar to ours. These authors defined two default values for T4, one for infants 25 – 30 weeks of gestational age and another for 31 – 36 weeks of gestational age they found correlation for TSH, however, they determined only a benchmark for all premature of 25 – 36 weeks.

Our study, for the most part, confirms the fin-dings of other authors on the evolution of thyroid hormones in preterm newborns and the presence of transient hypothyroxinemia in these infants. Nevertheless, it would be required a larger num-ber of subjects and a collection time of at least one year to prepare a reference curve for premature newborns, since seasonal changes may affect re-sults. Nevertheless, more than this confirmation, this study reveals to the team of neonatal care how thyroid function has been “forgotten”, especially in very premature newborns, allowing from this moment on another way to evaluate this function with rapid results and assurance if it is collected at the ideal time.

In conclusion, the values of T3, free T4 and TSH ranged in preterm newborns, they were di-rectly proportional to gestational age in newborns under 30 weeks of gestational age. Clinical ma-nifestation with confirmation of transient hypot-hyroxinemia in preterm newborns characterized by low free T4 and TSH was normal in the first 30 days of life. The ideal time of collection by this method for premature newborn is from the 3rd day of life on for TSH and free T4 and from the 7th day on for T3.

Acknowledgements

This research received financial support from Núcleo de Estudos de Pesquisa da Faculdade de Medicina do ABC (NEPAS-FMABC).

References

1. Khan DA, Cheema AN, Anwar M, Khan FA. En-docrine Dysfunction in Beta-Thalassaemic Major Patients at Rawalpindi, Pakistan. HealthMED J 2010;3:580-585.

632



2. Surkovic I, Suljevic I, Kudumovic A. Comparison of arterial blood pressure values in dysfunction of thyroid gland before and after the therapy. Heal-thMED J 2010;3:638-642.

3. Hajder E, Hajder M, Zukic E, Samardzic R. Basal Hyperprolactinemia, Occult Hyperprolactinaemia and Gonadotropins secretion in infertile women. HealthMED J 2010;3:664-671.

4. Uhrmann S, Marks KH, Maisels MJ, Friedman Z, Murray F, Kulin HE, Kaplan M, Utiger R. Asses-sment of Thyroid function in the preterm infant: a longitudinal assessment. J Pediatr 1978;92:968-73.

5. Mandel SJ, Hermos RJ, Larson CA, Prigozhin AB, Rojas DA, Mitchell ML. Atypical hypothyroi-dism and the very low birthweight infant. Thyroid 2000;10:693-5.

6. van Wassenaer AG, Kok JH. Hypothyroxinaemia and thyroid function after preterm birth. Semin Ne-onatol 2004;9:3-11.

7. Capurro H, Konichezky S, Fonseca D, Caldeyro-Barcia R. A simplified method for diagnosis of gestational age in the newborn infant. J Pediatr 1978;93:120-122

8. Ballard JL, Khoury JC, Wedig K, Wang L, Eilers-Walsman BL, Lipp R. New Ballard Score, expanded to include extremely premature infants. J Pediatr 1991;119417-423.

9. Toledo SP, dos Santos MA, Toledo Rde A, Lourenço DM Jr. Impact of RET proto-oncogene analysis on the clinical management of multiple endocrine neo-plasia type 2. Clinics 2006;61:59-70.

10. Toledo SP, Lourenço DM Jr, Santos MA, Tavares MR, Toledo RA, Correia-Deur JE. Hypercalcito-ninemia is not pathognomonic of medullary thyro-id carcinoma. Clinics 2009;64:699-706.

11. Pereira JC Jr, Pradella-Hallinan M, de Lins Pe-ssoa H. Imbalance between thyroid hormones and the dopaminergic system might be central to the pathophysiology of restless legs syndrome: a hy-pothesis. Clinics 2010;65:548-54.

12. Williams FLR, Mires GJ, Barnett C, Ogston SA, Toor Hv, Visser TJ, Hume R. Transient Hypot-hyroxinemia in preterm infants: The role of cord sera thyroid hormone levels adjusted for prenatal and intrapartum factors. J Clin Endocrin Metab 2005;90:4599-4606.

13. Ogilvy-Stuart AL. Neonatal thyroid disorders. Arch Dis Child Fetal Neonatal Ed 2002;87: 165-171.

14. Araujo MCK, Silva MHBN, Diniz EMA, Vaz FAC. A tireóide no feto e no recém-nascido: peculiari-

dades funcionais e principais doenças tireoidia-nas. Pediatr 2003;25:51-60.

15. Van Wassenaer A, Kok JH. Hypothyroxinaemia and thyroid function after preterm birth. Seminars in Neonatology 2004;9: 3-11.

16. Biswas S, Buffery J, Enoch H, Bland JM, Walters D, Markiewicz M. A longitudinal assessment of thyroid hormone concentrations in preterm in-fants younger than 30 weeks’ gestation during the first 2 weeks of life and their relationship to outco-me. Pediatr 2002;109: 222-227.

17. Chung HR, Shin CH, Yang SW, Choi CW, Kim BI, Kim EK, Kim HS, Choi JH. High incidence of thyroid dysfunction in preterm infants. J Korean Med Sci 2009;24:627-31.

18. Murphy N, Hume R, Toor Hv, Matthews TG, Og-ston SA, Wu SY, Visser TJ, Williams FLR. The Hy-pothalamic- Pituitary- Thyroid Axis in Preterm infants; Changes in the first 24 hours of postnatal life. J Clin Endocr Metab 2004;89:2824-2831.

19. Williams FLR, Simpson J, Delahunty C, Ogston SA, Bongers-Schokking JJ, Murphy N, Toor Hv, Wu S-Y, Visser TJ, Hume R. Developmental Trends in Cord and Postpartum Serum Thyroid Hormo-nes in Pretem Infants. J Clin Endocr Metab 2004; 89: 5314-5320.

20. Williams FLR, Ogston SA, Toor H, Visser TJ, Hume R. Serum Thyroid hormones in preterm infants: association with postnatal illnesses and drug usa-ge. J Clin Endocr Metab 2005;90:5954-5963.

21. Cuestas RA. Thyroid function in healthy prematu-re infants. J Pediatr 1978;92:963-967.

22. Frank JE, Faix JE, Hermos RJ, Mullaney DM, Rojan DA, Mitchell ML, Klein RZ. T. Thyroid function in very low birth weight infants: Effects on neonatal hypothyroidism screening. J Pediatr 1996;128:548-554.

23. Rooman RP, Du Caju MVL, Op de Beeck L, Docx M, Van Reempts P, Van Acker KJ. Low thyroxi-naemia occurs in the majority of very pretem newborns. Eur J Pediatr 1996;155:211-215.

24. Adams LM, Emery JR, Clark J, Carlton EI, Nel-son JC. Reference ranges for newer thyroid fun-ction tests in premature infants. J Pediatr 1995; 126: 122-127.

Corresponding author Ricardo Peres do Souto, Disciplina de Bioquímica, Faculdade de Medicina do ABC, Brasil, E-mail: [email protected]



Abstract

Objective: Aim of the study was to determine relationship between parental smoking and respi-ratory illness in infants.

Methods: This questionnaire-based study was conducted between February and May 2008 at a hospital with pediatric clinics in Erzurum in the north-east of Turkey and it included 150 infants with respiratory disease and their mothers.

Results: The infants’ the mean age was 8.08±2.62 months. It’s found that infants exposed to passive smoking came more times to hospitals for bronchopneumonia and pneumonia diseases than infants not exposed to passive smoking and the differences between them have statistically si-gnificant.

Conclusion: Health professionals need to in-form parents about the relationship between pa-rental smoking and respiratory illness in infants.

Key words: Parental Smoking; Respiratory Ill-ness; Infant; Nursing

Introduction

Exposure to tobacco smoke is an important pe-diatric health issue, and it is essential that pediatric health care providers consider tobacco exposure in patient assessment and advice. There is strong evi-dence that exposure is associated with a number of childhood illnesses and is deleterious to child he-alth in many ways [1-4], not only for the more ob-vious respiratory illnesses [5-8] but also for other illnesses such as meningococcal disease4 and oti-tis media1. The majority of studies on the effects of tobacco smoke exposure in children have focu-

sed on passive exposure to environmental tobacco smoke (ETS), usually associated with living in a home in which one or more parents actively smo-kes [1,9]. Preventing exposure to cigarette smoke in infancy and childhood has significant potential to improve children’s health worldwide [10].

Parental smoking has been demonstrated to be associated with adverse respiratory outcomes in children [11,12]. However; the differential effects of prenatal and postnatal tobacco smoke exposure on the respiratory health of young children have yet to be fully elucidated. Reports of stronger associations between infant respiratory illnesses and maternal smoking than with paternal smoking [13], may represent a congenital effect of tobacco metabolites on intrauterine lung or airway deve-lopment [14-17]. Alternatively, increased contact between young children and their mothers could lead to increased exposure to ETS exposure from this source [18,19].

Infants’ exposure to ETS is a major cause of morbidity (e.g., otitis media, respiratory infecti-ons, and sudden infant death, asthma and asthma exacerbations) for children younger than 5 years [20]. Parental smoking also has an association with child hospitalization. In particular, the risk of hospitalization for any lower respiratory tract ill-ness is up to four times greater in children exposed to ETS [21].

We carried out a descriptive study to exami-ne the exposure passive smoking in the stories of children from 0-1 years who had became an in-patient in a pediatric clinic because of respiratory illness or symptoms.

Relationship between Parental Smoking and Respiratory Illness in InfantsAyşe Gürol1, Cantürk Çapik2, Serap Ejder Apay3, Çiğdem Köçkar4

1 Atatürk University, College of Health Service, Department of Dialysis, Turkey, 2 Kafkas University, Kars Health School, Department of Public Health Nursing, Turkey, 3 Atatürk University, Faculty of Health Science, Department of Midwifery, Turkey,4 Atatürk University, Faculty of Health Science, Department of Surgery Nursing, Turkey.

634



Methods

Sample

This questionnaire-based study was conducted between February and May 2008 at a hospital with pediatric clinics in Erzurum in the north-east of Tur-key and it included 150 infants with respiratory di-sease and their mothers. Between the study dates all infants who were admitted to the clinics from acu-te/chronic any respiratory illness or symptom, and who met the study inclusion criteria were accepted into this study. The inclusion criteria for the infants were: vaginal birth, full-term gestation (>36 weeks), aged 0–12 months, and absence of congenital ano-malies and perinatal health problems. These criteria were used to exclude infants with conditions that may have had additional influences affecting lung growth and development, such as premature birth. The exclusion criteria for the infants were: preterm gestation (<36 weeks), perinatal health problems, and congenital anomalies.

This study included 150 infants with respira-tory illness. Major categories of illness affecting the participant infants included: 78.0% broncho-pneumonia, 12.0% pneumonia, 10% lumbar pne-umonia, and acute bronchiolitis. The infants were 0–12 months and the mean age was 8.08±2.62 months, most infants were male (61.3%).

Data collection

The interviews were held when all mothers attended the morning pediatric clinics. The data were collected with a questionnaire prepared by the researchers according to the results of a detailed literature review [9, 17, 22, 23]. Before the study data collection began, the researcher’s pilot tested the questionnaire on a sample of 10 parents, nece-ssary revisions were made afterward, and this data were not included in the study. The questionnaire comprised 14 items concerning the baby’s age and sex (2), the family’s smoking habits (7), the baby’s disease (5). The same researcher administered the questionnaire during a face-to-face interview with mothers. The interview lasted approximately 5–10 minutes and mothers answered the questionnaire on behalf of their infant-patient.


Permission to undertake this study was gai-ned from the ethical committee at the Institution of Hospital Directors and informed consent was obtained from each parent participant. Prior to this study, the mothers were informed of the purpose of the research. Participants were assured of their right to refuse to participate or to withdraw from the study at any stage. The anonymity and confi-dentiality of participants were guaranteed.


We analyzed data using SPSS 11.5 for Win-dows and expressed data as percentages. Chi-squ-are tests were used for comparison of exposure passive smoking and story of respiratory illness. The confidence interval was 95%; p < .05 was considered to be statistically significant.

Results

The family smoking habits were expressed in percentages and number values (Table 1). Then, we analyzed the relationship between exposure passive smoking and story of respiratory illness (Table 2).

One hundred and twenty infants (80.0%) lived in a house with at least one person who smoked. In households where at least one person smoked, 86 homes (71.7%) had smoking inside the house. In smoking households, 31 infants (25.8%) lived with two and more than two people who smo-ked. Both fathers and mothers in the household accounted for the highest percentage of smokers (34.2%). Fathers accounted for the second highest percentage of smokers.

Table 2 summarizes relationship between the respiratory illness and exposure passive smoking of the infants. It’s found that infants exposed to passive smoking came more times to hospitals for bronchopneumonia and pneumonia diseases than infants not exposed to passive smoking and the differences between them have statistically si-gnificant. The seeing periods of illness were two months or less time in 67.5% of infants. There



Table 1. Distribution of Family Smoking Habits (n=120)Family Smoking Habits n %

The environmental tobacco smoke (n = 150)Exposure Not exposure

12030

80.020.0

Period of exposure to tobacco Prenatal periodPostnatal periodBoth prenatal and postnatal period

484359

32.028.739.3

Smoker(s) in infant’s family FatherMother Both father and motherOther adults

37164126

30.813.334.221.7

Exposure passive smoking In same room with infantsIn a different room from infants

8634

71.728.3

Number of home smokers1 person2 person3 and high person

494031

40.833.325.8

The amount of cigarettes the mother smoked in a dayHalf a packet 16 100.0The amount of cigarettes the father smoked in a dayHalf a packetA packet

2512

67.632.4

Table 2. Relationship between Exposure Passive Smoking and Respiratory Illness

Variables*Exposure passive smoking (n = 120)

Not Exposure passive smoking (n = 30) p

n % n %Categories of illnessBronchopneumoniaLumbar PneumoniaAcute Bronchitis Pneumonia

960618

80.00

5.015.0

21630

70.020.010.0

0

.000

Seeing period of illness**2 months or less 3 months or more

8139

67.532.5

264

86.713.3 .043

Which times became inpatient for a illnessOnceTwo timesThree times

583131

48.325.825.8

18120

60.040.0

0

0.006

A history of frequent infection passed to the babyYesNo 58

6248.351.7

1515

50.050.0 1.00

Baby’s allergy historyYesNo

4080

33.366.7

228

6.793.3 .003

*Percentage of column(s) was taken.**The period between the first choice for the infant to hospital because of respiratory illness/symptom and the date of this study

636



was a significant relationship between seeing pe-riod of respiratory illness and exposure to hou-sehold smoker as shown in Table 2 (p = 0.043). It’s found that there was statistically significant difference between exposure passive smoking and categories of illness, seeing period of illness, whi-ch times became inpatient for a respiratory illness, and infants’ allergy story (p<0.05). It’s shown that most of infants who exposed to passive smoking (48.3%) were first inpatient.

Discussion

Our study shows an association between envi-ronmental tobacco smoke and respiratory illness throughout the first year of life. This finding sup-ports the results of Vargas et al. [20]. In their study, Jiménez-González et al. [24] reported that of the children affected by respiratory illness, 16.9% had exposure to smoke inside the home.

Our results have important implications regar-ding the current understanding about respiratory illness during early life: infants and children with parents who smoke have an increased seeing peri-od of respiratory illness, and there is strong associ-ation between seeing period of respiratory illness and exposure passive smoking. In this study it is found that the exposure passive smoking affects both the categories of illness and infant’s history of allergy. Similar findings involving familial fac-tors and passive tobacco smoke exposure directly influencing respiratory illness have been reported in children [5,25,26]. In their study, Radić et al. [27] reported that children of mothers who smoke during the first year of life had more respiratory infections. But, in their study on primary school children, Jiménez-González et al. [24] reported that there is no difference between children who have exposure to smoke and children who do not have exposure to smoke at home in terms of respi-ratory diseases.

Conclusions

Exposure to tobacco smoke is an important pe-diatric health issue, and it is essential that pediatric health care providers consider tobacco exposure

in children assessment and advice. This study de-monstrated the important association between see-ing period of respiratory illness and exposure to household smoking. In this study we found that the presence of smokers in an infants’ family and smoking in same room with infants affected the seeing period of respiratory illness, categories of illness, and the frequency of hospitalization. It is necessary to protect infants with respiratory ill-ness from ETS because it has a negative impact on their health. Nursing professionals should in-form parents about the relationship between pa-rental smoking and respiratory illness in infants. A simple health education intervention provided by nurses to mothers in a busy clinical setting can be effective in the short-term to motivate mothers to take actions to protect children from exposure to passive smoking produced by the father. Nurses working in child healthcare centers have an overall positive attitude to tobacco prevention but need continuous education and training in communica-tion skills, especially to reach socially vulnerable groups. Regular feedback from systematic follow-ups might increase motivation for this work.

Limitations of the study

One limitation of our study was the small sam-ple size and the sample was self-selected. Future studies need to be conducted with larger samples and a longitudinal study including the prenatal and postnatal period should be completed before the findings can be accepted with a greater degree of confidence.

Acknowledgement

We did not receive any financial support for this study. We thank the mothers who participated in this study.



References

1. Fischer M, Hdeberg K, Cardosi P, Plikaytis BD, Hoesly FC, Steingart KR, Perkins BA. Tobacco smoke as a risk factor for meningococcal disease. Pediatric Infectious Diseases. 1997; 16: 979–983.

2. Hofhuis W, de Jongste J, Merkus P. Adverse health effects of prenatal and postnatal tobacco smoke ex-posure on children. Archives of Disease in Childho-od. 2003; 88: 1086–1090.

3. Lancaster T, Stead L, Shepperd S. Helping parents to stop smoking: which interventions are effective? Pe-diatric Respiratory Reviews. 2001; 2(3): 222–226.

4. Man Kwong N, Das G, Proctor C, Whyte A, Pri-mhak MR. Diagnostic and treatment behaviour in children with chronic respiratory symptoms: relati-onship with socioeconomic factors. Thorax. 2002; 57: 701–704.

5. Hudson L, White A, Roseby R. Tobacco smoke ex-posure in hospitalized Aboriginal children in Cen-tral Australia. Journal of Paediatrics and Child Health. 2009; 45: 224–227.

6. Mannino D, Moorman J, Kingsley B, Rose D, Re-pace J. Health effects related to environmental tobacco smoke exposure in children in the United States: data from the Third National Health and Nutrition Examination Survey. Archives of Pedia-tric and Adolescent Medicine. 2001; 155: 36–41.

7. Morgan W, Crain E, Gruchalla R, O’Connor GT, Ka-ttan M, Evans R. III. Inner-City Asthma Study Group. Results of a home-based environmental intervention among urban children with asthma. New England Journal of Medicine. 2004; 351: 1068–1080.

8. Tepper S, Williams-Nkomo T, Martinez T, Kisling J, Coates C, Daggy J. Parental smoking and airway reactivity in healthy infants. American Journal of Respiratory and Critical Care Medicine. 2005; 171, 78–82.

9. Li JS, Peat JK, Xuan W, Berry G. Meta-analysis on the association between environmental tobacco smoke (ETS) exposure and the prevalence of lower respiratory tract infection in early childhood. Pedi-atric Pulmonology. 1999; 27: 5–13.

10. Priest N, Roseby R, Waters E, Polnay A, Campbe-ll R, Spencer N, Webster P, Ferguson-Thorne G. Family and career smoking control programs for reducing children’s exposure to environmental to-bacco smoke. Cochrane Database Systematic Re-views. 2008; 8(4): CD001746.

11. Landau LI. Parental smoking: asthma and whee-zing illnesses in infants and children. Pediatric Respiratory Reviews. 2001; 2: 202–206.

12. Tsai CH, Huang JH, Hwang BF, Lee YL. House-hold environmental tobacco smoke and risks of asthma, wheeze and bronchitic symptoms among children in Taiwan. Respiratory Research. 2010; 29: 11.

13. Thomas RE, Baker P, Lorenzetti D. Family-based programs for preventing smoking by children and adolescents. Cochrane Database Systematic Revi-ews. 2007; 1: CD004493.

14. Henderson AJ, Sherriff A, Northstone K, Kukla L, Hruba D, Avon Study of Parents and Children (ALSPAC) Study Team, European Longitudinal Study of Pregnancy and Childhood (ELSPAC) Coordinating Centre. Pre- and postnatal paren-tal smoking and wheeze in infancy: cross cultural differences. European Respiratory Journal. 2001; 18: 323–329.

15. Garrison MM, Christakis DA, Ebel BE, Wiehe SE, Rivara FP. Smoking cessation interventions for adolescents: a systematic review. American Jour-nal of Preventative Medicine. 2003; 25: 363–367.

16. Roddy E, Romill N, Challenger A, Lewis S, Britton J. Use of nicotine replacement therapy in socioe-conomically deprived young smokers: a commu-nity-based pilot randomized controlled trial. To-bacco Control. 2006; 15: 373–376.

17. Carlsen K, Lødrup Carlsen KC. Respiratory ef-fects of tobacco smoking on infants and young children. Paediatric Respiratory Reviews, 2008; 9: 11–20.

18. Moshammer H, Hoek G, Luttmann-Gibson H, Neuberger MA, Antova T, Gehring U, Fletcher T. Parental smoking and lung function in children: an international study. American Journal of Res-piratory and Critical Care Medicine. 2006; 173: 1255–1263.

19. Pattenden S, Antova T, Neuberger M, Nikiforov B, De Sario M, Grize L, Fletcher T. Parental smoking and children’s respiratory health: independent ef-fects of prenatal and postnatal exposure. Tobacco Control. 2006; 15: 294–301.

20. Vargas PA, Brenner B, Clark S, Boudreaux ED, Ca-margo Jr CA. Exposure to environmental tobacco smoke among children presenting to the emergency department with acute asthma: A multicenter study. Pediatric Pulmonology, 2007; 42: 646–655.

638



21. Ralston S, Roohi M. A Randomized, Controlled Trial of Smoking Cessation Counseling Provided During Child Hospitalization for Respiratory Ill-ness. Pediatric Pulmonology. 2008; 43: 561–566.

22. Henderson AJ. The effects of tobacco smoke ex-posure on respiratory health in school-aged chil-dren. Pediatric Respiratory Reviews. 2008; 9: 21–28.

23. Yamasaki A, Hanaki K, Tomita K, Watanabe M, Hasagawa Y, Okazaki R, et al. Environmental to-bacco smoke and its effect on the symptoms and medication in children with asthma. International Journal of Environmental Health Research, 2009; 19(2): 97–108.

24. Jiménez-González C, Santini V, Figueroa Cosme WI, Parilla Idel C. Do parents know about the adverse effects of passive smoking and the relati-onship with respiratory illness on their children? Boletín de la Asociación Médica de Puerto Rico. 2008; 100(2): 39–46.

25. Young S, Sherrill DL, Arnott J, Diepeveen D, Le-Souef PN, Landau LI. Parental factors affecting respiratory function during the first year of life. Pediatric Pulmonology. 2000; 29: 331–340.

26. Friguls B, Garcia-Algar O, Puig C, Figueroa C, Sunyer J, Vall O. Perinatal exposure to tobacco and respiratory and allergy symptoms in first ye-ars of life. Archivos de Bronconeumologia. 2009; 45: 585–590.

27. Radić S, Zivković Z, Erdeljan N, Cerović S, Jo-cić-Stojanović J. Influence of environmental toba-cco smoke on characteristics of childhood asth-ma. Srpski Arhiv Za Celokupno Lekarstvo. 2009; 137(3–4): 152–159.

Corresponding author: Ayşe Gürol, Atatürk University, College of Health Service, Department of Dialysis, Turkey, E-mail: [email protected]



Abstract

Nosocomial or hospital infections include di-seases that occur 48 hours after preparation for treatment. One infection is considered as a hos-pital infection if the patient in hospital admission hadn’t clinical symptoms of infection, as well as hadn’t been in incubatory period. Hospital infecti-ons are caused by microorganisms in the hospital environment. Currently 50-10% of patients, who are admitted to hospital, get a hospital infection. Prevention of nosocomial infections is careful identification of risk factors for infection develo-pment. Prevention strategy is divided into several groups, depends on the factors that influence the development of infection.

Key words: Infections, hospital, symptoms, microorganisms, prevention

Sažetak

Hospitalne ili nozokolijalne infekcije obuhva-taju bolesti koje se javljaju 48h nakon priprema na lečenje. Smatra se da je infekcija hospitalna ukoliko bolesnik na prijemu u bolnicu nije imao kliničku sliku infekcije, niti je bio u inkubatornom periodu. Ta infekcija nastaje mikroorganizmima iz bolničke sredine. Aktuelno 5-10% bolesnika koji se primaju na bolničko lečenje dobije neku hospitalnu infekciju. Prevencija nozokolijalnih in-fekcija podrazumeva pažljivu identifikaciju fakto-ra rizika za razvoj infekcije. Strategija prevencije podeljena je u nekoliko grupa zavisno od faktora koji utiču na razvoj infekcije.

Ključne riječi: Infekcija, bolnica, simptomi, mikroorganizmi, prevencija

Introduction

Inter-hospital infections are infections acquired during a patient stay in hospital, at least 48 hours after his reception in hospital and the most 48 ho-urs after his leaving the hospital.

Infections could be endogenous authentic and exogenous infections or cross infections. Frequ-ency of these infections in hospitalized patients is about 5-10% and in case of intensive care this percent is about 15-20%. Localization of the in-fections is the most frequent in urinary system with 35& of overall patients. Mainly, gram – ne-gative pathogens are represented. Because of lar-ge morbidity and expenses of medical treatment, it is very important to apply protocols concerning prophylaxis of hospital infections.

Intrahospital or nosocomial infections are in-fections acquired during the hospital stay, at least 48 hours after acceptance in the hospital, or the latest 48 hours after discharge from the hospital. It is important that there was no infection before or person is not in the incubation time before the acceptance in the hospital. Intrahospital infections are endogenous autoinfections or self infections caused by saprophytes of facultative pathogens as a result of diminished self defense mechanisms or impairment of natural defensive barriers. Infecti-ons could be exogenous, or cross infection, whe-re the pathogens are transferred directly from one person to another, or indirectly, that means tran-sfer via the contaminated food, drugs, water etc.

Both of them are causes of the complicated hospital treatment, increased morbidity, increased mortality, cost of the treatment, externalization of the hospital microorganisms in the communal en-

Control and prophylaxis of gram negative nosocomial infections in the intensive care unitsSvetlana Pavlovic, Natalija Vukovic, Biserka Ignjatovic, Vladimir Milic, Slobodan Ljubenovic, Zdenka Kalcic, Ivan Ignjatovic

Clinical centre Nis, Centre for Anesthesiology and Reanimatology, Clinic for urology, Serbia

640



vironment and the spread among the healthy po-pulation as well. Frequency of hospital infections is between 5% and 10% and 15-20% in the inten-sive care units.1

First written data about the attempts of health workers in solving hospital infection appeared in the XIX century literature. First international conference about hospital infections was held in 1970, which highlighted that inclusion of all heal-th professionals, especially medical doctors, was mandatory in the treatment of hospital infections. Wide spectrum of preventive clinical activities in the infection control is necessary.

Location of the hospital infection

Hospital infections are the most frequently lo-cated in the urinary tract: 35%, surgical wounds 20%, bloodstream infection 15%, respiratory tract infections 15%, digestive system skin and nervous system 15%. 2

Urinary tract infections are associated with the use of urinary catheter. They are caused by gram negative resistant bacteria species. These infecti-ons take a significant sometimes even life threate-ning risk. Bloodstream infections and respiratory tract infections are more serious with the highest price of treatment.

Causes of gram negative hospital infections - Enterobakteries: E. Coli, Klebsiella

pneumonie, Proteus mirabilis - ESCPPM group : Enterobacter, Serratia

spp, Citobacter freundii, Providencia, Pseudomonas aureginosa, Morganela

- Gram negative bacili : Pseudomonas spp i Acinetobacter spp

Causative bacteria for gram negative hospi-tal infections are becoming more resistant to the application of standardized antibiotic protocols. Hospital mortality is increased due to infection with resistant pathogens, so new generations of antibiotics are introduced in the clinical practice, and consequently price of the treatment is incre-ased.

Prophylaxis of hospital infections

Prophylaxis of nosocomial infection includes complete detection of risk factors for the infection development. Prophylaxis strategy is divided into several steps depending on influence of infection development: personal education, improvement in the quality of treatment and changes in the system of treatment as well. Goal of the prophylaxis is the application and improvement of general hygienic and sanitary praxis for the removal of the well known risk factors, as well as, removal of envi-ronmental factors responsible for the appearance of the hospital infections. Standards could be con-sidered as: general, standards according to clinical and epidemiological indications, standards inclu-ded in diagnostic procedures, treatment and care, and other standards.

Spread of infection in the hospital environment

Infection spread in the hospital circumstances depends on infective agent, host susceptibility, and the ways of transmission. Source of infecti-on could be a host, hospital staff or visitors. All of them could have acute disease; they could be in the incubation time, colonized persons, or per-manent bacterial careers. Other possible resources are: endogenous environment of the patient, con-taminated objects in the intensive care unit, drugs or medical devices in the environment. Numero-us factors from the patient could affect patient’s susceptibility like: chronic diseases, primary or secondary immunologic incompetence, surge-ry, stress, antibiotic therapy longer than 10 days, presence of multiresistant bacteria in the hospital environment and possible gene of resistance exc-hange. Possible bacterial transfer may be direct-over the hands of hospital staff or indirect-over the contaminated things, equipment or instruments. Indirect transmission is possible through the air, food or water. Contact is the most frequent way of spread of hospital cross infections. Hand washing is usually called as the most important measure in decreasing the risk of infection spread from one person to another, from one place to another, or for the spread of infection from primary infection



site to another site on the same person. Detailed hand washing is mandatory between the contacts with patients, tissue fluids, ecscretions and secre-tions, equipment or medical documentation of the patient.

Gloves usage plays an important role in the re-striction of bacterial spread, because they provide barrier to the blood, decrease bacterial migration during invasive and other procedures from the staff to the patient, and prevent spread of the in-fection between the patients. Gloves exchange as well as handwashing before and after the proce-dure are always obligatory. Disinfection fluids are necessary especially alcohol in the concentration of 65%-95%, because of the proved excellent ger-micide activity in vitro, especially against gram negative bacteria, including pathogens resistant to multiple antibiotics (MRSA and VRE).3

Prophylaxis of the urinary tract infection caused by urinary catheter

The most frequent gram negative cross infecti-ons are caused by the urinary catheter. Center for the disease control from Atlanta gave suggestions for the prevention of urinary tract infections.4

Category 1- strong recommended statements - Staff education for the adequate technique

of catheter placement and care, - Catheterization only in necessary situation, - Accentuate the importance of hand washing, - Catheter placement and sterile equipment, - Catheter ensure adequate, - Adequate urine sampling, - Maintain permanent urine flow.

Category 2 facultative recommendations - Periodical hospital staff reeducation, - The narrowest possible urinary catheter use, - Avoid system washing unless for the

prevention of obstruction, - Avoid daily care of the meatal care, - Do not change catheter after fixed periodical

intervals.

Category 3 marginal statements - Reconsider other ways of urinary drainage

before the catheter placement,

- Change collecting system in cases with impaired sterility of the system,

- Spatial separation of patients with urinary catheter with infection and without it,

- Periodical personal reeducation.

It is necessary to avoid urinary catheter during the diagnostic procedures, or in incontinent pati-ents as an alternative to medical care. The most restrictive approach regarding the time of catheter use is an important prerequisite for the limitation of urinary tract infection.5, 6

Recommendations for the prophylaxis of gram negative nosocomial cross pneumonia

- Education of the staff about pneumonia and ways of prophylaxis

- Follow up of pneumonia appearance in patients after the surgery and in patients with artificial ventilation in order to define bacterial species and antibiotic susceptibility.

- Use of the standard procedures of sterilization of the equipment which is in the intimate contact with the lower respiratory tract.

- Sterilization of all parts of the artificial ventilation equipment between the patients

- Use sterile water for the humidifiers in the artificial ventilation device

- Mandatory hand washing before and after the contacts with mucous membranes regardless of the gloves

- Take on the gloves and wash hands after every touch of tracheostomy or endotracheal tube or the respiratory device

- Exchange the suction extension tube for the respiratory secrets aspiration, between the patients and container.

- Head elevation 30/45 degrees to the bed - Postoperative cough stimulation, deep

breathing and the mobilization of patients with preexistent pulmonary disease

- Immunization of patients with the high risk of infection, persons over the age of 65, and persons with comorbidities and immunodeficiency

- Do not prevent pneumonia with the systemic antibiotic administration.

642



Suggestions for the prophylaxis of bloodstream infections caused by intravenous catheter

- Education about indications, placement and catheter care

- Careful follow up of the punction site and maintain standardized documentation

- Hands hygiene during the catheter placement and after every manipulation with the catheter

- Aseptic technique with the use of sterile gloves is mandatory

- Skin treatment with the iodine tincture, 70% alcohol or 2% chlor hexidine

- Sterile gauze is used for the bandage or transparent bandage for the catheter punction site

- Choice of the useful catheter and remove it immediately when it becomes unnecessary

- Do not give prophylactic antibiotics during the catheter placement and use

- Use antibiotic coated or antimicrobial coated catheter at the same site for five days

- Use the catheter with the muff whenever supposed time of use is longer than three weeks

- Choice of the punction site depends on the catheter use in the future7

Conclusion

In order to decrease IHI, in one hand, it is ne-cessary to provide permanent team work with goal to carry out continuous monitoring on staffs, pati-ents, hospital surrounding, sterility of instruments, medical solutions, etc. In another hand, permanent control on realization of overall known measures for prevention of possible infection spread is also very important. Adoption and respect on guideli-nes for prevention and control of IHI are crucially important.

References

1. Guideline for prevention of surgical site infecti-on, Infection control and hospital epidemiology 1999;20 ($) 247-278

2. WongES; Hooton, TM. Guideline for Preventionof Catheter associated Urinary Tract Infections.Cen-ter for disease control and prevention (CDC)

3. HELICS (Hospital in Europe Link for Infection Control through Surveillance):Surveillance of no-socomial infections in intensive care units, Proto-col, Oktober,2003.

4. National Nosocomial Infections Surveillance (NNIS)System Report,data summary from Janu-ary 1992 through june 2003,issued August 2003.A reportfrom the NNIS System Division of He-alhcare quality Promotion, National Center for InfectiousDiseases,Centers for Disease Control and Prevention,Public Health Service, US Depar-tment of Health and Human Services Atlanta Geor-gia.Am J Infect. Control 2003;31: 481-498.

5. Tenke P,Kovacs B, Bjerklund Johansen TE; Mat-sumoto T, Tambyah PA, Naber KG.European and Asian guidelines on menagement and prevention of cateter associated urinary tract infections.,Int J An-timicrob Agents 2008;31 S: S68- S78.

6. Foxman B.Epidemiology of urinary tract infecti-ons :incidence morbidity, and economic costs.Am J Med 2002; 113 Suppl 1A :5S-13S.

7. MMWR Guidelines for the Prevention of Intravas-cular Catheter – Related Infections.

Corresponding author Svetlana Pavlovic, Center for anesthesiology and reanimation, Clinical center Niš, Serbia, E-mail: [email protected]



Abstract

Objective: This research was conducted to evaluate whether sympathetic pregnancy was experienced by the partners of pregnant women who came to the hospital for routine control.

Methods: This descriptive research was con-ducted in compliance with the ethical principles between 1 April 2010 and 1 July 2010 with 670 pregnant women and their partners, who applied to Nene Hatun Kadın Maternity Hospital polycli-nic for prenatal follow up, who were in their 20th to 30th week of pregnancy, who were selected by random sampling method and who accepted to in-clude in the research. The data have been collected with questionnaire prepared by researchers.

Results: It was found that of the fathers parti-cipating in the research 32.2% of expectant fathers were participative, 28.1% were audience, 16.7% were functional, and 23.0% demonstrated audien-ce, functional and participative behavior patterns all together.

Conclusions: It was determined in the study that 15.8% of expectant fathers experienced sympathetic pregnancy symptoms. There was a statistically significant difference between the presence and absence of sympathetic pregnancy symptoms in expectant fathers according to their behavior types

Key words: Sympathetic pregnancy syndro-me; Father; Nursing

Introduction

Pregnancy is a physiological event which every woman in reproductive age group may experien-ce. Besides the physiological changes occurring in the pregnant woman’s body during pregnancy;

the pregnant woman, her partner and other family members experience a series of psychological and social changes and they feel the need to adapt to these changes. They have to learn new roles to get prepared to welcome a new baby into the family unit. Therefore, the process of pregnancy is consi-dered as a developmental crisis period for both the woman and her family [1, 2, 3, 4].

Experience of pregnancy is not only affected by the pregnant woman’s social environment, but the social environment is also influenced by the course of pregnancy [2,3]. Women have various physical and psychological symptoms throughout pregnancy and postpartum period [5,6]. Different reactions may be observed also in men after their partners get pregnant. This difference in men’s be-haviors is associated with their living conditions at that time as well as unknown matters about pa-ternity. This condition causes expectant fathers to experience conflicting emotions. While the idea of becoming a father makes them happy and proud, they may be terrified by the increasing number of responsibilities awaiting them in the future. When their partners get pregnant, men may unconsciou-sly exhibit audience, participative and functional behavior patterns in most cases [6].

Audience: An observer expectant father ali-enates himself from pregnancy fact emotionally and feels himself as a bystander [6].

Participative: The expectant father cooperates with his partner emotionally and in terms of other matters. He is fully aware of the requirements and changes brought along with pregnancy. He has a clear sense of responsibility [6].

Functional: generally being between above mentioned expectant fathers, functional expectant father is focused on his material responsibilities, yet still isolates himself emotionally from pre-gnancy [6].

Do Expectant Fathers Experience Sympathetic Pregnancy?Hava Özkan1, Ayşe Nur Aksoy2

1 Atatürk University, Faculty of Health Science, Department of Midwifery, Turkey,2 Dr. Nene Hatun Maternity Hospital, Department of Obstetrics and Gynecology, Turkey.

644



Couvade Syndrome (sympathetic pregnan-cy syndrome) is a poorly understood phenome-non brought into existence by somatic symp-toms observed during pregnancy on unknown physiological basis in the expectant father. Men with Couvade syndrome experience physiologi-cal symptoms shortly after their partners get pre-gnant. These symptoms include GIS (gastrointe-stinal system) diseases, abdominal enlargement, change in appetite, sensitivity to smell, back pain, leg cramps, malaise, sleep complaints, toothache, rash, syncope and weight gain. Psychological symptoms of the Couvade syndrome include anxi-ety, depression, stress, nervousness, mood swings, anxiety about physical integrity, and changes in the perception of the body. Symptoms start at the end of the first trimester, increase in the second trimester and continue until birth [7,8,9].

This research was conducted to evaluate whet-her sympathetic pregnancy was experienced by the partners of pregnant women who came to the hospital for routine control.

Methods

Sample

This descriptive research was conducted in compliance with the ethical principles between 1 April 2010 and 1 July 2010 with 670 pregnant wo-men and their partners, who applied to Nene Ha-tun Kadın Maternity Hospital polyclinic for pre-natal follow up, who were in their 20th to 30th week of pregnancy, who were selected by random sam-pling method and who accepted to include in the research. Patients were informed about the study.

Data Collection

The data were collected with a questionnaire form. The questionnaire included demographic information (age, education, number of pregnan-cies, duration of marriage etc) and questions about sympathetic pregnancy syndrome. The prepared questionnaire was completed applying face to face interview technique to the pregnant women and their partners who volunteered to participate

in the study. This self-administered questionnaire was completed within 10-15 min.

Data Analysis

The data obtained at the end of the research were assessed by using SPSS 13.0 packet pro-gram. Percentage, chi-square test were used in the assessment.


Informed consent was verbally obtained from voluntary participants. They were also informed of their right to withdraw from the study at any time. They were advised not to write their names on the questionnaire and were told that their res-ponses would be confidential.

Results

When the demographic features of the partici-pants included in study were examined in terms of the highest proportions, it was determined that 59.7 % of them were primary school graduates, 34.0 % husbands of pregnant women were primary school graduated, 66.0% four years and above were mar-ried, 73.3% of them were living in County, 35.5 % of them were number of pregnancies.

Significant relationship was not observed between the incidence of Couvade syndrome and planning status of pregnancy, partner’s education level, number of pregnancies, place of residence, duration of marriage (p>0.005 Table 1).

It was found that 32.2% of expectant fathers were participative, 28.1% were audience, 16.7% were functional, and 23.0% demonstrated audien-ce, functional and participative behavior patterns all together (Table 2).

It was determined that 15.8% of expectant fa-thers experienced sympathetic pregnancy symp-toms, while 84.2% were symptom-free. When the distribution of 106 expectant fathers (15.8%) with sympathetic pregnancy symptoms were exami-ned, it was found that 86 men (81.1%) experienced both physiological and psychological pregnancy



symptoms and 20 men (18.9%) experienced only psychological pregnancy symptoms (Table 3). Table 1. Distribution of the demographic charac-teristics of pregnant women and their partners

Features Number %Average age of pregnant womenAverage age of men

27.29±5.4230.26±5.45

Pregnant EducationPrimary schoolSecondary schoolHigh schoolUniversity

400 94124 52

59.714.018.5 7.8

Husband EducationPrimary schoolSecondary schoolHigh schoolUniversity

228 94222126

34.014.033.218.8

Duration of marriage 0-1 year2-3 year4 and above

154 74442

23.011.066.0

Place of residenceVillageTownCounty

94 82494

14.012.773.3

If pregnancy is being plannedAs plannedNot planned

308362

45.954.1

Number of pregnancies1234 and above

178238116138

26.635.517.320.6

Total 670 100.0

Table 2. Distribution of expectant fathers’ accor-ding behavior types

Features Number %

Audience Functional Participative Mixed

188112216154

28.116.732.223.0

Total 670 100.0

When expectant fathers’ experience of sympat-hetic pregnancy symptoms were examined accor-ding to their behavior types, it was determined that 5.7% of expectant fathers with sympathetic pregnancy symptoms were observers, 9.4% were functional and 56.6% were participative, while 28.3% exhibited mixed behavior types. On the other hand, 32.3% of expectant fathers experien-cing no sympathetic pregnancy symptoms were observers, 18.1% had functional, 27.7% were par-ticipative, and 23% displayed mixed behaviors. Subsequently, it was found that there was a stati-stically significant difference between states of the expectant fathers experiencing and not experien-cing sympathetic pregnancy symptoms according to their behavior types (p<0.000, Table 4).Table 3. Distribution of expectant fathers’ sympa-thetic pregnancy symptoms according experien-ced conditions

Sympathetic Pregnancy Symptoms Number %

Experienced 106 15.8Not experienced 564 84.2Total 670 100.0

Table 4. Distribution of expectant fathers’ sympathetic pregnancy symptoms according their behavior types

Behavior types

Sympathetic Pregnancy Symptoms

Relevance Experienced Not experienced Total

Number % Number % Number %

Audience 17 5.7 182 32.3 188 28.1X2=51.247

p<0.000

Functional 10 9.4 102 18.1 112 16.7Participative 60 56.6 156 27.7 216 32.2Mixed 30 28.3 124 22.0 154 23.0Total 106 100.0 564 100.0 670 100.0

646



Discussion

Couvade syndrome is a phenomenon observed in expectant fathers experiencing somatic symp-toms in pregnancy [10]. Trethowan and Conlon defines the Couvade syndrome as “the physical symptoms with psychogenic origin continuing from the beginning of pregnancy to childbirth and early postpartum period”. [11]. Different inciden-ces have been reported for this syndrome in studi-es (11-50%) [4,11]. Clinton reported an incidence of up to 97% in the United States [12]. Marilov, on the other hand, reported this incidence as 35% in Russia [13]. In our study, the incidence of Couva-de syndrome was found to be 15%.

Researchers have investigated the relationship between Couvade syndrome and socio-demo-graphic factors. Bogren found that the incidence of Couvade syndrome was higher in men with the highest education and social level [14]. Munreo et al. [15] and Lipkin et al. [16], on the other hand, reported a higher incidence in men with lower education level. In our study, no significant relati-onship was found between education level and the incidence of Couvade syndrome. Sizaret et al. [17] observed a higher number of couvades syndrome cases among the partners of primipara pregnant women compared to the partners of multipara pregnant women. Yet, Ferketich et al. [18] disco-vered a positive correlation between the inciden-ce of Couvade syndrome and the increase in the number of children. Similar to our study results, Trethowan et al. established no significant relati-onship between Couvade syndrome and number of pregnancies [11].

Clinton [19] and Strickland [20] reported a higher incidence of Couvade syndrome in unpla-nned pregnancies. On the other hand, similar to our study results, Bogren et al. did not find a si-gnificant relationship between Couvade syndro-me and planning the pregnancy [14]. Thomas et al. also established an insignificant relationship between Couvade syndrome and both the number of pregnancies and planning of pregnancy [21]. Conner et al. reported vomiting, chest pain, abdo-minal pain, change in appetite, respiratory distre-ss, leg cramps, back pain and sleep problems in men with Couvade syndrome [22]. In our study, similar symptoms were observed in men inclu-

ded in the group of participative behavior type. A study conducted by Chalmers and Meyer revealed that emotions like anxiety, fear and uncertainty experienced by expectant fathers during pregnan-cy led them to exhibit participative behaviors in pregnancy [23]. In our study, expectant fathers displaying participative behaviors constitute the majority. It is also reported in the studies con-ducted by Finnbogadottir et al. and Bartlett that expectant fathers experience psychological, social and physical changes during pregnancy [24,25].

Conclusion and Suggestions

It was concluded that - 32.2%, 28.1% and 16.7% of expectant

fathers exhibited participative, observer and functional behavior patterns, respectively, while 23.0% exhibited mixed behavior patterns,

- 15.8% of expectant fathers experienced sympathetic pregnancy symptoms,

- There was a statistically significant difference between the presence and absence of sympathetic pregnancy symptoms in expectant fathers according to their behavior types.

In line with these results, a series of suggestions may be introduced, such as evaluating the family as a whole in antenatal care services, providing necessary education and consultancy services, in-forming the expectant fathers experiencing sym-pathetic pregnancy symptoms about the fact that these symptoms may result from their inadequate knowledge about parenthood, and guiding these expectant fathers to receive supportive psychot-herapy at a health institution. Furthermore, more comprehensive studies may be conducted to reve-al the etiology of this syndrome.

Acknowledgement

No financial support has been given from outsi-de sources for this study.



References

1. Barsky AJ, Peekna HM, Borus JB. Somatic symp-tom reporting in women and men. Journal of Gene-ral Internal Medicine 2001; 16:226-275.

2. Lowdermilk DL, Perry S E, Bobak I M. Maternity and women’s health care: Family Dynamic of preg-nancy. St. Louis. Mosby, 1997.

3. Taşkın L., Birth and Women’s Health Nursing. Psy-chosocial and cultural dimensions of pregnancy. Ankara, 2007;211-226.

4. Klein H: Couvade syndrome: Male counterpart to pregnancy. Int J Psychiatry Med 1991; 21:57-69.

5. Affonso DD, Mayberry LJ, Lowett SM, Paul S. Cog-nitive adaptation to stresfull events during pregnan-cy and postpartum development and testing of the case instrument Nursing Research 1994;43: 343-46.

6. Sevil Ü, Kavlak O. Couvade Sendromu. Family and Community Education - Culture and Research Journal 2003;6:15-17.

7. Brennan A, Ayers S, Ahmed H, Marshall-Lucette S. A critical review of the Couvade syndrome: the pregnant male. Journal of Reproductıve And Infant Psychology 2007;25:173–89.

8. Robert W. Elwood and Carolyn Mason. The couva-de and the onset of paternal care: A biological pers-pective. Ethology and Sociobiology 1994;3:145-56.

9. Budur K, Mathews M. Couvade syndrome equiva-lent? Psychosomatics; 2005;46:71–72.

10. Basil B, Mathews M A Couvade Syndrome Variant? Psychosomatics 2006; 47:363-364, July-August.

11. Trethowan WH. Conlon MF. The C o u v a d e syndrome. British Journal of Psychiatry 1965; 11:57-66.

12. Clinton JF. Expectant fathers at risk of Couvade . Nursing Research 1986;30:281-84.

13. Marilov VV. The Couvade syndrome (in Russian). Zhurnal Nevrologii Psikhiatrii 1997;97:65-67.

14. Bogren LY.Couvade. Acta Psychiatric Scandina-via 1983; 68:55-65.

15. Munroe RL, Munroe RH, Nerlove SB. Male preg-nancy symptoms and cross-sex identitiy:two rep-lications. Journal of Social Psychology 1973; 89: 147-48.

16. Lipkin M, Lamb GS. The Couvade syndrome: a epidemiological study. Annals of Internal Medici-ne 1982;96:509-511.

17. Sizaret P, Degıovannı A, Gaıllard P, Benichou C. Study on the somatic symptoms of Couvade. An-nals of Medical Psychology 1991;149;230-233.

18. Ferketich SL, Mercer RT. Men’s health status du-ring pregnancy and early fatherhood. Research in Nursing and Health 1989;12:137-148.

19. Clinton J.Couvade: patterns, predictors, and nur-sing management: a research proposal submitted to the Division of Nursing. Western Journal of Nursing Reearch 1985;7:221-243.

20. Strickland OL. The occurence of symptoms in ex-pectant fathers. Nursing research 1987;36:184-189.

21. Thomas SG, Upton D. Expectant father’s attitudes toward pegnancy. British Journal of Midwifery 2000;8;4:218-221.

22. Conner GK, Denson V. Expectant father’s res-ponse to pregnancy: review of the literatüre and implications for research in high-risk pregnan-cy. Journal of Perinatal and Neonatal Nursing 1999;4:32-42.

23. Chalmers B, and Meyer D. What men say about pregnancy, birth and parenthood. J. Psychosom. Obstet. Gynecol. 1996;17 47-52.

24. Finnbogadottir H, Crang Svalenius E and Pers-son EK. Expectant first-time fathers’experiences of pregnancy. Midwifery 2003;19, 96-105.

25. Bartlett EE. The effects of fatherhood on the he-alth of men: a review of the literature Jmhg Vol. 1, Nos. 2–3, pp. 2004;159–169, September.

Corresponding author Hava Özkan, Atatürk University, Faculty of Health Science, Department of Midwifery, Turkey, E-mail: [email protected]

648



Abstract

Prospective randomized study was undertaken with the aim to compare open versus laparoscopic cholecystectomy in terms of perioperative pain and analgesics requirements. The study encoun-tered 60 patients classified as ASA I and II (Amer-ican Society of Anaesthesiologists), who were randomly assigned in to two groups, laparotomy and laparoscopy group. Level of pain was expre-ssed using PRST score (Pressure Rate Sweating Tears) and it was assessed on two occasions. First measuring was done immediately after laparot-omy in the open cholecystectomy group and af-ter inserting trocars in laparoscopy group, and second after goal bolder enucleating. The PRST score value in the laparoscopy group was 3, 5 (IQ 3-4) compared to the laparotomy group were the PRST score was 1, 5 (IQ 1-2) shoving statistical significance (p< 0, 0001). During the first measur-ing of the PRST I score, according to the acquired results 90% of patients undergoing open chole-cystectomy needed analgesia compared to 7% in laparoscopy group (p< 0, 0001). Requirements for additional analgesia were fund in 50% laparotomy group patients versus 0% in laparoscopy group (p< 0, 0001). PRST II score analysis showed need for analgesia in 50% of patients in laparotomy group as opposed to 23% in the laparoscopy group (p=0,06), and requirements for additional analge-sia in 7% as opposed to 0% in the laparoscopy group (p=0,47%). According to the displayed re-sults we can conclude that perioperative pain and need for analgesia are significantly lower in the

patients undergoing laparoscopic compared to open cholecystectomy.

Key words: laparoscopic cholecystectomy, open cholecystectomy, perioperative pain, analge-sia, PRST score

Introduction

Modern lifestyle and eating habits have largely contributed to the increased incidence of billiary system disorders. Most commonly gallbladder dis-ease is caused by gallstones and accompanied by strong pain, nausea, vomiting and local peritoneal irritation, and requires surgical treatment (1). The classical open cholecystectomy and laparoscopic approach are two alternatives for surgical removal of diseased gallbladder. Advantages of laparoscopy over open method are associated with faster reco-very and shorter hospital stay, implicating less in-traoperative stress during laparoscopic procedures (2, 3). However laparoscopic cholecystectomy is associated with increased intra abdominal pressure, which can lead to impairment of renal perfusion. Interventions such as administration of low dose dopamine, warming of insufflated gas, hyperven-tilation using lower respiratory volumes, can be undertaken with the aim to reduce negative impact of increased intra abdominal pressure(4). Laparos-copic cholecystectomy is associated with less pain and accordingly analgesic requirements in periope-rative as well as in postoperative period (5). There are many definitions of pain, one that is frequently used says: „pain is an unpleasant sensory and emo-

Perioperative Pain Comparison in Patients Undergoing Open versus Laparoscopic CholecystectomyHodzic Enes1, Imamovic Semir2, Hasukic Sefik3, Majdancic Husnija4, Imamovic Goran5, Iljazagic-Halilovic Fatima2

1 General Hospital Tešanj, Department of Surgery, Bosnia and Herzegovina,2 University Clinical Centre Tuzla, Department of Anesthesiology, Bosnia and Herzegovina,3 University Clinical Centre Tuzla, Department of Surgery, Bosnia and Herzegovina,4 General Practice, Outpatient facility Živinice, Bosnia and Herzegovina,5 University Clinical Centre Tuzla, Department of Internal medicine, Bosnia and Herzegovina.



tional experience arising from actual or potential ti-ssue damage“(6). Surgical trauma stimulates noci-oceptors and induces release of numerous humoral mediators thus activating a chain of inflammatory processes that cause pain (7). Intraoperative analge-sia is based on use of opioid analgesics, which act by blocking nocioceptive transmission on the level of medulla spinalis and higher levels of central ner-vous system (8). Subjective and objective methods are used for assessing of anesthesia depth and In-traoperative analgesics requirements. Subjective methods include monitoring of autonomic nervous system response (hemodynamic response, lacrima-tion, sweating and pupillary dilatation). Neverthe-less, there are no universal standards for pain qulifi-cation and quantification and in practice frequently used methods for pain assesment are based on the patient`s subjective opinion.

Aim of this research was to compare perope-rative pain intensity and analgesics requirements in patients undergoing open versus laparoscopic cholecystectomy.


The study was prospective randomized and was undertaken in General Hospital Tešanj and Uni-versity Clinical Center Tuzla in the period March 2009 to December 2009. It included 60 patients assigned for gallbladder operation due to chronic inflammation and gallbladder stones, all patients were ASA I and II and were randomly allocated in to two groups, laparotomy and laparoscopy gro-up. All patients underwent routine preoperative preparation and in both groups was used balanced anesthesia. In patients undergoing open chole-cystectomy, right sided laparotomy was applied, and laparoscopic cholecystectomy was preformed using three incisions, pneumoperitoneum was cre-ated using CO2 insufflation with intra abdominal pressure not exceeding 12 mm Hg.

Pain level and analgesics requirements during pe-rioperative period were assessed using PRST score (8). This score is frequently used for assessment of anesthesia depth and analgesia adequacy (Table 1).

The PRST score was assessed on two occasi-ons: PRST I score determined immediately after laparotomy in laparotomy group and after inser-

ting a trocars in laparoscopy group, PRST II score was assessed during gallbladder separation from the liver, in both groups.Table 1. PRST scoring system

Index Condition Score

Systolic blood pressure

control + 15control + 30control > 30

012

Heart rate control + 15control + 30control > 30

012

SweatingNilSkin moistVisible beads of sweat

012

Tears

No tears in open eyesExcess tears in open eyesOverflowing tears from closed eyes

0

1

2

PRST score values < 3 are associated to adequ-ate analgesia, if values of PRST score were > 4, dose of 0, 10 mg instead of a 0, 05 fentanyl was administered.


Statistical analysis was done by using Med Calc for Windows version 8.1.0.0. Central ten-dency and data dispersion measures are shown by arithmetic mean, with the appropriate standard deviation and median with inter quartile range, depending on the data distribution, symmetric or asymmetric, and the frequencies are presented in absolute and relative digits. For comparing the continuous variables with normal value distributi-on a T test of independent samples was computed and the Mann-Whitney U test was computed. For the categorical variable analysis the chi-square test was used, p value of 0.05 or less was fount to be statistically significant.

Results

Study included 60 patients that were randomly allocated in to two groups, laparoscopy and lapa-rotomy, each consisting of 30 patients. In the lapa-

650



rotomy group the mean age was 51,5 ± 12,8 and in the laparoscopy group the mean age was 45,7 ±14,8 with no statistically significant difference ( p=0,07 ). In the laparotomy group 60% of patients were classified as ASA II, and in the laparoscopy group 38 % of encountered patients were classi-fied as ASA II, bearing no statistical importance (p=0,08) (Figure 1).

Figure 1. ASA score occurrence in groups

PRST I score, in the laparotomy group was 3, 5 (IQ3-4) and in the laparoscopy group was 1, 5 (IQ1-2) which represents a significant statistical difference (p< 0, 0001).

PRST II score values in the laparotomy group were 2, 5 (IQ 2-3) and in the laparoscopy group 2 (IQ 2-2), which is statistically significant (p=0, 02) (Illustration 2 and 3).

Figure 2. PRST I score distribution

Figure 3. PRST II score distribution

Analysis of perioperative analgesia requirements

PRST I score in the laparotomy group in 90% of the patients indicated need for analgesia whe-re in the laparoscopy group analgesia was neces-sary only in 7% of observed patients (p< 0, 0001). PRST II score indicated that in 50% of the patients in the laparotomy group needed analgesia, and in the laparoscopy group of patients 23% of patients required analgesia (p<0,06) (Figure 4).

Figure 4. PRST I score comparing analgesia requirements between the groups



Figure 5. PRST II score comparing analgesia requirements between the groups

Analysis of perioperative requirements for additional analgesia

PRST I score indicated need for additional use of analgesics in 50% of the laparotomy gro-up patients compared to the laparoscopy group were there was no need for additional analgesia (p=0,0001). PRST II score shoved that 7% of the laparotomy group patients needed additional anal-gesia versus 0% patients in laparoscopy group (p=0,47) (Figure 6 and 7).

Figure 6. PRST I score comparing additional analgesic requirements between the two groups

Figure 7. PRST II score comparing additional analgesic requirements between the two groups

Discussion

Laparoscopic cholecystectomy is associated with reduced metabolic response to stress (2, 3), elimination of laparotomyy, preservation of di-aphragmatic function, preservation of pulmonary function (9), less postoperative complications (10), reduced incidence of postoperative illeus, earlier mobilization, shorter hospital stay and ear-lier return to normal activities. Main benefit rela-ted to laparoscopic cholecystectomy is assigned to elimination of abdominal incision and con-sequently less pain (11) although there are some contradicting results (12). Most general anesthe-tics, intravenous and inhalation, provide only se-dation and hypnosis but no/or insignificant level of analgesia, so copping with continuous painful stimulation during surgical procedures, requires addition of strong opioid analgesics (13). Altho-ugh inhalation anesthetics such as sevoflurane, alone do not provide analgesia, its concomitant use with opioid analgesics reduces opioid dosing requirements (14). Sevofluran diminishes number of immunoreactive neurons in dorsal horn of me-dulla spinalis, interfering with nocioceptive tran-smission (15, 16). In this study in both groups was used balanced anesthesia, with intravenous intro-duction and maintenance of anesthesia with inha-lation agent in this case, sevoflurane. Autonomic nervous system response to painful stimulation is

652



displayed as tachycardia, hypertension, sweating and lacrimation, occurrence of these symptoms is considered a sign of inadequate analgesia and/or shallow anesthesia (17, 18). Multiple prospective randomized trials and retrospective analysis have shown decreased analgesic requirements during laparoscopic procedures compared to open cho-lecystectomy (19, 20). In this study intraoperati-ve estimation of pain intensity was assessed by using PRST score, which was determined on two occasions, immediately after laparotomy and in the laparoscopy group after troacar insertion and in booth groups after gallbladder removal. Higher PRST scores were found on both occasions in the open cholecystectomy group. Dosing of opioid analgesics was based on the PRST scoring results. Based on these results we found higher analgesic requirements in the laparotomy group, related to baseline and additional analgesia, during skin inci-sion and during gallbladder separation from liver. Laparoscopic cholecystectomy was associated with less intraoperative analgesic requirements, indicating less intraoperative stress compared to open cholecystectomy. These results confirm exi-sting preference for laparoscopic versus open cho-lecystectomy.

Conclusion

This study was undertaken with the aim to compare open versus laparoscopic cholecystecto-my in terms of perioperative pain and analgesics requirements by using PRST scoring system. Ac-cording to the gained results we can conclude that perioperative pain and need for analgesia are sig-nificantly lower in the patients undergoing laparo-scopic compared to open cholecystectomy.

List of Abbreviations

PRST - Pressure Rate Sweating TearsASA - American Society of Anaesthesiologists

References

1. Carey MC, Calahan MJ. Enterohepatic circula-tion in: Arias MI, Jakoby WB, Popper H, Shahter D, Shafritz DA (eds). (1988): The Biology and pa-thobiology (2nd ed), New York, Raven Press Ltd.; 573-616.

2. Glerup H, Heidorf H, Flyjberg A, Jensen SL.(1995): Elective Laparoscopic Cholecystectomy Nearly Abolishes the Postoperative Catabolic Hepatic Stress Response. Ann Surg 3: 214-219.

3. Shietromsa M, Carlci F, Lezoche E, Agni li A, Enang GN, Marucci S, Minervini S, Lydigakis NJ. (2001): Evaluation of immune response in patients after open or laparoscopic cholecystectomy. Hepa-togastroenterology; 48: 642-646.

4. Madsen MR, Jensen KEJ. (1992): Postoperative pain and nausea after laparoscopic cholecystecto-my. Surg Endosc 2: 303-305.

5. Radojičić B. (1986): Fiziologija boli: Bolesti nervnog sistema, Medicinska knjiga Beograd-Za-greb, 32-36.

6. Carevero F, Laird JMA. (2004): Understanding the Signaling and Transmission of Visceral Nociceptive Events. Neurobiology, 61 (1): 44-45.

7. Ersek M, Cherrier MM, Overman SS, Irving GA. (2004): The Cognitive Effects of opioid, Pain Ma-nag Nurs 5(2): 75-93.

8. Evans JM., Davies WL. (1984): Monitoring ane-sthesia. Clin Anesth; 2: 243-262

9. Frazee RC, Roberts JW, Okeson GC et al. (1991): Open versus laparoscopic cholecystectomy: A com-parison of postoperative pulmonary function. Ann Surg 213:651-653

10. Holohan TV (1991) Laparoscopic cholecystecto-my. Lancet. 338:801-803

11. Ure BM, Troidl H, Spangerberger W et al.(1992): Pre incision local anesthesia with bupivacain and pain after laparoscopic cholecystectomy. A dou-ble-blind randomized clinical trial. Surg Endosc, 7: 482-488.

12. Joris J, Thiry E, Paris P, Weerts J, Lamy M. (1995): Pain after laparoscopic cholecystectomy: caracteristics and effect of intraperitoneal bupi-vacaine. Anesth Analg; 81: 379-384.



13. Dolin S. et al. (2002): Effectiveness of acute po-stoperative pain management. British Journal of Anaesthesia. 89: 409-423.

14. Ganjoo P, Farber NE, Schwabe D, Kampine JP, Schmeling WT. Desflurane attenuates the soma-tosympathetic reflex in rats. Anesth Analg 1996; 83:55–61.

15. Hao S, Takahata O, Mamiya K, Iwasaki H. Se-voflurane suppresses noxious stimulus-evoked expression of Fos-like immunoreactivity in the rat spinal cord via activation of endogenous opioid systems. Life Sci 2002; 71:571–580.

16. Desmond J, Gordon RA (1970) Ventilation in pa-tients anaesthetized for laparoscopy. Can Anesth Soc J 17: 378-387.

17. Russel I.: Conscious awareness during general anesthesia; relevance of autonomic signs and iso-lated arm movements as guides to depth of ane-sthesia. Baillires Clin. Anaesth. 1998; 3: 511-532.

18. Russell IF: Intraoperative awareness and the iso-lated forearm technique. Br J Anaesth 1995; 75: 819-821

19. Vecchio R, MacFadyen BV, Latteri S. Laparos-copic cholecystectomy: an analysis on 114,005 cases of United States series. Int Surg. 1998; 83:215–219 [PubMed]

20. Shea JA, Healey MJ, Berlin JA, et al. Mortality and complications associated with laparosco-pic cholecystectomy. A meta-analysis. Ann Surg. 1996; 224(5):609–620 [PMC free article] [Pub-Med]

Corresponding author Iljazagic-Halilovic Fatima, University Clinical Centre Tuzla, Department of Anesthesiology, Bosnia and Herzegovina, E-mail: [email protected]

654



Abstract

Background and aim: Osteoarthritis of the knee is a degenerative rheumatic disease that can lead to major disability, including immobility and dependence on someone else’s help.

The aim of this study was to determine the effect of physical therapy on functional ability in patients with osteoarthritis of the knee using Womac index.

Methods: The study included 60 patients dia-gnosed with osteoarthritis, which were applied to the combined physical therapy for twenty days: interferential currents, paraffin and kinesiothera-py. Functional ability of patients was evaluated before and after treatment.

The prospective study included 53 (88.3%) wo-men and 7 (11.7%) men, aged 42-80 years; most of the patients were in a group of 61-70 years. The disease lasted an average of 10.3 years.

Resuts: Individual values of Womac index for pain before the physical therapy were in the range 0.4 to 4.0 and after treatment from 0.2 to 2.8. The average value of Womac index for pain before the physical therapy was 2.34, and 1.34 after treatment, which represents a significant reduction in pain in-tensity (p<0.05). The average value of stiffness in the knee after treatment was reduced from 1.94 to 1.15 which is statistically significant. The average value of functional capacity before treatment, me-asured by Womac function subscale, was 2.36 or 59% of the maximum value of the test. Physical therapy resulted in a reduction in average Womac index of 1.47 (36.75% of the maximum value), which represents a significant difference (p<0.05).

Conclusion: Physical therapy leads to signifi-cant reduction of pain and improvement of fun-ctional ability in patients with osteoarthritis of the knee, which can be assessed using functional tests.

Key words: Osteoarthritis of the knee, functio-nal ability, Womac index, physical treatment.

Introduction

Musculoskeletal diseases are one of the leading medical, social and economic problems today, and osteoarthritis is the most common rheumatic disea-se in the developed world (1), It is characterized by the gradual emergence of joint pain, joint stiffness and limited movement. Osteoarthritis is not only common in the elderly, but is found even in 10% of tested persons aged 15-24 years. About 11% of people older than 64 years have symptomatic knee osteoarthritis (2). The disease usually starts at the articular cartilage, but does not exclude any possi-bility of the onset of disease due to changes in adja-cent bones, synovia or other soft tissues around the joint. Changes that affect the joints with osteoarthri-tis, regardless of location, are very similar, although the initial events may be different (e.g., static load of bearing joints, traumatic events in the hand jo-ints and similar). Physiatrists often have dilemma of choosing a strategy in the management of oste-oarthritis of the knee. The selection of therapeutic options depends on clinical symptoms and findings, and radiographic stage of disease. For the treatment of osteoarthritis of the knee there are guides who are constantly improved.

Evaluation of the effect of physical therapy for knee osteoarthritis using Womac indexDzevad Dzananovic1, Nedima Kapidzic-Basic2, Farid Ljuca3, Sahza Kikanovic2, Tatjana Nozica-Radulovic4 1 Health Center Tuzla, Polyclinic of Physical Medicine and Rehabilitation, Bosnia and Herzegovina,2 University Clinical Center Tuzla, Clinic for Physical Medicine and Rehabilitation, Bosnia and Herzegovina,3 Faculty of Medicine, University of Tuzla, Bosnia and Herzegovina,4 Institute for Physical Medicine and Rehabilitation, Dr Miroslav Zotović, Banja Luka, Bosnia and Herzegovina.



In the U.S., the American College of Rheuma-tology has issued recommendations in 2000. and in Europe the European League for the Fight Aga-inst Rheumatism (EULAR) issued final guide in 2003 (3). The goal of treatment is to educate the patient about the disease and its treatment. Physi-cal therapy can ease pain, reduce inflammation, strengthen weak muscles and increase mobility of affected joints. During the physical therapy the education of patients about the further treatment at home is also carried out. An educated patient will continue with learned exercises at home, with the use of topical therapy, and will be familiar with the location in which to hold the wrist in a painful phase, to avoid creating unnecessary contractures and disability (4). The physical procedures which are in use are: thermotherapy, electrotherapy, ul-trasound, magnetic and laser therapy. All these re-present the introduction to the most important pro-cedure, which is kinesio and hydrokinesiotherapy. Thermotherapy is the most used and best studied physical procedure. It leads to local hyperemia and increased circulation, which accelerates the elimi-nation of harmful products of metabolism. Ther-motherapy has an analgesic effect and contributes to reduction of muscle spasm. It is administered before conducting the exercise as an opening pro-cedure to prevent the pain which can be caused by exercise. Exercises and physical activity is the base of treatment of osteoarthritis and maintenan-ce of the quality of life. Exercises reduce pain and restore joint function, increase muscle strength, endurance, proprioception, aerobic capacity, con-fidence, and improves the general health, and re-duce the symptoms of depression and anxiety. In knee osteoarthritis, a key role to play is musculus quadriceps strength exercise, which leads to stabi-lization of the knee joint, reduce pain and improve knee function, which is reflected in the facilitati-on of walking, with increasing length of time of walk during the day (5, 6). Therapeutic exercises of strength can slow progression of osteoarthritis of the knee, because they change biomechanical relations associated with the knee loading. Exer-cise plan must be created in accordance with the state of the disease, age and comorbidity. Impro-vement of joint function by exercises is a result of increased range of motion and muscle strength (7). To evaluate the effect of therapy and to follow

the course of disease, it is necessary to perform functional testing of patients. For this purpose, different instruments, disease-specific and gene-ric questionnaires for quality of life are used. The most commonly used are disease-specific indexes, Lequesne and Western Ontario and McMaster University (Western Ontario and McMaster Uni-versities-Womac) (8). With their use it is possible to monitor the pain, stiffness and functional ability of patients.

The objective was to determine the effect of physical therapy on functional ability of patients with osteoarthritis of the knee.


The study was prospective. The study conse-cutively included 60 patients diagnosed with oste-oarthritis of the knee according to the criteria of the American Society of Rheumatology (9), who were admitted to physical treatment at The Pol-yclinic and The Clinic of Physical Medicine and Rehabilitation in Tuzla.

The patients, who beside the osteoarthritis of the knee had some other disease that requires physical treatment, were excluded from the exa-mination. Each subject underwent the physical treatment for twenty days, which included the fo-llowing procedures:

1. Interferential currents of constant frequency of 100 Hz, on the knees for 15 minutes;

2. Paraffin in the form of bandages, heated to a temperature of 50ºC for 30 minutes;

3. Kinesiotherapy: static and dynamic exercises to strengthen the above-knee musculature and exercises to improve range of motion in the knee. The data taken from the subjects were about their gender, age and disease duration. Measuring the functional status of patients was performed using the Womac index (8). Womac index has 3 subscales. Subscale for pain has 5 questions, 2 questions for stiffness and 17 questions for functional ability. Performing of an operation is evaluated with 5 ratings (no, mild, mean, moderate and extreme). Functional ability was measured before and after physical treatment. Descriptive

656



measures used in this study are: measures of central tendency, measures of dispersion, the relative numbers, and graphical display. The parametric Student t test and correlation analysis were used within the interferential statistics. Hypothesis testing was conducted with a significance level of 0.05.

Results

From 60 patients studied 53 were women (88.3%), and seven men (11.7%). Age of patients ranged from 42-80 years, most of the patients was in a group of 61-70 years (Figure 1).

Figure 1. Age distribution of patients with osteo-arthritis of the knee

The disease lasted for an average of 10.3 ye-ars, with a minimum duration of difficulties of one year, but no longer than 30 years. The majority of subjects (41.6%) were in a group of disease dura-tion up to five years.

Functional ability was assessed with the Womac index. Individual values of Womac index for pain before physical therapy were in the range 0.4 to 4.0 and after treatment from 0.2 to 2.8 (Figure 2).

The average value of Womac index for pain be-fore physical therapy was 2.34 which were 58.5% of the maximum value of the index. After therapy, the average value of Womac index for pain was 1.34 or 33.5% of the maximum value, which represents a significant reduction in pain intensity (p<0.05).

The average value of stiffness in the knee by Womac scale at the beginning of the study was 1.94 or 48.5% of the maximum value. After physi-cal therapy, stiffness in the joints is reduced, so

that the average value was 1.15 or 28.7% of the maximum value of the index. The difference of average value of stiffness before and after therapy is statistically significant (p<0.05).

Figure 2. Individual values of Womac index for pain before and after physical therapy

Womac index values for stiffness were reduced after physical therapy in the majority of patients (Figure 3). In 9 (15%) patients, there was no re-duction in stiffness in the joints.

Figure 3. Individual values of Womac index for stiffness before and after physical therapy

The average value of functional capacity mea-sured by Womac function subscale was at the be-ginning of therapy 2.36 or 59% of the maximum value of the test. Physical therapy resulted in a reduction in average Womac index for functional capacity of 1.47 (36.75% of the maximum value), which represents a significant difference (p<0.05).



The relationship of individual values before and after physical therapy is shown in Figure 4

Figure 4. Individual values of Womac index for function before and after therapy

Discussion

Osteoarthritis of the knee is a major health pro-blem because it affects many people and leads to greater disability, and clinical problems than oste-oarthritis of other joints (10). Osteoarthritis of the knee represents the most common form of arthritis in primary practice (11, 12). Among doctors there is a belief that the clinical changes and the course of the disease can not be modified. Therefore, patients with osteoarthritis of the knee visit physiatrist usu-ally when their functional ability is in such danger that makes them impossible for independent living, and independence in performing activities of dai-ly living. This research proves that as well, where there were a small number of patients with milder symptoms. The investigated group of patients was a mean age of 63.4 years and most of them were in a group of 60-70 years, and only 8.3% of them were younger than 50 years. Women were 7.5 times more frequent than men. Increasing incidence of knee osteoarthritis with increasing age and greater prevalence in female patients is referred by other authors as well (13; 14). The average duration of disease was 10.3 years, although in the majority of patients (46.1%) disease duration was 5 years. The pain was present in all patients. Normally it is the main reason for seeking medical help in patients with osteoarthritis (15). The disability was present as well, together with pain, because in knee osteo-

arthritis the disability correlates with loss of stren-gth of the most important muscle for the function of the knee (musculus quadriceps) (15). According to different guidebooks for the treatment of osteo-arthritis of the knee, for the treatment of pain and reduced functional ability, medicamentosal and non-medicamentosal therapy are used within the non-surgical therapy of knee osteoarthritis. Altho-ugh the patient visits the doctor usually because of need to reduce the pain, the additional benefit of su-ccessful treatment of pain is delayed deterioration of quality of life, which may be due to pain caused by osteoarthritis (15). As for the physical modalities in this study, patients had paraffin and interferential currents as opening procedures and exercises (iso-metric and dynamic), 20 times for 4 weeks. Exer-cises are considered as one of the most important treatment for knee osteoarthritis, mild to medium severity. Weak musculus quadriceps is a risk fac-tor for developing osteoarthritis of the knee. There are reports of positive effects of exercises on pain and function, as well as the cost of treatment (16, 17). The effect is similar to the effect of pharma-cological treatment. Exercises for strengthening the above-knee musculature, reduce the progression of osteoarthritis.

According to all indicators used, this research has proven that the physical therapy significantly reduced pain and stiffness in the joints and functi-onal disability. There was a significant reduction in pain in tested patients. According to the Womac subscale for pain, the rating ranged from 0.4 to 3.6, average 2.36, which represented the average va-lue of 58.5% of the maximum value. Assessment of pain by Womac index is practical and easy for patients, and quality, because it specifically asse-sses pain in 5 situations, and the evaluation is des-criptive. Testing of functional ability showed that there is a considerable degree of disability among the tested patients before starting physiotherapy. Womac index for assessing of physical disability and effect of physical treatment is very detailed and provides a greater range of assessment, and may show less change. With its 3 scales, it sepa-rately gives ratings of the most important clinical changes (pain, stiffness, function), so that it can most clearly show the clinical changes in patients with osteoarthritis of the knee. Recent studies of-ten use this index, though its taking requires too

658



much time and effort. Stiffness in joints which in degenerative rheumatism occurs in the morning and after a long resting creates problems to pati-ents, regardless of its relatively short duration. It is rated by Womac subscale index and it averaged prior to physical therapy 1.94 (range 1 to 3.5) whi-ch amounts to 48.5% of the maximum value. The-re was a decrease in stiffness in the joints to 1.15, or 20%. Functional ability measured by Womac index at the beginning of the study was an average of 2.36 which is 59% of the maximum value of the test. After physical therapy it was reduced to 1.34 (33.5% of the maximum value). The difference obtained was significant (p<0.05). The importan-ce of the use of functional indexes to evaluate the effect of therapy was accepted and recognized in different studies (18).

Conclusion

Osteoarthritis of the knee is a degenerative rheumatic disease that affects many people and is among the most common rheumatic diseases. Given the importance of knee for walking and all activities that are associated with walking, the knee osteoarthritis can lead to major disability, including immobility and dependence on some-one else’s help. It affects people of middle ages, and the highest percentage are women. Physical therapy leads to significant reduction of pain and improving functional ability in patients with oste-oarthritis of the knee. The research has shown, using functional tests that the knee osteoarthritis is not a benign disease, and it may considerably deteriorate the quality of life threatening primarily performing of daily activities independently. The-se results are the reason that physical therapy sho-uld be included in the first place of non-surgical treatment of osteoarthritis of the knee. Functional tests must be an essential part of everyday clinical work and research in our region too.

References

1. Grazio S. Osteoarthritis-epidemiology, economic aspects and quality of life. Rheumatism. 2005; 52(2): 21-29.

2. Felson D.T., Zhang Y. An update on the epidemio-logy of knee and hip osteoarthritis with a view to prevention. Arthritis Rheum. 1998; 41: 1343-1355.

3. Jordan K.M., Arden N.K., Doherty M. EULAR reco-mmendations 2003: an evidence based approach to the management of knee osteoarthritis: Report of a task force of the Standing Committee for Internati-onal Clinical Studies Including Therapeutic Trials ESCISIT. Ann Rheum Dis. 2003; 62 (12): 1145-1155.

4. Fries J.F., Lorig K., Holman H. Patient self-ma-nagement in arthritis? Yes! J Rhematol. 2003; 30: 1130-1132.

5. Puert DW, Griffin MR Published trials of non-me-dicinal and noninvasive therapies for hip and knee osteoarthritis. Ann Intern Med. 1994; 121:133-140.

6. Van Baar M., Assendelft J.J., Dekker J. Effectivene-ss of exercise therapy in patients with osteoarthritis of the hip or knee. Arthritis Rheum. 1999; 42(7): 1361-1369.

7. O’ Reilly S, Doherty M. Lifestyle changes in the management of osteoarthritis. Best Pract Res Clin Rheumatol 2001; 15:559-568.

8. Bellamy N. Womac Osteoarthritis Index. A user’s guide. London, Ontario, Canada: University of We-stern Ontario,1995.

9. Anonymous. American College of Rheumatology Subcommittee on osteoarthritis guidelines Recom-mendation for the medical management of osteoar-thritis of the hip and knee. Arthritis Rheum. 2000; 43: 1905-1915.

10. Felson D.T., Zhang Y., Hannan M.T. et al. The in-cidence and natural history of knee osteoarthri-tis in the elderly; The Framingam Osteoarthritis Study. Arthritis Rheum. 1995; 38:1500-1505.

11. Corti M.C., Rigon C. Epidemiology of osteoar-thritis: prevalence, risk factors, and functional impact. Aging Clin Exp Res 2003; 15:359-363.

12. De Filippis L., Gulli S., Caliri A et al. Epidemio-logy and risk factors in osteoarthritis: literature review data from«OASIS»Study (in Italian). Reu-matismo 2004; 56: 169-184.



13. Felson D.T., Zhang Y., Hannan M.T. et al. Risk factors for incident radiographic knee osteoar-thritis in the elderly: The Framingham Study. Ar-thritis Rheum. 1997; 40:728-733.

14. Lachance L., Sowers M.F., Jamadar D., Hochberg M. The natural history of emergent osteoarthritis of the knee in women. Osteoarthritis cartilage. 2002; 10:849-854.

15. Bernard R. Management of Osteoarthritis Knee pain. JAOA 2005; 105 (suppl 4): 23-28.

16. Pendleton A., Arden N., Dougados A. et al. EU-LAR recommendation for the management of knee osteoarthritis: report of a task force of the Stan-ding Committee for International Clinical Studies Including Therapeutic Trials (ESCISIT). Ann Rhe-um Dis. 2000; 59:936-944.

17. Pate R.R., Pratt M., Blair S.N. et al. Physical ac-tivity and public health. A recommendation from the Centers for Disease Control and Prevention and the American College of Sports Medicine. JAMA. 1995; 273: 402-407.

Corresponding author Farid Ljuca, Department of Physiology, Faculty of Medicine, University of Tuzla, Bosnia and Herzegovina, E-mail: [email protected]

660



Abstract

Introduction: Modern pharmacological trea-tments of schizophrenia imply usage of new an-tipsychotic drugs, because of the dramatic world changes in the area of psychopharmacology, in a sense that classic antipsychotics are in the retreat and currently new atypical antipsychotic drugs are in use, which have been shown as far more effici-ent and safer for the patients.

Aims: The aims of this study were to determi-ne which antipsychotics are currently in use and to establish which doses are administrated to patients in three Psychiatric Clinics in the Federation of Bo-snia and Herzegovina (Sarajevo, Tuzla, Mostar).

Materials and methods: This prospective study was performed in 2004. at the Psychiatric Clinics of Universities in Sarajevo, Tuzla and Mostar and included trough census all patients with schizophre-nia situated in previously mentioned clinics.

Results: There was a significant difference in frequency of application of haloperidol, pro-mazine and clozapine (49.3% vs 37.1% vs 13.6% respectively, c2=25.955; p=0.000) in Psychiatric Clinics of Federation of Bosnia and Herzegovina. There was a statistically significant difference at the p<0.05 level in means of daily doses of halo-peridol for the three tested centers [F(2,62)=8.440, p=0.001]. There was not a statistically significant difference at the p<0.05 level in means of daily doses of promazine for the three tested centers [F(2,46)=2.169, p=0.126]. There was not a stati-stically significant difference at the p<0.05 level in means of daily doses of clozapine for the three tested centers [F(2,15)=0.798, p=0.469].

Conclusion: Treatment with daily doses of an-tipsychotics in the Departments of Psychiatry in University Clinical Centers in Federation of Bo-snia and Herzegovina are mainly in accordance with international standards.

Key words: Schizophrenia, Antipsychotics, Doses

Introduction

Modifications in behaviour, mood and emo-tions by drugs have always been frequent in hu-mans. The use of psychoactive drugs involves two related pathways: the use of drugs to modify normal behaviour and produce altered states for religious, ceremonial or recreational purposes and their use to alleviate mental diseases (1).

Treatment of schizophrenia consists a combi-nation of psychosocial therapy and antipsychotic drugs. Drug treatment should de individualized for each patient with close monitoring. Negative symp-toms of schizophrenia tend to respond less well to drug therapy than positive symptoms do (2). The treatment of severe mental illness has improved si-gnificantly in recent years because of advances in pharmacology and psychosocial interventions. One of the most important pharmacologic advances has been the introduction of the second generation of ”atypical“ antipsychotic (SGAs), wich are less li-kely to cause the neurologic movement disorders compared to older first generation of antipsychoti-cs, such as haloperidol (3).

It is well known that low-potency antipsychotic are more sedative and they have strong antimusca-

The usage of the antipsychotic drugs in the specific different centers in Federation of Bosnia and HerzegovinaSvjetlana Loga-Zec1, Saida Fisekovic2, Slobodan Loga3

1 Institute of Pharmacology, Clinical Pharmacology and Toxicology, Faculty of Medicine, University of Sarajevo, Bosnia and Herzegovina,2 Department of Psychiatry of Clinical Centre University of Sarajevo, Bosnia and Herzegovina, 3 Academy of Sciences and Arts of Bosnia and Herzegovina, Bosnia and Herzegovina.



rinic and antiadrenergic effects, but they cause less acute extrapyramidal symptoms than the high-po-tency agents with a reversed pattern of adverse-effects. Sedative and muscarinic effects usually diminish with continuous usage, although sedati-ve effects may be useful for behavioral control in acute phase of illness (4).

Extrapyramidal side effects, caused by dopa-mine receptor blockade, including: acute dystonia, parkinsonism, akathisia and tardive dyskinesia-in-voluntary choreoathetoid movements witch, unli-ke other EPS, may persist even after withdrawal of the antipsychotic drug (5).

In Federation of Bosnia and Herzegovina mo-dern attitudes are accepted in the treatment of psychotic patients. These attitudes imply treatment within the community, closing of big hospitals and preference of out-patient clinics for the treatment of the patients. In this sense one question must be posed and that is to what extent pharmacologi-cal treatments of schizophrenia are accepted and applied in modern way. These modern, contempo-rary treatments imply usage of new antipsychotic drugs, because in the area of psychopharmacolo-gy there are dramatic world changes, in a sense that classic antipsychotics are in the retreat and currently new atypical antipsychotic drugs are in use, which have been shown as far more efficient and safer for the patients.

Application of atypical antipsychotics is more common in the world than in our country (except clozapine), due to their high cost and because the current health insurance system cannot provide to the patients affordable everyday use in our country. But nowadays we can use new antipsychotics wich are available to the professionals in our country.

The aim of this study was to establish which antipsychotics are currently in use and to determi-ne in what daily dosages these drugs are given to patients.


This prospective study was performed in 2004. at the Psychiatric Clinics of Universities in Saraje-vo, Tuzla and Mostar. Census, a review of the pa-tients, was done simultaneously in all centers. All patients with schizophrenia situated in the univer-

sity hospitals in FB&H (Sarajevo, Tuzla, Mostar) included trough census in this study. Inclusion criteria were: diagnosed schizophrenia by a neu-ropsychiatrist, antipsychotics treatment in tractu, both genders, all ages, patients without somatic disorders. Exclusion criteria were: patients with schizophrenia and co-morbidity (somatic), pre-gnancy, lactation. The following outcomes were evaluated: the frequency of usage and daily doses of haloperidol, promazine and clozapine.

Normal distribution of continuous variables was assessed using Kolmogorov-Smirnov test. The Chi-square test was used to analyze categori-cal variables. The one-way between-groups anal-ysis of variance is used for one independent (gro-uping) variable with three levels (groups) and one dependent continuous variable. A p-value <0.05 was considered as significant. Statistical analysis was performed by using the Statistical Package for the Social Sciences (SPSS Release 16.0; SPSS Inc., Chicago, Illinois, United States of America) software.

Results

Out of 132 patients involved in the study, 45 (34.1%) of them were hospitalized at the Psychi-atric Clinic of Sarajevo, 42 (31.8%) were hospi-talized at the Psychiatric Clinic of Tuzla, while 45 (34.1%) were hospitalized at the Psychiatric Clinic of Mostar.

There was a significant difference in frequency of application of haloperidol, promazine and clozapine (35.5% vs 57.8% vs 6.7% respectively, c2=17.733; p=0.000) at Psychiatric Clinic of Sarajevo. There was not a significant difference in frequency of ap-plication of haloperidol, promazine and clozapine (47.6% vs 26.2% vs 26.2% respectively, c2=3.857; p=0.145) at Psychiatric Clinic of Tuzla. There was a significant difference in frequency of application of haloperidol, promazine and clozapine (64.4% vs 26.7% vs 8.9% respectively, c2=21.733; p=0.000) at Psychiatric Clinics of Mostar.

There was a significant difference in frequen-cy of application of haloperidol, promazine and clozapine (49.3% vs 37.1% vs 13.6% respective-ly, c2=25.955; p=0.000) at Psychiatric Clinics of Federation of Bosnia and Herzegovina (Figure 1).

662



Figure 1. Application of haloperidol, promazine and clozapine in Psychiatric Clinics in FB&H

Haloperidol daily doses

The mean of daily dose of haloperidol admini-stered in Mostar was the highest (18.1 mg), while similar daily doses were applied in Sarajevo and Tuzla (6.4 mg and 8.2 mg, respectively) (Figure 2).

Figure 2. Means plot with 95% confidence inter-vals of daily doses of haloperidol

There was a statistically significant difference at the p<0.05 level in means of daily doses of haloperidol for the three groups [F(2,62)=8.440, p=0.001]. (Table 1).

Promazine daily doses

The mean of daily dose of promazine was the highest in Sarajevo (211.5 mg), while the lowest mean of daily dose was applied in Mostar (141.7 mg) (Figure 3).

Figure 3. Means plot with 95% confidence inter-vals of daily doses of promazine

There was not a statistically significant differ-ence at the p<0.05 level in means of daily doses of promazine for the three groups [F(2,46)=2.169, p=0.126]. (Table 2).

Table 1. Results of haloperidol – daily doses from a one – way ANOVAPsyhiatric Clinics n Mean 95 % CI F (df) p value

Sarajevo 16 6.4 3.8 - 9.0 8.440 (2,62) 0.001Tuzla 20 8.2 6.4 - 9.9Mostar 29 18.1 12.4 - 23.8

Table 2. Results of promazine – daily doses from a one – way ANOVAPsyhiatric Clinics n Mean 95 % CI F (df) p value

Sarajevo 26 211.5 178.6 – 244.5 2.169 (2,46) 0.126Tuzla 11 197.7 114.3 – 281.2Mostar 12 141.7 78.0 – 205.3



Clozapine daily doses

The mean of daily dose of clozapine administe-red in Sarajevo was the highest (266.7 mg), while the means of daily doses in Tuzla and Mostar were 240.9 mg and 168.8 mg, respectively (Figure 4).

Figure 4. Means plot with 95% confidence inter-vals of daily doses of clozapine

There was not a statistically significant diffe-rence at the p<0.05 level in means of daily doses of clozapine for the three groups [F(2,15)=0.798, p=0.469]. (Table 3).

Discussion

In our study, the mean of daily dose of cloza-pine administrated in Sarajevo was the highest (266.7 mg), while the means of daily doses in Tu-zla and Mostar were 240.9 mg and 168.8 mg, res-pectively. The mean of daily dose of haloperidol administered in Mostar was the highest (18.1 mg), while similar daily doses were applied in Sarajevo and Tuzla (6.4 mg and 8.2 mg, respectively). The mean of daily dose of promazine was the highest in Sarajevo (211.5 mg), while the lowest mean of daily dose was applied in Mostar (141.7 mg).

The doses in the United States are approxima-tely doubled compared to the doses in Europe (200-300 mg/day). Some of the side effects of clo-zapine, such as: convulsions, confusion and sexual dysfunction, are related to dose and blood levels. But, the increase of body mass was not dependant on dose. The latest reports show that optimal blo-od levels of clozapine should be between 200 and 250 μg/ml, although a lot of patients had good response even with usage of lower concentrations (6). The contemporary researches provided strong evidences about the efficiency of second genera-tion of antipsychotic in the treatment of schizop-hrenia, and clearly indicated that they cause much less extrapyramidal side effects (EPS) than the tra-ditional medications (7).

Also there are evidences that these medications have less potency to cause tardive dyskinesia (TD) than the first generation of antipsychotic, and can be useful in the treatment of preexisting TD. In general, patients tolerate much better these medi-cations than older generations of antipsychotics, with few important exceptions, including the risk of agranulocytosis in clozapine usage and poten-tial to increase body mass by many medications from this group. Due to their superior safety in terms of neurological side effects, it is considered that the second generation of antipsychotics sho-uld be available as the first choice of treatment in schizophrenia, and preferred in the first episode patients (8).

In the study „Clinical and socio-demographic profile of patients with schizophrenia according to the antipsychotic treatment prescribed“, mean psychotic dose was 660 mg/day and 68% of pa-tients were treated with an atypical antipsychotic (amisulpride, clozapine, olanzapine, risperidone). Thirty-two percent of patients were treated with doses between 600 and 1.000 mg/day and 24% with doses higher than 1.000 mg/day. Comparing patients according to the dose level that they were receiving (<300 mg/day; 300 to 599 mg/day; 600

Table 3. Results of clozapine – daily doses from a one – way ANOVAPsyhiatric Clinics n Mean 95 % CI F (df) p value

Sarajevo 3 266.7 123.2 – 410.1 0.798 (2,15) 0.469Tuzla 11 240.9 156.5 – 325.3Mostar 4 168.8 18.6 – 318.9

664



to 999 mg/day and >1.000 mg/day), there was no significant difference between groups for socio-demographic variables.

Patients treated with doses under 300 mg/day had better psychosocial profile and were more of-ten treated with loxapine, haloperidol and risperi-done. Patients treated with doses higher than 1.000 mg/day were more often receiving clozapine. The-re was still a substantial number of patients treated with conventional antipsychotics in >1.000 mg/day range. Patients receiving an antipsychotic mo-notherapy were more often treated with clozapine or olanzapine and were presented with a higher rate of positive symptoms (9).

Conclusion

The treatment with daily doses of antipsycho-tics at the Department of Psychiatry in University Clinical Centers of FB&H are mainly in accordan-ce with international standards. The importance of this research reflects in following: the data are useful within the ongoing reform of mental health system in FB&H, results point out the position of FB&H in the contemporary world trends in schi-zophrenia treatment, contribution to the rational usage of antipsychotic therapy imply that there was the reducement of frequency in side effects, which can occasionaly be dangerous, and contri-butes to the faster rehabilitation of schizophrenic patients with the reduction of financial costs of treatment.

References

1. Loga Zec S, Loga S, Mulabegovic N, Asceric M. Consumption Trend of Psychotropic and Antibiotic Drugs in Clinical Centre of University of Sarajevo (CCUS). Healt Med 2011, 5 (2): 435-442

2. Jibson MD, Tandon R. Treatment of schizophrenia. Psychiatry. Clin. North Am. 2000; 7: 83-113.

3. Primary Care Companion: A Roadmap to Key Pharmacological Principles in Using Antipsycho-tics. J Clin Psychiatr 2007;9(6): 444-454

4. Katzung BG. Basic and Clinical Pharmacolo-gy, Eighth Edition, the McGraw-Hill Companies. 2001; 478-490.

5. Reid J, Rubin P., And Walters M.: Clinical Phar-macology and Therapeutics,Blackwell Publishing, 2006; 197-198

6. Van der Zwaag C, McvGee M, McEvoy J.P., Freu-den-Reich O, Wilson W.H., Copper TB. Response of patients with treatment-refractory schizophrenia to clozapine within three serum ranges. American Journal of Psychiatry, 1996; 153:1579-84.

7. Fleischhacker WW. Drug Treatment of Schizophrenia. In: Maj M, Sartorius N (Eds). Schizophrenia.1999; Chichester: John Wiley & Sons Ltd.

8. Lieberman JA. Atypical antipsychotic drugs as a first line treatment of schizophrenia: A rationale and hypothesis. Journal of Clinical Psychiatry 1996; 57 (Suppl 11): 68-71

9. Lamarque I, Auffray L, Villamaux M, Demant JC, Launay C, Petitjean F, Salomé F.:[Clinical and socio-demographic profile of patients with schi-zophrenia according to the antipsychotic treatment prescribed] Encephale2006 May-Jun;32(3 Pt 1):369-76. French.

Corresponding author: Svjetlana Loga-Zec, Institute of Pharmacology, Clinical Pharmacology and Toxicology, Faculty of Medicine, University of Sarajevo, Bosnia and Herzegovina, E-mail: [email protected]



Abstract

Introduction: Post-traumatic stress disor-der (PTSD) is delayed or prolonged response to a provocative event or situation of exceptionally threatening or catastrophic nature. Global Asse-ssment of Functioning Scale, GAF, is a standard method in the approach to clinical assessment of the patient’s overall level of functioning.

Material and methods: This prospective study was conveyed at the Department of Neurop-hysiology Clinic for neuropsychiatric diseases at the Health Center in Tuzla in the period between March to December, 2008. The control group consisted of 50 clinically healthy subjects (44 male), aged 49.65 ± 6.7. The studied group con-sisted of 50 patients treated for PTSD, aged 50.5 ± 5.61, the same gender distribution as the con-trol group. Beck’s Anxiety Inventory, BAI, Beck’s Depression Inventory, BDI, and Beck’s Hopele-ssness Scale are used in the analysis of anxiety, depression and hopelessness.

Results: The majority of patients of the studied group (30%) had severe depression, 82 % of them had severe anxiety,, while 56 % suffered from se-vere hopelessness. The level of functionality, mea-sured by GAF was ‘’really significantly’’ negative-ly correlated with the level of anxiety (r=-0,6196), as well as with the level of depression (r=-0,6244) and the level of hopelessness (r=-0,5852).

Conclusion: The potential significance of the connection between the level of functioning ,me-asuerd by GAF, and the rate of anxiety, depressi-on and hopelessness is at the relatively fast asse-ssment of the improvement or the worsening of the patient’s mental condition, after the drug and/or psycotherapy treatment.

Key words: posttraumatic stress disorder, de-pression, anxiety, hopelessness.

Sažetak

UVOD: Posttraumatski stresni poremećaj (PTSP) je odgođeni ili produženi odgovor na provokativni događaj ili situaciju izuzetno prije-teće ili katastrofične prirode, koja kod većine oso-ba izaziva neprijatnost. Manifestuje se u formi nametajućih razmišljanja i slika, fenomenom izbjegavanja i povišenom pobuđenošću. Mnogi ljudi sa PTSP ponovno preživljavaju teška iskuše-nja u formi epizoda fleš beka, prisjećanja, noćnih mora, ili zastrašujućih razmišljanja, posebno kada su izloženi događajima ili objektima koji podsje-ćaju na traumu. Proširenost PTSP u opštoj popula-ciji: poremećaj se javlja u 0,5% muškaraca i 1,3% žena.

Skala globalne procjene funkcionisanja (Glo-bal Assessment of Functioning Scale, GAF) je standardna metoda u pristupu kliničke ocjene uku-pnog nivoa pacijentovog funkcionisanja. Omogu-ćava kliničaru da napravi pregled pacijentovog trenutnog, ali i najvećeg nivoa psihološkog, soci-jalnog i profesionalnog funkcionisanja.

Cilj istraživanja: Utvrditi stepen depresiv-nosti, anksioznosti, beznadnosti i funkcionalnosti ispitanika sa posttraumatskim stresnim poreme-ćajem liječenih medikamentozno i/ili psihoterapi-jom nakon zadnje psihoterapijske seanse, te utvr-diti korelaciju stepena funkcionalnosti sa nivoima depresivnosti, anksioznosti, beznadnosti.

Ispitanici i metode: Ova prospektivna studija je vršena u Kabinetu za neurofiziologiju Polikli-nike za neuropsihijatrijske bolesti Doma zdravlja Tuzla u periodu mart - decembar 2008. godine. Kontrolnu grupu je činilo 50 klinički zdravih is-pitanika (44 muškarca) prosječne dobi 49,65±6,7 godina. Ispitivanu grupu je činilo 50 pacijenata liječenih od PTSP prosječne dobi 50,5±5,61 godi-na, iste polne distribucije kao kontrolna skupina.

Functional parameters of those suffering from Posttraumatic Stress DisorderEmir Tupkovic1, Eldina Malkic Salihbegovic2, Zumreta Planic2 1 Health Centre Tuzla, Bosnia and Herzegovina,2 Health Centre Zivinice, Bosnia and Herzegovina.

666



U analizi anksioznosti i depresivnosti i beznadno-sti su upotrijebljene Beck-ova sala za anksioznost (Beck Anxiety Inventory, BAI), Beck-ova skala za depresivnost (Beck Depression Inventory, BDI) i Beck-ova skala beznadnosti (Beck Hopelles scale, BHS).

Rezultati: Najveći broj pacijenata ispitivane skupina (38%) imao je jaku depresivnost, 82% težu anksioznost, 56% težu beznadnost. Nivo funkcionalnosti mjeren sa GAF je „stvarno zna-čajno“ negativno korelirao sa nivoom anksioznosti (r=-0,6196), te nivoom depresivnosti (r=-0,6244) i beznadnosti (r=-0,5852).

Diskusija: Evidentirani su vrlo visoki skorovi anksioznosti, depresivnosti i beznadnosti ambu-lantno tretiranih pacijenata sa PTSP. Obzirom na značaj BHS u procjeni suicidalnosti kod depre-sivnih pacijenata, uočena je očekivana visoka, „stvarna značajna“ pozitivna korelacija stope be-znadnosti spram stope depresivnosti. No, visoke su, „stvarno značajne“ negativne i stope korelacije stope funkcionisanja sa svim skalama, a najjača je povezanost zabilježena sa stopom depresivno-sti. Drugim riječima, porast stope depresivnosti uvijek vodi ka padu funkcionalnosti, a da ni stopa anksioznosti u tome bitnije ne odstupa.

Zaključak: Potencijalni značaj povezanosti nivoa funkcionisanja mjerenog sa GAF sa sto-pom anksioznosti, depresivnosti i beznadnosti je u relativno brzoj procjeni oporavka ili pogoršanja psihičkog stanje pacijenta nakon sprovedene me-dikamentozne i/ili psihoterapije.

Ključne riječi: posttraumatski stresni poreme-ćaj, depresivnost, anksioznost, beznadnost.

Introduction

Anon: According to the MKB-10 classificati-on, the posttraumatic stress disorder (PTSD) is the delayed or prolonged response to the provocative action or situation with very threatening or cata-strophic nature, which in turn, provoke discomfort to the majority1. It manifests itself in the form of intruding thoughts and pictures (visions), or by the phenomenon of avoidance or intense excitement. Many people, suffering from the PTSD, go thro-ugh the same difficult temptations again, in the form of flash backs, remembering, nightmares, or

the frightening thinking, especially when they are exposed to the actions or things which remember them on the trauma they suffered once2. The extent of PTSD among the general population is: 0.5 % among the male population, and 1.3 % among the female population3.

People who suffer from PTSD tend to have ab-normal levels of key hormones included in the res-ponse to the stress. Neuropsychological analyses show that PTSD is combined with the dysfunction of the hypothalamy – gland axis as well as with other brain structures, such as: prefrontal cortex, hippocampus and amygdale. Neuro-endocrine studies held among the adults with the symptoma-tology of PTSD showed that corticotrophin relea-sing hormone (CRH) is enlarged in the cerebrospi-nal liquid, while the levels of cortical in urine vary, in most of the cases they are low. The excretion of catecholamine in urine is bigger in the cases with patients suffering from the PTSD than with con-trolled subjects without this disorder, including other psychiatric disorders4.

Global assessment of functioning scale

Anon: Global assessment of functioning scale (GAF) is the common method in the approach of the clinical analysis of the patient’s overall level of functioning and it contains information about the axis V DSM IV5. It allows clinician to do medi-cal examination of the patient’s present, but at the same time the highest level of his or her psycho-logical, social and professional functioning in the period of few months in the previous year, which has its importance when predicting the results of the treatment6,7. Several studies have confirmed the connection between the gravity of symptoms wich patient feel and the assessment of global fun-ctioning given by the clinician himself8.

There is an open question in terms of with whi-ch parameters the level of functioning most stron-gly correlates in different types of psychotherapy and drug treatment, and in different stages. There are very few studies which assess the GAF with the patients who suffer from chronic PTSD. Also, there is a small number of those studies which assess the relation between the same group of pa-tients and anxiety and depressiveness.



The aim of the research

The aim of this research is to confirm the degree of depressiveness, anxiety, desperation and functio-nality of those questioned who at the same time suf-fer from PTSD who went through the drug treatment and / or psychotherapy, after the last psychotherapy session had been completed. Also, the purpose of the research is to confirm the correlation of the de-gree of functionality with the levels of depressive-ness, anxiety and hopelessness of the patient’s state.

Examinee and methods

This is a prospective study. This study has been conducted at the Department of Neurophysiology Clinic for neuropsychiatric diseases in the Health Center in Tuzla in the period between March to December, 2008.

The control group consisted of 50 clinically he-althy subjects (44 men or 88%), average age 49.65 ± 6.7 (30-61).

The examined group consisted of 50 patients treated for posttraumatic stress disorder aged 50.5 ± 5.61 (39-62), mostly males of the same gender distribution as a control group randomly selected after the routine check-ups at the Center for Men-tal Health in the Health Center in Tuzla . All the men were war veterans. The average duration of PTSD symptoms was 10 ± 4.6 (1-20) years. Even 40 more examinees had a diagnosis of depression or anxiety-depressive disorder.

In the therapeutic scheme, 49 patients were given antidepressants, as well as hypnotics and sedatives, 15 patients were given antipsychotic, while 15 of them were administered and given an additional therapy. In the course of the study of individual and group psychotherapy sessions, 26 patients were visiting those sessions, while with 11 patients psychotherapeutic treatment has been completed. In the case of 9 patients, psychothera-py was indicated, but for various reasons it could not be exercised, while this treatment wasn’t reco-mmended to the rest of the patients. Functionality is therefore estimated with the Gaf scored from 0 (minimum) to 100 (maximal function).

Beck’s Anxiety Inventory, BAI, and Beck’s Depression Inventory, BDI, were used in the anal-

ysis of anxiety and depression. Beck’s Anxiety In-ventory is ranked as followed: minimal (non-anxi-ety) (0-9), mild anxiety (10-16), moderate anxi-ety (17-29), severe anxiety (30-63). On the other side, BDI is ranked as followed: normal ups and downs (0-10), mild behavioral disorders (11-16), borderline clinical depression (17-20), moderate depression (221-30), strong depression (31-40), and extreme depression (over 40).

Beck’s Hopeless Scale, BHS, is the scale which consists of 20 questions, which determine the risk for suicide. It is recommended as the background instrument for Beck’s Depression Scale. It is ranked in the following range: minimum (0-3), mild (4-8), moderate (9-14), and severe hopelessness (15-20).

Medical statistics

The median values of functionality, anxiety, de-pression and hopelessness, as well as Spierman’s correlation coefficient are estimated in the statisti-cal analysis of parameters, while the differences are taken into account as the meaning for p < 0,05.

Results The values of rates of depression, anxiety, ho-

pelessness and functionality measured with BDI, BAI, BHS, and GAF of the group examined are shown in Table 1. Most of the patients of the exa-mined group (38%) had severe depression, fo-llowed by extreme depression (26%) and modera-te depression (24%) (Fig.1). Most patients (82%) who suffered from PTSD had severe anxiety (Fig. 2). The majority of examinees (56%) is distributed in the group with predominantly hopelessness and despair followed by moderate (28%) and mild ho-pelessness (12%) (Fig.3).

Graphical representation of the correlation between BDI and BHS is shown on the Figure 5, fo-llowed by the representation of the GAF and BAI on the Fig.6, and GAF and BHS on the Figure 7. There is a relatively high positive correlation between ho-pelessness and depression (Fig. 4). The highest rate of correlation function measured by the GAF is ex-hibited towards depression (Fig. 5), and quite high, or only slightly lower, compared to anxiety (Fig. 7).

668



Figure 1. The distribution of the degree of depre-ssion in patients with posttraumatic stress disor-der measured by Beck’s Depression Scale (BDI) 0-10 normal ups and downs, 11-16 mild behavi-oral disorders, 17-20 borderline clinical depre-ssion, 21-30 moderate depression, 31-40 severe depression, 41-63 extreme depression.

Figure 2. The distribution of the level of anxiety in patients with posttraumatic stress disorder me-asured by Beck’s Anxiety Scale (BAI); 10-16 mild anxiety, 17-29 moderate anxiety, 30-63 harder anxious.

Figure 3. The distribution of the degree of hope-lessness among patients with posttraumatic stress disorder measured by Beck’s Hopelessness Scale (BHS); Minimum 0-3 hopelessness, 4-8 mild ho-pelessness, 9-14 moderate hopelessness, 15-20 severe hopelessness

Figure 4. Graphical representation of correla-tion degree of depression measured by Beck’s Depression Scale (BDI) with the degree of ho-pelessness measured Beck’s Hopelessness Scale (BHS). Spierman: r = 0.6125 (p <0.0001)

Table 1. The parameters of Beck’s depression scale, Beck’s anxiety scale, Beck’s Hopelessness Scale, and global functioning scale of patients with posttraumatic stress disorder

Parametar Mediana Percentile (25-75) Min. Max.

BDI 34,5 26,25-41,5 8 52BAI 38,5 31,25-45 13 61BHS 16 13-18 2 20GAF 45 40-49,5 35 73

BDI: Beck’s Depression Scale, BAI: Beck’s Anxiety, BHS: Beck’s Hopelessness Scale, GAF: the global scale of functioning of subjects with posttraumatic stress disorder



Figure 5. Graphical representation of correlation of the global scale of functioning (GAF) with the de-gree of depression measured by Beck’s Depression Scale (BDI). Spierman: r =- 0.6244 (p <0.0001)

Figure 6. Graphical representation of correlation of the global scale of functioning (GAF) with the degree of anxiety measured by Beck’s Anxiety Scale (BAI). Spierman: r =- 0.6196 (p <0.0001)

Figure 7. Graphical representation of correlation of the global scale of functioning (GAF) and the degree of hopelessness measured by Beck’s Ho-pelessness Scale (BAI). Spierman: r =- 0.5852 (p <0.0001)

Discussion

There are some very high scores of anxiety, de-pression and hopelessness with patients suffering from PTSD who were treated in hospitals. Given the importance of BHS in the assessment of sui-cide in the cases of depressed patients, there is a high expected “real significant” positive correla-tion between the rates of hopelessness against the rates of depression. But there are some high “re-ally significant” negative correlations between the rates and the rate of functioning of all scales, and the strongest observed correlation is with the rate of depression. In other words, the growth of the rate of depression always leads to functional decline, and the rate of anxiety does not fall much behind.

The potential importance of such GAF connec-tion with the parameters mentioned earlier,would be relatively quick assessment of recovery ( for example, after the drug and psychotherapy trea-tment), or worsening the patient’s mental health, which is confirmed by some studies. In the furt-her analysis , the GAF has proven to be extremely useful index in the assessment of the improvement and worsening of depression, not only during but also after the combined therapy and the therapy carried out only with medicaments9.

In other words, based only on the rate of fun-ctionality in a certain stage of patient’s treatment, we can get the insight into the level of his or her anxiety or depression, and thus assess or determi-ne about the need for the further ‘more sensitive’ toxicological analyses.

Conclusion

In the cases of ambulatory treated patients suf-fering from PTSD, there are found some elevated values of anxiety, depression and hopelessness that are highly significantly negatively correlated with the level of functionality.

The potential significance of the connection between the global scale of functioning and the rate of anxiety, depression and hopelessness is in a relatively rapid evaluation of recovery or wor-sening of the patient’s mental condition after the drug and/or psychotherapy treatment.

670



References

1. Anonymous. Međunarodna klasifikacija bolesti i srodnih zdravstvenih problema – deseta revizija, Zagreb: Hrvatski zavod za javno zdravstvo, Medi-cinska naklada 1994:(1).

2. Sutović A. Posttraumatski stresni poremećaj: neu-ropsihologija, klinička detekcija, diferencijalna di-jagnoza.Tuzla: PNT,1997.

3. Klain E, Moro LJ. Velike i male grupe u ratu. U: Klain E. (ur): Ratna psihologija i psihijatrija. Za-greb: Glavnog sanitetki stožer RH, 1992: 66-81.

4. Pervanidou P, Chrousos GP. Post-traumatic Stre-ss Disorder in children and adolescents: from Si-gmund Freud’s “trauma” to psychopathology and the (Dys)metabolic syndrome. Horm Metab Res 2007; 39(6): 413-419.

5. Anonymous. Diagnostic and statistical ma-nual of mental disorders,Fourth Edition. Washington:American Psychiatric Association, 1994.

6. Bodland O, Kullgren G, Ekselius L, Lindstrom E, Von Knorring L. Axis V - Global Assessment of Functioning Scale: Evaluation of a self-report ver-sion. Acta Psychiatrica Scandinavia 1994; 90: 342-347.

7. Phelan M, Wykes T, Goldman H (1994). Global function scales. Social Psychiatry and Psychiatric Epidemiology 1994; 29: 205-211.

8. Roy-Byrne P, Dagadakis C, Unutzer J, Ries R . Evidence for limited validity of the revised Global Assessment of Functioning Scale. Psychiatric Ser-vices 1996; 47: 864-866.

9. Petković J, Tupković E. Comparative analysis of the level of functioning of depressive patients tre-ated psychopharmacotherapy and by cognitive-be-havioral therapies and only by psychopharmacot-herapy. Med Arh 2007; 61(2): 53.

Corresponding author Eldina Malkic Salihbegovic, Health Centre Zivinice, Bosnia and Herzegovina, E-mail: [email protected]



Abstract

Left ventricular hypertrophy in patients with arterial hypertension, who are undergoing chro-nic dialysis, is a myocardial response to increased load caused by volume and it is a compensatory mechanism. Left ventricular hypertrophy, along with the secondary anemia, changes in the relation between Ca and P, secondary hyperparathyroidi-sm, changes in biochemical content of plasma - in which azotemia dominates; inflammation and accelerated atherosclerosis, has a significant role in the development of cardiovascular diseases.

Systolic function of the heart stays preserved for a long time thanks to the left ventricular hyper-trophy. Diastolic function of the heart is disrupted by the effects of two factors: hypervolemia and the left ventricular hypertrophy. The increased mass of myocardium and interstitial connective tissue slows down the relaxation of the myocardium.

The aim of this study was to attest the influence of left ventricular hypertrophy on its diastolic fun-ction in patients on dialysis.

The study consisted of a group of 26 patients who had been undergoing dialysis for more than 3 years; of whom 19 (73.08%) patients suffered left ventricular hypertrophy - 14 (53,84%) of them had LVH with a diastolic dysfunction (LVHDD), and 5 (19,23%) of them suffered left ventricular hypertrophy (LVH) wit normal diastolic function of the left ventricle; 7 (26.92 %) patients did not have left ventricular hypertrophy.

The patients with arterial hypertension and left ventricular hypertrophy were older, had been more than 3 years on hemodialysis and had higher systo-lic blood pressure. The diastolic function parame-ters in the patients with hypertension and left ven-tricular hypertrophy compared to the diastolic fun-

ction parameters in the patients with hypertension without left ventricular hypertrophy, have indicated a significant extension of the isovolumic relaxation time (IVRT) (p<0.001) and a significant reduction of E/A ratio (p< 0.05). The correlation between the left ventricular mass index (LVMI) and the diastolic function parameters: IVRT, DT and the E/A ratio has proved that the IVRT significantly correlates with the MLKI (p<0.0005) and that DT signifi-cantly correlates with MLKI (p<0.01).

Key words: left ventricular hypertrophy, arte-rial hypertension, diastolic function, hemodialysis.

Introduction

Left ventricular hypertrophy in patients on chronic dialysis is a response to increased pressure load as a result of increased liquid volume in the body and increased systemic vascular resistance and it can be seen, up to a certain degree, as a ne-cessary, protective and compensatory mechanism. Above that degree, different forms of dysfunction of the left ventricular hypertrophy are developed, which can be manifested as systolic dysfuncti-on, diastolic dysfunction or systolic and diastolic dysfunction.

Frequency of the left ventricular hypertrophy in patients, measured by echocardiogram, is di-rectly related to the length of the renal insufficien-cy, hypertension, and the age of the patient, as well as to the presence of other cardiovascular diseases.

Left ventricular hypertrophy is a physiological response to the increased hemodynamic load of the heart by pressure and/or volume. During heart load by volume, hypertrophy of the septum and left ventricular wall is developed, and at the same time the left ventricle gets enlarged.

Impact of left Ventricular Hypertrophy on diastolic function in hemodialysis (HD) patientsSedija Arapcic

A Public Health Institution - The Lukavac Health Center, Bosnia and Herzegovina

672



Echocardiography is nowadays used as a met-hod of choice when establishing a diagnosis of left ventricular hypertrophy; since its sensitivity is 93% and specificity 95%.

Left ventricular mass (LVM) is a dimension used to estimate left ventricular hypertrophy and it is calculated according to the Penn convention using the Deveraux and Reichek’s formula. Left Ventricular Mass Index (LVMI) is even more pre-cise criterion, and it is obtained when left ventri-cular mass (expressed in grams) is divided by the body height (expressed in meters) or body surface area (expressed in square meters). Normal upper values for the left ventricular mass index regar-ding the body surface area are 134 g/m² for men or 110 g/m² for women.

Diastolic dysfunction is almost always present with left ventricular hypertrophy. Left ventricular hypertrophy has a protective effect in the preserva-tion of the systolic function of the left ventricle in patients with arterial hypertension. Adverse incre-ase in myocardial mass and interstitial connective tissue has an impact on the diastolic function of the left ventricular hypertrophy, because it slows down the relaxation and increases the hardness of the myocardium. Slow relaxation of the myocardi-um results from the increased energy needs of the hypertrophic myocardium as well as from chronic heart load caused by volume.

Left ventricular diastolic dysfunction in pati-ents with hypervolemia and left ventricular hyper-trophy is characterized by extended IVRT, reduc-tion of E wave and extension of A wave, which results in the reduction of the E/A ratio and the extension of the DT. The DT is extended in hyper-trophic heart proportionally to the left ventricu-lar mass index. Left ventricular hypertrophy has reversed relationship with the E/A ratio, which means that the more significant the left ventricu-lar hypertrophy is, the lower the E/A ratio is. The LVMI significantly correlates with the indexes of the diastolic filling at ease.

The frequency of the left ventricular hypertrop-hy, measured using an echocardiogram, in patients on dialysis with medium or severe hypertension is between 50 to 90%; and they are prone to higher risk of cardiovascular morbidity and mortality. The size of the left ventricular hypertrophy can be con-sidered as a predictor of severe heart conditions; be-

cause the presence of severe hypertrophy is associ-ated with the increased risk of sudden death caused by acute myocardial infarction and fatal arrhythmia.

Aim of the study

The aim of the study was to examine the impact of left ventricular hypertrophy on the diastolic function of the left ventricle in patients on chronic dialysis.


The study is retrospective and it has included 26 patients - 17 men and 9 women, 25 to 75 years of age, who had been on dialysis for more then 3 years. The study has been conducted at the Luka-vac Health Center Cardiology Outpatients; and the patients have been treated with acetate dialysis at the Tuzla Internal Medicine Clinic for 4 hours three times a week, or for 5 hours two times a week.

Anthropometric measurements have been used to determine body weight (BW) and height (H), and then the body mass index (BMI) was calcula-ted. The body surface area (BSA) was calculated from the table. All the patients have been exami-ned using an echocardiogram - the General Elec-tric LOGIQ 3 ultrasound machine.

According to the ASE recommendations, the following has been measured in the parasternal position in both two-dimensional (B-mode) and in one-dimensional (M-mode) technique:

1. interventricular systolic diameter diastole (IVSDd),

2. posterior wall diameter diastole (PWDd),3. left ventricular diameter at end-diastole

(LVDd),4. left ventricular diameter at end-systole

(LVDs),5. left atrium diameter (LA)

Left ventricular mass (LVM) was calcula-ted by Deveraux and Reichek formula, accor-ding to the Penn Convention: LVM=1.04 ((LVDd+PWDd+IVSDd) 3-(LVDd) 3-13.6

The left ventricular mass index (LVMI) has been obtained by the standardization of the left



ventricular mass in relation to the body surface area. Normal upper values for the LVMI in relati-on to the body surface mass are 134 g/m² for men and 110 g/m² for women.

The ejection fraction (Ef) has been calculated by the Simpson’s rule.

Diastolic function parameters have been mea-sured by pulse Doppler echocardiogram in apical 4 chamber position with volume placed at the mi-tral valve leaflet tips, as follows:

- IVRT - isovolumic relaxation time - the time from aortic valve closure to mitral valve opening,

- E wave - the maximum velocity during early diastolic filling,

- A wave - the maximum velocity during late diastolic filling,

- DT - deceleration time of E wave, - E/A ratio - calculated from the obtained

values.

Statistical data processing has been done appl-ying relevant statistical tests. All the values have been given as average values and average devia-tions. Student’s t-test, Hi quadrant test and linear correlation test have been used for the comparison. The statistical importance has been determined at the level of 5% (p<0.05).

The results

The study has included 26 patients - 17 men and 9 women at the age of 25 to 75, who had been on chronic dialysis for more that 3 years. 19 pati-ents (73.08%) suffered left ventricular hypertrop-hy - 14 (53,84%) of them suffered left ventricular hypertrophy with diastolic dysfunction (a kind of relaxation disorder and pseudo normalization; there was no restriction), and 5 (19,23%) of them had normal left ventricular diastolic function; and 7 patients (26.92%) did not suffer left ventricular hypertrophy.

The average age of the patients was 48.55 ye-ars, and the average number of years on dialysis was 5.5.

The patients with arterial hypertension and left ventricular hypertrophy compared to the patients with arterial hypertension without left ventricu-

lar hypertrophy have not showed any significant statistical difference regarding the BMI, diastolic blood pressure, systolic function, ejection fraction and the size of the left atrium. They were signifi-cantly older, had spent more time on chronic di-alysis, and had significantly higher systolic blood pressure (p<0.001).Table l. Presentation of the patients’ characteristics

With the LVH without the LVH

Total 19 7Men 14 3Women 5 4Systolic pressure 178 145

Diastolic pressure 110 102

Age 53 42Years on dialysis 5.5 3.4

BMI 26 28IVRT 145 90E/A ratio 0.59 1.0DT 176 157Ef 62.3 60.7A wave 0.70 0.59LV mass 289.3 174.5

Chart l. Direct correlation between LVH and the length of dialysis

674



Chart 2. Correlation between A and the length of dialysis

The longer the period of dialysis is, the higher

the rates of LVH are. People without LVH are yo-unger and have been on dialysis for shorter period of time.

The patients with arterial hypertension and left ventricular hypertrophy compared to the patients with arterial hypertension without left ventricular hypertrophy had longer IVRT (p<0.00l), greater A-wave (p <0.005) and lower E/A ratio (p<0.05).

Chart 3. Correlation between DT and the length of dialysis

Chart 4. Direct correlation between IVRT and the length of dialysis

Discussion

The prognostic importance of left ventricular hypertrophy (LVH) in hypertensive patients has been given in the Framingham Heart Study, whose authors have come to the conclusion that increased left ventricular mass along with increased risk of cardiovascular diseases and risk of cardiovascular death, do not depend on blood pressure, BMI, di-abetes, or disorder of lipid metabolism. The incre-ase in the left ventricular mass for 50 g increases 1.7 times the risk of sudden death.

Our study included 26 patients (17 men and 9 women) who were on chronic dialysis. 19 patients suffered left ventricular hypertrophy, which match the data in the literature.

The patients with arterial hypertension and left ventricular hypertrophy compared to the patients with arterial hypertension without LVH did not differ regarding sex, BMI value, diastolic blood pressure, systolic function of the left ventricle, ejection fraction and the size of the left atrium.

The patients with arterial hypertension and left ventricular hypertrophy compared to the patients with arterial hypertension without LVH were si-gnificantly older, had spent more time on chronic dialysis, and had significantly higher systolic blo-od pressure (p<0.001).

The left ventricle diastolic function parameters in the patients with arterial hypertension and LVH compared to the left ventricle diastolic function parameters in the patients with arterial hypertensi-



on without LVH have been significantly changed: IVRT has been significantly longer, A wave has been bigger (p<0.005), and the E/A ratio has been smaller (p<0.05). The DT and E wave values have not shown significant difference.

Left ventricle hypertrophy leads to the extension of IVRT. The increase in the LVMI is in an inverse relationship with the E/A ratio; the bigger LVMI the smaller the E/A ratio. Our study has shown that left ventricular hypertrophy in the patients with arterial hypertension significantly extends IVRT and redu-ces the E/A ratio. The diastolic function parameter correlation: IVRT, DT and the relation of the E/A ratio with the LVMI significantly correlate with: IVRT and DT; and LVMI does not correlate with the E/A ratio. In studies by other researchers corre-lation between diastolic function parameters and LVM has not been established.

The patients with left ventricular hypertrophy and left ventricle diastolic dysfunction had, on average, spent 5.5 years on dialysis, compared the patients with LVH without diastolic dysfunction (3.4 years) and without LVH (3 years); which me-ans that the duration of hypertrophy is important for the onset of diastolic dysfunction of the left ventricle; which in an average occurs after 5.5 ye-ars of hypervolemia. The existence of direct corre-lation between LVH, LVM, LVDD and the dura-tion of hypervolemia has been shown. IVRT also directly correlates with the duration of hypervo-lemia; and there is no significant correlation with DT, the E/A ratio, E wave and A wave regarding the duration of hypervolemia.

Conclusion

- The patients with arterial hypertension with left ventricular hypervolemia and hypertrophy, compared to the patients with arterial hypertension without LVH, had been on chronic dialysis for longer period, they were older and they had higher systolic blood pressure.

- IVRT was extended, and the E/A ratio was smaller in the patients with arterial hypertension and LVH.

- In the correlations, LVMI showed no effect on IVRT and DT.

- Left ventricular hypertrophy and the diastolic dysfunction which goes with it are reversible changes. The regression of the hypertrophy and diastolic dysfunction can be achieved by good blood pressure regulation, in other words by good regulation of volemia (volume of plasma in the body) by regular dialysis, along with hygiene and dietary regime and usage of proper pharmacological preparations.

References

1. D’Amico M, Locatelli F. Hypertension in Dialysis: Pathophysiology and Treatment. J.Nephrol, 2002; 15:438-45

2. Choara B. How Iimportant is Volume Excess in the Aethiology of Hypertension in Dialysis Patients Se-min Dial, 1999; 12: 297-9.

3. Locatelli, F, Covic, A, Chazot, C, et al. Hypertensi-on and Cardiovascular Risk Assessment in Dialysis Patients. Nephro Dial Transplant, 2004; 19:1058.

4. Jungers PY, Robino C, Choukroun G, Nguyen-Khoa T, Massy ZA, Jungers P. Incidence of Anemia, and Use of Epoetin Therapy in Pre-dialysis Pati-ents: A prospective study in 403 patients. Nephro Dial Transplant, 2002; 17: 162-1627.

5. Huting J. Kramer W.Schuterlle G. Wizeman V., Analysis of Left-Ventricular Changes Associated with Chronic Hemodialysis A Noninvasive Follow-Up Study. Nephron, 1988; 49:284-90.

Corresponding author Arapcic Sedija A Public Health Institution The Lukavac Health Center, Bosnia and Herzegovina, E-mail: sabina.arapcic @gmail.com

676



Abstract

The aim of this research was to examine the ability to understand reading in hearing-impaired children, identify the prognostic factors (predic-tors) and determine the level of impact of each predictor on these skills.

Examiners, 65 of them, were classified into several groups according to the following crite-ria: age, class, gender, degree of hearing damage, when has the hearing-loss occurred, evaluation of the native language, socio-economic status, edu-cation level of parents, hearing status of parents, and the terms and quality of education.

We have concluded that the ability to under-stand the reading materials in hearing-impaired subjects is not satisfactory. Significant predictors presented are: the attending class, terms and quali-ty of education, evaluation of the native language knowledge and the education level of parents.

Key words: hearing impairment, predictors, understanding reading

Introduction

Reading in itself should not be a purpose. Du-ring the work with children with hearing- impair-ments, and after reading the text, it is important to determine the degree of his/her understanding. The problem with the reading in hearing-impaired chil-dren is a problem of understanding a written text, so the research inevitably went in this direction (1). To understand the text, it is necessary that the person knows and understands about 90% to 95% of the words in that text (2). By the ten-years of age, the majority of words are taught by direct teaching, or with the help and clarifications of the text or the dic-tionary (3). In order for the children to understand

the text, it is necessary to learn the words randomly, without direct instruction.

Hearing-impaired child that try to learn to read, are faced with two major problems (4). First of all, they have a poorly developed speech and there-fore cannot realize that the written word is just a differently presented code of language. Deaf chil-dren learn to read at the same time they learn how to speak. According to some studies, deaf children gain the same level of reading skills by the end of education as the children with normal hearing aged 9 to 10 years (5, 1). Some authors (6) emphasize the maximum use of the residual hearing, oral commu-nication, continuous education and socioeconomic status as one of the factors that contribute to the faster progress of reading in deaf children. Conrad says that the hearing-impaired children of the ages 15 to 16 have the same reading ability as the 9 year-old child who hears normally (7). Hammermeister (1971) examined 60 adolescents, deaf persons from 7 to 13 years of age, and concluded that their voca-bulary increased upon completion of education, but their ability to understand reading has not (8).

Objective

This study will examine the ability to under-stand the reading material in the hearing-impaired children, to identify prognostic factors (predic-tors) and to determine the extent to which these predictors affect their reading abilities.

Methodology

Sample of variables

Independent or experimental variables in this study were: hearing status of subjects, the degree

Understanding reading in persons with hearing impairmentsAlma Huremovic1, Dzevida Sulejmanovic2

1 Faculty of Education and Rehabilitation, University of Tuzla, Bosnia and Herzegovina, 2 SOS Center Hermmang Meiner Sarajevo, Bosnia and Herzegovina.



and time when the hearing damage has occurred, age, gender, skills of the native language, socio-economic status, education level of parents, the existence of hearing impairments in parents, terms and quality of education. Dependent or criteria variables are the variables related to the ability to understand the reading materials.

In order to assess the level of understanding of the reading material, we choose the response method. It involves the sample of questions asked after reading the text, knowing that “the questions are the universal and the best tool that help us cla-rify what is read or to understand the text (9).

Questions are usually set up in the way so that the student finds parts of the questions in the text and gives the right answer. However, when it co-mes to the hearing-impaired children, the answers provided may mislead us into thinking that a stu-dent understood the text. In those situations, we should ask questions that are not directly related to the text, so that the response involves creative and independent thinking, helping us penetrate deeper into the essence of the text.

Sample of examiners

Basic group of examiners, from which the sample was created, involves the hearing-impai-red children from 7 to 14 years of age. Knowing that the hearing-impaired children start dealing with the language and speech systematically, just at the beginning of elementary school, the testing of linguistic knowledge, especially vocabulary in such cases was not possible. Therefore, we have decided to set the third grade elementary school as the lower limit. In this way we have determined the selection of sample frames.

In order to be selected as one for the respon-dents, the main characteristics had to be that they were diagnosed with the hearing-impairment and that they are attending elementary school.

Eliminatory control characteristics in this case are: diagnosed additional difficulties in the su-bjects, and intellectual status below average. The study was conducted in Banja Luka, Brcko, Tuzla and Sarajevo, in the following institutions: Center for the Education and Rehabilitation of Hearing and Speech in Banja Luka”, “Secondary Elemen-

tary School in Brčko”,” Center for the Educati-on and Rehabilitation of Hearing and Speech in Tuzla”,”SOS Center Hermmang Meiner Saraje-vo” and Elementary school, “Mejdan” Tuzla. The study included students who attended one of these schools or have undergone individual therapy in one of these institutions during the year 2007/08.

Respondents with hearing impairments, 65 of them, were classified into several groups in res-pect to the following criteria: age, attending class, gender, level of hearing damage, when the hearing loss has occurred, level of skills in native langu-age, socio-economic status, education level of parents, hearing status of parents and terms and quality of education.

Instruments

The study material used was the “Diagnostic material for Detection of Specific Difficulties in Reading and Writing - The Area of Reading Com-prehension Texts with Understanding (10), and the story “Different punishments.” During the selection of the study materials, we have conduc-ted all parameters that can affect the level of un-derstanding the reading materials: familiarity of the material to the knowledge and experiences of those reading it, knowledge of the words meaning contained in the materials, meaning the writing style (11).

Understanding of the text was tested using ele-ven questions, constructed in the following manner:

- direct questions (questions whose answers are directly in the text),

- indirect questions (questions whose answers are not directly in the text),

- questions where the answers require abstract thinking and reasoning.

During the assessment of understanding the re-ading texts the following was valued:

- A child has fully understood the content and has responded to questions?

- A child has partially understood the contents and has given an incomplete explanation?

- A child has wrongly understood or has not understood the contents?

678



Data processing techniques

According to the general objectives, hypothe-ses, structure of the sample and the analyzed vari-ables, during the statistical processing of the data collected we have applied appropriate statistical procedures and methods of unvaried and multi-variate analysis. Considering that the frequency distributions were normal, applied methods of pa-rametric statistics were used:

- Methods of descriptive statistics, in other words, calculation of the basic statistics: mean, standard deviation, variance, standard error and minimum and maximum values; we used all of this statistical information in order to examine variations between groups and within each group,

- Testing significance of variations; we performed it using the variance method.

- Factors of differentiation were established using the method of discriminatory analysis.

- Examining the significance of system predictors; we performed this using regression analysis methods,

- The results have also been interpreted using the analysis of errors of the subjects examined.

For data processing we have used a statistical package program SPSS for Windows Release 14.0.

Results and discussion

During the assessment of the reading under-standing, the answers to the set of questions were evaluated in the following way: 2 points were gi-ven if the student understood the content and has properly formulated a response to the question, 1 point was given if the student has understood the content, but exhibited a problem in formulating responses, while the 0 points was given to the stu-dent if the content was not understood, and if he/she was not able to answer the question.

According to the Table 1, the largest number of respondents correctly answered the question No. 1, which was: “Who ran to the schoolyard”, then

the question No 2. (“Who has pushed who?”), No. 3. (“What did Luka do?”), No. 4. (“What did the teacher do?”), and the question No. 8. (“What kind of a person is Zvonimir?”)

Worse results were achieved for the questions No. 5 (“How have students defended themsel-ves?), and No. 6 (“How should they have been punished?”).

However, the worst answers were received for the question No. 7 (“Why did Zvonimir push Luka?”), No. 10 (“What would you have done if you were the teacher?”), No. 11 (“What is the main message of this story? “), and No. 9 (“Why was one boy grounded less than the other?”).

We believe that the answers we have received say much about the nature of these questions. In fact, question No. 1, No. 2, No. 3, and No. 4 were direct questions. (The answers to these questions can be found directly below). Questions No. 5, and No. 6 are indirect questions and the answers to these questions are not formulated directly in the text. The questions no. 7, No. 9, No. 10, and No. 11 are the questions requiring abstract thin-king and reasoning. To properly answer these qu-estions the respondent must understand the deeper meaning of the text contents, which seemed to be the problem for subjects with hearing impairment. Unless respondents did not possess a certain level of syntactical abilities, that has prevented them from using a proper dictionary.

Figure 1 shows the arithmetic mean results for all responses.

Figure 1. Arithmetic mean of the results in un-derstanding the reading materials in hearing-im-paired subjects

Figure 2 shows the percentage of quality an-swers to all 11 questions.



Figure 2. Arithmetic mean of the test results in understanding reading materials in respect to the quality of answers

Theoretical scale range spreads from 0 to 22. Each student was able to achieve the variable re-sult ranging from 0 to 2, and the average score is 1.

If we multiply this number with the number of qu-estions (11), the average scale score will be 11. It is evident from the Table 2 that the average score (9.38) is lower than the mid-scale. That can not be considered satisfactory, since we have previously pointed out that the student receives 0 points if he has not understand the contents, 1 point if he has understood the content, but exhibited problems with the formulation of responses, and 2 points if he understood the contents, and properly formu-lated responses. This means that if the arithmetic mean is higher, the level of understanding the rea-ding material is better and vice versa.

In order to create statistically significant diffe-rences in the quality of responses in comparison the model predictors, we have used the regression analysis (Table 3).

Table 1. Descriptive statistics of the test regarding understanding of the reading materials in the res-pondents with hearing impairments

N Minimum Maximum Arithmetic mean Standard deviation Variance

Question 1 65 1,00 2,00 1,53 0,50 0,25Question 2 65 ,00 2,00 1,45 0,53 0,28Question 3 65 ,00 2,00 1,22 0,84 0,70Question 4 65 ,00 2,00 1,12 0,85 0,73Question 5 65 ,00 2,00 0,78 0,87 0,76Question 6 65 ,00 2,00 0,88 0,82 0,67Question 7 65 ,00 2,00 0,49 0,73 0,53Question 8 65 ,00 2,00 1,02 0,74 0,54Question 9 65 ,00 2,00 0,18 0,53 0,27Question 10 65 ,00 2,00 0,35 0,65 0,42Question 11 65 ,00 2,00 0,26 0,57 0,32

Total 65 2,00 22,00 9,3846 5,64 31,83

Table 2. Results of descriptive statistics on total variables in regards to the understanding of the reading materials in the subjects with hearing impairments

N Minimum Maximum Arithmetic mean Standard deviation

Total variable 65 2,00 22,00 9,3846 5,64217

Table 3. Results of the regression analysis of model predictors R R2 Corrected R2 Standard error estimates

,844(a) ,713 ,660 3,29085

680



Significant predictors were the following: the attending elementary grade of the participant, terms of education, success level in the native lan-guage and educational level of parents (Table 4). Similar results were found by Dimić (9), where she pointed out that the degree of hearing damage, success in the native language skills, and the age of subjects were relevant to the understanding of the reading materials.

The table structure of the matrix (Table 5) shows the largest absolute correlation coefficients

of discriminatory variables and standardized ca-nonical discrimination functions in relation to the attending class. We can see that the questions 3, 4 and 5 have exhibited high correlations with dis-criminative function, while the questions 1, 2, 5 and 6 have exhibited moderate correlations with discriminative function.

The most favorable positions have the respon-dents who attend classes VIII, then V and VII, and then VI, IV and class III (Table 6).

Table 4. Standardized and not standardized coefficients in relation to the model predictorsNot standardized

coefficientsStandardized

coefficientsT sig.

B StandardError Beta

Class 1,549 ,531 ,460 2,916 ,005Chronological age -,212 ,482 -,074 -,441 ,661Gender ,745 ,910 ,066 ,819 ,416When hearing impairments was developed 4,276 2,268 ,160 1,886 ,065The degree of hearing loss ,733 ,422 ,139 1,736 ,088Success in native language skills 2,553 ,515 ,398 4,956 ,000Socioeconomic status -,474 1,117 -,041 -,424 ,673Level of education of parents 3,682 1,003 ,351 3,671 ,001Hearing status of parents 1,695 ,976 ,140 1,736 ,088Terms and quality of education -2,748 1,440 -,152 -1,908 ,042

Table 5. The structure of the matrix in the test of understanding the reading materials in comparison to the attending class

Functions

1 2 3 4 5

Question 3 ,686 -,007 -,010 -,159 -,168Question 4 ,646 ,351 -,574 -,069 ,036Question 8 ,534 -,172 ,185 ,031 ,232Question 6 ,451 -,007 -,220 -,004 ,118Question 1 ,430 ,256 -,135 ,058 ,203Question 5 ,404 -,145 -,286 -,041 -,328Question 7 ,280 -,013 -,231 ,107 ,087 Question 2 ,434 -,520 -,098 ,200 -,125Question 9 ,089 ,011 -,196 -,153 ,579 Question 10 ,273 -,073 -,298 ,440 ,440 Question 11 ,198 ,001 -,262 ,201 ,322



Table 6. Centroids of the groups in the test of un-derstanding of the reading materials in compari-son to the attending class

Functions

1 2 3 4 5

III -2,763 -,191 -,185 ,368 -,134IV -,693 ,489 ,836 -,264 ,433 V 1,033 -,833 ,734 ,140 -,186VI ,232 -,725 -,769 -,558 ,150 VII ,426 ,908 -,088 -,334 -,300VIII 1,338 ,367 -,489 ,751 ,193

Table 7. The structure of the matrix in the test of understanding the reading materials with compa-rison to the success in the native language

Functions

1 2 3

Question 6 ,876 ,076 ,221Question 7 ,628 ,239 -,371Question 3 ,615 ,501 ,221Question 5 ,563 ,103 ,196Question 11 ,521 ,034 -,172Question 10 ,512 ,157 -,271Question 2 ,463 ,343 -,174Question 1 ,459 ,367 ,072Question 9 ,387 ,016 -,121Question 4 ,441 ,456 ,243 Question 8 ,360 ,384 ,503

Based on the largest absolute correlation coe-fficients of discriminatory variables and standar-dized canonical discrimination functions, we can conclude that the question 6 has exhibited a very high degree of correlation with discriminative fun-ction, while questions 1, 2, 3, 5, 10 and 11 have exhibited moderate correlations with discriminati-ve function (Table 7).

The most favorable position, in the discrimina-tive area, belongs to the participants with the mark “excellent” in the native language, followed by the respondents with the mark “very good”, while the most unfavorable position on discriminative area belongs to the respondents that have achieved the score “good” or less (Table 8).

Table 8. Centroids of the groups in the test of un-derstanding the reading materials with the res-pondents with hearing impairment in comparison to the success in the native language

Functions

1 2 3

3 -,847 -,662 ,1804 -,501 ,829 -,0485 1,014 -,144 -,004

According to the highest absolute correlation coefficients of discriminatory variables and stan-dardized canonical discrimination functions, we can conclude that the question 9 has provided us with a high degree of correlation with discrimina-tory function, while questions 7, 10 and 11 have provided us with a moderate correlation with the discriminatory function (Table 9). Now we can see the importance of creative thinking and abstract reasoning previously mentioned.Table 9. The structure of the matrix in the test un-derstanding reading materials in comparison to the education level of parents

Functions

1 2

Question 9 ,854 ,073Question 11 ,549 -,357Question 7 ,513 -,348Question 10 ,466 -,458Question 5 ,330 -,257Question 8 ,244 ,109Question 3 ,226 -,225Question 1 ,272 -,466Question 6 ,356 -,395Question 2 ,281 -,383Question 4 ,252 -,260

The best position in the discriminative area is occupied by the respondents whose parents have the university degree education; the second place belongs to the respondents whose parents have se-condary vocational education, while the most un-favorable position on discriminative are is occu-pied by the respondents whose parents have the lowest education degree available (Table 10).

682



Table 10. Centroid groups in the test of under-standing reading materials in comparison to the education level of parents

Functions

NSS -,578 ,579SSS ,093 -,404VSS 5,120 ,927

Conclusion

We have concluded that the ability to under-stand the reading materials in hearing-impaired subjects is not satisfactory. The largest number of respondents has correctly answered to direct que-stions. The answers to these questions were easily found in the text. Indirect questions, where the an-swers to these questions are not clearly formula-ted in the text as well as the questions where the answers require abstract thinking and reasoning represent a definite struggle for the hearing-impa-ired subjects. In order to properly answer the qu-estions provided, a respondent had to understand the deeper meaning of the text, which has proved to be the problem for subjects with hearing impa-irment. Unless the respondents possessed a signi-ficant amount of syntactical abilities, using dictio-naries represented a definite problem.

Some of the significant predictors were the fo-llowing: the attending of the participants, terms and quality of education, success in the native lan-guage and educational level of parents.

References

1. King CM, Quigley SP. (1985) Reading and deafne-ss. San Diego. CA: College-Hill Press.

2. Nagy WE, Scott J. (2000) Vocabulary processes. U: Kamil, M. (Ur.) Handbook of Reading Research, vol. III, pp. 343-366

3. Biemiller A. (2001) Teaching vocabulary: Early, direct and sequential. American Educator, Spring, www.aft.org

4. Clarke B, Rogers W, Booth J. (1982) How hearing impaired children learn to read: Theoretical i prac-tical issues. The Volta Review. 84, 57-69

5. Conrad R. (1979) The deaf school child. London: Harper and Row.

6. Lane HS, Baker D. (1974) Reading achievement of the deaf: Another look. Volta Review 76:489–499.

7. Pinter R, Patterson D. (1961) A measurement of the language ability of deaf children. Psychological Review. 23:413–436.

8. Hammermeister FK. (1971) Reading achivement in deaf adults. American Annals of the Deaf: 116, 25-28

9. Dimić ND. (2004) Problemi u jezičkom izrazu kod gluve i nagluve dece. Društvo defektologa Srbije i Crne Gore. Beograd,

10. Bjelica J, Posokhova I. (2001) Dijagnostički kom-plet za ispitivanje sposobnosti govora, jezika, čitanja i pisanja u djece, Beograd: Defektološki fakultet.

11. Dimić N.D. (1997) Specifičnosti u čitanju dece oštećenog sluha. Beograd: Defektološki fakultet.

Corresponding autor Alma Huremovic, Faculty of Education and Rehabilitation, University of Tuzla, Bosnia and Herzegovina, E-mail: [email protected]



Abstract

Introduction: Schizophrenia is complex psyc-hiatric disorder with proposed neurodevelopmen-tal and neurodegenerative process of potential underlying ethiopatology where overall plasma antioxidant capacity can be lower compared to normal control subjects. Serum levels of albumin, creatinine and uric acid are indicators of damaged antioxidative properties. This study investigated correlation between mentioned biochemical para-meters and schizophrenia.

Methods: The survey was performed on fifty inpatients, admitted to Psychiatric Clinic, Clinical Centre University of Sarajevo (KCUS) during one year period. For diagnostic purposes all patients were interviewed using Structural Clinical Intervi-ew (SCID I) for DSM IV and Positive and Nega-tive Syndrome Scale (PANSS) was also applied. Serum levels of albumin, creatinine and uric acid were completed in Institute for Chemistry and Bi-ochemistry, KCUS. SPSS® version 15 for win-dows was used for all statistical analyzes, on 95% statistical significance level.

Results: Study results showed positive relati-onship between low albumin levels and symptoms duration prior to current hospitalization patients with schizophrenia.

Conclusion: Our findings suggest that antioxi-dant injury is potentially implicated in ethipatoge-nesis of schizophrenia episode onset.

Key words: Schizophrenia, antioxidative da-mage, albumin, creatinine, uric acid

Sažetak

Uvod: Shizofrenija je kompleksni psihijatrijski poremećaj sa mogućim neurorazvojnim i neurode-

generativnim procesom u etiopatogenezi, gdje je ukupni antioksidativni potencijal niži u poređenju sa zdravim subjektima. Serumski nivoi albumina, kreatinina i urične kiseline su indikatori oštećenih antioksidativnih svojstava. U ovom istraživanju smo ispitivali povezanost između pomenutih bio-hemijskih parametara i shizofrenije.

Metodologija: Istraživanje je uključilo pedeset pacijenata hospitaliziranih na Psihijatrijskoj klinici Kliničkog centra Univerziteta u Sarajevu (KCUS), tokom perioda od godinu dana. Korišteni su dija-gnostički instrumenti: Structural Clinical Intervi-ew (SCID I) za DSM IV i Positive and Negative Syndrome Scale (PANSS). Nivoi serumskog albu-mina, kreatinina i urične kiseline su određivani na Institutu za hemiju i biohemiju KCUS. Za statistič-ku analizu je korišten SPSS® verzija 15 za win-dows, na 95% nivou signifikantnosti.

Rezultati: Rezultati pokazuju pozitivnu pove-zanost između niskog nivoa albumina i trajanja simptoma prije aktuelne hospitalizacije pacijenata sa shizofrenijom.

Zaključak: Naši nalazi ukazuju da bi antiok-sidativni proces mogao biti impliciran u nastanak shizofrene episode.

Ključne riječi: Shizofrenija, antioxidativni stres, albumin, kreatinin, urična kiselina.

Introduction

Schizophrenia is one of the most severe psyc-hiatric disorder with heterogeneous expression of positive and negative symptoms. There is eviden-ce that increased oxidative stress may play role in pathophysiology of this complex disorder (1,2). It is found that overall plasma antioxidant capa-city in patients suffering from schizophrenia to be lower compared to normal control subjects with

Antioxidative imbalance in patients with SchizophreniaLilijana Oruc1, Amra Memic1, Lejla Burnazovic-Ristic2

1 Psychiatric Clinic Clinical Centre University of Sarajevo, Bosnia and Herzegovina2 Institute of Pharmacology, Clinical Pharmacology and Toxicology, Medical Faculty University of Sarajevo, Bosnia and Herzegovina

684



no respect to number of episodes and to antipsyc-hotic treatment (3). Albumin is binding protein possessing free radical scavenging properties and thus is attractive candidate as selective antioxi-dant. Some data showed significantly lower se-rum albumin levels associated with schizophrenia (4,5). Findings suggest that uric acid can also be implicated in reactive oxidative potential (6). Re-cently, several discoveries pointed out that serum creatinine imbalance are also potential indicator of oxidative injury which deservers to be investiga-ted under prediction that schizophrenia is subtle neurodevelopment disorder of brain with altered neuroplasticity (7). Bearing in mind that there is a lack of literature looking into the function of albu-min, uric acid and creatinine in relationship with positive and negative symptoms of schizophrenia, we intend to investigate this in present study.

Methods

Subjects and design

The study was performed on 50 inpatients of either sex (35 woman and 15 men) ranging in age from 18 to 65 years admitted to Psychiatric Clinic, Clinical Centre University of Sarajevo (KCUS) from November 2008 to May 2009. All patients were interviewed for life time psychopathology using Structural Clinical Interview for DSM IV Axis I disorders (SCIDI; 8) double translated from English to Bosnian and vice versa (9). Only those who met criteria for schizophrenia were enrolled in the study. For evaluation of presence of positi-ve and negative symptoms Positive and Negative Syndrome Scale (PANSS; 10) was also applied to each patient. Subjects were recruited according to exclusion criteria which hold the following: any other present or past comorbid psychiatric disor-der including substance and alcohol abuse, organic brain disorders, pregnancy, presence of impaired hepatic, renal or pancreatic function and cataract. Written informed consent was obtained from all the patients who took part in the study after being given a complete description and protocol of the study previously reviewed and approved by Ethic Committee of KCUS.

Laboratory data

Serum albumin levels were detected using bro-mocresol purple dye-binding method reported by Carter (11) and Louderback (12). The quantitative determination of uric acid in serum was performed by modification of the uricase method (13).

Serum creatine values were measured by kine-tic Jaffe reaction reported by Larsen (14). All abo-ve mentioned analysis were completed in Institute for Chemistry and Biochemistry, KCUS, on fa-sting blood samples drown between 8 and 9 a.m.


Statistical analyzes was performed using SPSS® version 15 for windows. Descriptive va-riables were presented in counted means, SD and SEM values, For comparison of categorical vari-ables Pearson Chi-Square tests (with Yates’ Con-tinuity Correction for all 2 · 2 tables) were used. When expected rates in cells were less than five, Fischer’s exact test was used instead of Pearson Chi Square Test. Two-tailed significance level of P <0.05 were selected for all tests. Spearman’s correlation coefficients were obtained in due to small sample size, and potential violation of nor-mality assumptions.

Results

Sample characteristics

The total sample consisted of 50 schizophrenia enrolled patients, dominantly females (70%; n = 35 female; versus 30%, n = 15 male;) with a mean age of 38.4 years (SD 12,52), and a mean age of disorder onset at 28.0 years (SD 7,7). Overall, so-ciodemographic data suggested that most of study participants were unemployed (58,0%, n = 29), and almost equally married and single (42%; n = 21 married; versus 52%, n = 26 single). Also the study subjects were mainly high school level of education (64%, n = 32).



Clinical characteristics

In terms of clinical characteristics our data reve-aled that majority of patients were categorized with positive symptoms based on PANSS (70%; n=35). The course of illness is presented in Table 1. Table 1. Course of illness

Course of illness N %

First Hospitalization 6 12,0Intermittent 15 30,0Progradient 16 32,0Chronically 13 26,0Total 50 100,0

Analyzes of blood derived parameters resulted with following: serum albumin levels recognized as hypoalbuminemia (serum albumin <35 g/l) was found in 13 out of 50 patients. The mean values of serum albumin were with statistical difference in terms of both schizophrenia types (positive and ne-gative) PANSS verified, but only within those whe-re albumin levels were bellow referral interval ran-ge (Fisher’s Exact Test, p=0, 04, shown in Table 2.).

Interestingly, our results showed existence of positive relationship between low albumin levels and symptoms duration prior to current hospita-lization. This relationship was investigated using Spearman’s rho correlation coefficient in due to small sample size, and it was established as me-dium and positive correlation (R2=0.35, n=50,

p=0,01). Data indicates that hypoalbuminemic in-dividuals were admitted at hospital maximally in period of 30 days, since symptoms onset (Shown in graph 1). Other blood parameters of research interest were creatinine and uric acid, and did not show any significant imbalances out of normal re-ferent ranges as presented in tables 3, 4 and 5. Table 2. Serum albumin levels in different schi-zophrenia symptoms types

Schizophrenia symptoms scale

types

albuminTotal

<35 g/l 35-50 g/l

Negative n=7 n=8 n=15Positive n=6 n=29 n=35Total n=13 n=37 n=50

Fisher’s Exact Test, Exact Sig. (2-sided) 0,040; Computed only for a 2x2 table.

Graph 1. Relationship between albumin levels and duration of shizophrenia symptoms prior to hospitalization

Table 3. Levels of creatinine and uric acid measured at schizophrenia inpatients Blood parameters N Xmin Xmax Mean Std. Error Std. Deviation

Creatinine 45-115 mmol/l 50 45 102 71,54 1,686 11,924Uric acide 155-428umol/l 50 167 453 247,46 9,248 65,397

Table 4. Creatinine levels without difference in PANSS scale verified types of Schizophrenia Blood parameter PANSS N Mean Std. Deviation Std. Error Mean

Creatinine 45-115 mmol/lNegative 15 69,53 11,957 3,087Positive 35 72,40 11,978 2,025

Table 5. Uric acid levels without difference in PANSS scale verified types of SchizophreniaBlood parameter PANSS N Mean Std. Deviation Std. Error Mean

Uric acide 155-428 umol/lNegative 15 246,93 68,599 17,712Positive 35 247,69 65,005 10,988

686



Discussion

This exploratory pilot study investigated poten-tial antioxidant properties of albumin, creatinine and uric acid in schizophrenia diagnosed patients with positive and negative symptoms. It is found that overall plasma antioxidant capacity in patients suffering from schizophrenia to be lower compa-red to normal control subjects with no respect to number of episodes and to antipsychotic treatment (15,16). Rare studies with similar investigative pro-perties suggested predictive engagement for low albumin levels, to be in line with our findings (3,5). However, our results showed positive correlation between low albumin levels (referred as hypoalbu-minemia) and duration of symptoms prior to hos-pitalization. All other factors which can influence albumin levels were controlled for potential con-founding (gender, inflammatory diseases, medica-tion, and smoking). Therefore, these findings can support hypothesis of antioxidant alterations during exacerbation of schizophrenia epizode no matter of positive or negative type as Virit et al (2009) also suggested. Worsening of symptoms and hospitali-zations resulted in due to lack of treatment adhe-rence. Reduced levels of albumin in specific sub-group of patients can indicate that this biochemical parameter has potential role in whole antioxidant capacity (5). Other explored antioxidant indicators (creatinin, uric acid) were not linked to free radical clearance pattern in possible ethiopatogensis of sc-hizophrenia which is not in accordance with resear-ch favoring understanding of uric acid biochemical derangement as major plasma radical-trapping an-tioxidant (7). The limitation of our study was small sample size, although analyze showed 90% power to detect effect size. Further studies are necessary to explore the associations between antioxidative dis-turbances and schizophrenia in larger sample sizes and with healthy matched control group.

Conclusion

As previously appointed this research was explo-ratory in its nature and with obvious limitations presented, still we can draw conclusion about antio-xidative enrolment in ethipatogenesis of schizophre-nia, especially exacerbations of episode onset.

References

1. Zhang M, Zhao Z, He L, Wan C. A meta-analysis of oxidative stress markers in schizophrenia. Sci China Life Sci. 2010;53(1):112-24.

2. Ranjekar PK, Hinge A, Hegde MV, Ghate M, Kale A, Sitasawad S, Wagh UV, Debsikdar VB, Mahadik SP. Decreased antioxidant enzymes and membrane essential polyunsaturated fatty acids in schizophre-nic and bipolar mood disorder patients. Psychiatry Res. 2003 Dec 1;121(2):109-22.

3. Pae CU, Paik IH, Lee C, Lee SJ, Kim JJ, Lee CU. Decreased plasma antioxidants in schizophrenia. Neuropsychobiology. 2004;50(1):54-6.

4. Halliwell B. Albumin – an important extracellular antioxidant? Biochem Pharmacol 1988; 37:569–571.

5. Uma D. P & Murugan. S. Biochemical Deran-gements In Patients With Schizophrenia: A Case-Control Study.Journal of Clinical and Diagnostic Research. 2008;4(2);1001-1008.

6. Yao JK, Reddy R, van Kammen DP. Reduced level of plasma antioxidant uric acid in schizophrenia. Psychiatry Res. 1998;80:29–39.

7. Yao JK, Reddy R, van Kammen DP. Abnormal age-related changes of plasma antioxidant proteins in schizophrenia. Psychiatry Res 2000; 97(2-3):137–151. doi: 10.1016/S0165-1781(00)00230-4.

8. First, MB, Spitzer, RL, Gibbon, M. & Williams, JB, Structured Clinical Interview for the DSM-IV Axis I Disorders. Clinical version. 1997. Washington DC, American Psychiatric Press.

9. Oruc L, Kapetanovic A, Pojskic N, Miley K, For-stbauer S, Mollica RF, Henderson DC. [Screening for PTSD and depression in Bosnia and Hercegovi-na: validating the Harvard Trauma Questionnaire and the Hopkins Symptom Checklist] International Journal of Culture and Mental Health, 2008, Vol 1(2): pp 105-116.

10. Stanley RK et al. The Positive and Negative Syn-drome Scale (PANSS) for Schizophrenia; Schizop-hrenia Bulletin 1987.13:261-276.

11. Carter P. Ultramicroestimation of human serum albumin: binding cationic dye 5,5’ dibromo-o cre-solsulfonphthalein. Microchem J.1970;15:531-539.



12. Louderback A, Measley EH, Taylor NA. A new dye-binder technic using bromocresol purple for Determination of albumin in serum. Clin Chem. 1968;14:793-794.

13. Kalckan HM. Differential spectrophotometry of purine compounds by means of specific enzymes. J Biol Chem. 1947;167-429.

14. Larsen K. Creatinine assay by a reaction-kinetic approach. Clin Chem Acta. 1972; 41:209-217.

15. Yao JK, Reddy RD, van Kammen DP. Oxidative damage and schizophrenia: an overview of the evidence and its therapeutic implications. CNS Drugs. 2001;15:287–310.

16. Reddy R, Keshavan M, Yao JK. Reduced plasma antioxidants in first-episode patients with schizop-hrenia. Schizophr Res 2003; 62(3):205–12.

17. Virit O, Altindag A, Yumru M, Dalkilic A, Savas HA, et al. A Defect in the Antioxidant Defense System in Schizophrenia. Neuropsychobiology. 2009;60:87–93.

Corresponding author Oruc Lilijana, Psychiatric Clinic Clinical Centre University of

Sarajevo, Bosnia and Herzegovina, E-mail: [email protected]

688



Abstract

Introduction: Rodents are a natural reservoir of hantaviruses. Hantaviruses are narrowly rela-ted to their reservoir. Each serotype in the genus of Hantavirus has a specific host among rodents: HTV – Apodemus agrarius, DOBV – Apodemus flavicollis, PUUV – Clethrionomys glareolus.

Hantaan virus is dominant in Asia; it causes se-vere clinical features, with a number of infected individuals per year and relatively high mortality rate. HGBS occurs endemically in the Balkan Pe-ninsula. Risk groups involve the individuals who get in touch with excretes of mice-alike rodents in any way. These are usually the individuals who are in contact with nature. HGBS usually occurs in the groups aged 20 – 40, more frequently in men than in women. Hantaan virus is a causal agent of severe clinical forms of HGBS, which can be divided into five phases. Puumala virus usually causes mild cli-nical forms of the disease. Early and rapid diagno-stic of HGBS, as well as non-traumatic transport of patients to specialized health institutions, is greatly significant for treatment and prevention.

Material and methods: The study involved 107 patients with clinical suspicion of hemorrha-gic fever with kidney syndrome. Blood samples were collected by venepunction and the separated serum samples were put on -20oC until the test. ELISA test and IFT test were used for serologi-cal confirmation of HGBS. ELISA IgM “capture” test was used for detection of specific HGBS IgM antibodies to the Hantaan and Puumala antigens, while ELISA IgG test and IFT test were used for detection of specific IgG antibodies to the Hanta-an, Puumala and Dobrava antigens.

Results: The percentage of seropositive men was higher (80.9%). Acute hantavirus infection

was confirmed in 40.2% of the tested patients, by detection of specific HGBS IgM antibodies using ELISA test. Specific IgG antibodies to the Hanta-an, Puumala and Dobrava antigens were detected in higher percentage using IFT test (42.1%), com-pared to ELISA test (8.4%).

Conclusions: High susceptibility and specifi-city of ELISA IgM test was confirmed; combined with ELISA and IFT IgG test, it is a strong method in diagnostic of HGBS. Serological diagnostic of HGBS is necessary because of the varying range of clinical manifestations.

Key words: Hantavirus infection, ELISA, IFT, IgM and IgG antibodies.

1. Introduction

In summer 1976, Korean scientist Ho Wang Lee et al. discovered an etiological agent in the lungs of the field mouse Apodemus agrarius in Seoul (Ko-rea); the virus was then isolated from the city rats and human materials (1, 2). Animals that the virus was isolated from had been caught in the Valley of Hantaan River, which runs along the 38th parallel and separates North and South Korea, so the iso-lated virus was named after the Hantaan River (1).

Rodents are a natural reservoir of hantaviruses. Hantaviruses are narrowly related to their reser-voir. Human isolates are narrowly related, in se-rological and genetic terms, to the isolates from rodents, which represent a reservoir of certain hantaviruses (3, 4, 5). Puumala virus was initially isolated from a bank vole (Clethrionomys glare-olus) (6, 7). Dobrava virus was initially isolated in Slovenia, from Apodemus flavicollis, yellow-necked mouse (8, 9). Each serotype in the genus of Hantavirus has a specific host among rodents:

Indirect Immunofluorescence Test (IFT) and Enzyme Immunoassay (ELISA) in diagnostic of Hantavirus infectionsSadeta Hamzic, Edina Beslagic, Sukrija Zvizdic

Medical Faculty of the University of Sarajevo, Bosnia and Herzegovina



HTV – Apodemus agrarius, DOBV – Apodemus flavicollis, PUUV – Clethrionomys glareolus. Se-ro-epidemiological studies among humans and ro-dents and the data on HGBS diseases suggest that this disease is spread worldwide (10, 11).

Hantaan virus is dominant in Asia; it causes se-vere clinical features, with a number of infected in-dividuals per year and relatively high mortality rate. In Europe, most of the infected individuals manifest mild clinical features, but there are data on mode-rately severe and severe forms of the disease. Only two hantaviruses, Puumala virus and Dobrava vi-rus, have been proven to cause human infection in Europe. Both viruses cause HGBS (12, 13). HGBS occurs endemically in the Balkan Peninsula. HGBS is moderately spread in the Balkans, with approxi-mately 100 cases registered in most of the years and the mortality rate of 15%. However, the large po-pulation of rodents – carriers, which significantly changes, affects the data. Significant increase in the number of small mammals, which happened in this region in the year of 1986 and 1989, is clearly rela-ted to infections with this disease (14, 15, 16).

Risk groups involve the individuals who get in touch with excretes of mice-alike rodents in any way. These are usually the individuals who are in contact with nature. HGBS usually occurs in the groups aged 20 – 40, more frequently in men than in women. Although the cases of HGBS have been registered among children, their frequency is not significant. The most frequently infected professi-onal groups include soldiers, agrarians, farmers, foresters, hikers, weekend tourists and housewi-ves (17). Infection cases have been also described among laboratory workers handling the infected rodents (18).

Hantaan virus is a causal agent of severe clini-cal forms of HGBS, which can be divided into five phases (19, 20). Severity varies from subclinical to mild and severe forms; therefore, the diagnosis must be confirmed by serological test. General ma-nifestation includes three symptoms: fever, hemorr-hagic manifestations and renal defects. The disease usually begins with sudden fever, along with other nonspecific constitutional symptoms, the symp-toms of eyes and gastrointestinal tract (21). Puuma-la virus usually causes mild clinical forms of the disease. Nephropathia epidemica (NE) is more of a renal disease than a hemorrhagic fever.

There is no special treatment for HGBS and, therefore, the treatment must be supported and based on the understanding of pathophysiological features of the disease, as well as the evolution of clinical and laboratory findings. The main tre-atment of HGBS is still symptomatic. Early and rapid diagnostic of HGBS, as well as non-trauma-tic transport of patients to specialized health in-stitutions, is greatly significant for treatment and prevention.

2. Materials and methods

The study involved 107 patients with clinical suspicion of hemorrhagic fever with kidney syn-drome, who were tested at the Microbiological Laboratory, Department for Microbiology, Medi-cal Faculty of the University of Sarajevo; results of the analyses were confirmed at the WHO Co-llaborating Centre for Arbovirus and Hemorrha-gic Fevers Reference and Research, Institute of Microbiology, University of Ljubljana, which also provided all necessary reagents for serological di-agnostic of HGBS.

Blood samples were collected by venepunction and the separated serum samples were put on -20oC until the test. ELISA test and IFT test were used for serological confirmation of HGBS. ELISA IgM “capture” test was used for detection of specific HGBS IgM antibodies to the Hantaan and Puumala antigens, while ELISA IgG test and IFT test were used for detection of specific IgG antibodies to the Hantaan, Puumala and Dobrava antigens.

ELISA IgM („capture“) test is performed in the following way: goat anti-human IgM antibodies (Bio Source) are applied onto the polystyrene mi-crotiter plate NUNC - Maxy Sorp a day earlier and the plate is put on +4oC overnight. Sera are diluted to the initial ratio 1:100 in the serum diluent, whi-ch is made of the phosphate buffer solution – PBS, with addition of 0.1% Tween-20 and 5% dry milk. The prepared sera of the individuals, as well as the sera used as a positive and negative control, are put in the volume of 100 microlitres per notch and incubated for 1 hour at 37oC. After the incubation, the plates are washed with the Wash Solution three ties. Hantaan and Puumala antigens are then appli-ed in dilution of 1:2, with additional of normal hu-

690



man serum (NHS). Incubation and washing are the next steps. Rabbit antibodies for Hantaan and Puumal are then added in dilution of 1:1000. After the incubation and washing, peroxidase-substrate is added and the plate is appropriately incubated again. Results are read on spectrophotometer at 405/492 nm.

ELISA IgG test is performed in the following way: antigens HTN 76-118, CG 18-20 and DOB 907/5, and VERO E-6 are applied, in the same dilution, onto the polystyrene microtiter plate NUNC - Poly Sorp a day earlier and the plate is put on +4oC overnight. Before applying the sera, the plates are washed with the Wash Solution three times. The sera are diluted to the initial ratio, and then titered and put into the notches for incuba-tion. After washing, the conjugate (Accurate) is added in dilution of 1:20000 and incubated, and then washed. Peroxidase-substrate is then added and the plate is incubated. Results are then read on spectrophotometer at 405/492 nm.

Results of the test are considered positive if the OD values in adequate titer (more than 1:100) exceed the calculated Cutoff value (average + 3 standard deviations in relation to normal control).

Indirect Immunofluorescence Test is perfor-med in the following way: slides with the Hanta-an, Puumala and Dobrava antigens are taken from the refrigerator and left at the room temperature to defrost and dry. Sera are diluted from 1:16 and fur-ther. The diluted sera are then put onto each field, i.e. the existing antigen, in the volume of 7 micro-litres. The plates are incubated, washed and dried. Conjugate (anti-human IgG with EVANS BLUE) is then applied, also in the volume of 7 microlitres, and the plates are incubated, washed and dried. At the end, 4 drops of glycerol are added onto each plate and microscopy is performed using fluores-cent microscope.

3. Results

Table 1 and the Chart 1 present the gender structure of the tested and HGBS-seropositive pa-tients. The percentage of seropositive men is hi-gher (80.9%).

Detection of specific HGBS IgG antibodi-es using the Indirect Immunofluorescence Test

was performed for the Hantaan (HTN), Puumala (PUU) and Dobrava (DOB) antigens. Table 2 and the Chart 2 present the results of detection of spe-cific Hantaan IgG antibodies. It is evident that the-se antibodies were found in serum of 35.5% of the tested patients. The most frequent titer of Hantaan IgG antibodies was 1:512, in 34.2% of seropositi-ve patients.Table 1. Gender structure of the tested and HGBS-seropositive patients

Gender TestedSeropositive

Number %

Male 84 38 80.9Female 23 9 19.1Total: 107 47 100.0

Chart 1. Gender structure of HGBS-seropositive patients

Table 2. Review of the results of detection of spe-cific Hantaan IgG antibodies (IFT)

Tested sera Number %Positive – HTN IgG

antibodies ≥ 1:16 38 35.5

Negative – HTN IgGantibodies < 1:16 69 64.5

Total: 107 100.0

Results of detection of specific Puumala IgG antibodies using the Indirect Immunofluorescence Test are presented in the Table 3 and Chart 3. The antibodies were found in serum of 37.4% of the tested patients. The most frequent titer of Puumala IgG antibodies was 1:64, in 27.5% of seropositive patients.



Chart 2. Results of detection of specific Hantaan IgG antibodies (IFT)

Table 3. Review of the results of detection of spe-cific Puumala IgG antibodies (IFT)

Tested sera Number %Positive – Puu IgGantibodies ≥ 1:16 40 37.4

Negative – Puu IgGantibodies < 1:16 67 62.6

Total: 107 100.0

Chart 3. Results of detection of specific Puumala IgG antibodies (IFT)

Results of detection of specific Dobrava IgG an-tibodies using the Indirect Immunofluorescence Test are presented in the Table 4 and Chart 4. The antibo-dies were found in serum of 35.5% of the tested pa-tients. The most frequent titer of Dobrava IgG anti-bodies was 1:512, in 29.0% of seropositive patients.

Detection of HGBS specific IgG antibodies in the tested patients was also performed using ELISA test. Table 5 presents detection of speci-fic HGBS IgG antibodies using the ELISA test. HGBS specific IgG antibodies were found in se-rum of a total of 9 tested patients.

Table 4. Review of the results of detection of spe-cific Dobrava IgG antibodies (IFT)

Tested sera Number %Positive – Dob IgGantibodies ≥ 1:16 38 35.5

Negative – Dob IgGantibodies < 1:16 69 64.5

Total: 107 100.0

Chart 4. Results of detection of specific Dobrava IgG antibodies (IFT)

Table 5. Review of the results of testing the sera to HGBS specific IgG antibodies (ELISA)

Tested sera Number %

Hantaan IgG positive 1 11.1Puumala IgG positive 7 77.8Dobrava IgG positive 1 11.1Total: 9 100.0

The results obtained suggest that specific HGBS IgG antibodies were detected in 42.1% using the IFT test and in 8.4% using the ELISA test (Table 6 and Chart 5).

Table 6. Review of the results of detection of HGBS specific IgG antibodies (IFT and ELISA)

Type of serological

test

IgG seropositive The number of tested patientsNumber %

IFT 45 42.1 107ELISA 9 8.4 107

Detection of specific Hantaan and Puumala IgM antibodies was performed using the serologi-cal test ELISA “Capture” IgM to the Hantaan and Puumala antigens. Table 7 suggests that specific

692



Hantaan IgM antibodies were found in serum of 33.7% of the tested patients. Titer values in ELI-SA test for detection of Hantaan IgM antibodies were the most frequent at 1:1600, in 69.4% of se-ropositive patients.

Chart 5. Results of detection of HGBS specific IgG antibodies (IFT and ELISA)

Table 7. Review of the results of detection of spe-cific Hantaan IgM antibodies (ELISA)


Positive HTN IgM antibodies 36 33.7Negative HTN IgM antibodies 71 66.3Total: 107 100.0

Table 8 suggests that specific Puumala IgM anti-bodies were found in serum of 25.2% of the tested patients. Titer values in ELISA test for detection of Puumala IgM antibodies were the most frequent at 1:600, in 48.1% of seropositive patients.Table 8. Review of the results of detection of spe-cific Puumala IgM antibodies (ELISA)


Positive Puu IgM antibodies 27 25.2Negative Puu IgM antibodies 80 74.8Total: 107 100.0

4. Discussion

Our work presents the results of the study that involved a total of 107 patients with clinical sus-picion of HGBS. Using the ELISA test, specific HGBS IgM antibodies were found in serum of 40.2% of the tested patients, as a sign of acute infection. Specific Hantaan IgM antibodies were found in serum of 33.7% of the tested patients. Ti-

ter values in ELISA test for detection of Hantaan IgM antibodies were the most frequent at 1:1600, in 69.4% of seropositive patients. Specific Puuma-la IgM antibodies were found in serum of 25.2% of the tested patients and the most frequent titer values in ELISA test were 1:1600, in 48.1% of se-ropositive patients.

Specific HGBS IgG antibodies were detected, using the ELISA test, in 8.4% and, using the IFT test, in 42.1% of cases. Specific HGBS IgG anti-bodies were detected by the IFT test to the Han-taan, Puumala and Dobrava antigens. The results obtained suggest that specific HTN IgG antibodies were found, using this method, in 35.5% of the te-sted patients, in the most frequent titer at 1:512, in 34.2% of seropositive patients. Specific Puu IgG antibodies were found, using the IFT test, in 37.4% of the tested patients, in the most frequent titer at 1:64, in 27.5% of seropositive patients. Specific Dobrava IgG antibodies were found, using this method, in 35.5% of the tested patients, in the most frequent titer at 1:512, in 29.0% of seropo-sitive patients. Using ELISA test, specific HGBS IgG antibodies were found in serum of 8.4% of the tested patients.

The researches have suggested that HGBS in Bosnia and Herzegovina is caused by the Puuma-la and Dobrava viruses. Given the cross-reactivity between several hantaviruses related to HGBS, it is still unclear which viruses are related to the va-rious forms of HGBS in the Balkans and which rodents – carriers serve as their primary reservoirs. Such data are necessary in order to estimate the importance of these viruses and related diseases in public health. ELISA IgM and IgG are useful methods in determination if a patient is infected by hantavirus infection, suggesting a serotype that infects (22). Through the presence of speci-fic hantavirus antibodies in the sera of the tested individuals, we confirmed the presence of human hantavirus infections in Bosnia and Herzegovina (23). Nonspecific measures are undertaken in pre-vention of HGBS: control, determination and esti-mation of the number of mouse-alike rodents at predetermined natural focal points, sanitary remo-val of waste substances and deratization, intensifi-ed health control over professional groups at risk and raising health awareness (24).



5. Conclusions

1. The percentage of HGBS-seropositive men is higher, 80.9%, compared to women, 19.1%.

2. Acute hantavirus infection was confirmed in 40.2% of the tested patients by detection of specific HGBS IgM antibodies using ELISA test.

3. Specific Hantaan IgM antibodies were found in serum of 33.7% of the tested patients.

4. Titer values in ELISA test for detection of Hantaan IgM antibodies were the most frequent at 1:1600, in 69.4% of seropositive patients.

5. Specific Puumala IgM antibodies were found in serum of 25.2% of the tested patients.

6. Titer values in ELISA test for detection of Puumala IgM antibodies were the most frequent at 1:600, in 48.1% of seropositive patients.

7. Specific IgG antibodies to the Hantaan, Puumala and Dobrava antigens were detected in higher percentage using the IFT test (42.1%), compared to ELISA test (8.4%).

8. High susceptibility and specificity of ELISA IgM test was confirmed; combined with the IgG test, it is a strong method in diagnostic of HGBS.

9. Serological diagnostic of HGBS is necessary because of the varying range of clinical manifestations.

6. References

1. Lee HW, Lee PW and Johnson KM. Isolation of the Etiologio Agent of Korean Hemorrha-gic Fever. The Journal of Infecctious Disea-ses,1978;137(3):298-308.

2. Lee HW, Baek Lj and Johnson KM. Isolation of Hantaan virus the Etiologio agent of Korean He-morrhagic Fever from Wild Urban Rats. The Jour-nal of Infectious Diseases,1982;146(5):638-644.

3. Yanagihara R. And Gajdušek DC. Hemorrhagic fe-ver with renal syndrome: Global epidemiology and ecology of hantavirus infection. B.V. ( Biomedical Division). In: Medical Virology V.L.M. De La Maza and E.M. Peters, editors,1987.

4. Arikawa J, Takashima I, Hashimoto N, Yagi k, and Hattori K. Epidemiological Studies of Hemorrha-gic Fever with Renal Syndrome (HFRS). Rolated virus infection among urban rats in Hokkaido, Ja-pan, Archives of Virology,1986;88:231-240.

5. Lee PW, Yanagihara R, Gibbs CJ and Gajdušek DC. Pathogenesis of experimental Hantaan Virus Infection in Laboratory rats. Archives of Virolo-gy,1986;88:57-66.

6. Brummer-Korvenkontio M, A. Vaheri, C-H von Bonsdorff, J Vuorimies, T Manni, K Penttinen, N. Oker-Blom, and J. Lhdevirta,1980. Nephropathia epidemica: detection of antigen in bank voles and serologic diagnosis of human infection. J Infect Dis 141:131-134.

7. Niklasson B, and JW LeDuc. Isolation of the nephropathia epidemica agent in Sweden. Lan-cet:1012-1013.

8. Avšič-Županc T, Xiao SY, Stojanović R, Gligić A, Van der Groen G, LeDuc JW. Characterization of Do-brava virus a hantavirus from Slovenia,Yugoslavia. J Med Virol 1992;38:132-137.

9. Avšič-Županc T, Toney A, Anderson K, Chu Y-K, Schmaljohn C. Genetic and antigenic properties of vDobrava virus: a unique member of the Han-tavirus genus, family Bunyaviridae. J Gen Virol 1995;76:2801-2808.

10. LeDuc JW, Smith GA, Childs JE et al. Global survey of antibody to hantaan-related viruses among peridomestic rodents. Bull World Health Organ.1986;64:139-144.

694



11. Lee HW, Lee PW, Baek LJ, Chu YK. Geographical distribution of hemorrhagic fever with renal syn-drome and hantaviruses. Arch Virol 1990;(suppl 1):5-18.

12. Kanerva M, Mustonen J, Vaheri A. Pathogenesis of Puumala and other hantavirus infections. Rev Med Virol 1998;81:67-86.

13. Vapalahti O, Plyusnin A, Lundkvist A, Hentto-nen H, Vaheri A. Hantaviruses in Europe. Lancet 1999,in press.

14. Gligić A, Stojanović R, Obradović M, Hlača D, Dimković MN, Diglisić G et al. Hemorrhagic fever with renal syndrome in Yugoslavia: Epidemiologic and epizootiologic features of a nationwide outbre-ak in 1989. Eur J Epidemiol 1992;8:816-825.

15. Avšič-Županc T, Čizman G, Gligić A, Van der Groen G. Evidence for hantavirus disease in Slovenia,Yugoslavia, Acta Virol 1989;33:327-37.

16. Ler Ž, Gligić A, Čelik Š, Obradović M. Epidemi-ološke karakteristike hemoragične groznice sa bubrežnim sindromom u jednom žarištu kod Foče. Vojnosanit Pregl 1990;47:326-8.

17. Xu ZY, GuO CS, Wu YL, Zhang XW, Lin K. Epi-demiological studies of hemorrhagic fever with renal syndrome. Analysis of risk factors and mode of transmission. J Infect Dis 1985;152:137-144.

18. Lee HW, Johnson KM. Laboratory-aquired infections with Hantaan virus, the etiologic agent of Korean hemorrhagic fever. J Infect Dis 1982;146:645-651.

19. Chun CH, Laehdevirta J, Lee HW. Clinical mani-festations of HFRS. U: Lee HW, Dalrymple JM, ed. Manual of hemorrhagic fever with renal syn-drome. Seoul: WHO Collaborating Center for Vi-rus Reference and Research ( Hemorrhagic fever with renal syndrome) Institute for Viral Diseases, Korea University,1989:19-38.

20. Ruo SL, Li YL, Tong Z et al. Retrospective and prospective studies of hemorrhagic fever with renal syndrome in rural China. J Infect Dis 1994;170:527-534.

21. Lee SY, Lhdevirta J, Koster F. Clinical manife-stations of HFRS. U: Lee HW, Calisher CH, Sch-maljohn C,ed. Manual of hemorrhagic fever with renal syndrome and hantavirus pulmonary syn-drome Seoul: WHO Collaborating Center for Vi-rus Reference and Research ( Hantaviruses) Asan Institute for Life Sciences, Seoul 1998;17-33.

Corresponding author Sadeta Hamzic, Medical Faculty of the University of Sarajevo, Bosnia and Herzegovina, E-mail: [email protected]



Every sent magazine gets its number, and author(s) will be notified if their paper is accepted and what is the number of paper. Every corresponedence will use that number. The paper has to be typed on a standard size pa-per (format A4), leaving left margins to be at least 3 cm. Ali materials, including tables and references, have to be typed double-spaced, so one page has no more than 2000 alphanumerical characters (30 lines). Sent paper needs to be in the form of triplicate, considering that original one enclosure of the material can be photocopied. Presenting paper depends on its content, but usually it consists of a page title, summary, text references, legends for pictures and pictures. Type your paper in MS Word and send if on a diskette or a CD-ROM.

TITLE PAGEEvery article has to have a title page with a title of no

more than 10 words: name (s), last and first of the author (s), name of the instituion the authors (s) belongs to, abstract with maximum of 45 letters (including space), footnote with acknowledgments, name of the first aut-hor or another person with whom correspondence will be maintained.

SUMMARySecond page needs to contain paper summary, 200

words at the most. Summary needs to hold all essential facts of the work-purpose of work, used methods (with specific data, if possible) and basic facts. Summaries must have review of underlined data, ideas and con-clusions from text. Summary has no quoted references. For key words, at the most, need to be placed below the text.

CENTRAL PART OF THE ARTICLEAuthentic papers contain these parts: intro-duction,

goal, methods, results, discussion and conclusion. Intro-duction is brief and clear review of a problem. Methods are shown so that interested reader is able to repeat des-cribed research. Known methods don’ t need to be iden-tified, it is cited (referenced). Results need to be shown clearly and legically, and their significance proven by statistical analysis. In discussion, results are interpreted and compared to existing, previously published findings in the same field. Conclusions have to give an answer to author’s goal.

Instructions for the authorsAll papers need to be sent to e-mail: [email protected]

REFERENCESQuoting references must be in a scale in which they

are really used. Quoting most recent literature is recom-mended. Only published articels (or articles accepted for publishing) can be used as references. Not-published observations and personal notifications need to be in text in brackets. Showing references is as how they appear in text. References cited in tables or pictures are also numbered according to quoting order. Citing paper with six or less authors must have cited names of all authors; if seven or more authors’ wrote the paper, the name of the first three authors are cited with a note “et all”. If the author is unknown, at the beginning of papers reference, the article is named as “unknown”. Titles of the publications are abbreviated in accordance to Index Medicus, but if not listed in the index, whole title of the journal has to be written.

Footnote-comments, explanations, etc., cannot be used in the paper.

STATISTICIAL ANALySISTests used for statistical analysis need to be shown in

text and in tables or pictures containing statistical ana-lysis.

TABLES AND PICTURESTables have to be numbered and shown by their or-

der, so they can be understood without having to read the paper. Every column needs to have title, every me-asuring unit (SI) has to be clearly marked, preferably in footnotes below the table, in Arabian numbers or sym-bols. Pictures also have to be numbered as they appear in text. Drawings need to be enclosed on a white paper or tracing paper, while black and white photo have to be printed on a radiant paper. Legends next to pictures and photos have to be written on a separate A4 format paper. All illustrations (pictures, drawings, diagrams) have to be original and on their backs contain illustration num-ber, first author last name, abbreviated title of the pa-per and picture top. It is appreciated if author marks the place for table or picture. Preferable the pictures format is TIF, quality 300 DPI.

USE OF ABBREAVIATIONSUse of abbreviations has to be reduced to minimum.

Conventional units can be used without their defini-tions.

696



Uputstvo za autoreSve rukopise treba slati na e-mail adresu [email protected]

Svaki upućeni časopis dobija svoj broj i autor(i) se obavještavaju o prijemu rada i njegovom broju. Taj broj koristit će se u svakoj korespondenciji. Rukopis tre-ba otipkati na standardnoj veličini papira (format A4), ostavljajući s lijeve strane marginu od najmanje 3 cm. Sav materijal, uključujući tabele i reference, mora biti otipkan dvostrukim proredom, tako da na jednoj strani nema više od 2.000 alfanumeričkih karaktera (30 linija). Rad treba slati u triplikatu, s tim da original jedan pri-log materijala može biti i fotokopija. Način prezentacije rada ovisi o prirodi materijala, a (uobičajeno) treba da se sastoji od naslovne stranice, sažetka, teksta, referenci, tabela, legendi za slike i slika. Svoj rad otipkajte u MS Wordu i dostavite na disketi ili kompakt disku Redakcij-skom odboru, čime će te olakšati redakciju vašeg rada.

NASLOVNA STRANASvaki rukopis mora imati naslovnu stranicu s naslo-

vom rada ne više od 10 riječi: imena autora; naziv usta-nove ili ustanova kojima autori pripadaju; skraćeni na-slov rada s najviše 45 slovnih mjesta i praznina; fusnotu u kojoj se izražavaju zahvale i/ili finansijska potpora i pomoć u realizaciji rada, te ime i adresa prvog autora ili osobe koja će s Redakcijskim odborom održavati i kore-spondenciju.

SAžETAKSažetak treba da sadrži sve bitne činjenice rada-svr-

hu rada, korištene metode, bitne rezultate (sa specifičnim podacima, ako je to moguće) i osnovne zaključke. Sa-žeci trebaju da imaju prikaz istaknutih podataka, ideja i zaključaka iz teksta. U sažetku se ne citiraju reference. Ispod teksta treba dodati najviše četiri ključne riječi.

SAžETAK NA BOSANSKOM JEZIKUPrilog radu je i prošireni struktuirani sažetak (cilj),

metode, rezultati, rasprava, zaključak) na bosanskom je-ziku od 500 do 600 riječi, uz naslov rada, inicijale imena i prezimena auora te naziv ustanova na engleskom jezi-ku. Ispod sažetka navode se ključne riječi koje su bitne za brzu identifikaciju i klasifikaciju sadržaja rada.

CENTRALNI DIO RUKOPISAIzvorni radovi sadrže ove dijelove: uvod, cilj rada,

metode rada, rezultati, rasprava i zaključci. Uvod je kra-tak i jasan prikaz problema, cilj sadrži kratak opis svrhe istraživanja. Metode se prikazuju tako da čitaoci omo-guće ponavljanje opisanog istraživanja. Poznate metode se ne navode nego se navode izvorni literaturni podaci.

Rezultate treba prikazati jasno i logički, a njihovu značaj-nost dokazati odgovarajućim statističkim metodama. U raspravi se tumače dobiveni rezultati i uspoređuju s po-stojećim spoznajama na tom području. Zaključci moraju odgovoriti postavljenom cilju rada.

REFERENCEReference treba navoditi u onom obimu koliko su

stvarno korištene. Preporučuje se navođenje novije li-terature. Samo publicirani radovi (ili radovi koji su pri-hvaćeni za objavljivanje) mogu se smatrati referencama. Neobjavljena zapažanja i lična saopćenja treba navoditi u tekstu u zagradama. Reference se označavaju onim redom kako s pojavljuju u tekstu. One koje se citiraju u tabelama ili uz slike također se numeriraju u skladu s redoslijedom citiranja. Ako se navodi rad sa šest ili ma-nje autora, sva imena autora treba citirati; ako je u citi-rani članak uključeno sedam ili više autora, navode se samo prva tri imena autora s dodatkom “et al”. Kada je autor nepoznat, treba na početku citiranog članka ozna-čiti “Anon”. Naslovi časopisa skraćuju se prema Index Medicusu, a ako se u njemu ne navode, naslov časopisa treba pisati u cjelini. Fusnote–komentare, objašnjenja, itd. Ne treba koristiti u radu.

STATISTIčKA ANALIZATestove koji se koriste u statističkim anaizama treba

prikazivati i u tekstu i na tabelama ili slikama koje sadrže statistička poređenja.

TABELE I SLIkETabele treba numerirati prema redoslijedu i tako ih

prikazati da se mogu razumjeti i bez čitanja teksta. Svaki stubac mora imati svoje zaglavlje, a mjerne jedinice (SI) moraju biti jasno označene, najbolje u fusnotama ispod tabela, arapskim brojevima ili simbolima. Slike također, treba numerisati po redoslijedu kojim se javljaju u tekstu. Crteže treba priložiti na bijelom papiru ili paus papiru, a crno-bijele fotografije na sjajnom papiru. Legende uz cr-teže i slike treba napisati na posebnom papiru formata A4. Sve ilustracije (slike, crteži, dijagrami) moraju biti origi-nalne i na poleđini sadržavati broj ilustracije, prezime pr-vog autora, skraćeni naslov rada i vrh slike. Poželjno je da u tekstu autor označi mjesto za tabelu ili sliku. Slike je potrebno dostavljati u TIFF formatu rezolucije 300 DPI.

KORIšTENJE KRATICAUpotrebu kratica treba svesti na minimum. Konven-

cionalne SI jedinice mogu se koristiti i bez njihovih de-finicija.

Web page: http://www.iomcworld.com/ijcrimph

Web page: http://www.ttem-bih.org

DRUNPP Publishers

Web page: http://www.healthmedjournal.com

Web page: http://www.iomcworld.com/rgmhr/

DRUNPP Publishers

health med neutropenia; 2011

Documents