functional human monoclonal antibodies of all isotypes constructed from phage display...

Journal of Immunological Methods 239 (2000) 153–166www.elsevier.nl / locate / jim

Recombinant Technology

Functional human monoclonal antibodies of all isotypesconstructed from phage display library-derived single-chain Fv

antibody fragmentsa , b a b*Edwin Boel , Sjors Verlaan , Miriam J.J.G. Poppelier , Nomdo A.C. Westerdaal ,

a bJos A.G. Van Strijp , Ton LogtenbergaEijkman-Winkler Institute for Microbiology, Infectious Diseases and Inflammation, Utrecht University Hospital, Rm G04.614,

P.O. Box 85500, NL-3508 GA Utrecht, The NetherlandsbDepartment of Immunology, Utrecht University Hospital, Utrecht, The Netherlands

Received 27 August 1999; received in revised form 16 February 2000; accepted 16 February 2000

Abstract

We have constructed a series of eukaryotic expression vectors that permit the rapid conversion of single chain (sc) Fvantibody fragments, derived from semi-synthetic phage display libraries, into intact fully human monoclonal antibodies(mAb) of each isotype. As a model, a scFv fragment specific for sheep red blood cells (SRBC) was isolated from asemi-synthetic phage antibody (Ab) display library, and used to produce human mAbs of IgM, IgG1–IgG4, IgA1, IgA2m(1)and IgE isotype in vitro in stably transfected cells. N-terminal protein sequence analysis of purified immunoglobulin heavy(H) and light (L) chains revealed precise proteolytic removal of the leader peptide. Biochemical analysis of purifiedrecombinant human mAbs demonstrated that properly glycosylated molecules of the correct molecular size were produced.The IgG and IgA mAbs retained SRBC-binding activity, interacted with different Fc receptor-transfectants, and inducedcomplement-mediated hemolysis and Ab-dependent phagocytosis of SRBC by neutrophils in a pattern consistent with theimmunoglobulin (Ig) H chain isotype. We conclude that in vitro produced recombinant human mAbs constructed from phagedisplay library-derived scFv fragments mirror their natural counterparts and may represent a source of mAbs for use inhuman therapy. 2000 Elsevier Science B.V. All rights reserved.

Keywords: Isotype switching; Phagocytosis; Complement-mediated lysis; Cloning vectors; Transient and stable expression

Abbreviations: Ab, antibody; BHK, baby hamster kidney cells; 1. IntroductionC, constant; complement; ELISA, enzyme-linked immunosorbentassay; FITC, fluorescein isothiocyanate; HRP, horseradish per-

Since the advent of hybridoma technology, theoxidase; H, immunoglobulin heavy chain; Ig, immunoglobulin; L,immunoglobulin light chain; mAb, monoclonal antibody; NHS, potential of murine mAbs for therapeutic applicationnormal human serum; scFv, single-chain Fv fragment; SRBC, in humans has been a focus of interest.sheep red blood cell; V, variable; V , immunoglobulin heavy chainH Clinical testing has shown that murine antibodiesvariable region; V , immunoglobulin light chain variable regionL may evoke an anti-mouse immune response, the*Corresponding author. Tel.: 131-30-2507-625; fax: 131-

occurrence and magnitude of which is likely affected302541-770.E-mail address: [email protected] (E. Boel) by the disease-related immune status of the recipient

0022-1759/00/$ – see front matter 2000 Elsevier Science B.V. All rights reserved.PI I : S0022-1759( 00 )00170-8

154 E. Boel et al. / Journal of Immunological Methods 239 (2000) 153 –166

and by the mode and duration of antibody adminis- vectors for the rapid conversion of phage displaytration (Jaffers et al., 1986). Although mouse anti- library-derived scFv Ab fragments to intact humanbodies of various isotypes, compared to their human IgG1, IgG2, IgG3, IgG4, IgA1, IgA2m(1), IgM, andequivalents, less efficiently bind human complement IgE Abs. The procedure involves two cloning stepsand Fc receptors expressed by human effector cells, and constructs can be transiently or stably expressedsome mouse antibodies have been shown to be in eukaryotic cells. The combined experiments indi-cytotoxic in humans (Bonnefoy-Berard and Revil- cate that the in vitro produced Abs are correctlylard, 1996). Yet, it may be anticipated that antibodies assembled and glycosylated. Intact human mAbswith human Fc regions are more effective cytotoxic constructed from a phage display library-derivedreagents in human immunotherapy. scFv specific for SRBC were shown to perform

Attempts to generate mAbs of human origin using effector functions that correlated with their C regiona variety of methods including somatic hybridization isotype.or immortalization of cells with Epstein–Barr virushave met with considerable technological and ethicalproblems and have not resulted in the establishment

2. Materials and methodsof reliable and robust methods. Humanization ofmurine mAbs by replacing Ig constant (C) orvariable (V) region sequences, resulting in 2.1. Construction of expression vectors‘chimeric’ and ‘humanized’ Abs (Morrison et al.,1984; Jones et al., 1986), has led to a reduction of pBR322 plasmids containing the human k L chainthe immunogenicity of the molecules. Further reduc- (Hieter et al., 1982) or H chain IgG1-4 C regionstion of immunogenicity can be expected from com- (Cg1-4) (Kirsch et al., 1982) were used as apletely human mAbs, which have recently been template to append BamHI, NotI and SmaI restric-derived from transgenic mice and from phage display tion sites to the C regions by PCR amplificationlibraries. (Table 1A,B). The amplified products were cloned

Immunization of transgenic mice harboring human into the pNUT expression vector (Palmiter et al.,Ig H and L chain mini-loci and subsequent im- 1987) using BamHI and SmaI restriction enzymes,mortalization of spleen cells by somatic hybridiza- resulting in the plasmids pNUT-Ck and pNUT-Cg1–tion yields high-affinity human mAbs of predefined 4. Because the Cg1–3 C regions contain an internalspecificities (Taylor et al., 1992; Mendez et al., SmaI restriction site, the amplified products were1997). An alternative approach has been the con- first digested with BamHI and subsequently partiallystruction of libraries of human Ab fragments ex- digested with SmaI, subjected to agarose gel electro-pressed on the surface of filamentous phages and the phoresis and the full-length products were isolatedselection of desired Ab-specificities by in vitro and cloned into the pNUT vector.panning (Burton and Barbas, 1994; Winter et al., The C regions of human IgM (Cm) and IgA1 and1994). The Ab fragments obtained from these li- IgA2m(1) (Ca1 and Ca2) (Ravetch et al., 1980)braries are small scFv or Fab fragments and differ were PCR amplified from genomic clones in plasmidfrom intact natural Abs in terms of valency, phar- pBR322 using Cm- and Ca-specific primers, respec-macokinetic behavior, and ability to recruit Fc tively (Table 1A,B), digested with BamHI andregion-dependent effector functions. EcoRV and cloned into the BamHI- and SmaI-di-

We have previously described the construction of gested pNUT vector.a semi-synthetic phage Ab display library of scFv A BamHI restriction fragment containing thefragments and shown that a variety of phage selec- human IgE C region gene (Ce) was obtained from ation procedures on purified antigens, tissue frag- l charon 38A phage clone (Max et al., 1982) andments, microorganisms, and eukaryotic cells permit subcloned into the pBluescript vector (van der Stoep,the isolation of specific scFv Ab fragments (de Kruif 1995). Ce was PCR amplified from this plasmid withet al., 1995a,b, 1996; Boel et al., 1998). Here we the Ce primers introducing NotI and EcoRV restric-describe the construction of eukaryotic expression tion sites (Table 1A,B), and cloned into the pNUT-

E. Boel et al. / Journal of Immunological Methods 239 (2000) 153 –166 155

Table 1aOligonucleotide primers

(A) Human back primers for immunoglobulin constant regionsC -5 TTTATTAAGGGATCCGCGGCCGCTAGGAAGAAACTCAAAk ]]]

ACC -5 CAGGTGCGGATCCAGCGGCCGCGAGCCCAGACACTGGACg ]]]C -5 CAGCCCTGGGATCCAGGGCACGCGGCCGCAGCTCCTCACm ]]]C -5 CAATCATAAGGATCCTCACGCGGCCGCTCTGTGCTGGGTTa ]]]

CCTC -5 CAGGCTGGCGGCCGCTGGCCTGAGe ]]]

(B) Human forward primers for immunoglobulin constant regionsC -3 TGGGGGCCCGGGTACCTCTAACACTCTCCCCTk ]]]C -3 GGGGCTTCCCGGGTACCGCACTCATTTACCCGGAGAg ]]]C -3 CCGAGCCTGATATCAGGGTACCAGGGTCAGTAGm ]]]C -3 CAATATCGGATATCAGGTACCTCAGTAGCAGGTGCCGACa ]]]C -3 AGGGAGGGGATATCAGGTACCTCATTTACCe ]]]

(C) Primers to generate the HAVT20 leaderHAVT20 CCCATAGAGGAATTCGGATCCAATGGCATGCCCTGGCTTC

]]]CTGTGGGCACTTGTGATCTCCACCTGTCTTGAATTTTCCATGGCTGAAATTGAGCTCGTCGACAGGTGAGTGCGGCCGCAAGCTTAAAGGTCTGG

HAVT20-C CCAGACCTTTAAGCTTGCGG]]]

(D) Human V back primersk

V 1a TGTGACATCGAGCTCACCCAGTCTCCATCCk ]]]V 2a TGTGATGTTGAGCTCACTCAGTCTCCACTCk ]]]V 3pan GA(A/T/C)AT(T/C)GAGCTCAC(G/A/T/C)CAGTCTCCk ]]]V 4 TGTGACATCGAGCTCACCCAGTCTCCAGACTCCk ]]]

(E) Human J forward primerk

J pan TTCTCGACTTGCGGCCGCAAAGTGCACTTACGTTTGATCTk ]]]CCACCTTG

(F) Human V back primersl

V 1 TCCCAGTCTGAGCTCACGCAGCCGCCCTCl ]]]V 2 TCCCACGTTGAGCTCACTCAACCGCCCTCTGl ]]]V 3a TCCTCCTATGAGCTCACTCACCCACCCTl ]]]V 3b TCCTCCTATGAGCTCACTCAGGACCCTl ]]]

(G) Human J forward primerl

J pan TTCTCGACTTGCGGCCGCGACTCACCTAGGACGGTCAGCTl ]]]TGGTC

a Restriction sites used for cloning are underlined.

g4 vector from which the g4 chain was removed by restriction sites and a splice donor site, and clonedrestriction digestion with NotI and SmaI. into the pLEADER vector (Figs. 1A and 2). The VL

The pLEADER vector was constructed by exten- gene fused to the HAVT20 leader was subsequentlysion of two partially complementary oligonucleo- cloned into the pNUT-Ck vector using BamHI andtides, HAVT20 and HAVT20C (Table 1C), and NotI.cloning of the double-stranded product into the The phagemid containing the coding sequence forpUC18 vector using EcoRI and HindIII. the anti-SRBC scFv S6 was isolated from Es-

The seven V genes used previously to construct cherichia coli XL1-blue cells (Stratagene, La Jolla,L

the phage display library of scFv fragments (de Kruif CA) and purified using a Qiagen plasmid isolationet al., 1995a), were PCR amplified with the relevant kit (Qiagen, Hilden, Germany). The phagemid wasprimers (Table 1D–G) to introduce SacI and NotI digested with NcoI and XhoI and the V regionH

156E

.B

oelet

al./

Journalof

Imm

unologicalM

ethods239

(2000)153

–166

Fig. 1. Expression vectors for human Ig H and L chains and strategy for converting scFv fragments into intact human mAbs. (A) The V region is PCR-amplified to introduce restrictionL

sites and a splice donor sequence (D) and cloned into the pLEADER vector. The V region fused to the HAVT20 leader sequences is excised and subcloned into the pNUT-Ck vector.L

(B) The V region is excised from the pHEN1 phagemid, cloned into pLEADER, and subcloned together with the HAVT20 leader and splice donor sequence into pNUT containing theH

different H chain C regions. Amp, ampicillin resistance gene; DHFR, dihydrofolate synthetase gene; gIII, M13 minor coat protein III gene; Mtp, human metallothionein promotor; SV40,SV40 origin of replication.


Fig. 2. The cloning sites of pLEADER. Restriction endonuclease sites are underlined, the HAVT20 leader and the first four amino acids ofthe Vl chain are indicated.

cloned into the NcoI- and SalI-digested pLEADER 10% FCS at 378C in a 5% CO humidified chamber.2

vector (Fig. 2). Subsequently, the HAVT20 leader Cells were washed in PBS and transfected with theand V were subcloned into the pNUT expression plasmids in RPMI 1640 medium containing 2% FCS,H

vectors using BamHI and NotI restriction sites (Fig. 100 mM chloroquine and 400 mg/ml DEAE–dextran1B). for 1.5 h, washed with PBS and supplemented with

DMEM–10% FCS. After transfection, the cells were2.2. Phage selection cultured for 3–5 days before the expression of Abs

was determined in the supernatant by ELISA.Phage Ab S6 specific for SRBC was isolated from

a semi-synthetic phage display library as described 2.4. Transfection of fur-BHK cellspreviously (de Kruif et al., 1995a). Approximately

125310 phages were blocked in 2% low-fat dry milk Baby hamster kidney 21 (BHK-21) cells con-5powder in PBS and subsequently mixed with 10 taining the furin gene (Lankhof, 1996) were trans-

SRBC. The phages were allowed to bind for 3 h at fected using the calcium–phosphate method as de-48C, after which the SRBC were washed five times scribed (Graham and van der Eb, 1973). Selectionin PBS by pelleting the SRBC and removing the was initiated by adding 100 mM of methotrexatesupernatant containing non-binding phages. After the (Sigma, St. Louis, MO, USA). After 2 weeks,final washing step the pelleted SRBC were resus- colonies of resistant cells were picked and culturedpended in water and binding phages were used to in methotrexate-containing medium. The productioninfect E. coli XL1-Blue cells. The E. coli cells were of Abs was determined in the supernatant by ELISA.plated on agar containing the appropriate antibioticsand 5% glucose, and used to prepare phages for a 2.5. ELISAsubsequent round of selection as previously de-scribed (Marks et al., 1991). After three rounds of All Abs used for ELISA were from Southernselection, monoclonal phage preparations were tested Biotechnology Associates (Birmingham, AL), exceptfor SRBC-binding by flow cytometric analysis on a the IgG subclass-specific Abs, which were from theFACScan (Becton-Dickinson, San Jose, CA) as Central Laboratory for Bloodtranfusion (Amsterdam,described (de Kruif et al., 1995b). The Netherlands). Wells of a 96-well plate (Flow

Laboratories, Irvine, UK) were coated with a 1/10002.3. Transfection of COS cells dilution of a goat anti-human k L chain Ab in PBS

overnight at 48C and 100-ml aliquots of cultureSV40-transformed African green monkey kidney supernatant or purified Abs were added. Plates were

cells (COS-7) cells were maintained in DMEM with incubated at 378C for 1 h, washed in 0.05% Tween


20–PBS, and a 1/1000 dilution of horseradish FITC-labeled lectins were used in the detection step.peroxidase (HRP)-labeled Ab specific for the rel- After washing, individual wells were filled with PBSevant human isotype was added. The plates were and bound FITC was quantified using a fluorescenceincubated for 1 h at 378C and washed with Tween multi-well reader (Cytofluor; Perspective Bio-20–PBS. HRP activity was quantified by addition of systems, Framingham, MA). The following lectinstetramethylbenzidine free base substrate and further were used: Limax flavus (LFA) for the detection ofincubation for 10 min at room temperature. The sialic acid, Eyrthrina cristaglli (ECA) forenzyme reaction was stopped with H SO and the galactose(b1,4)N-acetylglucosamine, and Canavalia2 4

OD was determined. ensiformis (Con A) for a-D-mannose, a-D-glucose,450

branched mannose (EY Laboratories, San Mateo,2.6. Purification of human Abs CA).

The transfected cell lines were cultured in serum- 2.9. Binding of human Absfree CHO-S-SFM II medium (Gibco-BRL, GrandIsland, NY) and culture supernatants were harvested SRBC were sensitized with the different purifiedtwice weekly. Cellular debris was removed from all S6 Ab preparations by incubation for 30 min at 378Csupernatants by centrifugation at 3000 rpm for 10 under agitation and washed in RPMI 1640 mediummin followed by filtration over a 0.2-mm membrane containing 5% FCS. SRBC-bound S6 mAbs were(Gelman Sciences, Ann Arbor, MI). detected with FITC-labeled Abs specific for human

All Ig subclasses were purified from culture IgG or IgA (Southern Biotechnology Associates) bymedium by protein A–Sepharose chromatography incubation for an additional hour at 378C, followed(Pharmacia, Uppsala, Sweden). For every purifica- by flow cytometric analysis on a FACScan.tion a new column was used to avoid cross-contami-nation of different Abs. The concentration of purified

2.10. Fc receptor-transfected cell lines and SRBC-mAbs was determined using radial immunodiffusionIg rosetting assayplates

of the relevant isotype (LC-Partigen; Behring-Murine B cell line IIA1.6 transfected with FcgRIwerke, Marburg, Germany) according to the manu-

(van Vugt et al., 1996), FcgRIIa-H131, FcgRIIa-facturer’s recommendations.R131 (van den Herik-Oudijk et al., 1994), FcgRIIIb-NA2 (Ory et al., 1991) and FcaRI (Morton et al.,2.7. SDS–PAGE and N-terminal amino acid1995) were cultured in RPMI 1640, supplementedsequence analysiswith 10% FCS, 100 units /ml penicillin, 100 mg/mlstreptomycin, 2 mM glutamine, and 1 mM sodiumAliquots of the purified Abs containing 3 mg ofpyruvate. Rosette formation between Fc receptor-protein were run on a 10% reducing or 7.5% non-transfected cell lines and Ab-sensitized SRBC wasreducing SDS–polyacrylamide gel. Proteins wereperformed as described in detail elsewhere (van dedetected by Coomassie brilliant blue staining. ForWinkel et al., 1987).N-terminal amino acid sequence analysis, proteins

were blotted onto a Problott membrane (AppliedBiosystems, Foster City, CA) using 10 mM CAPS– 2.11. Fluorescent labeling of SRBC and10% methanol as blotting buffer. H and L chains phagocytosiswere detected by Coomassie brilliant blue staining,and sequenced by Edman degradation. SRBC were stained with the red fluorescent dye

PKH26 (Sigma) as described in detail elsewhere2.8. Glycosylation analysis (Van Amersfoort and Van Strijp, 1994). Heparinized

blood was obtained from healthy volunteers andGlycosylation of recombinant human Abs was neutrophils were isolated as described previously

determined following the same procedure as de- (Troelstra et al., 1997).scribed for the isotype-specific ELISA, except that PKH26-labeled SRBC were sensitized with the


different S6-Ab preparations by incubation at 378C (Hoogenboom et al., 1991). Part of the genomicfor 30 min under mild agitation. Neutrophils and human J 4 mini gene sequence (Kabat et al., 1991)H

sensitized SRBC were washed and resuspended in was introduced downstream of a SalI restriction siteRPMI 1640 containing 1% BSA to a final con- in the pLEADER vector, to complete the V regionH

7 8centration of 1310 and 1.2310 cells /ml, respec- and to introduce a splice donor sequence. The VH

tively. Twenty-ml aliquots of neutrophils and SRBC region was subcloned into pLEADER using NcoIwere mixed, centrifuged at 253g for 5 min at 48C, and XhoI, the same restriction sites which were usedincubated at 378C for 20 min, washed and resuspend- to construct the library (de Kruif et al., 1995a).ed in 150 ml PBS. Flow cytometric analysis was Subsequently, using the BamHI and NotI restrictionperformed on a FACScan. Neutrophils were differen- sites, the HAVT20–V -splice donor construct wasH

tiated from free SRBC on the basis of their forward subcloned into the different expression vectors har-and side scatter properties. boring the genomic H chain C regions, in which

splice acceptor sequences are present (Fig. 1B).The seven V genes present in the phage displayL2.12. Complement-mediated hemolysis

library were PCR-amplified with primers introducinga splice donor site and restriction sites for cloning.Complement-mediated hemolysis (CH50) wasTo facilitate the cloning of V genes, the HAVT20Lestimated by hemolytic microtiter assay as describedleader sequence is followed in frame by the sequencepreviously (Klerx et al., 1983). To reduce back-for the first four amino acids of a V domainLground, NHS was preabsorbed with SRBC by mix-containing a SacI restriction site, identical to thating one volume of serum with three volumes ofused in the construction of the phage display librarypacked SRBC. After incubation for 20 min on ice,(de Kruif et al., 1995a). The 39-primer completes theSRBC were removed by centrifugation and serumV genes and adds part of the intron containing theLwas stored in small aliquots at 2708C.splice donor sequence, and a restriction site. All VL

constructs were cloned into the pNUT-Ck vector(Fig. 1A). Thus, all L chains will contain a human k

3. Results C region.The expression vectors are derivatives of pNUT,

3.1. Construction of vectors for the production of which contains a dihydrofolate reductase gene forhuman IgG1-4, IgA1-2, IgM, and IgE mAbs selection of stably transfected cells and a SV40

origin of replication for transient expression in COSWe have constructed a series of vectors that allow cells (Fig. 1).

the rapid conversion of scFv Ab fragments isolatedfrom a semi-synthetic phage display library, to

3.2. Selection of SRBC-binding phagecomplete human mAbs of every isotype. The previ-ously described phage Ab display library of scFv

Phages were selected for binding to SRBC, andfragments was constructed from seven different VL after three rounds of selection monoclonal phage8genes and more than 10 V genes (de Kruif et al.,H preparations were tested by flow cytometry. Clone1995a). The V gene encoding a scFv isolated fromH S6 was specific for SRBC and did not bind to ox orthis library was first cloned into the pLEADER

human erythrocytes or sheep leukocytes (not shown).vector, resulting in the introduction of a splice donor

The V 3 H chain and Vl3 L chain genes encodingHsequence at the 39 end and the eukaryotic HAVT20scFv fragment S6 were cloned into the different

leader peptide sequence at the 59 end of the VH expression vectors.segment (Kimura et al., 1987; Kabat et al., 1991).The T cell receptor leader peptide HAVT20 wasselected because it allowed the introduction of a 3.3. Expression and purification of recombinantNcoI restriction site at precisely the same position as mAbswas used in the pelB leader of the phage displaylibrary, without altering the amino acid sequence Integrity of the constructs was assessed by tran-


sient expression in COS cells. Supernatants wereharvested 3–5 days after transfection and analysedby ELISA for the presence of Abs, and by flowcytometry for binding to SRBC (not shown). Afterconstruct integrity was confirmed, stably transfectedcell lines were established by co-transfection of Hand L chain constructs in fur-BHK21 cells. Fur-BHK21 cells contain the furin gene and have beenshown to be superior in the production of complex,high-molecular weight proteins such as factor VIIIprotein (Lankhof, 1996).

Methotrexate-resistant clones were analysed forAb production and stable cell lines were propagatedin selection medium. Culture supernatant was har-vested twice weekly and all subclasses were purifiedfrom pooled supernatants using a protein A column,based on the observation that protein A binds tohuman V 3-encoded Ab domains (Sasano et al.,H

1993). MAb yields after purification as measured byradial gel filtration ranged from 5 to 18 mg/ l ofculture supernatant for the IgG subclasses, 0.5 to 3 Fig. 3. Coomassie brilliant blue-stained SDS–PAGE gel of the

purified S6 Ab preparations under reducing (A) and nonreducingmg/ l for the IgA subclasses, 70 mg/ l for IgM andconditions (B). HH and LL indicate homodimers of H and L9.6 mg/ l for IgE (Table 2). Because of their lowchains, respectively, of IgA2m(1). Lane 1, IgG1; lane 2, IgG2;yield, the IgM and IgE mAbs were not included inlane 3, IgG3; lane 4, IgG4; lane 5, IgA1; lane 6, IgA2m(1); M,

the functional studies. molecular weight marker.

3.4. Characterization of recombinant human S6 cules (Fig. 3B). In purified IgA1 preparations, amAbs predominant band of 160 kDa was observed. In

addition, a band of approximately 120 kDa molecu-All S6 mAbs produced were tested in ELISA for lar mass was visible, probably representing a com-

the presence of a k L chain and for the isotype of the plex of a single H and L chain, as has been reportedH chain. IgG1-4 subclass identity was confirmed previously (Morton et al., 1993). Some high-molecu-using subclass-specific mAbs (not shown). lar weight aggregates were noticeable near the top of

SDS–PAGE under reducing conditions showed H the gel. A faint band of 80–90 kDa, representing lessand L chain bands of the predicted size; L chains than 10% of the total protein content, most probablydisplayed a band of 30 kDa molecular mass while H represents a partial degradation product. Similarchains revealed bands ranging from 50 to 60 kDa bands of 60 and 80 kDa were noticed in the IgG3molecular mass, dependent on the isotype (Fig. 3A). and IgG4 preparations, respectively.

SDS–PAGE under nonreducing conditions re- Under nonreducing conditions, SDS–PAGE ofvealed a single band of approximately 150–160 kDa, purified IgA2m(1) preparations revealed two pre-corresponding to the size of monomeric IgG mole- dominant bands of 120 and 50 kDa molecular mass,

Table 2aProduction levels of human immunoglobulins

IgG1 IgG2 IgG3 IgG4 IgA1 IgA2 IgM IgE

17.9 mg 6.4 mg 13.3 mg 5.5 mg 3.0 mg 0.5 mg 70 mg 9.6 mga Yield per liter after purification.


with some higher molecular weight aggregates. The120 and 50 kDa bands represent disulfide-bonded Hand L chain homodimers, respectively (Morton et al.,1993). In the IgA2m(1) allotype expressed here, Hand L chain are not disulfide-linked. Instead, disul-fide bonds are formed between the L chains (Mes-tecky and Kilian, 1985).

To verify the correct proteolytic removal of theHAVT20 leader peptide from the H and L chains, theN-terminal sequence of both chains from the S6-IgG4 Ab was determined. The amino acid sequenceswere precisely as predicted from the nucleotidesequences of the correctly cleaved V and V chains,H L

EVQLVE and EIELT, respectively.Human Ab molecules contain N-linked carbohy-

drates at conserved positions in the C regions of theH chains. Oligosaccharide is attached as high-man-nose sugar and trimmed when the glycoproteinpasses through the endoplasmatic reticulum and thecis Golgi. Processing may cease at this point,yielding glycoproteins with high-mannose sugarsattached. Alternatively, processing may proceed to acomplex biantennary form. The lectin Con A wasused to confirm glycosylation, while the lectins ECAand LFA were used to detect the two terminal sugar

Fig. 4. Binding of IgG and IgA mAbs to SRBC. SRBC wereresidues of fully processed carbohydrates, galactosesensitized with serially diluted preparations of the different mAbs

and sialic acid, respectively. S6-IgG1 and S6-IgG2 and binding was detected with relevant FITC-labeled Abs by flowwere analyzed using FITC-labeled lectins, and bind- cytometry. Human mAb GBS7-IgG2, specific for group B strep-

tococcal type III capsular polysaccharide, served as a control foring was quantified on a fluorometer. Protein A-background staining.purified IgG1 and IgG2 mAbs or crude culture

supernatants from fur-BHK21 cell lines transfectedwith the S6-IgG1 or S6-IgG2 constructs were cap- cal type III capsular polysaccharide (GBS7-IgG2, detured on microwells coated with anti-k L chain Kruif et al., 1995a) and produced and purified asmAbs. Protein A-purified IgG1 and IgG2 mAbs described for the S6 mAbs, did not reveal anydisplayed Con A reactivity, but lacked reactivity binding with SRBC (Fig. 4).with ECA or LFA (not shown). In contrast, non- The interaction of recombinant S6 Ab with a panelpurified IgG1 and IgG2 present in culture super- of Fc receptor-transfected cell lines was determinednatants bound Con A, ECA and LFA (not shown). using a SRBC-rosetting assay (Table 3). IgG1 and

IgG3 were bound by all Fcg receptors, while IgG2-3.5. In vitro produced recombinant human mAbs opsonized SRBC only formed rosettes with theare functional FcgRIIa-H131 transfected cell line. IgG4 was effi-

ciently bound by FcgRI, while some rosetting wasThe binding capacity of the different S6-Ab observed with FcgRIIa. IgA1 and IgA2 were the

preparations was assessed by flow cytometry. The only isotypes bound by the FcaRI-transfected cellfour human IgG and the two IgA isotypes revealed a line.similar pattern of binding to SRBC (Fig. 4). A The capacity to mediate phagocytosis of SRBC bycontrol human IgG2 mAb, constructed from a phage neutrophils was determined for the IgG1 and IgG4library-derived scFv specific for group B streptococ- anti-SRBC mAbs (Fig. 5). Neutrophils readily


Table 3aRosetting of Ig-opsonized SRBC with Fc receptor-transfected cells

IgG1 IgG2 IgG3 IgG4 IgA1 IgA2

FcgRI 100/100 0 100/100 100/100 0 0FcgRIIa-H131 76/77 58/21 70/83 19/6 0 0FcgRIIa-R131 80/85 0 100/60 47/6 0 0FcgRIIIb-NA2 62/65 0 41/27 0 0 0FcaRI 0 0 0 0 85/78 21/7

a Rosetting was defined as at least three SRBC bound to a cell. Two hundred cells per sample were scored and percentages are depictedfor SRBC sensitized with 0.6 /0.3 mg/ml antibody.

phagocytozed IgG1-opsonized SRBC, while SRBC complement, resulting in lysis of SRBC, was de-incubated with IgG4 were not phagocytozed. For termined for a series of S6 mAb concentrations. Thecomparison fluorescence of neutrophils incubated concentration of mAb that gave 50% lysis of SRBCwith non-opsonized SRBC is shown (Fig. 5). (CH50) was calculated for the four IgG subclasses of

The ability to activate the classical pathway of S6-Ab (Fig. 6). Induction of hemolysis by IgG1 wasvery efficient, reaching optimal lysis at approximate-ly 1 mg/ml of mAb. IgG3 also was capable of lysingSRBC, albeit slightly less efficiently than IgG1. IgG4did not lyse SRBC at concentrations of up to 10mg/ml, whereas marginal lysis was observed with

Fig. 5. Phagocytosis of IgG1- and IgG4-opsonized SRBC by Fig. 6. Isotype-dependent, complement-mediated hemolysis.neutrophils. PKH26-labeled SRBC were sensitized with different SRBC were sensitized with serially diluted mAb preparations andconcentrations of the mAbs and after incubation with neutrophils, the amount of human serum required for 50% hemolysis wasphagocytosis was measured by flow cytometry. The solid bar determined (CH50). As controls, non-opsonized SRBC and SRBCrepresents the level of background phagocytosis of non-opsonized opsonized with serum from a hyperimmunized rabbit (R22) wereSRBC. included.


IgG2 at the highest mAb concentration tested (Fig. site for cloning (Fig. 1A). A set of seven L chain6). expression vectors containing each of the L chains

used to assemble our phage Ab display library can berepeatedly used for expression of new human mAbs,

4. Discussion based on scFv derived from this library.Ig constructs were introduced in BHK21 cells

Phage Ab display technology has facilitated the transfected with the furin gene. Fur-BHK21 cellsrapid isolation of human Ab fragments specific for a yield higher amounts of recombinant proteins aswide variety of purified antigens, micro-organisms compared to BHK21 cells (Lankhof, 1996), probablyand eukaryotic cells. We have previously described because fur-BHK21 cells reach higher cell densitiesthe construction of a semi-synthetic phage Ab dis- at confluency, resulting in increased protein accumu-play library of scFv fragments and its applications lation in the supernatant. In addition, supernatants(de Kruif et al., 1995a,b, 1996; Boel et al., 1998). from fur-BHK21 cells may be harvested up to 8Here we show that scFv selected from this library weeks after reaching confluency. After purification,can be converted to complete and functional human Ab yields of up to 18 mg/ l of culture supernatantmAbs of each of the eight isotypes. For the V were obtained, comparing favorably to publishedH

region, the procedure was designed to encompass production levels of recombinant human Abs thattwo cloning steps and avoids PCR amplification were not specifically selected for high levels of

¨procedures and concomitant introduction of muta- expression (Bruggemann et al., 1987; Co et al.,tions. In the first step, the V region is cloned into 1992; Bender et al., 1993; Persic et al., 1997). OfH

the intermediate pLEADER vector to append the note, IgM and IgE transfectants yielded considerablyHAVT20 leader peptide sequence and a splice donor lower levels of Abs.site. The T cell receptor a chain leader HAVT20 N-Terminal amino acid sequence analysis of the(Kimura et al., 1987) was selected because it al- V 3 and Vl3 chains encoding Ab S6-IgG4, showedH

lowed the introduction of a NcoI restriction site that the HAVT20 leader peptide was correctly re-facilitating the subcloning of the V chain, without moved from both the H and L chains in the matureH

interfering with the amino acid sequence. In addition, Ab. The glycosylation pattern of recombinant mAbsthe pLEADER vector contains the genomic J 4 produced in fur-BHK21 cells was analyzed usingH

sequence downstream of a SalI restriction site to lectins specific for sugar residues attached in differ-complete the V gene and to introduce the genomic ent stages of maturation of the oligosaccharideH

splice donor sequence. In the second cloning step, (reviewed in Wright and Morrison, 1997). MAbs inthe V region with appended leader and splice donor the crude culture supernatant appeared to be com-H

site is subcloned into one of eight expression vectors pletely glycosylated, resulting in oligosaccharidescontaining genomic sequences of each of the differ- with terminal galactose and sialic acid residues. Inent human Ig C region genes. The genomic splice contrast, the latter residues could not be detected onacceptor sequence resides in the C region domain purified Abs obtained after protein A chromatog-constructs, resulting in the removal of the artificial raphy. It is likely that these residues were removedintron between V and the C region by splicing. in the elution step with low pH buffers. Thus, fur-H

The HAVT20 leader was also used for the con- BHK-21 cells attach polysaccharides to the Abstruction of vectors for the expression of Ig L chains. molecules which are subsequently trimmed andA sequence encoding the first four amino acids of the processed to the complex biantennary form.V region, containing a SacI restriction site, was The IgG and IgA mAbs produced by fur-BHK21L

used in the phage library to facilitate cloning of V cells assembled correctly as shown by SDS–PAGEL

genes (de Kruif et al., 1995a). This same sequence analysis under nonreducing conditions (Fig. 3B).was fused in frame to the HAVT20 leader sequence The IgA2m(1) allotype expressed here does notin the pLEADER vector. PCR amplification was contain disulfide bonds between H and L chains;used to complete the V domain and to introduce the instead disulfide-bonded L chains dimers are formedL

genomic splice donor sequence and a NotI restriction (Mestecky and Kilian, 1985), which are linked to the


H chains by noncovalent interactions, explaining the concentrations. As expected, no hemolysis was ob-served with IgG4 at any of the Ab concentrationspredominant bands of 120 and 50 kDa moleculartested.mass.

The conversion of phage Abs fragments to com-The different isotypes of the human Ab S6 boundplete Ig molecules of a single isotype has beento Fc receptors in a pattern consistent with publishedreported for a tetanus toxoid-specific human Fabreports (van de Winkel and Anderson, 1991; Shen,fragment (Bender et al., 1993), two complement1992). IgG1 and IgG3 interacted with all Fcgcomponent C5a-specific murine Fab fragmentsreceptors tested, whereas IgG2 was efficiently bound(Ames et al., 1995), a HPA-1a-specific human scFvby the FcgRIIa-H131 transfectant only. IgG4-sen-Ab (Watkins et al., 1999), and a human scFv Absitized SRBC bound to FcgRI-transfected cells, butfragment of which the target was not specifiedsome rosetting with FcgRIIa was also seen. The(Persic et al., 1997). The Fab fragments and theIgA1 and IgA2 preparations bound to FcaRI-trans-HPA-1a-specific scFv fragments performed similarlyfected cells only, and no IgG preparation bound toto the corresponding whole Abs (Bender et al., 1993;these cells. Phagocytosis of IgG1- but not of IgG4-Ames et al., 1995; Watkins et al., 1999), whereas theopsonized SRBC is consistent with the absence orspecificity and biological activity of the other scFvvery low level expression of FcgRI on restingfragment and corresponding whole Ab have not beenneutrophils (Antal-Szalmas et al., 1997).compared (Persic et al., 1997). The SRBC-specificIn our model, IgG1 induced complement-mediatedscFv fragment described here was converted to intactlysis much more efficiently than IgG3. The relativefully human anti-SRBC Abs of all eight isotypes.efficiency of lysis of target cells by different IgThe Abs retained binding specificity, were correctlysubclasses has been shown to be dependent on theassembled and glycosylated and performed in Fctarget epitope. IgG1 is considerably more effectivereceptor binding, complement activation and phago-than IgG3 in mediating lysis of NIP-coated erythro-cytosis assays conform their Ig isotype. Human scFv¨cytes (Bruggemann et al., 1987; Bindon et al., 1988),fragments against a wide variety of antigens havewhile IgG3 is more effective at mediating lysis ofbeen isolated from a number of combinatorial anddansyl-coated erythrocytes (Dangl et al., 1988).semi-synthetic phage display libraries. Recently de-However, in another report using NIP-coated eryth-veloped mutagenesis and selection strategies facili-rocytes, IgG1 was better than IgG3 at high antigentate the construction of very high affinity derivativesconcentration, while the reverse was observed atwith affinities in the picomolar range (Schier et al.,lower antigen concentration (Garred et al., 1989;1996). The expression vectors described here facili-Lucisano Valim and Lachmann, 1991). IgG2 wastate the rapid construction of high affinity, intactonly effective at the highest antigen densities. Thisfully human mAbs for clinical application using scFvobservation fits well with the known preferentialAb fragments selected from phage display librariesIgG2 response against polysaccharides on encapsu-as building blocks.lated bacteria. The repetitive epitopes of polysac-

charides would fulfil the requirements for comple-ment activation found in these studies. Indeed,

Referencescomplement activation by the human IgG2 isotypehas been reported for purified polyclonal Ab prepara-

Ames, R.S., Tornetta, M.A., Deen, K., Jones, C.S., Swift, A.M.,tions directed against bacteria (Weinberg et al., 1986;Ganguly, S., 1995. Conversion of murine Fabs isolated from a

Givner et al., 1987; Amir et al., 1990; Bredius et al., combinatorial phage display library to full length immuno-1992). The recombinant S6 Abs recognize a natu- globulins. J. Immunol. Methods 184, 177.rally occurring antigen on SRBC, which, in Scat- Amir, J., Scott, M.G., Nahm, M.H., Granoff, D.M., 1990. Bac-

tericidal and opsonic activity of IgG1 and IgG2 anticapsularchard analysis, was estimated to be expressed at lessantibodies to Haemophilus influenzae type b. J. Infect. Dis.than 3000 molecules per cell. Indeed, IgG2 induced162, 163.

some hemolysis only at the highest Ab concen- Antal-Szalmas, P., Van Strijp, J.A.G., Weersink, A.J.L., Verhoef, J.,trations tested, while maximum complement-medi- van Kessel, K.P.M., 1997. Quantitation of surface CD14 onated hemolysis was reached at low IgG1 and IgG3 human monocytes and neutrophils. J. Leukocyte Biol. 61, 721.


Bender, E., Woof, J.M., Atkin, J.D., Barker, M.D., Bebbington, immunoglobulin kappa J region genes. J. Biol. Chem. 257,C.R., Burton, D.R., 1993. Recombinant human antibodies: 1516.linkage of an Fab fragment from a combinatorial library to an Hoogenboom, H.R., Griffiths, A.D., Johnson, K.S., Chiswell, D.J.,Fc fragment for expression in mammalian cell culture. Hum. Hudson, P., Winter, G., 1991. Multi-subunit proteins on theAntibod. Hybridomas 4, 74. surface of filamentous phage: methodologies for displaying

¨Bindon, C.I., Hale, G., Bruggemann, M., Waldmann, H., 1988. antibody (Fab) heavy and light chains. Nucl. Acids Res. 19,Human monoclonal IgG isotypes differ in complement activat- 4133.ing function at the level of C4 as well as C1q. J. Exp. Med. Jaffers, G.J., Fullers, T.C., Cosimi, P.S., Russel, P.S., Winn, H.J.,168, 127. Colvin, R.B., 1986. Monoclonal antibody therapy. Anti-

Boel, E., Bootsma, H., de Kruif, J., Jansze, M., Klingman, K.L., idiotypic and non-anti-idiotypic antibodies to OKT3 arisingvan Dijk, H., Logtenberg, T., 1998. Phage antibodies obtained despite intense immunosuppression. Transplantation 41, 572.by competitive selection on complement-resistant Moraxella Jones, P.T., Dear, P.H., Foote, J., Neuberger, M.S., Winter, G.,(Branhamella) catarrhalis recognize the high-molecular- 1986. Replacing the complementarity-determining regions in aweight outer membrane protein. Infect. Immun. 66, 83. human antibody with those from a mouse. Nature 321, 522.

Bonnefoy-Berard, N., Revillard, J.P., 1996. Mechanisms of im- Kabat, E.A., Wu, T.T., Oerry, H.M., Gottesman, K.S., Foeller, C.,munosuppression induced by antithymocyte globulins and 1991. Sequences of proteins of immunological interest. USOKT3. J. Heart Lung Transplant 15, 435. Department of Health and Human Services, Public Health

Bredius, R.G.M., Driedijk, P.C., Schouten, M.F.J., Weening, R.S., Service, National Institutes of Health, Bethesda, MD.Out, T.A., 1992. Complement activation by polyclonal im- Kimura, N., Toyonaga, B., Yoshikai, Y., Du, R., Mak, T.W., 1987.munoglobulin G1 and G2 antibodies against Staphylococcus Sequences and repertoire of the human T cell receptor a and b

aureus, Haemophilus influenzae type b and Tetanus toxoid. chain variable region genes in thymocytes. Eur. J. Immunol.Infect. Immun. 60, 4838. 17, 375.

¨Bruggemann, M., Williams, C.T., Bindon, C.I., Clark, M.R., Kirsch, I.R., Morton, C.C., Nakahara, K., Leder, P., 1982. HumanWalker, M.R., Jefferis, R., Waldmann, H., Neuberger, M.S., immunoglobulin heavy chain genes map to a region of1987. Comparison of the effector functions of human immuno- translocation in malignant B lymphocytes. Science 216, 301.globulins using a matched set of chimeric antibodies. J. Exp. Klerx, J.P.A.M., Beukelman, C.J., van Dijk, H., Willers, J.M.N.,Med. 166, 1351. 1983. Microassay for colorimetric estimation of complement

Burton, D.R., Barbas, C.F., 1994. Human antibodies from com- activity in guinea pig, human and mouse serum. J. Immunol.binatorial libraries. Adv. Immunol. 57, 191. Methods 63, 215.

Co, M.S., Avdalovic, N.M., Caron, P.C., Avdalovic, M.V., Schein- Lankhof, H., 1996. Ph.D. Thesis, University of Utrecht, Utrecht,berg, D.A., Queen, C., 1992. Chimeric and humanized anti- The Netherlands.bodies with specificity for the CD33 antigen. J. Immunol. 148, Lucisano Valim, Y.M., Lachmann, P.J., 1991. The effect of1149. antibody isotype and antigenic epitope density on the com-

Dangl, J.L., Wensel, T.G., Morrison, S.L., Stryer, L., Herzenberg, plement-fixing activity of immune complexes: a systematicL.A., Oi, V.T., 1988. Segmental flexibility and complement study using chimaeric anti-NIP antibodies with human Fcfixation of genetically engineered chimeric human, rabbit and regions. Clin. Exp. Immunol. 84, 1.mouse antibodies. EMBO J. 7, 1989. Marks, J.D., Hoogenboom, H.R., Bonnert, T.P., McCafferty, J.,

de Kruif, J., Boel, E., Logtenberg, T., 1995a. Selection and Griffiths, A.D., Winter, G., 1991. By-passing immunization.application of human single chain Fv antibody fragments from Human antibodies from V-gene libraries displayed on phage. J.a semi-synthetic phage antibody display library with designed Mol. Biol. 222, 581.CDR3 regions. J. Mol. Biol. 248, 97. Max, E.E., Battey, J., Ney, R., Kirsch, I.R., Leder, P., 1982.

de Kruif, J., Terstappen, L., Boel, E., Logtenberg, T., 1995b. Duplication and deletion in the human immunoglobulin ep-Rapid selection of cell subpopulation-specific human mono- silon genes. Cell 29, 691.clonal antibodies from a synthetic phage antibody library. Mendez, M.J., Green, L.L., Corvalan, J.R.E., Jia, X., Maynard-Proc. Natl. Acad. Sci. USA 92, 3938. Currie, C.E., Yang, X., Gallo, M.L., Louie, D.M., Lee, D.V.,

de Kruif, J., van der Vuurst de Vries, A., Cilenti, L., Boel, E., van Erickson, K.L., Luna, J., Roy, C.M.-N., Abderrahim, H.,Ewijk, W., Logtenberg, T., 1996. New perspectives on recom- Kirschenbaum, F., Noguchi, M., Smith, D.H., Fukushima, A.,binant human antibodies. Immunol. Today 17, 453. Hales, J.F., Finer, M.H., Davis, C.G., Zsebo, K.M., Jakobovits,

Garred, P., Michaelsen, T.E., Aase, A., 1989. The IgG subclass A., 1997. Functional transplant of megabase human immuno-pattern of complement activation depends on epitope density globulin loci recapitulates human antibody response in mice.and antibody and complement concentration. Scand. J. Im- Nat. Genet. 15, 146.munol. 30, 379. Mestecky, J., Kilian, M., 1985. Immunoglobulin A (IgA). Meth-

Givner, L.B., Baker, C.J., Edwards, M.S., 1987. Type III group B ods Enzymol. 116, 37.Streptococcus: functional interaction with IgG subclass anti- Morrison, S.L., Johnson, M.J., Herzenberg, L.A., Oi, V.T., 1984.bodies. J. Infect. Dis. 155, 532. Chimeric human antibody molecules: mouse antigen-binding

Graham, F., van der Eb, A., 1973. A new technique for the assay domains with human constant region domains. Proc. Natl.of infectivity of human adenovirus 5 DNA. Virology 52, 456. Acad. Sci. USA 81, 6851.

Hieter, P.A., Maizel, J.V., Leder, P., 1982. Evolution of human Morton, H.C., Atkin, J.D., Owens, R.J., Woof, J.M., 1993.


Purification and characterization of chimeric human IgA1 and Troelstra, A., Giepmans, B.N.G., van Kessel, K.P.M., Lichtens-IgA2 expressed in COS and chinese hamster ovary cells. J. tein, H.S., Verhoef, J., Van Strijp, J.A.G., 1997. Dual effects ofImmunol. 151, 4743. soluble CD14 on LPS priming of neutrophils. J. Leukocyte

Morton, H.C., van den Herik-Oudijk, I.E., Vossebeld, P., Snijders, Biol. 61, 173.A., Verhoeven, A.J., Capel, P.J.A., van de Winkel, J.G.J., 1995. Van Amersfoort, E.S., Van Strijp, J.A.G., 1994. Evaluation of aFunctional association between the human myeloid immuno- flow cytometric fluorescence quenching assay of phagocytosisglobulin A Fc receptor (CD89) and FcR gamma chain. of sensitized sheep erythrocytes by polymorphonuclearMolecular basis for CD89/FcR gamma chain association. J. leukocytes. Cytometry 17, 294.Biol. Chem. 270, 29781. van de Winkel, J.G.J., Anderson, C.L., 1991. Biology of human

Ory, P.A., Clark, M.R., Talhouk, A.S., Goldstein, I.M., 1991. immunoglobulin G Fc receptors. J. Leukocyte Biol. 49, 511.Transfected NA1 and NA2 forms of human neutrophil Fc van de Winkel, J.G.J., Tax, W.J.M., van Bruggen, M.C.J.,receptor III exhibit antigenic and structural heterogeneity. Roozendaal, C.E.P., Willems, H.W., Vlug, A., Capel, P.J.A.,Blood 77, 2682. Koene, R.A.P., 1987. Characterization of two Fc receptors for

Palmiter, R.D., Behringer, R.R., Quaife, C.J., Maxwell, F., Max- mouse immunoglobulins on human monocytes and cell lines.well, I.H., Brinster, R.L., 1987. Cell lineage ablation in Scand. J. Immunol. 26, 663.transgenic mice by cell-specific expression of a toxin gene. van den Herik-Oudijk, I.E., Westerdaal, N.A.C., Henriquez, N.V.,Cell 50, 435. Capel, P.J.A., van de Winkel, J.G.J., 1994. Functional analysis

Persic, L., Robert, A., Wilton, J., Cattaneo, A., Bradbury, A., of human Fc gamma RII (CD32) isoforms expressed in BHoogenboom, H.R., 1997. An integrated vector system for the lymphocytes. J. Immunol. 152, 574.eukaryotic expression of antibodies or their fragments after van der Stoep, N., 1995. Ph.D. Thesis, University of Utrecht,selection from phage display libraries. Gene 187, 9. Utrecht, The Netherlands.

Ravetch, J.V., Kirsch, I.R., Leder, P., 1980. Evolutionary approach van Vugt, M.J., Heijnen, A.F., Capel, P.J.A., Park, S.Y., Ra, C.,to the question of immunoglobulin heavy chain switching: Saito, T., Verbeek, J.S., van de Winkel, J.G.J., 1996. FcREvidence from cloned human and mouse genes. Proc. Natl. gamma-chain is essential for both surface expression andAcad. Sci. USA 77, 6734. function of human Fc gamma RI (CD64) in vivo. Blood 87,

Sasano, M., Burton, D.R., Silverman, G.J., 1993. Molecular 3593.selection of human antibodies with an unconventional bacterial Watkins, N.A., Armour, K.L., Smethurst, P.A., Metcalfe, P., Scott,B cell antigen. J. Immunol. 151, 5822. M.L., Hughes, D.L., Smith, G.A., Williamson, L.M., Clark,

Schier, R., McCall, A., Adams, G.P., Marshall, K.W., Merritt, H., M.R., Ouwehand, W.H., 1999. Rapid phenotyping of HPA-1aYim, M., Crawford, R.S., Weiner, L.M., Marks, C., Marks, using either diabody-based hemagglutination or recombinantJ.D., 1996. Isolation of picomolar affinity anti-c-erbB-2 single- IgG1-based assays. Transfusion 39, 781.chain Fv by molecular evolution of the complementarity Weinberg, G.A., Granoff, D.M., Nahm, M.H., Shackelford, P.G.,determining regions in the center of the antibody binding site. 1986. Functional activity of different IgG subclass antibodiesJ. Mol. Biol. 263, 551. against type b capsular polysaccharide of Haemophilus in-

Shen, L., 1992. Receptors for IgA on phagocytic cells. Immunol. fluenzae. J. Immunol. 136, 4232.Res. 11, 273. Winter, G., Griffiths, A.D., Hawkins, R.E., Hoogenboom, H.R.,

Taylor, L.D., Carmack, C.E., Schramm, S.R., Mashayekh, R., 1994. Making antibodies by phage display technology. Annu.Higgins, K.M., Kuo, C.-C., Woodhouse, C., Kay, R.M., Rev. Immunol. 12, 433.Lonberg, N., 1992. A transgenic mouse that expresses a Wright, A., Morrison, S.L., 1997. Effect of glycosylation ondiversity of human sequence heavy and light chain immuno- antibody function: implications for genetic engineering.globulins. Nucl. Acids Res. 20, 6287. Trends Biotechnol. 15, 26.

functional human monoclonal antibodies of all isotypes constructed from phage display...

Documents