B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

ava i l ab l e a t www.sc i enced i r ec t . com

www.e l sev i e r . com/ loca te /b ra i n res

Research Report

Differential expression of synaptic proteins after chronicrestraint stress in rat prefrontal cortex and hippocampus

Heidi Kaastrup Müllera,⁎, Gregers Wegenera, Maurizio Popolib, Betina Elfvinga

aCentre for Psychiatric Research, Aarhus University Hospital, Risskov, DenmarkbCenter of Neuropharmacology—Department of Pharmacological Sciences, Center of Excellence on Neurodegenerative Diseases,University of Milano, Milano, Italy

A R T I C L E I N F O

⁎ Corresponding author. Fax: +45 7789 3549.E-mail address: heidmull@rm.dk (H.K. MüAbbreviations: ANOVA, analysis of varia

aspartate; RT, room-temperature; Real-timeprotein; SNARE, soluble N-ethylmaleimide-s

0006-8993/$ – see front matter © 2011 Elsevidoi:10.1016/j.brainres.2011.02.048

A B S T R A C T

Article history:Accepted 14 February 2011Available online 24 February 2011

Prolonged stress has been associated with altered synaptic plasticity but little is knownabout the molecular components and mechanisms involved in the stress response. In thisstudy, we examined the effect of chronic restraint stress (CRS) on the expression of genesassociated with synaptic vesicle exocytosis in rat prefrontal cortex and hippocampus. Ratswere stressed daily using a 21 day restraint stress paradigm, with durations of half an houror 6 h. RNA and protein were extracted from the same tissue sample and used for real-timequantitative polymerase chain reaction (real-time qPCR) and immunoblotting, respectively.Focusing on the SNARE complex, we investigated the expression of the SNARE corecomponents syntaxin 1A, SNAP-25, and VAMP2 at both transcriptional and protein levels. Inaddition, the expression of 10 SNARE regulatory proteins was investigated at thetranscriptional level. Overall, the prefrontal cortex was more sensitive to CRS comparedto the hippocampus. In prefrontal cortex, CRS induced increased mRNA levels of VAMP2,VAMP1, syntaxin 1A, snapin, synaptotagmins I and III, and synapsins I and II, whereasSNAP-25 was down-regulated after CRS. Immunoblotting demonstrated equivalent changesin protein levels of VAMP2, syntaxin 1A, and SNAP-25. In hippocampus, we found increasedmRNA levels of VAMP2 and SNAP-29 and a decrease in VAMP1 levels. Immunoblottingrevealed decreased VAMP2 protein levels despite increased mRNA levels. Changes in theexpression of synaptic proteins may accompany or contribute to the morphological,functional, and behavioral changes observed in experimental models of stress and mayhave relevance to the pathophysiology of stress-related disorders.

© 2011 Elsevier B.V. All rights reserved.

Keywords:SNARESynapticStressPlasticityHippocampusPrefrontal cortex

1. Introduction

Stress is amajor risk factor for psychiatric disorders. In rodents,chronic stress inducesprofoundbehavioral changesmanifested

ller).nce; CRS, chronic restraqPCR, real-time quantita

ensitive factor attachmen

er B.V. All rights reserved

as depressive/anxiety-like symptomsand learning andmemorydeficits, paralleled by structural and functional alterations inspecific brain regions and disturbed synaptic plasticity such aschanges in the strength or efficacy of synaptic transmission

int stress; ECS, electroconvulsive seizures; NMDA, N-methyl-D-tive polymerase chain reaction; SNAP, synaptosomal-associatedt protein receptor; VAMP, vesicle-associated membrane protein

.

27B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

(Pittenger and Duman, 2008). Synaptic transmission relies onthe coordinated action between SNARE (soluble N-ethylmalei-mide-sensitive factor attachmentprotein receptor) proteinsanda number of regulatory synaptic proteins (Jahn and Scheller,2006; Rizo and Rosenmund, 2008; Südhof, 2004). Exocytosis ofsynaptic vesicles is promoted by the neuronal SNARE complex,in which the membrane-associated SNAP-25 (synaptosomal-associatedprotein 25 kDa) and syntaxin1A interactwithVAMP2(vesicle-associated membrane protein 2) to create a stableternary core complex (Söllner et al., 1993; Südhof and Rothman,2009). The SNARE complex provides a bridge between thesynaptic vesicle and the plasma membrane, driving themembrane fusion required for exocytosis. The SNARE complexis regulated by a number of synaptic vesicle associated proteinssuch as the phosphoproteins synapsin I–III, which tethersynaptic vesicles to the presynaptic cytoskeletal network,controlling the number of vesicles available for release at thenerve terminus (Fdez and Hilfiker, 2006); the Ca2+ bindingsynaptotagmins I–III, which function as calcium sensors in theregulation of neurotransmitter release (Malsam et al., 2008);SNAP-29, a promiscuous syntaxin-binding SNARE protein,which acts as a negativemodulator of neurotransmitter release(Su et al., 2001), and snapin, a SNAP-25 binding protein, whichhas been suggested to modulate synaptic vesicle exocytosis(Ilardi et al., 1999; Tian et al., 2005).

A number of previous studies have demonstrated changesin gene and protein expression of SNAREs and their regulatoryproteins after stress or antidepressant treatment, althoughwith somewhat conflicting results. VAMP2, in particular, hasbeen reported to be targeted by stress and antidepressanttreatments but with no apparent consensus in the direction ofchange in gene or protein expression (Bonanno et al., 2005;Elfving et al., 2008; Gao et al., 2006; Iwamoto et al., 2007;Yamada et al., 2002; Rapp et al., 2004). Synaptophysin, which isgenerally considered a marker of synaptic density, has beenfound to be down-regulated in hippocampus after acute andrepeated restraint stress (Thome et al., 2001; Xu et al., 2004)and up-regulated after chronic antidepressant treatment(Rapp et al., 2004). However, other studies report no changein hippocampal synaptophysin levels after CRS (Gao et al.,2006) or chronic antidepressant treatment (Bonanno et al.,2005). In severe mental disorders, studies of individual SNAREproteins as well as regulatory proteins indicate abnormalitiesin prefrontal cortex and hippocampus in schizophrenia(Davidsson et al., 1999; Honer et al., 1999; Harrison, 1999;Fatemi et al., 2001; Thompson et al., 2003), and in hippocam-pus, frontal cortex, and cingulate cortex, in depression andbipolar disorder (Eastwood and Harrison, 2001; Scarr et al.,2006; Fatemi et al., 2001; Jorgensen and Riederer, 1985; Torreyet al., 2005). These studies suggest that the presynapticorganization and release machinery is targeted by stress andantidepressant treatment and that the changes in levels ofsynaptic components may represent a form of disturbedsynaptic plasticity involved in the pathophysiologies ofmood disorders.

To gain further insights into stress-induced alterations insynaptic plasticity at the level of synaptic vesicle exocytosis,we investigated the gene expression profiles of SNARE andSNARE regulatory proteins after CRS in rat prefrontal cortexand hippocampus. Due to a limited amount of protein lysate,

immunoblotting was restricted to the analysis of the SNAREproteins syntaxin 1A, SNAP-25, and VAMP2.

2. Results

2.1. Gene expression in prefrontal cortex

CRS induced altered transcription levels of all three SNAREcomplex components: VAMP2, syntaxin 1A, and SNAP-25(Fig. 1). The VAMP2 mRNA levels were increased to 283%±61% of control levels after 6 h of daily restraint stress. A trendtoward increased VAMP2mRNA expression was also observedin the group subjected to half an hour of daily restraint stress.A similar pattern was observed for syntaxin 1A with tran-scription levels increasing to 344%±72% of control after 6 h ofdaily restraint stress and a trend toward increased transcrip-tion levels after half an hour of daily restraint stress.Transcription levels of SNAP-25 were reduced to 32%±5%and 42%±6% of control after half an hour and 6 h of CRS,respectively. VAMP1 was the only gene exhibiting an expres-sion profile with a pronounced effect on transcription levelsafter half an hour (338%±42%) but not after 6 h of dailyrestraint stress. In addition, CRS increased the transcriptionlevels of 6 of the remaining 9 genes after 6 h of daily restraintstress; SNAP-29 (237%±47%), synaptotagmin I (366%±75%),synaptotagmin III (321%±58%), synapsin I (233%±39%), synap-sin II (307%±71%), and snapin (303%±60%). Similar tendencieswere observed after half an hour of daily restraint stress butthe differences did not reach statistical significance. Synapto-physinwas unaffected by CRS, and although therewere trendstoward increased transcription levels of synaptotagmin II andsynapsin III after CRS, they did not reach statisticalsignificance.

2.2. Gene expression in hippocampus

In hippocampus, we observed a significant effect on thetranscription levels of VAMP1, VAMP2, and SNAP-29 afterboth half an hour and 6 h of daily restraint stress (Fig. 2).Specifically, VAMP2mRNA levels were increased to 137%±9%and 136%±5% of control, SNAP-29 mRNA levels wereincreased to 133%±6% and 128%±7% of control, and VAMP1mRNA levels were reduced to 83%±2% and 80%±2% ofcontrol after half an hour and 6 h of daily restraint stress,respectively. No significant differences were observed inmRNA levels for the two SNARE proteins syntaxin 1A andSNAP-25; the SNARE regulatory proteins snapin and synap-tophysin; the phosphoproteins synapsins I, II, and III; or theSNARE associated calcium sensor proteins synaptotagmins I,II, and III.

2.3. Protein quantification in prefrontal cortex andhippocampus

In the prefrontal cortex, we found stress-induced changes inprotein expression levels equivalent to the changes in mRNAlevels observed by real-time qPCR analysis (Fig. 3a–d).Specifically, CRS induced increases in VAMP2 protein levelsafter half an hour (169%±13%) and 6 h of daily restraint stress

Fig. 1 – Effect of CRS on the gene expression of synaptic proteins in the prefrontal cortex. Real-time qPCR was used to quantifymRNA expression levels of 13 synaptic proteins in prefrontal cortex. Values for each individual sample were normalized withthe geometric mean of the reference genes Rpl13A and Hmbs. Plotted data show mean group values±SEM and expressed aspercentage of control. (*p<0.05, **p<0.01, ***p<0.001 compared to control and ###p<0.001 between half an hour and 6 h; one-wayANOVA followed by Bonferroni's multiple comparison test).

28 B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

Fig. 2 – Effect of CRS on the gene expression of synaptic proteins in the hippocampus. Real-time qPCRwas used to quantifymRNAexpression levels of 13 synaptic proteins in hippocampus. Values for each individual sample were normalized with thegeometricmean of the reference genes Actb andHmbs. Plotted data showmean group values±SEMand expressed as percentageof control. (*p<0.05, **p<0.01, ***p<0.001 compared to control; one-way ANOVA followed by Bonferroni's multiple comparisontest).

29B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

Fig. 3 – Immunoblot analysis of SNARE protein expression in the prefrontal cortex after CRS. (A) Within each of the threetreatment groups, tissue samples were pooled in three subgroups each consisting of four samples and analyzed byimmunoblotting as described in experimental procedures. Representative immunoblots are shown. (B–D) Graphs represent thestatistical densitometric analysis of immunoblot data from three separate experiments. Protein levels were evaluated bycomparing the mean relative intensities for VAMP2, SNAP-25, and syntaxin 1A immunoreactivity (normalized to thecorresponding GAPDH band) between the control and the two stress groups. Data are expressed as mean percentage±SEM ofcontrol mean values. (***p<0.001 compared to control; one-way ANOVA followed by Bonferroni's multiple comparison test).

30 B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

(205%±6%), and in syntaxin 1A protein levels, after 6 h of dailyrestraint stress (256%±27%). Significant reductions in SNAP-25levels were detected after both half an hour and 6 h of dailyrestraint stress (63%±3% and 67%±5% of control samples,respectively). In hippocampus, as shown in Fig. 4a and b, asignificant decrease in VAMP2 immunoreactivity was ob-served after both half an hour and 6 h of daily restraint stress(60%±4% and 59%±5% of control, respectively), which isopposite to the direction of change in VAMP2 mRNA levelsas determined by real-time qPCR. CRS did not affect proteinexpression levels of syntaxin 1A and SNAP-25 in hippocampus(Fig. 4c and d).

3. Discussion

Themain finding of this study is that CRS predominantly affectsthe expression of synaptic proteins in the prefrontal cortexcompared to the hippocampus, suggesting a fundamental role ofthe prefrontal cortex in response to stress. Most changes in geneexpression were significant only after 6 h and not after half anhourofdaily restraint stress, suggesting that thedurationofdailystress exposure differentially affects the transcriptional activityof synaptic proteins with shorter periods of stress potentially

servinganadaptive functionwhile longerdurationsmayresult inmore profound changes in synaptic structure and/or function.Because only the left brain regionwas used in the present study,the observed changes in gene and protein expression levelsmaybe specific and differ from findings in the right brain-region. Ourdata support previous findings that the prefrontal cortex ismoresensitive to stress at the level of synaptic transmission whencompared to the hippocampus (Moghaddam, 1993; Moghaddam,2002; Musazzi et al., 2010).

3.1. Regulation in the prefrontal cortex

In the prefrontal cortex, CRS increased the transcription levelsof 9 of the 13 synaptic proteins (VAMP2, syntaxin 1A,synaptotagmins I and III, synapsins I–II, snapin, VAMP1, andSNAP-29). Only SNAP-25 transcription levels were reducedafter CRS. Consistent with the real-time qPCR data, immuno-blotting demonstrated an increase in VAMP2 and syntaxin 1Aand a decrease in SNAP-25 protein levels after CRS. Only a fewprevious studies have focused on the expression of synapticproteins in the frontal cortex after stress or antidepressanttreatment. We have previously analyzed the effects ofrepeated electroconvulsive seizures (ECS) on gene expressionlevels of the same subset of synaptic proteins included in the

Fig. 4 – Immunoblot analysis of SNARE protein expression in the hippocampus after CRS. (A)Within each of the three treatmentgroups, hippocampal tissue samples were pooled in three subgroups each consisting of four samples and analyzed byimmunoblotting as described in Experimental procedures. Representative immunoblots are shown. (B–D) Graphs represent thestatistical densitometric analysis of immunoblot data from three separate experiments. Protein levels were evaluated bycomparing the mean relative intensities for VAMP2, SNAP-25, and syntaxin 1A immunoreactivity (normalized to thecorresponding GAPDH band) between the control and the two stress groups. Data are expressed as mean percentage±SEM ofcontrol mean values. (***p<0.001 compared to control; one-way ANOVA followed by Bonferroni's multiple comparison test).

31B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

present study and found only synapsin II to be significantlyup-regulated after repeated ECS in the frontal cortex (Elfvinget al., 2008). In contrast, Yamada et al. (2002) showed increasedVAMP2 protein expression after chronic antidepressant treat-ment and ECS in the rat frontal cortex with no change in theprotein levels of syntaxin 1A and SNAP-25. These studiessuggest that restraint stress and chronic antidepressanttreatment including repeated ECS do not have direct opposingeffects on the expression of synaptic proteins, which may beexplained, in part, by the type of stressor and by the fact thatthe antidepressant treatments were given to non-stressedanimals.

Synaptophysin is a widely used marker of synaptic densityand an increase in synaptophysin is generally correlated withsynaptogenesis (Masliah and Terry, 1993; Eastwood andHarrison, 2001). While synaptophysin levels were unchangedin our study after CRS, the expression of synaptophysin wasreduced after acute and repeated immobilization stress(Thome et al., 2001) and increased after chronic antidepres-sant treatment in the cerebral cortex (Rapp et al., 2004),indicating that synaptophysin is a stress-responsive gene thatmay be implicated in the actions of antidepressants. It is likely

that stress affects the overall expression of synaptophysin inthe cerebral cortex but not in the prefrontal cortex, thusexplaining the difference between our study and the observa-tions reported by Thome et al. (2001).

The increase in levels of synaptotagmin III and synapsin Iafter CRS is complemented by a previous study reportingreduced levels of synaptotagmin III and synapsin I afterchronic antidepressant treatment in the cerebral cortex(Rapp et al., 2004), suggesting a regulatory role of synapto-tagmin III and synapsin I in the effects of stress andantidepressants. Members of the synaptotagmin family actalong with the SNARE complex to enable calcium-regulatedsynaptic vesicle exocytosis. While synaptotagmin III is lesswell-studied, synaptotagmin I is directly linked to the SNAREcomplex and is the onlymolecule besides the SNAREs that hasbeen shown to have a direct effect on the kinetics of exocytosis(Nagy et al., 2006).

3.2. Regulation in the hippocampus

Since stress consistently has been found to induce molecular,functional, and structural changes within the hippocampus

32 B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

(Pittenger and Duman, 2008), it was somewhat intriguing tofind that CRS only had little effect on synaptic proteinexpression in hippocampus compared to the more extensivechanges observed in the prefrontal cortex. In hippocampus,CRS resulted in increased transcription levels of VAMP2 andSNAP-29 and a decrease in VAMP1. Our immunoblot datarevealed a paradoxical discrepancy between the mRNA andprotein levels of VAMP2, with a decrease in VAMP2 proteinlevels despite increased VAMP2 mRNA levels. Our result is incontrast with a thorough histochemical study by Gao et al.(2006), who demonstrate an increase in VAMP immunoreac-tivity after CRS (6 h/day for 21 days) across rat hippocampalsubregions. Gao et al. (2006) used antisera recognizing bothVAMP1 and VAMP2, but since VAMP2 is the most abundantform in the rat brain and especially in most areas of thehippocampal formation (Raptis et al., 2005; Trimble et al.,1990), it seems likely that the observed increase in VAMPimmunoreactivity represents an increase in VAMP2 levels.Correlation analysis in large-scale data sets report only 50%correspondence between mRNA and protein levels (Andersonand Seilhamer, 1997; Pradet-Balade et al., 2001; Tian et al.,2004). While the expression of many genes is controlled at thetranscriptional level, other genes also employ posttranscrip-tional regulation processes involving mRNA stability, transla-tion initiation, and protein stability with no or oppositechanges at the mRNA level (Tian et al., 2004). Since ourVAMP2 antibody specifically and dose-dependently recog-nizes VAMP2 when overexpressed in mammalian cells (datanot shown), our finding is unlikely to be caused by technicalproblems. Rather, the discrepancy between VAMP2 proteinand mRNA expression is most likely a result of posttranscrip-tional regulation of VAMP2. Our results emphasize the need toexercise caution in extrapolating changes in mRNA levels tosimilar changes in protein levels and demonstrate thesignificance of quantifying mRNA and protein levels withinthe same experimental tissue samples.

Similar to our findings, Gao et al. (2006) found no changesin the levels of syntaxin, SNAP-25, synaptophysin, synapto-tagmin, and synapsin in the hippocampus after CRS. Similarly,synaptophysin protein levels were unchanged in the hippo-campus after 6 h of daily restraint stress for 2 weeks (Rosen-brock et al., 2005). However, increased expression ofsynaptotagmin mRNA levels and reduced expression ofsynaptophysin mRNA (Thome et al., 2001) and protein levels(Xu et al., 2004) have been demonstrated in hippocampalsubregions after repeated immobilization stress (1 h/day for5 days and 4 h/day for 3 days, respectively). The apparentdiscrepancy between our study and the findings reported byThome et al. (2001) may be explained by the application ofdifferent stress paradigms, chronic restraint stress versusrepeated immobilization stress. Restraint stress involves aphysical component but acts primarily as a psychologicalstressor through awareness of the inability to escape whereasthe use of immobilization bags may have a greater physicalstress component (McLaughlin et al., 2007), which may resultin reduced synaptic density as indicated by the reduction insynaptophysin levels observed by Thome et al. (2001).

To our knowledge, changes in VAMP1 expression have notpreviously been associated with stress or antidepressanttreatments. VAMP1 is, just like VAMP2, involved in calcium-

dependent synaptic vesicle exocytosis. The fact that VAMP2knockout mice die shortly after birth (Schoch et al., 2001)indicates that VAMP2 cannot be substituted by VAMP1, thussuggesting specialized functions for each isoform in exocytosis.

CRS increased mRNA levels of SNAP-29 which is similar towhat we observed after repeated ECS in our previous study(Elfving et al., 2008). SNAP-29 is amember of the SNAP23/25/29subfamily which has a rather ubiquitous expression patternand binds promiscuously to several syntaxins (Hohensteinand Roche, 2001). SNAP-29 has been suggested to act as anegative modulator of neurotransmitter release, probably byslowing down the recycling of SNARE proteins after synapticexocytosis (Pan et al., 2005; Su et al., 2001).

3.3. Functional significance of changes in synapticprotein levels

Studies examining the effects of stress on the brain havemainly focused on the hippocampus which is the principaltarget site in the brain for stress hormones, having one of thehighest concentrations of receptors for corticosteroids in themammalian brain (de Kloet et al., 1990). In animals, chronicstress such as the 21 day restraint stress paradigm causesshortening and debranching of apical dendrites of pyramidalneurons in the hippocampus (Watanabe et al., 1992; Magar-inos and McEwen, 1995; McLaughlin et al., 2007; Sousa et al.,2000), which is generally accompanied by loss of synapticplasticity and cognitive impairment (Luine et al., 1994;McLaughlin et al., 2007; Hageman et al., 2009; Kim andDiamond, 2002). While synaptic and morphological changeshave been less intensively studied in the prefrontal cortexthan in the hippocampus, it is becoming increasingly clearthat chronic stress produces apical dendritic retraction inpyramidal neurons in the prefrontal cortex, similar to theeffects described in the hippocampus (Cook and Wellman,2004; Radley et al., 2004; Bloss et al., 2010; Brown et al., 2005;Goldwater et al., 2009; Wellman, 2001).

In the prefrontal cortex, we identified a widespread increasein the gene expression of synaptic proteins after CRS. However,an important issue is the extent to which the changes inexpression patterns ofmRNAs reflect corresponding changes intheir cognate proteins. The stress-induced up-regulation inVAMP2 and syntaxin 1A both at mRNA and protein levels islikely to reflect facilitation of neurotransmitter release. Thecontrary finding of reduced levels of SNAP25, which togetherwith syntaxin 1A serves as a receptor for the synaptic vesicle,may not be relevant for exocytotic events. SNAP-25, inparticular, is highly abundant in neurons and not restricted tosynapses (Tao-Cheng et al., 2000; Walch-Solimena et al., 1995)and the decrease in SNAP-25 could therefore easily reflectimpaired functions other than exocytosis. In the hippocampus,we only found few changes in the expression levels of synapticproteins, suggesting that more subtle changes, such as in thekinetics of SNARE complex assembly, may be induced by theCRS in the hippocampus.

CRS (6 h/21 days) has been shown to induce a reorganiza-tion of synaptic vesicles and higher packing density of vesicleswithin hippocampal mossy fiber terminals (Magarinos et al.,1997). Tail pinch, forced swimming, restraint, and foot shockhave been shown to increase glutamate release in the

33B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

prefrontal cortex and hippocampus (Bagley and Moghaddam,1997; Gilad et al., 1990; Lowy et al., 1993; Musazzi et al., 2010;Moghaddam, 1993). Furthermore, increased glutamate releaseimposed by acute foot shock stress is paralleled by accumu-lation of presynaptic SNARE complexes in synaptic mem-branes of the prefrontal/frontal cortex (Musazzi et al., 2010).These studies have led to the hypothesis that increased levelsof glutamate acting via N-methyl-D-aspartate (NMDA) recep-tors is a potential mechanism through which stress causesatrophy of apical dendrites. Our results support the hypoth-esis that stress leads to presynaptic changes and possiblyincreased neurotransmitter release in the prefrontal cortexand hippocampus.

The CRSmodel is a reliable and efficientmethod to producedendritic retraction and spatialmemory deficits but themodelhas low validity as a model of depression compared to otherstress models such as the chronic social stress, chronic mildstress, or the learned helplessness model (Willner andMitchell, 2002; Rygula et al., 2008). This may explain ourfindings that the CRS mainly induced changes in theprefrontal cortex compared to the hippocampus. Chronictreatment with antidepressants has been shown to reduceSNARE protein expression in synaptic membranes fromhippocampus (Bonanno et al., 2005) but not from theprefrontal cortex (Musazzi et al., 2010), suggesting thatchanges in the presynaptic machinery of hippocampalneurons are involved in the therapeutic action of antidepres-sants. Moreover, our previous study showed that repeated ECSinduced profound changes in the expression of synapticproteins in the hippocampus compared to the frontal cortex(Elfving et al., 2008). It will be of interest to test whether stressmodels with higher validity for depression-like behaviorproduce more changes in synaptic protein expression in thehippocampus compared to the CRS model and whether thesechanges can be targeted by antidepressants.

3.4. Summary

CRS mainly affected the gene expression of synaptic proteinsin the prefrontal cortex compared to the hippocampus,suggesting a fundamental role of the prefrontal cortex inresponse to stress. The daily duration of stress exposure wasimportant for determining the extent of changes in synapticprotein expression. Stress-induced changes in synaptic pro-tein expression may, at least in part, be associated withmorphological and functional changes previously observedafter chronic stress andmay represent a form of compromisedsynaptic plasticity involved in the pathophysiology of stress-related disorders. Our results may help to explain some of theneurological and behavioral deficits imposed by stress thatcannot be attributed to the hippocampus.

4. Experimental procedures

4.1. Restraint stress

Male Sprague–Dawley rats (weighing 300–350 g, age 8–9 weeks;Taconic MB, Denmark) were housed in pairs in standard cages(Cage 1291H Eurostandard Type III H, 425×266×185 mm;

Techniplast, Italy) at 22±1 °C and maintained on a 12 h light/dark cycle (lights on at 6:00 a.m.) with food and water freelyavailable. After a 1 week acclimatization period, the animalswere randomly assigned to 1 of 3 groups: control (n=12), halfan hour of CRS (n=12), or 6 h of CRS (n=12). Rats wererestrained for a period of 21 days and experiments wereperformed during the light period of the cycle, beginning at9:00 am. During this period, rats in the control group werehandled once daily. On the day following the last restraint, therats were killed by decapitation and prefrontal cortex (dis-sected 1.5 mm from the anterior pole, corresponding to4.20 mm from Bregma) and hippocampus were dissected onan ice-cold tile, frozen with dry ice powder, and stored at−80 °C. All animal procedures were in accordance withprotocols approved by the Danish National Committee forEthics in Animal Experimentation (2007/561-1378).

4.2. RNA extraction

The Paris™ RNA and protein isolation kit (Ambion, TX, USA)was used to isolate RNA and protein from left prefrontal cortexand left hippocampus. The isolation was processed accordingto the manufacturer's specifications. Briefly, prefrontal cortexand hippocampus (n=12 for each group) were homogenized in8 volumes of ice-cold Cell Disruption Buffer with a mixer-mill(Retsch; twice for 1 min at 30 Hz/s). After homogenization, thefraction to be used for protein quantification was processed asspecified under “immunoblotting” and the fraction to be usedfor RNA isolation was immediately mixed with an equalvolume of 2X Lysis/Binding Solution at room temperature (RT).Subsequently, 1 sample volume of 100% ethanol was added tothe tube andmixed. The samplemixturewas applied to a filtercartridge assembled in a collection tube and centrifuged for1 min at 13,000g. The sample was washed with 700 μl WashSolution 1 and twice with 500 μl Wash Solution 2/3. Eachwashing step was followed by centrifugation (13,000g, 1 min).The RNA was eluted with 2 sequential aliquots (25 μl) of hotElution Solution (~95 °C) followed by centrifugation (13,000g,30 s). RNA quantification and qualification were determinedas described previously (Elfving et al., 2008).

4.3. cDNA synthesis

Before cDNA synthesis, the RNA concentration of the samples(n=36) was adjusted to match the sample with the lowestconcentration. RNA was reversely transcribed using randomprimers and Superscript III Reverse Transcriptase (Invitrogen,CA, USA) following manufacturer's instructions and with RNAconcentrations per reaction of 42 ng/μl for the prefrontalcortex and 19 ng/μl for the hippocampus. The cDNA sampleswere stored undiluted at −80 °C until real-time qPCR analysis.The cDNA samples were diluted 1:30 with DEPC water beforebeing used as a qPCR template.

4.4. Real-time qPCR

Real-time qPCR was carried out on individual samples in 96-wellPCR-plates using theMx3000P (Stratagene, USA) and SYBRGreen.The gene expression of 8 different reference genes (18s rRNA,ActB, CycA, Gapd, Hmbs, Hprt1, Rpl13A, Ywhaz) and 13 genes

Table 1 – Characteristics of gene-specific real-time qPCR primers.

Gene symbol Gene name Accessionno. a

Primer sequence Ampliconsize b

Ct-value c

Reference genes18s rRNA 18s subunit ribosomal RNA M11188 (+) acggaccagagcgaaagcat 310 13 (72)

(−) tgtcaatcctgtccgtgtccActB Beta-actin NM_031144 (+) tgtcaccaactgggacgata 165 21 (72)

(−) ggggtgttgaaggtctcaaaCycA Cyclophilin A XM_345810 (+) agcactggggagaaaggatt 248 23 (67)

(−) agccactcagtcttggcagtGapd Glyceraldehyde-3-phosphate dehydrogenase NM_017008 (+) tcaccaccatggagaaggc 168 18 (69)

(−) gctaagcagttggtggtgcaHmbs Hydroxy-methylbilane synthase NM_013168 (+) tcctggctttaccattggag 176 29 (66)

(−) tgaattccaggtgagggaacHprt1 Hypoxanthine guanine phosphoribosyl transferase 1 NM_012583 (+) gcagactttgctttccttgg 81 24 (72)

(−) cgagaggtccttttcaccagRpl13A Ribosomal protein L13A NM_173340 (+) acaagaaaaagcggatggtg 167 22 (67)

(−) ttccggtaatggatctttgcYwhaz Tyrosine 3-monooxygenase/tryptophan BC094305 (+) ttgagcagaagacggaaggt 136 20 (72)

5-monooxygenase activation protein, zeta (−) gaagcattggggatcaagaa

Target genesSNAP25 Synaptosomal associated protein 25 kDa NM_030991 (+) ctggcatcaggactttggtt 200 22 (63)

(−) attattgccccaggctttttSNAP29 Synaptosomal associated protein 29 kDa NM_053810 (+) acacggagaagatggtggac 219 26 (56)

(−) tggcttggtacttgctttccSnapin NM_001025648 (+) tggatctggacccctatgtt 182 29 (64)

(−) tttgcttggagaaccaggagSynapsin I NM_019133 (+) caccaggatgaagacaagca 184 26 (71)

(−) gtcgttgttgagcaggaggtSynapsin II NM_001034020 (+) catgggtgtttgctcagatg 127 23 (63)

(−) accacgacaggaaacgtaggSynapsin III NM_017109 (+) cacagcaagaatggcagaga 182 31 (42)

(−) ttagtctgtggaccccaaggSynaptophysin NM_012664 (+) cagtgggtctttgccatctt 222 23 (70)

(−) ttcagccgacgaggagtagtSynaptotagmin I NM_001033680 (+) cttctccaagcacgacatca 219 22 (69)

(−) ccacccacatccatcttcttSynaptotagmin II NM_012665 (+) aggtgaaagtgcccatgaac 241 29 (52)

(−) ctcttgccattctgcatcaaSynaptotagmin III NM_019122 (+) ggactccaatgggttctcag 234 28 (63)

(−) agcaggttgtccaaaaccacSyntaxin 1A NM_053788 (+) accgcttcatggatgagttc 155 25 (64)

(−) gagctcctccagttcctcctVAMP1 Vesicle-associated membrane protein 1 NM_013090 (+) gtgctgccaagctaaaaagg 88 25 (69)

(−) actaccacgattgatggcacaVAMP2 Vesicle-associated membrane protein 2 NM_012663 (+) ctgcacctcctccaaatctt 191 22 (67)

(−) cttggctgcacttgtttcaa

a Genbank accession number of cDNA and corresponding gene, available at http://www.ncbi.nlm.nih.gov/.b Amplicon length in base pairs.c Mean Ct-values of analyzed samples from both hippocampus and prefrontal cortex. The numbers of determinations are given in parentheses.

34 B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

(VAMP1, VAMP2, syntaxin 1A, SNAP-25, SNAP-29, snapin, synap-sins I–III, synaptotagmins I–III, synaptophysin) encoding forsynaptic proteins were investigated as previously described(Elfving et al., 2008; Bonefeld et al., 2008) (Table 1). Briefly, eachSYBRGreenreaction (10 μl total volume) contained1×SYBRGreenmaster mix (BIORAD, CA), 0.5 μMprimer pairs, and 3 μl of dilutedcDNA. The thermal conditions for the PCR were 3min at 95 °C toactivate thehot-start iTaqDNApolymerase, followedby 40 cyclescomprised of 10 s denaturation at 95 °C, 30 s annealing at 60 °C,and 60 s extension at 72 °C. Each run was completed by meltingcurve analysis to confirm the amplification specificity andabsence of primer dimers. All samples were run in duplicate

and a standard curve, also performed in duplicate, was generatedon each plate.

4.5. Real-time qPCR data analyses

For data normalization, we firstmeasuredmRNA levels for thereference genes. Stability comparison of the expression of thereference genes was conducted with the NormFinder software(http://www.mdl.dk). Rpl13A and Hmbswere determined to bethe best combination in the prefrontal cortex, whereas Actband Hmbs were determined to be the best combination in thehippocampus. Therefore, values from each individual sample

35B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

were normalized with either the geometric mean of thereference genes Rpl13A and Hmbs or Actb and Hmbs in theprefrontal cortex and hippocampus, respectively. Statisticalanalyses were performed with GraphPad Prism version 5.01for Windows (GraphPad Software, San Diego, CA, USA). Groupmeans were analyzed for statistical significance using one-way ANOVA followed by Bonferroni's multiple comparisontest. P<0.05 was considered statistically significantlydifferent.

4.6. Immunoblotting

In parallel to quantification of mRNA levels, the relativeprotein expression levels of syntaxin 1A, SNAP-25, andVAMP2, within the same experimental tissue samples, wereexamined (blinded to the results of the real-time qPCR) bymeans of immunoblotting. Initial optimization experimentson dilutions of antibody and protein lysateswere performed toensure consistent and sensitive detection of proteins and thatprotein loading was within the linear range of detection (datanot shown). All samples were initially analyzed individually toensure the integrity and quality of each sample (data notshown) before all samples within each of the three treatmentgroups were pooled in three subgroups each consisting of foursamples to allow for simultaneous analysis of relative proteinexpression between control and the two restraint groups.Aliquots of total homogenate from individual animals,obtained using the Paris™ RNA and protein isolation kit(Ambion, TX, USA) were diluted in lysis buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, and 1×proteinase inhibitor cocktail (Roche, Mannheim, Germany)) toa final protein concentration of 2 μg/μl. After 30 min on ice,samples were clarified by centrifugation for 2 min at 12,000g.Aliquots of supernatants were stored at −20 °C until use ormixed with SDS-sample buffer (125 mM Tris–HCl, pH 6.8, 20%glycerol, 4% SDS, 0.02% bromophenol blue, and 125 mMdithiothreitol). Samples were boiled to ensure denaturationof the SNARE complex (Hayashi et al., 1994) and analyzed bySDS–polyacrylamide gel electrophoresis using 10% precastNuPAGE gels (Invitrogen, CA, USA) with a MOPS buffer system.Proteins were transferred onto nitrocellulose membranesusing the iBlot dry blotting system (Invitrogen, CA, USA). Themembranes were blocked with 5% dry milk in TBS-T (50 mMTris–HCl, pH 8.0, 150 mM NaCl, and 0.5% Tween 20) for 1 h atRT and probedwith the primary antibodies: rabbit anti-VAMP2(1:1000), rabbit anti-SNAP-25 (1:1000) (both from SynapticSystem, Göttingen, Germany), mouse anti-syntaxin 1A(1:200) (Sigma, MO, USA), and mouse anti-GAPDH (1:1000)(Abcam, Cambridge, UK) overnight at 4 °C followed byincubation with the appropriate HRP-conjugated secondaryantibody for 2 h at RT: anti-rabbit antibody (1:50,000) or anti-mouse antibody (1:2000) (both obtained from Pierce, IL, USA).Immunoreactive bands were visualized using ECL AdvanceWestern Blotting Detection Reagent (GE Healthcare, UK). Thechemiluminescent signals were captured on a KODAK ImageStation 440 and relative intensities were quantified by theKODAK 1D3.6 Image Analysis Software. All protein bandswerenormalized for GAPDH levels within the same membrane.Group means were analyzed for statistical significance usingone-way ANOVA followed by Bonferroni's multiple compari-

son test. P<0.05 was considered statistically significantlydifferent.

Acknowledgments

We gratefully acknowledge Pia Høgh Plougmann and HeidiJungland for technical assistance. This work was supported byCarlsbergfondet, the DanishMedical Research Council, Augus-tinus Foundation, Aase and Ejnar Danielsens Foundation,Overlæge Dr. Med. Einar Geert-Jørgensen and Hustru EllenGeert-Jørgensens Foundation, Brødrene Hartmann Founda-tion, Direktør Jacob Madsen and Hustru Olga MadsensFoundation, and Ivan Nielsen Foundation.

R E F E R E N C E S

Anderson, L., Seilhamer, J., 1997. A comparison of selected mRNAand protein abundances in human liver. Electrophoresis 18 (3–4),533–537.

Bagley, J., Moghaddam, B., 1997. Temporal dynamics of glutamateefflux in the prefrontal cortex and in the hippocampusfollowing repeated stress: effects of pretreatment with salineor diazepam. Neuroscience 77 (1), 65–73.

Bloss, E.B., Janssen, W.G., McEwen, B.S., Morrison, J.H., 2010.Interactive effects of stress and aging on structural plasticity inthe prefrontal cortex. J. Neurosci. 30 (19), 6726–6731.

Bonanno, G., Giambelli, R., Raiteri, L., Tiraboschi, E., Zappettini, S.,Musazzi, L., Raiteri, M., Racagni, G., Popoli, M., 2005. Chronicantidepressants reduce depolarization-evoked glutamate releaseand protein interactions favoring formation of SNARE complex inhippocampus. J. Neurosci. 25 (13), 3270–3279.

Bonefeld, B.E., Elfving, B., Wegener, G., 2008. Reference genes fornormalization: a study of rat brain tissue. Synapse 62 (4),302–309.

Brown, S.M., Henning, S., Wellman, C.L., 2005. Mild, short-termstress alters dendritic morphology in rat medial prefrontalcortex. Cereb. Cortex 15 (11), 1714–1722.

Cook, S.C., Wellman, C.L., 2004. Chronic stress alters dendriticmorphology in rat medial prefrontal cortex. J. Neurobiol. 60 (2),236–248.

Davidsson, P., Gottfries, J., Bogdanovic, N., Ekman, R., Karlsson, I.,Gottfries, C.G., Blennow, K., 1999. The synaptic-vesicle-specificproteins rab3a and synaptophysin are reduced in thalamusand related cortical brain regions in schizophrenic brains.Schizophr. Res. 40 (1), 23–29.

de Kloet, E.R., Reul, J.M., Sutanto, W., 1990. Corticosteroids and thebrain. J. Steroid Biochem. Mol. Biol. 37 (3), 387–394.

Eastwood, S.L., Harrison, P.J., 2001. Synaptic pathology in theanterior cingulate cortex in schizophrenia andmood disorders.A review and a Western blot study of synaptophysin, GAP-43and the complexins. Brain Res. Bull. 55 (5), 569–578.

Elfving, B., Bonefeld, B.E., Rosenberg, R., Wegener, G., 2008.Differential expression of synaptic vesicle proteins afterrepeated electroconvulsive seizures in rat frontal cortex andhippocampus. Synapse 62 (9), 662–670.

Fatemi, S.H., Earle, J.A., Stary, J.M., Lee, S., Sedgewick, J., 2001.Altered levels of the synaptosomal associated protein SNAP-25in hippocampus of subjects with mood disorders andschizophrenia. NeuroReport 12 (15), 3257–3262.

Fdez, E., Hilfiker, S., 2006. Vesicle pools and synapsins: newinsights into old enigmas. Brain Cell Biol. 35 (2–3), 107–115.

Gao, Y., Bezchlibnyk, Y.B., Sun, X., Wang, J.F., McEwen, B.S., Young,L.T., 2006. Effects of restraint stress on theexpressionof proteins

36 B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

involved in synaptic vesicle exocytosis in the hippocampus.Neuroscience 141 (3), 1139–1148.

Gilad, G.M., Gilad, V.H., Wyatt, R.J., Tizabi, Y., 1990. Region-selectivestress-induced increase of glutamate uptake and release in ratforebrain. Brain Res. 525 (2), 335–338.

Goldwater, D.S., Pavlides, C., Hunter, R.G., Bloss, E.B., Hof, P.R.,McEwen, B.S., Morrison, J.H., 2009. Structural and functionalalterations to rat medial prefrontal cortex following chronicrestraint stress and recovery. Neuroscience 164 (2), 798–808.

Hageman, I., Nielsen,M.,Wortwein,G.,Diemer,N.H., Jorgensen,M.B.,2009. Electroconvulsive stimulations normalizes stress-inducedchanges in the glucocorticoid receptor and behaviour. Behav.Brain Res. 196 (1), 71–77.

Harrison, P.J., 1999. The neuropathology of schizophrenia. Acritical review of the data and their interpretation. Brain 122(Pt 4), 593–624.

Hayashi, T., McMahon, H., Yamasaki, S., Binz, T., Hata, Y., Südhof,T.C., Niemann, H., 1994. Synaptic vesicle membrane fusioncomplex: action of clostridial neurotoxins on assembly. EMBOJ. 13 (21), 5051–5061.

Hohenstein, A.C., Roche, P.A., 2001. SNAP-29 is a promiscuoussyntaxin-bindingSNARE.Biochem.Biophys.Res.Commun.285 (2),167–171.

Honer, W.G., Falkai, P., Chen, C., Arango, V., Mann, J.J., Dwork, A.J.,1999. Synaptic and plasticity-associated proteins in anteriorfrontal cortex in severe mental illness. Neuroscience 91 (4),1247–1255.

Ilardi, J.M., Mochida, S., Sheng, Z.H., 1999. Snapin: aSNARE-associated protein implicated in synaptictransmission. Nat. Neurosci. 2 (2), 119–124.

Iwamoto, Y., Morinobu, S., Takahashi, T., Yamawaki, S., 2007.Single prolonged stress increases contextual freezing and theexpression of glycine transporter 1 and vesicle-associatedmembrane protein 2 mRNA in the hippocampus of rats. Prog.Neuropsychopharmacol. Biol. Psychiatry 31 (3), 642–651.

Jahn, R., Scheller, R.H., 2006. SNAREs—engines for membranefusion. Nat. Rev. Mol. Cell Biol. 7 (9), 631–643.

Jorgensen, O.S., Riederer, P., 1985. Increased synaptic markers inhippocampus of depressed patients. J. Neural Transm. 64 (1),55–66.

Kim, J.J., Diamond, D.M., 2002. The stressed hippocampus,synaptic plasticity and lost memories. Nat. Rev. Neurosci. 3 (6),453–462.

Lowy, M.T., Gault, L., Yamamoto, B.K., 1993. Adrenalectomyattenuates stress-induced elevations in extracellularglutamate concentrations in the hippocampus. J. Neurochem.61 (5), 1957–1960.

Luine, V., Villegas, M., Martinez, C., McEwen, B.S., 1994. Repeatedstress causes reversible impairments of spatial memoryperformance. Brain Res. 639 (1), 167–170.

Magarinos, A.M., McEwen, B.S., 1995. Stress-induced atrophy ofapical dendrites of hippocampal CA3c neurons: comparison ofstressors. Neuroscience 69 (1), 83–88.

Magarinos, A.M., Verdugo, J.M., McEwen, B.S., 1997. Chronic stressalters synaptic terminal structure in hippocampus. Proc. Natl.Acad. Sci. U. S. A 94 (25), 14002–14008.

Malsam, J., Kreye, S., Sollner, T.H., 2008. Membrane fusion: SNAREsand regulation. Cell. Mol. Life Sci. 65 (18), 2814–2832.

Masliah, E., Terry, R., 1993. The role of synaptic proteins in thepathogenesis of disorders of the central nervous system. BrainPathol. 3 (1), 77–85.

McLaughlin, K.J., Gomez, J.L., Baran, S.E., Conrad, C.D., 2007. Theeffects of chronic stress on hippocampal morphology andfunction: an evaluation of chronic restraint paradigms. BrainRes. 1161, 56–64.

Moghaddam, B., 1993. Stress preferentially increases extraneuronallevels of excitatory amino acids in the prefrontal cortex:comparison to hippocampus and basal ganglia. J. Neurochem.60 (5), 1650–1657.

Moghaddam, B., 2002. Stress activation of glutamateneurotransmission in the prefrontal cortex: implications fordopamine-associated psychiatric disorders. Biol. Psychiatry 51(10), 775–787.

Musazzi, L., Milanese, M., Farisello, P., Zappettini, S., Tardito, D.,Barbiero, V.S., Bonifacino, T., Mallei, A., Baldelli, P., Racagni, G.,Raiteri, M., Benfenati, F., Bonanno, G., Popoli, M., 2010. Acutestress increases depolarization-evoked glutamate release inthe rat prefrontal/frontal cortex: the dampening action ofantidepressants. PLoS ONE 5 (1), e8566.

Nagy, G., Kim, J.H., Pang, Z.P., Matti, U., Rettig, J., Südhof, T.C.,Sorensen, J.B., 2006. Different effects on fast exocytosis inducedby synaptotagmin 1 and 2 isoforms and abundance but not byphosphorylation. J. Neurosci. 26 (2), 632–643.

Pan, P.Y., Cai, Q., Lin, L., Lu, P.H., Duan, S., Sheng, Z.H., 2005.SNAP-29-mediated modulation of synaptic transmission incultured hippocampal neurons. J. Biol. Chem. 280 (27),25769–25779.

Pittenger, C., Duman, R.S., 2008. Stress, depression, andneuroplasticity: a convergence of mechanisms.Neuropsychopharmacology 33 (1), 88–109.

Pradet-Balade, B., Boulme, F., Beug,H.,Mullner, E.W., Garcia-Sanz, J.A.,2001. Translation control: bridging the gap between genomics andproteomics? Trends Biochem. Sci. 26 (4), 225–229.

Radley, J.J., Sisti, H.M., Hao, J., Rocher, A.B., McCall, T., Hof, P.R.,McEwen, B.S., Morrison, J.H., 2004. Chronic behavioral stressinduces apical dendritic reorganization in pyramidal neuronsof the medial prefrontal cortex. Neuroscience 125 (1), 1–6.

Rapp, S., Baader, M., Hu, M., Jennen-Steinmetz, C., Henn, F.A., Thome,J., 2004. Differential regulation of synaptic vesicle proteins byantidepressant drugs. Pharmacogenomics J. 4 (2), 110–113.

Raptis, A., Torrejon-Escribano, B., Gomez I, d.A., Blasi, J., 2005.Distribution of synaptobrevin/VAMP 1 and 2 in rat brain.J. Chem. Neuroanat. 30 (4), 201–211.

Rizo, J., Rosenmund, C., 2008. Synaptic vesicle fusion. Nat. Struct.Mol. Biol. 15 (7), 665–674.

Rosenbrock, H., Koros, E., Bloching, A., Podhorna, J., Borsini, F., 2005.Effect of chronic intermittent restraint stress on hippocampalexpression of marker proteins for synaptic plasticity andprogenitor cell proliferation in rats. Brain Res. 1040 (1–2), 55–63.

Rygula, R., Abumaria, N., Havemann-Reinecke, U., Ruther, E.,Hiemke, C., Zernig, G., Fuchs, E., Flugge, G., 2008. Pharmacologicalvalidation of a chronic social stress model of depression in rats:effects of reboxetine, haloperidol and diazepam. Behav.Pharmacol. 19 (3), 183–196.

Scarr, E.,Gray, L., Keriakous,D., Robinson, P.J., Dean,B., 2006. Increasedlevelsof SNAP-25andsynaptophysin in thedorsolateralprefrontalcortex in bipolar I disorder. Bipolar Disord. 8 (2), 133–143.

Schoch, S., Deak, F., Konigstorfer, A., Mozhayeva, M., Sara, Y.,Südhof, T.C., Kavalali, E.T., 2001. SNARE function analyzed insynaptobrevin/VAMP knockout mice. Science 294 (5544),1117–1122.

Söllner, T., Whiteheart, S.W., Brunner, M., Erdjument-Bromage, H.,Geromanos, S., Tempst, P., Rothman, J.E., 1993. SNAP receptorsimplicated in vesicle targeting and fusion. Nature 362 (6418),318–324.

Sousa, N., Lukoyanov, N.V., Madeira, M.D., Almeida, O.F.,Paula-Barbosa, M.M., 2000. Reorganization of the morphology ofhippocampal neurites and synapses after stress-induced damagecorrelates with behavioral improvement. Neuroscience 97 (2),253–266.

Su, Q., Mochida, S., Tian, J.H., Mehta, R., Sheng, Z.H., 2001. SNAP-29: ageneral SNARE protein that inhibits SNARE disassembly and isimplicated in synaptic transmission. Proc. Natl. Acad. Sci. U. S. A98 (24), 14038–14043.

Südhof, T.C., 2004. The synaptic vesicle cycle. Annu. Rev. Neurosci.27, 509–547.

Südhof, T.C., Rothman, J.E., 2009. Membrane fusion: grapplingwithSNARE and SM proteins. Science 323 (5913), 474–477.

37B R A I N R E S E A R C H 1 3 8 5 ( 2 0 1 1 ) 2 6 – 3 7

Tao-Cheng, J.H., Du, J., McBain, C.J., 2000. Snap-25 is polarized toaxons and abundant along the axolemma: an immunogoldstudy of intact neurons. J. Neurocytol. 29 (1), 67–77.

Thome, J., Pesold, B., Baader, M., Hu, M., Gewirtz, J.C., Duman, R.S.,Henn, F.A., 2001. Stress differentially regulates synaptophysinand synaptotagmin expression in hippocampus. Biol.Psychiatry 50 (10), 809–812.

Thompson, P.M., Egbufoama, S., Vawter, M.P., 2003. SNAP-25reduction in the hippocampus of patients with schizophrenia.Prog. Neuropsychopharmacol. Biol. Psychiatry 27 (3), 411–417.

Tian, J.H., Wu, Z.X., Unzicker, M., Lu, L., Cai, Q., Li, C., Schirra, C.,Matti, U., Stevens, D., Deng, C., Rettig, J., Sheng, Z.H., 2005. Therole of snapin in neurosecretion: snapin knock-out miceexhibit impaired calcium-dependent exocytosis of largedense-core vesicles in chromaffin cells. J. Neurosci. 25 (45),10546–10555.

Tian, Q., Stepaniants, S.B., Mao, M.,Weng, L., Feetham,M.C., Doyle,M.J., Yi, E.C., Dai, H., Thorsson, V., Eng, J., Goodlett, D., Berger, J.P.,Gunter,B., Linseley, P.S., Stoughton,R.B.,Aebersold,R.,Collins, S.J.,Hanlon,W.A., Hood, L.E., 2004. Integrated genomic and proteomicanalyses of gene expression in mammalian cells. Mol. Cell.Proteomics 3 (10), 960–969.

Torrey, E.F., Barci, B.M., Webster, M.J., Bartko, J.J., Meador-Woodruff,J.H.,Knable,M.B., 2005.Neurochemicalmarkers for schizophrenia,bipolar disorder, and major depression in postmortem brains.Biol. Psychiatry 57 (3), 252–260.

Trimble, W.S., Gray, T.S., Elferink, L.A., Wilson, M.C., Scheller, R.H.,1990. Distinct patterns of expression of two VAMP genes withinthe rat brain. J. Neurosci. 10 (4), 1380–1387.

Walch-Solimena, C., Blasi, J., Edelmann, L., Chapman, E.R., vonMollard, G.F., Jahn, R., 1995. The t-SNAREs syntaxin 1 andSNAP-25 are present on organelles that participate in synapticvesicle recycling. J. Cell Biol. 128 (4), 637–645.

Watanabe, Y., Gould, E., McEwen, B.S., 1992. Stress inducesatrophy of apical dendrites of hippocampal CA3 pyramidalneurons. Brain Res. 588 (2), 341–345.

Wellman, C.L., 2001. Dendritic reorganization in pyramidalneurons in medial prefrontal cortex after chroniccorticosterone administration. J. Neurobiol. 49 (3), 245–253.

Willner, P., Mitchell, P.J., 2002. Animal models of depression: adiathesis/stress approach. In: D'haenen, H.A.H., den Boer, J.A.,Willner, P. (Eds.), Biological Psychiatry, 2, pp. 703–728. BiologicalPsychiatry Vol.2.

Xu, H., He, J., Richardson, J.S., Li, X.M., 2004. The response ofsynaptophysin and microtubule-associated protein 1 to restraintstress in rat hippocampus and its modulation by venlafaxine.J. Neurochem. 91 (6), 1380–1388.

Yamada, M., Takahashi, K., Tsunoda, M., Nishioka, G., Kudo, K.,Ohata, H., Kamijima, K., Higuchi, T., Momose, K., Yamada, M.,2002. Differential expression of VAMP2/synaptobrevin-2 afterantidepressant and electroconvulsive treatment in rat frontalcortex. Pharmacogenomics J. 2 (6), 377–382.