1 23

Journal of Molecular Neuroscience ISSN 0895-8696Volume 48Number 1 J Mol Neurosci (2012) 48:86-96DOI 10.1007/s12031-012-9780-y

Expression of K2P Channels in Sensory andMotor Neurons of the Autonomic NervousSystem

Alba Cadaveira-Mosquera, MontsePérez, Antonio Reboreda, Paula Rivas-Ramírez, Diego Fernández-Fernández &J. Antonio Lamas

1 23

Your article is protected by copyright and

all rights are held exclusively by Springer

Science+Business Media, LLC. This e-offprint

is for personal use only and shall not be self-

archived in electronic repositories. If you

wish to self-archive your work, please use the

accepted author’s version for posting to your

own website or your institution’s repository.

You may further deposit the accepted author’s

version on a funder’s repository at a funder’s

request, provided it is not made publicly

available until 12 months after publication.

Expression of K2P Channels in Sensory and Motor Neuronsof the Autonomic Nervous System

Alba Cadaveira-Mosquera & Montse Pérez &

Antonio Reboreda & Paula Rivas-Ramírez &

Diego Fernández-Fernández & J. Antonio Lamas

Received: 11 January 2012 /Accepted: 11 April 2012 /Published online: 29 April 2012# Springer Science+Business Media, LLC 2012

Abstract Several types of neurons within the central andperipheral somatic nervous system express two-pore-domainpotassium (K2P) channels, providing them with resting po-tassium conductances. We demonstrate that these channels arealso expressed in the autonomic nervous system where theymight be important modulators of neuronal excitability. Weobserved strongmRNA expression ofmembers of the TRESKand TREK subfamilies in both the mouse superior cervicalganglion (mSCG) and the mouse nodose ganglion (mNG).Motor mSCG neurons strongly expressed mRNA transcriptsfor TRESK and TREK-2 subunits, whereas TASK-1 andTASK-2 subunits were only moderately expressed, with onlyfew or very few transcripts for TREK-1 and TRAAK(TRESK ≈ TREK-2 > TASK-2 ≈ TASK-1 > TREK-1 >TRAAK). Similarly, the TRESK and TREK-1 subunits werethe most strongly expressed in sensorial mNG neurons, whileTASK-1 and TASK-2 mRNAs were moderately expressed,and fewer TREK-2 and TRAAK transcripts were detected(TRESK ≈ TREK-1 > TASK-1 ≈ TASK-2 > TREK-2 >TRAAK). Moreover, cell-attached single-channel recordingsshowed a major contribution of TRESK and TREK-1

channels in mNG. As the level of TRESK mRNA expressionwas not statistically different between the ganglia analysed,the distinct expression of TREK-1 and TREK-2 subunits wasthe main difference observed between these structures. Ourresults strongly suggest that TRESK and TREK channels areimportant modulators of the sensorial and motor informationflowing through the autonomic nervous system, probablyexerting a strong influence on vagal reflexes.

Keywords K2P channels . Superior cervical ganglion .

Nodose ganglion . Mouse . Immunocytochemistry . qRT-PCR . Cell-attached patch . Perforated patch

Introduction

Since its discovery (Lesage et al. 1996), the two-pore-domainpotassium (K2P) channels have been shown to be expressedin the central (CNS) and somatic peripheral nervous system(sPNS), as well as in a number of non-neuronal mammaliantissues and organs (Medhurst et al. 2001; Reyes et al. 1998;Talley et al. 2001; Talley et al. 2003). However, the presenceof K2P channels in the autonomic nervous system (ANS) hasreceived little attention, although we recently demonstratedthat TREK-2 channels are functionally expressed in neuronsof the mouse superior cervical ganglion (mSCG: Cadaveira-Mosquera et al. 2011). A single native neuron may expressseveral of the 15 known mammalian K2P subunits, oftenbelonging to more than one of the six K2P subfamilies (Hanet al. 2003; Kang et al. 2004a; Kang and Kim 2006). Ac-cordingly, the three members of the TREK subfamily(TREK-1, TREK-2 and TRAAK) were seen to be expressedby mSCG neurons (Cadaveira-Mosquera et al. 2011). Al-though we demonstrated that activation or inhibition of thesechannels affected the resting membrane potential of these

Alba Cadaveira-Mosquera and Montse Pérez contributed equally tothis work.

A. Cadaveira-Mosquera :M. Pérez :A. Reboreda :P. Rivas-Ramírez :D. Fernández-Fernández : J. A. Lamas (*)Department of Functional Biology, Faculty of Biology,University of Vigo,Campus Lagoas-Marcosende,36310 Vigo, Spaine-mail: antoniolamas@uvigo.es

Present Address:M. PérezCentro Oceanográfico de Vigo, Instituto Español de Oceanografía,Subida a radio faro 50,36390 Vigo, Spain

J Mol Neurosci (2012) 48:86–96DOI 10.1007/s12031-012-9780-y

Author's personal copy

neurons, we could not rule out that other background currentsalso participated in maintaining this potential. Therefore, wehave investigated whether other subunits of the K2P familymay also be expressed by mSCG neurons.

The importance of K2P channels in the excitability ofsomatic sensory system neurons, mainly from the dorsal root(DRG) and trigeminal ganglia, has been clearly demonstrated(Kang and Kim 2006; Maingret et al. 2000; Yamamoto et al.2009). However, there are little data regarding K2P channelexpression in the autonomic nervous system, which led us toextend our study to include mouse nodose ganglion (mNG)neurons. This allowed us to compare the expression of two-pore-domain channels in autonomic motor and sensory neu-rons, both very important for the correct working of the veg-etative nervous system. To the best of our knowledge, the onlydata available regarding the expression of these channels inNG neurons were generated in rat (Zhao et al. 2010).

Hence, we have used reverse transcriptase PCR (RT-PCR),immunocytochemistry and quantitative RT-PCR (qRT-PCR)to determine and quantify the expression of seven K2P chan-nels that belong to four different subfamilies in autonomicmSCG and mNG neurons. Single-channel recording was alsoemployed to determine the functional units present in themembrane of mNG neurons. The high abundance of TRESKand TREK subunits observed in both ganglia are discussedfrom a putatively functional point of view.

Results

Expression of mRNAs Encoding Members of the TASK andTRESK Subfamilies in the mSCG and mNG

We recently reported that the three members of the TREKsubfamily are expressed in the mSCG (Cadaveira-Mosqueraet al. 2011). To determine whether other K2P subfamilieswere present in the mSCG, we assessed the expression ofmRNAs encoding for members of the TASK (TASK-1 andTASK-3) and TRESK subfamilies by RT-PCR. Transcriptsfor each of the three K2P subunits were detected in themSCG, demonstrating the expression of these subunits inthis structure for the first time (Fig. 1a).

The mSCG is an autonomic motor ganglion, and thus, wewondered whether the same K2P subunits might also beexpressed in the autonomic sensory system. Using the sameprotocol, we found that mRNAs for these three subunitswere also expressed in the mNG (Fig. 1b). This is consistentwith data on TASK-1 expression previously reported in ratNG (Zhao et al. 2010).

In these assays, we used the hypothalamus as a positivecontrol because it is known to express TASK-1, TASK-3(Karschin et al. 2001) and TRESK channels (Yoo et al.2009). β-actin expression was used to assess RNA quality

(see Fig. 1), and in the absence of cDNA, no products wereamplified (Fig. 1, last lane of each group). All band sizesmatched those expected (Table 1), and the amplicon sizeswere checked against the published mRNA coding sequence.

As we mentioned before, previous studies in mSCGdemonstrated the presence of mRNA and membrane pro-teins for the TREK subfamily; nevertheless, electrophysio-logical single-channel experiments showed only TREK-2but not TREK-1 nor TRAAK activity (Cadaveira-Mosqueraet al. 2011). These data suggested that the distinct TREKchannels may be expressed at different levels in the mSCG,and thus, we quantified the relative expression of thesechannels (TREK-1, TREK-2 and TRAAK) together withTRESK, TASK-1, TASK-2 and TASK-3 by qRT-PCR.

In order to determine the relative contribution of eachchannel to the mRNA expression pattern of K2P channels inthe two different branches of the autonomic nervous system,we extended this study to mNG, a vagal sensory ganglion.

The relative expressionwas calculated using the cycle thresh-old (ΔΔCt) method, which requires similar amplification effi-ciencies between a housekeeping and the target gene. Theefficiencies calculated were in the range of 95 % to 100 % forGAPDH and all the K2P genes, except TASK-3 (see Table 2).Representation of theΔCt against the log of total cDNA resultedin slopes <0.1 when using GAPDH, indicating that the efficien-cies were equivalent, except for TASK-3 (see Fig. 2d).

Surprisingly, TRESK channel mRNAwas the most stronglyexpressed in both mSCG and mNG neurons (see Fig. 2), andsince the relative expression of this channel was almost identi-cal in both ganglia (p>0.05; see Fig. 2c), we used it as an

Fig. 1 RT-PCR detection of TASK-1, TASK-3 and TRESK mRNA.TASK-1 (696 bp, lanes 2 and 3), TASK-3 (538 bp, lanes 7 and 8) andTRESK (760 bp, lanes 12 and 13) transcripts were detected by RT-PCR in the mRNA isolated from the mouse SCG (a) and NG (b). Thehypothalamus was used as a positive control (lanes H), and β-actinexpression served to assess RNA quality. Negative controls (unlabelledlanes 6, 11, 16 and 19), carried out in the absence of cDNA, did notproduce any visible band. First lane shows the 100-bp ladder

J Mol Neurosci (2012) 48:86–96 87

Author's personal copy

internal calibrator. In the mSCG, the most strongly expressedK2P subunit following TRESK (considered to be 100 %) wasTREK-2 (about 70 %, Fig. 2a), explaining our earlier resultsfrom “cell-attached” single-channel recordings (Cadaveira-Mosquera et al. 2011). Transcripts for TASK-1 and TASK-2represented about 20 % when compared to that of TRESK,while the other two members of the TREK subfamily weremuch less strongly expressed (TREK-1 6 % and TRAAK 2%).

The expression of TASK-3 could not be calculated as theefficiency of amplification was too low and no amplificationwas detected with small quantities of total RNA.

In the mNG, a TREK subfamily subunit, TREK-1 (about70 %), was also the mRNA most strongly expressed afterTRESK (considered 100 %; Fig. 2b). Like mSCG neurons,TASK-1 and TASK-2 were the next most strongly expressedtranscripts (about 30 %), followed by TREK-2 (15 %) andTRAAK (8 %).

To compare the expression of K2P channels between theganglia, we used themost expressed channel (TRESK from themNG) as a calibrator (Fig. 2c). Except TREK-2, all K2Pchannels were more strongly expressed in the mNG than inthe mSCG, and significant differences were detected forTREK-1, TRAAK and TASK-1 (p<0.05), but not for TRESKand TASK-2. TREK-2 was the only subunit more stronglyexpressed in the mSCG (p<0.05). It should be highlighted thatapart from TRESK, transcripts for TREK were the moststrongly expressed K2P subunits in both ganglia. Interestingly,

mSCG mainly expressed TREK-2 mRNA, while the mNGexpressed mainly TREK-1 transcripts. The expression ofTASK-1 and TASK-2 was moderate in both ganglia, whileall other subunits tested showed comparatively weakexpression.

Mouse SCG and NG Neurons Express TASK, TALKand TRESK Proteins

The presence of functional subunits of the TREK subfamilyhas recently been demonstrated in cultured mSCG neurons(Cadaveira-Mosquera et al. 2011). To ensure that mNG TREKsubfamily and TASK, TALK and TRESK mRNAs were alsotranslated into protein, we studied their membrane expressionby immunocytochemistry in cultured mSCG and mNG neu-rons. All the K2P subunits tested: TREK-1 (Fig. 3a), TREK-2(Fig. 3b) and TRAAK (Fig. 3c) in mNG, and TASK-1(Fig. 4a), TASK-3 (Fig. 4b), TRESK (Fig. 4c) and TASK-2(Fig. 4d) in both mSCG (left column) and mNG (right col-umn) neurons, were recognised by immunochemistry (green).In these experiments, the cell nuclei were stained with DAPI(blue), and we often detected that some nuclei were notsurrounded by FITC immunoreactivity. However, when thefluorescence and Nomarski images were combined (as shownin Figs. 3 and 4), we realised that nuclei stained with DAPI butnot surrounded by FITC staining belonged to non-neuronalsatellite glial cells that were frequently wrapped around orclose to motor and sensory ganglion neurons in culture(Konishi 1996; Shoji et al. 2010). This is consistent with thelack of proteins from the TREK subfamily recently reported insatellite cells from the mSCG (Cadaveira-Mosquera et al.2011). These data confirmed those obtained by RT-PCR, andimportantly, they indicate that the origin of the mRNA wasneuronal and not from glial cells.

Single-Channel Recording of Functional K2P Channelsin the Membrane

Perforated patch whole-cell and cell-attached single-channelrecordings were performed in cultured nodose ganglion

Table 1 Primer sequences used to amplify K2P channels and β-actin gene

Gene Reference Ta(°C) Primer sequence 5’' to 3’' Expected size bp

TASK-1 Kang et al. 2004a 53 F:TGTTCTGCATGTTCTACGCG 696Kang et al. 2004a R:TGGAGTACTGCAGCTTCTCG

TASK-3 Kang et al. 2004a 53 F:TGACTACTATAGGGTTCGGCG 538Kang et al. 2004a R:AAGTAGGTGTTCCTCAGCACG

TRESK This work Kang et al. 2006 59 F:ATGTACCCTGTCACCAGGCTC 760R:AAACAAACAGCATGAGGGTTT

β-actin Cadaveira-Mosquera et al. 2011 53 F:TGCCGCATCCTCTTCCTC 655R:CGCCTTCACCGTTCCAGT

Ta: annealing temperature; F: forward; R: reverse

Table 2 Values of slopes, R2 and efficiency for qRT-PCR assays

Name Gene Slope R2 Efficiency (%)

TREK-1 KCNK2 -3.33 ± 0.02 0.999 100

TREK-2 KCNK10 -3.28 ± 0.08 0.997 101

TRAAK KCNK4 -3.38 ± 0.17 0.992 98

TASK-1 KCNK3 -3.14 ± 0.01 0.999 108

TASK-3 KCNK9 -7.00 ± 0.64 0.983 39

TASK-2 KCNK5 -3.41 ± 0.10 0.998 96

TRESK KCNK18 -3.40 ± 0.18 0.992 97

GAPDH GAPDH -3.46 ± 0.11 0.997 95

88 J Mol Neurosci (2012) 48:86–96

Author's personal copy

neurons. Application of riluzole (100 μM), a TREK sub-family agonist, in the bath evoked an outward current in64 % of the cells recorded with an average of 37.98±4.13pA (n023). Prior to riluzole, a cocktail of blocking drugs(TTX 0.5 μM, TEA 15 mM, Cd2+ 100 μM and Cs+ 1 mM)was applied to eliminate the contribution of other Na+, Ca2+

and classical K+ currents (Fig. 5a).Single-channel recordings in cell-attached configuration

with equimolar 150-mM K+ showed the presence of severalfunctional K2P subunits in 33 out of 37 patches (see Table 3).Focusing in the TRESK and TREK subfamilies, we foundmainly TRESK, TREK-1 and TREK-2 single-channelconductances.

Functional TRESK channels show a very weak (inward) ornon-rectifying current–voltage relationship, with conductancevalues measured at -60/+60 mV of 20.15/19.01 pS (Fig. 5c).Moreover, the presence of short openings at negative values isalso shownwith an average duration of 0,193±0,013ms (n07)calculated at -100 mV which greatly differs from long open-ings measured at +100 mV (2,218±0,799 ms, n07). A signif-icant difference in Po is also found between -100 (0,077±0,020) and +100 mV (0,304±0,061).

On the other hand, single-channel recording showed alsotwo isoforms of TREK-1 channels: TREK-1a and TREK-

1b. TREK-1a conductance was 119.06/126.73 pS (-60/+60 mV), which is in the range of the conductance reportedin the literature, and the I-V was non-rectifying (Fig. 5d).Differently, the TREK-1b isoform displays a 56.47/53.80 pSconductance (Fig. 5e). Finally, only 2 out of 32 patchesshowed a typical TREK-2 conductance with an inwardrectification at positive voltages (data not shown). TREK-2conductance levels were 102.88/49.41 pS, similar to thosereported for mouse superior cervical ganglion channels(Cadaveira-Mosquera et al. 2011) and for the 60 KDa iso-form expressed in HeLa cells (Simkin et al 2008). NoTRAAK-like activity was recorded.

Discussion

Our results demonstrate the expression of TRESK, TASK-1,TASK-2 and TASK-3 in mouse sympathetic neurons(mSCG) for the first time, as well as that of TRESK,TREK-1, TREK-2, TRAAK, TASK-1, TASK-2 andTASK-3 in mouse vagal sensory neurons (mNG), and quan-tify the levels of mRNA of all of them but TASK-3. Theyalso corroborate our own earlier data on the expression ofthe TREK subfamily (TREK-1, TREK-2 and TRAAK) in

Fig. 2 Relative expression of K2P channels in the mSCG and mNG. aRelative expression of K2P channels in the mSCG using TRESKmRNA as a calibrator. The expression level was TRESK≈TREK-2>TASK-2≈TASK-1>TREK-1>TRAAK. b Relative expression of K2Pcannels in the mNG using TRESK mRNA as an internal calibrator.Expression levels were TRESK≈TREK-1>TASK-1≈TASK-2>TREK-2>TRAAK. c Comparative distribution of K2P channels in

the mSCG and mNG using the most expressed channel (TRESK inthe mNG) as a calibrator. Except for TREK-2, all K2P channels areexpressed more in the mNG than in the mSCG (*p<0.05). Note thatthe relative expression was expressed in a logarithmic scale to facilitatethe examination. d Absolute slope values for “log total cDNA versusΔCt” were 0.08 for TREK-1, 0.06 for TREK-2, 0.02 for TASK-1, 0.02for TASK-2, 0.03 for TRAAK and 0.03 for TRESK

J Mol Neurosci (2012) 48:86–96 89

Author's personal copy

the mSCG (Cadaveira-Mosquera et al. 2011), and theyconform with previous non-quantitative data on the expres-sion of TREK-1, TRAAK, TASK-1 and TASK-2 in the rNG(Zhao et al. 2010). An important novel observation was thatTRESK mRNAwas the most strongly expressed of the K2Pchannel subunits tested in both ganglia, closely followed bythe TREK channel subunits (TREK-1 in the mNG and

TREK-2 in the mSCG). Both TRESK and TREK-1 are alsothe main functional K2P subunits in cell-attached single-channel recording in mNG. This is consistent with theseTREK and TRESK channels contributing to more than 95 %of the background potassium conductance of rat DRG neu-rons (Kang and Kim 2006).

TRESK Subfamily

TRESK channels were initially reported to be exclusivelyexpressed in the spinal cord of humans (Sano et al. 2003);however, the expression of these channels was later reportedin the brain and other tissues (Czirjak et al. 2004; Dobler et al.2007; Liu et al. 2004). It has been reported that TRESK ismore abundantly expressed than TREK channels in rat DRG

Fig. 3 Detection of TREK-1, TREK-2 and TRAAK proteins usingspecific antibodies. Neurons labelled (green) with antibodies againstTREK-1 (a), TREK-2 (b) and TRAAK (c) in cultures of mNG. Nucleistained with DAPI (blue) but not surrounded by FITC immunolabel-ling belong to satellite glial cells, not immunostained with K2P channelantibodies. The figure shows Nomarski and confocal images super-imposed to display the cell's morphology

Fig. 4 Detection of TASK-1, TASK-3, TRESK and TASK-2 proteinsusing specific antibodies. Neurons labelled (green) with antibodiesagainst TASK-1 (a), TASK-3 (b), TRESK (c) and TASK-2 (d) incultures of mSCG (left column) and mNG (right column). Nucleistained with DAPI (blue) but not surrounded by FITC immunolabel-ling belong to satellite glial cells, not immunostained with K2P channelantibodies. The figure shows Nomarski and confocal images super-imposed to display the cell's morphology

90 J Mol Neurosci (2012) 48:86–96

Author's personal copy

using cell-attached patches (Kang and Kim 2006). Indeed,TRESK is also the most abundant K2P channel in mouse

DRG, showing a higher expression than TREK-1, TASK-1,TRAAK, TASK-2 and TALK-1 (Dobler et al. 2007). These

Fig. 5 Functional K2P channels in mNG neurons. The application ofthe TREK subfamily agonist riluzole (100 μM) in the presence ofTTX, TEA, Cd2+ and Cs+ generates an outward current in mostmNG neurones (a). Summary of the presence of functional single-

channel subunits from TRESK and TREK subfamilies (b). Single-channel recordings and IV plots from TRESK (c), TREK-1a (d) andTREK-1b (e) channels

J Mol Neurosci (2012) 48:86–96 91

Author's personal copy

results are in good agreement with the qRT-PCR data shownhere for autonomic ganglia and could point to TRESK chan-nels as a mark of identity for the peripheral ganglia, irrespec-tive of their motor/sensory or somatic/autonomic nature.

TRESK channel has been reported to show a non- orweakly rectifying single-channel conductance with charac-teristic short openings at negative potentials. The conduc-tance levels reported are 13 pS at positive potentials inXenopus oocytes (Czirják et al., 2004), 14 pS in dorsal rootganglion neurons (Kang and Kim 2006) and 16/13 pS(negative/positive potential) in COS-7 cells Kang et al.(2004b). In our hands, TRESK channels show a slightlyincreased conductance and the same difference in the dura-tion of openings and Po between positive and negativepotentials. Altogether, our data allow us to confirm thepresence of TRESK channels as the main functional K2Pin NG neurons.

TREK Subfamily

Members of the TREK channel subfamily are widely butdifferentially distributed all throughout the CNS. In rodents,TREK-1 mRNA has been reported to be mainly expressed inthe striatum, cerebellum, cortex, hypothalamus and hippo-campus, whereas TREK-2 was mainly found in the cerebel-lum and TRAAK in the cortex (Fink et al. 1996; Lauritzen etal. 2000; Maingret et al. 2000; Talley et al. 2001). Despitesome important disparities, widespread expression has alsobeen found in the human CNS (Medhurst et al. 2001; Talley etal. 2003). It is interesting that while TREK-1 and TREK-2 arealso well expressed in several non-neuronal tissues, TRAAKexpression seems to be mainly restricted to neurons (Fink etal. 1998; Medhurst et al. 2001).

Concerning the TREK subfamily in the PNS, TRAAKhas been reported to be the most strongly expressed subunitin somatic sensory rat and human DRG neurons, followedby TREK-1 and TREK-2 (Medhurst et al. 2001; Talley et al.2001). TRAAK is also expressed in more rat trigeminalganglion neurons than either TREK-2 or TREK-1 (Yama-moto et al. 2009). By contrast, we show here that theexpression in sensory neurons of the mNG is strong forTREK-1 and moderate for TREK-2, and TRAAK is onlyweakly expressed.

Among the K2P family, the members of the TREK sub-family are the most conspicuous according to their high

conductance levels (for a review see Lotshaw 2007). Con-sistent with the qRT-PCR experiments, single-channelrecordings showed a high abundance of TRESK channelactivity followed by two isoforms of TREK-1 (Fig. 5b andTable 3). Because our primers cannot distinguish betweenthese two isoforms, if we pool the data from them forcomparison purposes, we obtain 48.48 % (n016) ofTREK-1 channels in the membrane, a value comparable tothat for TRESK channels. No TRAAK single-channel ac-tivity was recorded.

Our results are consistent with TRAAK mRNA beingexpressed in only 30 % of rat nodose neurons (Zhao et al.2010) and with TRAAK being much weakly expressed thanTREK-1 in mouse DRG (Dobler et al. 2007). Certainly,accumulating evidence indicates a considerable differencein the expression of the TREK subfamily in mouse whencompared to rat and human ganglia.

Also in mSCG neurons, we found the lowest expressionfor TRAAK, but the highest expression was for TREK-2(TREK-2>>TREK-1>TRAAK), answering the pendingquestion of why in our previous study single-channel activ-ity could only be recorded for TREK-2 subunits (Cadaveira-Mosquera et al. 2011). Indeed, TREK-2 was also shown tobe the most abundant TREK channel in rat DRG neuronswhen cell-attached patches were studied (Kang and Kim2006). The reason for the strong difference in the expressionof TREK channels among different peripheral ganglia isunknown, but indicates that general assumptions on expres-sion and probably function of TREK subfamily channels inthe PNS cannot be made.

TASK Channels (TASK and TALK Subfamilies)

In an extensive study, TASK-1 channels were shown to bewidely expressed in human neuronal and non-neuronal tis-sue, while TASK-2 was mainly restricted to non-neuronaltissues, and TASK-3 was strongly expressed in the cerebel-lum alone (Medhurst et al. 2001); nevertheless, otherauthors reported the expression of TASK-3 mRNA at stronglevels throughout the nervous system (Talley et al. 2001).The expression of TASK-1 and TASK-3 has been reportedin rat DRG (Kang and Kim 2006), although human DRGseems to principally express TASK-1 and TASK-2, asTASK-3 expression went virtually undetected (Medhurst etal. 2001). Similarly, TASK-1/2 channels have been reported

Table 3 Summary of single -channel conductance and pro-portion of TRESK and TREKsubunits in mNG

K2P Conductance -60 mV (pS) Conductance +60 mV (pS) Number/(%)

TRESK 20.15 ± 1.18 19.01 ± 1.22 15 (45.45 %)

TREK-1a 119.06 ± 12.72 126.73 ± 8.23 5 (15.15 %)

TREK-1b 56.47 ± 5.22 53.80 ± 4.83 11 (33.33 %)

TREK-2 102.88 ± 6.65 49,41 ± 5.23 2 (6.06 %)

92 J Mol Neurosci (2012) 48:86–96

Author's personal copy

in mouse DRG, although much more weakly than TRESKand TREK-1 channels, and significantly, TASK-3 expres-sion was not detected (Dobler et al. 2007). The moderate(20 % to 30 % of that of TRESK) expression of TASK-1 andTASK-2 in the mSCG and mNG is in accordance withprevious data on DRG. Besides, the data reported in mouseand human DRG indicate that our unusual data on TASK-3could be due to very low mRNA expression rather than atechnical problem. Nevertheless, we did observe TASK-3immunostaining in both mSCG and mNG neurons.

Putative Physiological Impact

Our results revealed that several K2P channels, mainly fromthe TRESK and TREK subfamilies, were expressed in theneurons of sensory and motor autonomic ganglia but not inganglionic satellite cells. No expression of several K2Psubunits in CNS glial cells has been previously reported(Fink et al. 1996; Karschin et al. 2001), suggesting that themajor role of these channels in the nervous system may bethe modulation of neuronal excitability.

In the mNG, TRESK and TREK-1 were more stronglyexpressed than the other K2P channels, as reported in mouseDRG neurons (Dobler et al. 2007). Since NG neurons are alsosensory, we hypothesise that the role of these channels in themNG could be equivalent to that reported for DRG. It is wellknown that TREK and, to a lesser extent, TRESK channelsare sensitive to a plethora of physiological physical and chem-ical stimuli, such as temperature, mechanical deformation,unsaturated fatty acids and pH variations (for a review seeLotshaw 2007). Therefore, these channels are good candidatesfor transducing this kind of information from the organsinnervated by NG neurons, such as the cardiovascular, respi-ratory and gastrointestinal systems. In fact, a very recent studyhas shown TRAAK immunoreactivity in nerve endings ofvagal afferents in lungs (Lembrechts et al. 2011). It is tempt-ing to speculate that K2P channels may also be important inthe functioning of vagal reflexes depending on the sensoryinformation picked up by the NG afferents (Browning andMendelowitz 2003).

Likewise, in the mSCG, TRESK and TREK-2 mRNAswere the most strongly expressed of the K2P channelstested. Activation (using riluzole) and inhibition (usingfluoxetine) of TREK channels modulate the resting mem-brane potential of mSCG neurons (Cadaveira-Mosquera etal. 2011). The inhibition of TREK channels (using fluoxe-tine) also increases the excitability of mSCG neurons byreducing the latency to the first action potential evoked by adepolarizing current step (Cadaveira-Mosquera et al. 2011).Neurons in the mSCG are autonomic motor neurons and notenvironment sensing neurons; however, as post-ganglionicsympathetic neurons, they receive a strong cholinergic inputfrom pre-ganglionic cells. Indeed, the modulation of the

resting membrane potential and excitability by muscarinicagonists has been investigated extensively in SCG cells(Brown et al. 1997; Brown and Constanti 1980; Lamas1999; Lamas et al. 2002; Romero et al. 2004; Suh and Hille2002; Winks et al. 2005; Zhang et al. 2003) and mostlyascribed to the regulation of potassium M-channels(KCNQ). Nonetheless, it should be noted that inhibition ofTREK (Kang et al. 2006) and TASK (Czirjak et al. 2001;Lindner et al. 2011) channels by activating muscarinicreceptors and Gq proteins has also been reported. Interest-ingly, activation (but not inhibition) of TRESK channels bymuscarinic M1 (but not M2) receptors has also been dem-onstrated (Czirjak et al. 2004). We suggest that the increasein excitability induced by muscarinic agonists, which istypical of sympathetic neurons, may be at least partiallydue to the modulation of K2P channels (see Cadaveira-Mosquera et al. 2011). In global terms, muscarinic inhibi-tion of potassium channels (KCNQ, TREK and TASK)would dominate over TRESK channel activation aroundthe resting membrane potential in mSCG neurons.

Experimental Methods

All animal handling and experimental procedures were ap-proved by the Spanish Research Council and the University ofVigo Committee for Animal Experimentation, and they ob-served the Spanish and European directives for the protectionof experimental animals (RD1201/2005; 86/609/EEC).

Immunocytochemistry

The protocol to culture mouse superior cervical ganglion(mSCG) neurons has been described elsewhere (Lamas et al.2009; Martínez-Pinna et al. 2002; Romero et al. 2004), andthe same protocol was used to culture mouse nodose gan-glion (mNG) neurons. Mice (Swiss CD-1), 20 to 60 day old,were deeply anaesthetised with CO2 and then decapitated.The ganglia were extracted under a binocular microscope,cleaned and sliced in cold Leibovitz medium (L-15). Aninitial enzymatic treatment was carried out in collagenase(2.5 mg/ml in Hank's balanced salt solution) for 15 min at37°C, and after rinsing, the ganglia were further digested for30 min in trypsin (1 mg/ml in Hank's solution). Finally,neurons were dispersed by mechanical agitation, centrifugedand seeded on round glass coverslips previously coated withlaminin (10 μg/ml in EBSS). Neurons were cultured for 1 to2 days at 37°C and 5 % CO2 in L-15 medium supplementedwith 24-mM NaHCO3, 10 % foetal calf serum, 2-mML-glutamine, 38-mM D-glucose, 100-UI/ml penicillin, 100-μg/ml streptomycin and 50-ng/ml nerve growth factor.

Cultured cells were fixed with 2 % paraformaldehyde for30 min, washed three times with phosphate buffered saline

J Mol Neurosci (2012) 48:86–96 93

Author's personal copy

(PBS) and permeabilised for 10 min at room temperaturewith 0.2 % Triton X-100 in PBS. The cells were thenincubated for 30 min in blocking solution (10 % donkeyserum in PBS). Immunostaining was performed overnight at4°C with the primary antibodies against TASK-1, TASK-2,TASK-3 and TRESK at a dilution of 1:100. The cells werethen washed three times in PBS (5 min) before the second-ary FITC-conjugated donkey anti-goat IgGs were appliedfor 1 h at room temperature at a dilution of 1:200. Afterthree 5-min rinses with PBS, the nuclei were stained withDAPI for 2 min at a 1:10,000 dilution, the cells were washedagain, and then, they were mounted in ProLong Gold anti-fade reagent (Molecular Probes). Confocal images wereobtained on a Confocal Leica SP5 microscope using LASAF 2.0 software. Negative controls were not exposed to theprimary antibody, and neuronal labelling was not observed.All antibodies were obtained from Santa Cruz Biotechnolo-gy: TASK-1 (sc-32065), TASK-2 (sc-11314), TASK-3 (sc-11322), TRESK (sc-51240), TREK-1 (sc-11556), TREK-2(sc-11560) and TRAAK (sc-11326).

RT-PCR

Total RNA samples were extracted from the mSCG andmNG using the RNeasy Kit (Qiagen) and from the hypo-thalamus using the Trizol method. RNA concentrationswere determined by absorbance at 260 nm. Total RNA wasreverse-transcribed with M-MLV Reverse Transcriptase(Invitrogen), the reaction mix (30 μl) containing 2 μg oftotal RNA, 6 μl of 5× buffer (Invitrogen), 6 μl of 2.5-mMdNTP mix, 200-U M-MLV, 10U of RNaseOUT recombinantribonuclease inhibitor (Invitrogen), RNase-free water and0.57 ng of random primers (Invitrogen). The reaction wasrun at 37°C for 60 min and then at 42°C for 15 min before itwas terminated at 95°C for 5 min. The first strand cDNAwas used as a template for PCR amplification using specificprimer sequences for K2P channels (Table 1). β-actin wasamplified as an endogenous control using primers designedwith the program Primer Premier (Premier Biosoft Interna-tional). Primer specificity was confirmed using theBLASTN analysis software (Altschul et al. 1990) againstthe complete genome of Mus musculus. The PCR reactionmix (50 μl) contained 15 μl of cDNA, 1.5 mM of MgCl2, 10pmol of each primer, 0.2 mM of dNTPs mix, 1.25 U of TaqDNA polymerase (Invitrogen), 5 μL of 10× reaction buffer(Invitrogen) and RNase-free water. PCR conditions were95°C for 5 min; 35 cycles at 95°C for 45 s, a specifictemperature (Ta, see Table 1) for 1 min and 72°C for2 min; and a final extension step at 72°C for 15 min. PCRproducts were separated by electrophoresis in 1 % agarosegel and visualised by ethidium bromide staining. Hypothal-amus tissue was used as a positive control for PCR ampli-fication, and β-actin expression was assessed to check RNA

quality. Negative controls were also performed to excludecontamination.

Quantitative PCR

Total RNA from the mSCG and mNG was isolated using theRNeasy Kit (Qiagen), and all samples were treated withDNase I (Amplification Grade, Invitrogen) at a concentra-tion of 1 U DNase I/μg RNA. The integrity and quantity ofRNA were analysed using Bioanalyzer 2100 (Agilent Tech-nologies) with the RNA 6000 Nano chip Kit (Agilent Tech-nologies). Reverse transcription was performed with 1 μg oftotal RNA using the High Capacity cDNA Reverse Tran-scription Kit (Applied Biosystems) following manufac-turer's instructions.

The expression of TREK-1, TREK-2, TRAAK, TASK-1,TASK-2, TASK-3 and TRESK mRNA was quantified byqPCR using Custom TaqMan Array 96-Well Plates andTaqMan Gene Expression Assays for GAPDH (housekeep-ing gene). Primers and probes were synthesised by AppliedBiosystems as follows: TREK-1: Mm01323942_m1,TREK-2: Mm00504118_m1, TRAAK: Mm00434626_m1,TASK-1: Mm00807036_m1, TASK-2: Mm0048900_m1,TASK-3: Mm02014295_s1, TRESK: Mm01702237_m1and GAPDH: Mm99999915_g1. For each PCR, 25 ng ofcDNA were amplified with the TaqMan Gene ExpressionMaster Mix. The final volume of the reaction was 10 μl, andprimer and final probe concentrations were 900 and 250nM, respectively. Quantitative PCR was carried out on a7900HT Fast Real-Time PCR System (Applied Biosys-tems), and the data were analysed with the SDS 2.4 software(Applied Biosystems). PCR amplification conditions wereone cycle at 50°C for 2 min and 95°C for 10 min, and 40cycles comprising a step at 95°C for 15 s and a second stepat 60°C for 1 min.

The relative expression of target genes was calculated bythe cycle threshold (ΔΔCt) method using the K2P channelwith the highest expression as a calibrator (see Lin et al.2004). Quantification of the target cDNAs in all the sampleswas normalised to GAPDH (Cttarget–CtGAPDH0ΔCt). Therelative target expression was given by the formula: 1/(2-ΔΔCt) where ΔΔCt0ΔCt calibrator - ΔCt target. Each experi-ment was performed in triplicate, and three independentsamples were analysed. Standard curves were generatedfor each TaqMan probe to determine the efficiency of am-plification, and the absolute value of the slope of log ng totalcDNA versus ΔCt was <0.1.

Statistical analyses were performed using the SPSS Sta-tistics 17.0 software. The differences in relative expressionbetween groups were examined using one-way ANOVA,followed by Games–Howell post-hoc test. Averages repre-sent the mean±SEM, and the statistical significance wasaccepted as p<0.05.

94 J Mol Neurosci (2012) 48:86–96

Author's personal copy

Electrophysiological techniques

Whole-cell perforated-patch (amphotericin-B; 50 μg/ml)and cell-attached single-channel techniques were used tocarry out electrophysiological recordings as previously de-scribed (Cadaveira-Mosquera et al. 2011). Briefly, culturedneurons were continuously perfused by gravity (≈ 8 ml/min)at room temperature. Recordings were obtained using anAxopatch 200B amplifier and 4–6-MΩ pipettes for wholecell and 10–12 MΩ for single-channel experiments. Gener-ation of protocols, data storage and analysis were carried outusing pClamp10 and Origin7.5 software. Averaged valueswere given as mean±SEM, and statistical significance wasassessed using the Student's t-test at P<0.05. Bath standardsolution for whole-cell recordings contained (in mM) 140NaCl, 3 KCl, 1 MgCl2, 2 CaCl2, 10 D-glucose and 10HEPES, pH 7.2 adjusted with Tris, and the standard pipettesolution contained (in mM) 90 K-acetate, 20 KCl, 3 MgCl2,1 CaCl2, 3 EGTA, 40 HEPES and ~20 NaOH to give a pHof 7.2.

Pipette and bath solutions for single-channel recordingswere composed of (in mM) 150 KCl, 1 MgCl2, 5 EGTA and10 HEPES, pH 7.2 with KOH.

Acknowledgments This work was supported by grants from theSpanish Government (MICINN BFU2008-02952/BFI and CONSOL-IDER CSD2008-00005), the Galician Government (INBIOMED 2009/063) and the University of Vigo to JAL. SGIker technical and humansupport (UPV/EHU) is gratefully acknowledged. We also thank VanesaDomínguez for her technical assistance.

References

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basiclocal alignment search tool. J Mol Biol 215:403–410

Brown DA, Abogadie FC, Allen TG, Buckley NJ, Caulfield MP,Delmas P, Haley JE, Lamas JA, Selyanko AA (1997) Muscarinicmechanisms in nerve cells. Life Sci 60:1137–1144

Brown DA, Constanti A (1980) Intracellular observations on theeffects of muscarinic agonists on rat sympathetic neurones. Br JPharmacol 70:593–608

Browning KN, Mendelowitz D (2003) Musings on the wanderer:what's new in our understanding of vago-vagal reflexes?: II.Integration of afferent signaling from the viscera by the nodoseganglia. Am J Physiol Gastrointest Liver Physiol 284:G8–G14

Cadaveira-Mosquera A, Ribeiro SJ, Reboreda A, Pérez M, Lamas JA(2011) Activation of TREK currents by the neuroprotective agentriluzole in mouse sympathetic neurons. J Neurosci 31:1375–1385

Czirjak G, Petheo GL, Spat A, Enyedi P (2001) Inhibition of TASK-1potassium channel by phospholipase C. Am J Physiol Cell Phys-iol 281:C700–C708

Czirjak G, Toth ZE, Enyedi P (2004) The two-pore domain K+ chan-nel, TRESK, is activated by the cytoplasmic calcium signalthrough calcineurin. J Biol Chem 279:18550–18558

Dobler T, Springauf A, Tovornik S, Weber M, Schmitt A, Sedlmeier R,Wischmeyer E, Doring F (2007) TRESK two-pore-domain K+

channels constitute a significant component of background

potassium currents in murine dorsal root ganglion neurones. JPhysiol 585:867–879

Fink M, Duprat F, Lesage F, Reyes R, Romey G, Heurteaux C,Lazdunski M (1996) Cloning, functional expression and brainlocalization of a novel unconventional outward rectifier K+ chan-nel. EMBO J 15:6854–6862

FinkM, Lesage F, Duprat F, Heurteaux C, Reyes R, Fosset M, LazdunskiM (1998) A neuronal two P domain K+ channel stimulated byarachidonic acid and polyunsaturated fatty acids. EMBO J17:3297–3308

Han J, Gnatenco C, Sladek CD, Kim D (2003) Background andtandem-pore potassium channels in magnocellular neurosecretorycells of the rat supraoptic nucleus. J Physiol 546:625–639

Kang D, Choe C, Kim D (2004a) Functional expression of TREK-2 ininsulin-secreting MIN6 cells. Biochem Biophys Res Commun323:323–331

Kang D, Mariash E, Kim D (2004b) Functional expression of TRESK-2, a new member of the tandem-pore K+channel family. J BiolChem 279:28063–28070

Kang D, Han J, Kim D (2006) Mechanism of inhibition of TREK-2(K2P10.1) by the Gq-coupled M3 muscarinic receptor. Am. J.Physiol. Cell Physiol 291:C649–C656

Kang D, Kim D (2006) TREK-2 (K2P10.1) and TRESK (K2P18.1) aremajor background K+ channels in dorsal root ganglion neurons.Am J Physiol Cell Physiol 291:C138–C146

Karschin C, Wischmeyer E, Preisig-Muller R, Rajan S, Derst C,Grzeschik KH, Daut J, Karschin A (2001) Expression pattern inbrain of TASK-1, TASK-3, and a tandem pore domain K+ channelsubunit, TASK-5, associated with the central auditory nervoussystem. Mol Cell Neurosci 18:632–648

Konishi T (1996) Developmental and activity-dependent changes inK+ currents in satellite glial cells in mouse superior cervicalganglion. Brain Res 708:7–15

Lamas JA (1999) The role of calcium in M-current inhibition bymuscarinic agonists in rat sympathetic neurons. Neuroreport10:2395–2400

Lamas JA, Reboreda A, Codesido V (2002) Ionic basis of the restingmembrane potential in cultured rat sympathetic neurons. Neuro-report 13:585–591

Lamas JA, Romero M, Reboreda A, Sanchez E, Ribeiro SJ (2009) Ariluzole- and valproate-sensitive persistent sodium current con-tributes to the resting membrane potential and increases the ex-citability of sympathetic neurones. Pflugers Arch -Eur J Physiol458:589–599

Lauritzen I, Blondeau N, Heurteaux C,Widmann C, Romey G, LazdunskiM (2000) Polyunsaturated fatty acids are potent neuroprotectors.EMBO J 19:1784–1793

Lembrechts R, Pintelon I, Schnorbusch K, Timmermans JP, AdriaensenD, Brouns I (2011) Expression of mechanogated two-pore domainpotassium channels in mouse lungs: special reference to mechano-sensory airway receptors. Histochem Cell Biol 136:371–385

Lesage F, Guillemare E, Fink M, Duprat F, Lazdunski M, Romey G,Barhanin J (1996) TWIK-1, a ubiquitous human weakly inwardrectifying K+ channel with a novel structure. EMBO J 15:1004–1011

Lin W, Burks CA, Hansen DR, Kinnamon SC, Gilbertson TA (2004)Taste receptor cells express pH-sensitive leak K+ channels. JNeurophysiol 92:2909–2919

Lindner M, Leitner MG, Halaszovich CR, Hammond GR, Oliver D(2011) Probing the regulation of TASK potassium channels by PI(4,5)P2 with switchable phosphoinositide phosphatases. J Physiol589:3149–3162

Liu C, Au JD, Zou HL, Cotten JF, Yost CS (2004) Potent activation ofthe human tandem pore domain K channel TRESK with clinicalconcentrations of volatile anesthetics. Anesth Analg 99:1715–1722

J Mol Neurosci (2012) 48:86–96 95

Author's personal copy

Lotshaw DP (2007) Biophysical, pharmacological, and functionalcharacteristics of cloned and native mammalian two-pore domainK+ channels. Cell Biochem Biophys 47:209–256

Maingret F, Lauritzen I, Patel AJ, Heurteaux C, Reyes R, Lesage F,Lazdunski M, Honore E (2000) TREK-1 is a heat-activated back-ground K+ channel. EMBO J 19:2483–2491

Martínez-Pinna J, Lamas JA, Gallego R (2002) Calcium current com-ponents in intact and dissociated adult mouse sympathetic neu-rons. Brain Res 951:227–236

Medhurst AD, Rennie G, Chapman CG, Meadows H, Duckworth MD,Kelsell RE, Gloger II, Pangalos MN (2001) Distribution analysisof human two pore domain potassium channels in tissues of thecentral nervous system and periphery. Brain Res Mol Brain Res86:101–114

Reyes R, Duprat F, Lesage F, Fink M, Salinas M, Farman N, LazdunskiM (1998) Cloning and expression of a novel pH-sensitive twopore domain K+ channel from human kidney. J Biol Chem273:30863–30869

Romero M, Reboreda A, Sánchez E, Lamas JA (2004) Newly devel-oped blockers of the M-current do not reduce spike frequencyadaptation in cultured mouse sympathetic neurons. Eur J Neurosci19:2693–2702

Sano Y, Inamura K, Miyake A, Mochizuki S, Kitada C, Yokoi H,Nozawa K, Okada H, Matsushime H, Furuichi K (2003) A noveltwo-pore domain K+ channel, TRESK, is localized in the spinalcord. J Biol Chem 278:27406–27412

Shoji Y, Yamaguchi-Yamada M, Yamamoto Y (2010) Glutamate- andGABA-mediated neuron-satellite cell interaction in nodose gan-glia as revealed by intracellular calcium imaging. Histochem CellBiol 134:13–22

Simkin D, Cavanaugh EJ, Kim D (2008) Control of the single channelconductance of K2P10.1 (TREK-2) by the amino-terminus: roleof alternative translation initiation. J Physiol 586:5651–63.36

Suh BC, Hille B (2002) Recovery from muscarinic modulation of Mcurrent channels requires phosphatidylinositol 4,5-bisphosphatesynthesis. Neuron 35:507–520

Talley EM, Sirois JE, Lei Q, Bayliss DA (2003) Two-pore-domain(KCNK) potassium channels: dynamic roles in neuronal function.Neuroscientist 9:46–56

Talley EM, Solorzano G, Lei Q, Kim D, Bayliss DA (2001) CNSdistribution of members of the two-pore-domain (KCNK) potas-sium channel family. J Neurosci 21:7491–7505

Winks JS, Hughes S, Filippov AK, Tatulian L, Abogadie FC, BrownDA, Marsh SJ (2005) Relationship between membranephosphatidylinositol-4,5-bisphosphate and receptor-mediated in-hibition of native neuronal M channels. J Neurosci 25:3400–3413

Yamamoto Y, Hatakeyama T, Taniguchi K (2009) Immunohistochemicalcolocalization of TREK-1, TREK-2 and TRAAK with TRP chan-nels in the trigeminal ganglion cells. Neurosci Lett 454:129–133

Yoo S, Liu J, Sabbadini M, Au P, Xie GX, Yost CS (2009) Regionalexpression of the anesthetic-activated potassium channel TRESKin the rat nervous system. Neurosci Lett 465:79–84

Zhang H, Craciun LC, Mirshahi T, Rohacs T, Lopes CM, Jin T,Logothetis DE (2003) PIP(2) activates KCNQ channels, and itshydrolysis underlies receptor-mediated inhibition of M currents.Neuron 37:963–975

Zhao H, Sprunger LK, Simasko SM (2010) Expression of transientreceptor potential channels and two-pore potassium channels insubtypes of vagal afferent neurons in rat. Am J Physiol Gastro-intest Liver Physiol 298:G212–G221

96 J Mol Neurosci (2012) 48:86–96

Author's personal copy