dietary-induced serum phenolic acids promote bone growth via p38 mapk/β-catenin canonical wnt...

Dietary-Induced Serum Phenolic Acids Promote BoneGrowth via p38 MAPK/b-Catenin Canonical WntSignaling

Jin-Ran Chen,1,2 Oxana P Lazarenko,1,3 Xianli Wu,1,3 Jie Kang,1 Michael L Blackburn,1,3 Kartik Shankar,1,2

Thomas M Badger ,1,2,3 and Martin JJ Ronis1,2,4

1Arkansas Children’s Nutrition Center, University of Arkansas for Medical Sciences, Little Rock, AR, USA2Departments of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, AR, USA3Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock, AR, USA4Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, AR, USA

ABSTRACTDiet and nutritional status are critical factors that influences bone development. In this report we demonstrate that a mixture of phenolic

acids found in the serum of young rats fed blueberries (BB) significantly stimulated osteoblast differentiation, resulting in significantly

increased bone mass. Greater bone formation in BB diet–fed animals was associated with increases in osteoblast progenitors and

osteoblast differentiation and reduced osteoclastogenesis. Blockade of p38 phosphorylation eliminated effects of BB on activation of

Wnt signaling in preosteoblasts. Knocking down b-catenin expression also blocked the ability of serum from BB diet–fed rats to stimulate

osteoblast differentiation in vitro. Based on our in vivo and in vitro data, we propose that the underlying mechanisms of these powerful

bone-promoting effects occur through b-catenin activation and the nuclear accumulation and transactivation of TCF/LEF gene

transcription in bone and in osteoblasts. These results indicate stimulation of molecular events leading to osteoblast differentiation

triggered by P38 MAP kinase (MAPK)/b-catenin canonical Wnt signaling results in significant increases in bone growth in young rats

consuming BB-supplemented diets. Liquid chromatography/mass spectrometry (LC/MS) characterization of the serum after BB feeding

revealed a mixture of simple phenolic acids that may provide a basis for developing a new treatment to increase peak bone mass and

delay degenerative bone disorders such as osteoporosis. � 2010 American Society for Bone and Mineral Research.

KEY WORDS: PHENOLIC ACID; BLUEBERRY; BONE GROWTH; OSTEOBLAST

Introduction

In postnatal life, childhood exposure to environmental factors

(primarily diet) can influence adult susceptibility to chronic

disease. Examples of such dietary factors include the intake of

phytochemicals, saturated fat, calcium, and vitamins. It is

recognized that accumulation of bone mineral during childhood

and adolescence is a major determinant of the risk of

osteoporosis later in life.(1) Although there is a definite genetic

component that influences an individual’s susceptibility to

disease, many of risk factors for osteoporosis are nongenetic in

nature. The optimal early diet composition required to reduce

the frequency of bone fracture later in life remains to be

determined. It appears increasingly likely that as-yet-unidentified

factors found in the daily consumption of fruits or vegetables

may play a role in the building of optimal peak bone mass.(2)

Population-based studies indicate that fruit and vegetable

intake is an independent predictor of bone size in early pubertal

children.(3,4) Edible berries such as blueberries contain com-

pounds such as polyphenols and anthocyanins that are reported

to have antioxidant, antiaging, and anticarcinogenic benefits.(5)

recently, consumption of blueberry (BB)–supplemented diets has

been shown to be anti-inflammatory and to attenuate sex steroid

deficiency–induced bone loss.(6,7) BB appears to have broad

health beneficial effects, for example, also promoting mammary

epithelial differentiation.(8) However, mechanisms underlying

tissue-specific cellular events following BB consumption have

never been examined. Furthermore, the specific bioactive

components appearing in serum after BB feeding remain

unidentified. Digestion of dietary factors in the gastrointestinal

tract is followed by first-pass metabolism during absorption, and

bioactive molecules (ie, proteins, peptides, or phytochemicals)

ORIGINAL ARTICLE JJBMR

Received in original form November 9, 2009; revised form March 25, 2010; accepted May 5, 2010. Published online May 17, 2010.

Address correspondence to: Jin-Ran Chen, PhD, Arkansas Children’s Nutrition Center, Mail Slot 512-20B, 15 Children’s Way, Little Rock, AR 72202, USA.

E-mail: [email protected]

Additional Supporting Information may be found in the online version of this article.

Journal of Bone and Mineral Research, Vol. 25, No. 11, November 2010, pp 2399–2411

DOI: 10.1002/jbmr.137

� 2010 American Society for Bone and Mineral Research

2399

will appear in the circulation. Therefore, testing the effect of

serum from animals fed particular diets on cellular outcomes

should provide initial information for evaluation of a dietary

effect on specific organs.(9,10) In this report we used serum from

rats fed BB-supplemented diets to assess the effects on bone

formation in vitro.

Bone formation depends on the activity and differentiation of

osteoblasts, whereas resorption of preexisting mineralized bone

matrix by osteoclasts is necessary for bone remodeling. In young,

rapidly growing animals, bone formation usually exceeds bone

resorption, resulting in bone accrual. Wnt signaling has been

shown to be critical for normal development, including bone

formation. In the canonical Wnt pathway, Wnt binding to Frizzled

receptors and low-density lipoprotein receptor–related protein 5

or 6 (LRP5/6) activates the cytoplasmic signaling protein

Dishevelled (Dvl) to stabilize cytosolic b-catenin. On entering

the nucleus, b-catenin, in turn, activates transcription of

downstream target genes via lymphoid enhancer-binding factor

1 (LEF1) and T-cell factors (TCF1, -3, and -4).(11) It is becoming

clear that nuclear localization of b-catenin is essential for its

canonical signaling. However, mechanisms controlling this

process are not well understood. A recent report showed that

Rac1 activation may be one of the critical factors to control

nuclear localization of b-catenin.(12) P38 mitogen-activated

protein kinase also may regulate canonical Wnt/b-catenin

signaling.(13) However, whether p38 also contributes to control-

ling b-catenin nuclear translocation, particularly in bone cells,

remains provocative.

Here we report that BB diets stimulate bone formation in

young rats. We show nuclear accumulation of b-catenin and

activation of canonical Wnt signaling in response to feeding a BB-

supplemented diet in vivo and that serum from BB diet–fed rats

stimulate p38 phosphorylation and b-catenin signaling in vitro.

Moreover, we present evidence that polyphenol-derived phenolic

acids in serum from BB diet–fed rats are bioactive, stimulating

osteoblast differentiation through canonical Wnt signaling.

Materials and Methods

Animals and diets

Time-impregnated female Sprague-Dawley rats (n¼ 6; Harlan

Industries, Indianapolis, IN, USA) arrived on gestational day 4 and

were housed individually in an Association for Assessment

and Accreditation of Laboratory Animal Care–approved animal

facility at the Arkansas Children’s Hospital Research Institute with

constant humidity and lights on from 06:00 to 18:00 hours at

228C. All animal procedures were approved by the Institutional

Animal Care and Use Committee at University of Arkansas for

Medical Sciences (UAMS). Pregnant rats were fed AIN-93G diets

(Harlan Teklad, Madison, WI, USA) made with casein as the sole

protein source.(14) Litters from these dams were culled to 5 male

and 5 female pups. Pups on postnatal day 20 were assigned

randomly (10 per group) to AIN-93G diets with or without

BB supplementation. BB diets were made from AIN-93G

semipurified diets supplemented with 10% whole BB powder.

Freeze-dried whole wild BB (Vaccinium angustifolium) powder

(Hi-Actives Wild Blueberry) was kindly provided by VDF/

FutureCeuticals (Momence, IL, USA). The product contains

1.5% anthocyanins. AIN-93G containing 10% freeze-dried BB

powder (10% BB) was made by Harlan Teklad (Madison, WI, USA).

To eliminate caloric density as a confounding variable, all diets

were formulated to be isocaloric and isonitrogenous. Both diets

consisted of 20% casein as the protein source, and the diets

in different groups had the same levels of protein, calories,

vitamins, and minerals. Diet formulation is presented in Table 1.

The diets contained the National Research Council nutrient

recommendations and the same calcium and phosphorus

levels.(15) Amino acids were added to each diet to equalize

the essential amino acids. Animals were weighed every other

day. After 14 and 40 days of ad libitum feeding, the male and

female rats were euthanized, and blood and other tissues were

collected for analysis.

Bone peripheral quantitative computed tomography(pQCT) and histomorphometry

At euthanization, the right rear tibia was removed and frozen in

liquid nitrogen. pQCT scans were performed on individual tibial

bones from each rat using a STRATEC XCT 960M unit (XCT

Research SA, Norland Medical Systems, Fort Atkins, WI, USA) with

software Version 5.4. The details of pQCT scanning have been

described previously.(15)

Several key points are summarized briefly here. The position

for pQCT scanning was defined at a distance from the proximal

tibial growth plate. All analyses were conducted in a blinded

fashion. Five consecutive slices separated by 1mm (1 through 5,

1 being most distal) were scanned for each tibia beginning

immediately below the tibial growth plate. Data from slices 2 and

3 were combined and are presented in Fig. 1. A threshold of

470mg/cm3 was used to distinguish cortical bone and a

threshold of 107mg/cm3 was used to distinguish cancellous

bone throughout the experiment. Tibial bone mineral density

(BMD) was separated into total and trabecular and cortical

compartments, bone mineral content (BMC) was calculated

Table 1. Diet Composition

Control BB

Energy (kcal/g) 3.7 3.7

Ingredient

BB 0 100

Casein 200.0 196.3

L-Cysteine 3.0 3.0

Sucrose 100 100

Maltodextrin 150 150

Corn starch 397.5 310.3

Corn oil 50 49.9

Cellulose 50 49.6

Mineral mix, AIN-93G-MX 35 35

Vitamin mix, AIN-93G-VX 10 10

Choline bitartrate 2.5 2.5

TBHQ 0.01 0.01

Total (g) 1000 1000

Note: Values represent composition of each ingredient in the diet

(g/kg).

2400 Journal of Bone and Mineral Research CHEN ET AL.

automatically, and color images were generated. At euthaniza-

tion, calcein-labeled left rear tibial bones were removed and

fixed, and sequential dehydration was carried out using different

concentrations of alcohol. Proximal tibial bone samples were

embedded, cut, and stained with von Kossa, tetrachrome, and

Masson stains by histology special procedures. For histomor-

phometric analysis, sections were read in a blinded fashion.

Parameters of cancellous and cortical bones in the proximal tibia

and tibial shaft were measured with a digitizing morphometry

system that consists of an epifluorescent microscope (Model BH-

2, Olympus America, Melville, NY, USA), a color video camera, and

a digitizing pad (Numonics 2206; Numonics, Montomerville, PA,

USA) coupled with a computer (Sony Corporation of America,

New York, NY, USA) and a morphometry program (OsteoMetrics,

Inc., Atlanta, GA, USA). Total bone area, total bone surface,

osteoid surface, osteoblast surface, osteoclast surface, eroded

surface, osteoid area, and single- and double-labeled perimeters

were obtained by manual tracing.

Measurement of serum bone turnover markers

The serum bone-formation markers bone-specific alkaline

phosphatase (ALP), osteocalcin (OCN), and insulin-like growth

factor 1 (IGF1) were measured using enzyme immunoassay kits

from Quidel Corporation (San Diego, CA, USA). Based on data

provided by the manufacturer, intra- and interassay coefficients

of variation and sensitivity of the assay are 5.3%, 7.3%, and

0.78 U/L for ALP, 5.0%, 5.5%, and 50.0 ng/mL for OCN, and 4.3%,

8.3%, and 0.026 ng/mL for IGF1, respectively. The serum bone

resorption marker RatLaps ELISA kit was purchased from Nordic

Bioscience Diagnostics A/S (Herlev, Denmark). According to the

manufacturer’s recommendations, 50mL of serum from each

sample was used, and the absorbance at 450 nm with

subtraction at 650 nm was measured. Intra- and interassay

coefficients of variation and sensitivity of the assay are 5.6%,

10.5%, and 2.0 ng/mL.

Real-Time Reverse-Transcription Polymerase ChainReaction

Right tibial bone total RNA and in vitro cultured cell RNA

were extracted using TRI Reagent (MRC, Inc., Cincinnati, OH, USA)

according to the manufacturer’s recommendations, followed by

DNase digestion and column cleanup using Qiagenminicolumns

(Qiagen, Valencia, CA, USA). Reverse transcription was carried out

using an iScript cDNA synthesis kit from Bio-Rad (Hercules, CA,

Fig. 1. Blueberry (BB) diet increases bone formation without affecting normal growth in weaning rats. (A) Scout view of rat left tibia (above, left) and

parameters from pQCT analysis. Five consecutive slices (those closest to the tibial growth plate) from each rat tibia were scanned in a blinded manner.

Pictures under casein (Cas) and BB are representatives of the third-scan slice of tibia from different diet rats, and data were analyzed from slices 3 and 4

(average). Color changes fromwhite to blue, yellow, and red to gray and black represent decreases in bone density. (B) Body weight gains between BB and

Cas groups in both 34- and 61-day-old female rats. (C ) Serum osteocalcin (OCN) and RatLaps measured by ELISA. �p< .05 Cas versus BB, n¼ 9. All data

are expressed as mean� SEM.

EFFECTS OF BLUEBERRY DIET ON BONE Journal of Bone and Mineral Research 2401

USA). Real-time RT-PCR was carried out using SYBR Green and

an ABI 7000 sequence detection system (Applied Biosystems,

Foster City, CA, USA). Primers for all genes used in this report

were designed using Primer Express Software 2.0.0 (Applied

Biosystems) and listed in a Table 2.

Ex vivo osteoblast differentiation and in vitrocell cultures

Bone marrow cells were aspirated and harvested from each

34- and 61-day-old male and female rat femur at the end of

each experiment according to a method described previously

in mice.(16) For quantification of colony-forming unit fibroblasts

(CFU-Fs) and osteoblasts (CFU-OBs), cells were seeded in six-

well cell culture plates at a density of 1.5� 106 and 3� 106 cells

per well, respectively. Cell cultures were maintained in the

presence of MEM (Invitrogen, Calsbad, CA, USA) with 15% fetal

bovine serum (FBS) (Hyclone Laboratories, Logan, UT, USA) and

1mM ascorbyl-2-phosphate (Sigma-Aldrich, St. Louis, MO, USA),

4mM L-glutamine, and 100 U/mL each of penicillin and

streptomycin (Sigma-Aldrich). Cell cultures were stopped on

days 10 and 25, and cells were fixed and stained with alkaline

phosphatase (ALP) and von Kossa for CFU-Fs and CFU-OBs,

respectively. Osteoclastogenesis assay was performed using a

48-well plate with 1� 106 bone marrow cells per well in the

presence of vitamin D3 at a concentration of 10�8 M. TRACPase

staining was used for quantifying osteoclast number in each

well. For in vitro cell culture experiments, calvarial osteoblasts

isolated from neonatal rat calvaria, UMR-106 osteoblast cell line,

and ST2 cells were used and treated with serum from different

diet rats or phenolic acids. Cells were cultured with 7.5% FBS

without osteogenic medium as negative control. The effects of

treatment with 5% FBS plus either 2.5% 0.45-mm-filtered serum

from control or BB diet–fed rats on osteoblasts and their

precursors were compared. ALP staining, ALP measurement,

and cell RNA isolation and real-time RT-PCR were performed as

described earlier.

DNA constructs, luciferase activity assays, transienttransfection, and subcellular localization of b-catenin andsiRNA

b-Catenin–green fluorescent protein (GFP) construct was

generated by inserting a full-length rat b-catenin 2.3-kb PCR

product into a pEGFP-N1 vector (Clontech, Palo Alto, CA, USA).

Briefly, RNA isolated from rat calvarial cells was used for reverse

transcription using an iScript cDNA synthesis kit from Bio-Rad.

High-fidelity PCR amplication (PFX kit from Invitrogen) of b-

catenin was obtained using forward primer 5’-CAGGAGCTCTG-

GACAATGGCTACTCAAGCTGACC-3’ and reverse primer 5’-ACGG-

GATCCAGGTCGGTATCAAACCAGGCCA-3’. PCR products were

digested with SacI and BamHI and inserted into the same sites

in the appropriate pEGFP-N1 vector. TCF/LEF–Firefly luciferase

reporter plasmid (TOPFLASH) and control reporter containing

mutant TCF biding sites (FOPFLASH) were purchased from

Upstate Biotechnology (Billerica, MA, USA). Using 24-well plates,

rat osteoblastic UMR-106 cells (ATCC, Rockville, MD, USA) were

transiently transfected with 0.005mg TOPFLASH or 0.005mg

FOPFLASH plasmid and 0.025mg empty pEGFP-N1 vector.

Constitutively active pRL-CMV Renilla luciferase vector

(0.005mg; Promega, Madison, WI, USA) was used as an internal

control for transfection efficiency. Following transfection, cells

were allowed to grow overnight before being treated with 2.5%

of serum from experimental rats. Then, 24 hours after cell

treatment, Firefly and Renilla luciferase activity was determined

using the Dual Luciferase Assay System according to the

manufacturer’s instructions (Promega). Luciferase activity was

measured on an MLX Microtiter Plate Luminometer (Dynex

Technolnogies, Inc., Chantilly, VA, USA). For the b-catenin nuclear

translocation experiment, full-length wild-type b-catenin-GFP

plasmid along with red fluorescent protein (pDs 1Red-N1,

Clontech) targeted to the nucleus (nRFP)(17) was transiently

transfected into UMR-106 cells in 24-well plates using

Lipofectamine 2000 (Invitrogen). Transfected cells were cultured

for 24 hours. Subsequently, cells were serum-starved by culturing

in the presence of 2% bovine serum albumin for 4 hours and

Table 2. Real-Time RT-PCR Primer Sequences

Gene Forward primer Reverse primer

Rat

ALP TGAATCGGAACAACCTGACTGA TTCCACTAGCAAGAAGAAGCCTTT

OCN AAGCCCAGCGACTCTGAGTCT GCTCCAAGTCCATTGTTGAGGTA

RUNX2 CCGTGGCCTTCAAGGTTGTA ATTTCGTAGCTCGGCAGAGTAGTT

RANKL TGGGCCAAGATCTCTAACATGA TCATGATGCCTGAAGCAAATG

GAPDH TGAGGTGACCGCATCTTCTTG TGGTAACCAGGCGTCCGATA

Mouse

ALP TAACCGCTACCCGGATCCTA TGTCTTGGACAGAGCCATGTG

OCN TTGTGCTGGAGTGGTCTCTATGAC CACCCTCTTCCCACACTGTACA

Axin2 TGGCTTTGACTACGCCCA GGGAGCTGAAGCGCTGG

OPG AGTCCGTGAAGCAGGAGTG CCATCTGGACATTTTTTGCAAA

RUNX2 CGGTCTCCTTCCAGGATGGT GCTTCCGTCAGCGTCAACA

b-Catenin GATATTGACGGGCAGTATGCAA AACTGCGTGGATGGGATCTG

GAPDH GTATGACTCCACTCACGGCAAA GGTCTCGCTCCTGGAAGATG


treated with 2.5% serum from experimental rats for 6 hours. Cells

showing either nuclear or cytoplasmic accumulation of b-catenin

were visualized directly using a fluorescence microscope. SiRNA

b-catenin (sc-44253) was purchased from Santa Cruz (Santa Cruz

BioTechnology, Inc., Santa Cruz, CA, USA), and transfection of

siRNA b-catenin into ST2 cells was carried out using an Amaxa

Cell Line Nucleofector Kit (Amaxa Biosystems, Gaithersburg, MD,

USA).

Western blotting and immunoprecipitation

Right tibial bone tissue proteins for Western immunoblot analysis

were extracted using cell lysis buffer, as described pre-

viously.(18) The cytosolic and nuclear fractions of bone tissues

and cells were prepared according to a procedure provided

by the manufacturer (Pierce Biotechnology, Rockford, IL, USA).

Western blot and immunoprecipitation analyses were per-

formed using standard protocols. Primary and secondary

antibodies for b-catenin, b-actin, Runx2, Msx2, p38, and

ERK1/2 were purchased from Santa Cruz Biotechnology and

Cell Signaling (Danvers, MA, USA). Blots were developed using

chemiluminescence (Pierce Biotechnology) according to the

manufacturer’s recommendations. Quantification of the inten-

sity of the bands in the autoradiograms was performed using a

VersaDoc imaging system (Bio-Rad).

Characterization and quantification of polyphenol-derived phenolic acids using liquid chromatography/mass spectrometry (LC/MS)

Sera from control or 10% BB diet–fed rats were processed

with Sep-Pak C18 SPE (Waters, Pittsburgh, PA, USA) cartridge

as follows: The cartridge was washed with 3mL of methanol,

followed by equilibration with 3mL of 0.2% formic acid aqueous

solution. Serum (500mL) was loaded onto the cartridge. The

cartridge was washed with 3mL of 0.2% formic acid aqueous

solution, and total phenolic acids were recovered with 0.2%

formic acid–methanol solution. The methanol solution was dried

under N2 flow and redissolved in 200mL of 0.2% formic acid–

methanol solution for phenolic acid analysis. Characterization

and quantification of phenolic acids were carried out using an

Agilent 1100 HPLC system (Agilent Technologies, Santa Clara, CA,

USA) coupled with a 4000 Q TRAP mass spectrometer (Applied

Biosystems) according to a method described previously.(19)

Data and statistical analyses

Data were expressed as means� SEM. ANOVA was used

followed by Student-Newman-Keuls post hoc analysis for

multiple pairwise comparisons between treatment groups.

Values were considered statistically significant at p< .05.

Results

High-bone-mass phenotype occurs in response tofeeding a BB diet to weaning rats without affectingnormal growth

To investigate the effects of BB on bone formation, we fed

21-day-old male and female Sprague-Dawley rats with AIN-93G

diets(20) made with or without 10% powdered whole BB for 14 or

34 days. Body growth and skeletal responses were assessed. No

significant differences in body weight gain between groups were

found (Fig. 1B and Supplemental Fig. S1). We found no significant

group differences in uterine weight in females or seminal vesicle

weight in males, suggesting no effects on reproductive function

(data not shown). To assess the bone mass differences between

groups, the left tibia was scanned using pQCT scan immediately

after euthanization, as described previously.(8) In both genders,

weaning rats fed a BB diet until day 34 showed increases in bone

mass, including bone mineral density (BMD) and bone mineral

content (BMC) (p< .05; Fig. 1A). Both total BMD and trabecular

BMD were increased approximately 30%. Although bone in

34-day-old rats has not completely mineralized (based on our

pQCT measurement), cortical BMD and BMC also increased by

10% in BB diet–fed animals compared with controls (p< .05;

Fig. 1A). At age 61 days, an age at which rats reach relative

maturity, the increases in total and trabecular BMD produced by

BB feeding were similar to those at age 34 days (p< .05).

Interestingly, there were no differences in cortical BMD at this

age (Fig. 1A). To examine whether bone turnover markers in

serum reflect the increased bone mass observed in BB diet–fed

animals, we measured the bone-formation markers bone-

specific ALP and OCN and the bone-resorption marker

procollagen cross-links (RatLaps) in serum. We found that

OCN (Fig. 1C) and ALP (Supplemental Fig. S1) were both

significantly higher in BB diet–fed animals than in control

animals at age 34 days. However, there was no difference in the

bone-resorption marker RatLaps (Fig. 1C). In contrast, when diets

were fed continuously until age 61 days, the bone-resorption

marker RatLaps was lower in BB diet–fed animals, whereas the

increased bone-formation markers observed at age 31 days were

sustained (p< .05; Fig. 1C and Supplemental Fig. S1), implying

that osteoclast activity and differentiation were affected in part

by continuously increased osteoblastogenesis. Interestingly,

there were no group differences in IGF1 levels at either 34 or

61 days (Supplemental Fig. S1), indicating that a key endocrine

system effect on bone growth was not altered by BB diets.

Uncoupling the effects of the BB diet onosteoblastogenesis and osteoclastogenesis

To determine whether a BB diet has a role in controlling

physiologic status at the cellular level in the skeleton, we

analyzed bones histomorphometrically at 34 and 61 days of age

from male and female rats. No evident of abnormality was

observed in the gross development of the skeleton in either

group. Long bone sections indicated that the growth plates were

not altered significantly. BB diet–fed female rats had a 30%

increase and BB diet–fed male rats had a 50% increase in

trabecular bone volume compared with control animals at

34 days of age (p< .05; Fig. 2A). The increase in trabecular bone

volume also was 50% in both sexes at 61 days of age (p< .05;

Fig. 2A). Increases in trabecular number followed similar patterns

to those of bone volume. Consumption of a BB-supplemented

diet was associated with increased osteoblast number, increased

bone-formation rate (BFR), and increased mineral apposition

rate (p< .05; Fig. 2A). rats fed a BB-supplemented diet also had


a decrease in osteoclast number at 61 days of age (p< .05;

Fig. 2A). This is consistent with the bone-resorption marker

data in Fig. 1C. These changes are indications of uncoupled

bone formation after consumption of BB diets and are clearly

distinct from the effects of antiremodeling agents such as

estrogens.(9)

In an effort to decipher the cellular mechanism leading to the

increase in bone mass observed in BB diet–fed rats compared

with controls, we examined whether the bone marrow

contained the same number of osteoprogenitor cells. No

significant group differences in total bone marrow cells per

femur were found (data not shown). Bone marrow cells from

34-day-old rats were plated in a six-well plate to assess

osteoblastogenesis. The ALP-staining colony-forming units

(CFU-Fs) and von Kossa–staining colony-forming units (CFU-

OBs) both were increased in BB diet–fed rats compared with

control rats of both genders (Fig. 2B, C), suggesting that the

BB diet significantly altered the differentiation potential of

mesenchymal cells into osteoblasts. When bone marrow cells

were cultured in a 48-well plate in the presence of 10�8 M 1,25-

dihydroxyvitamin D3 [1,25(OH)2D3] for 10 days, which is known

to induce osteoclast formation in this culture system,(21) the

number of TRACPþ osteoclast-like cells also was lower in rats

fed the BB diet compared with cultures from control animals at

Fig. 2. (A) Static and dynamic histomorphometric parameters from either BB or casein (Cas) diet–fed 34- and 61-day-old female and male rats. Pictures

under Cas and BB are representatives of histomorphometric Masson staining from different diet rat proximal tibia, and blue color indicates bone. Pictures

under Masson staining pictures are representative of tibial bone calcein double labeling from different diet rats; the farther the distance between the two

green lines, the faster is the bone growth rate. Numbers are from histomorphometric reading (see details under ‘‘Materials and Methods’’). (B) Ex vivo

osteoblastogenesis assay for colony-forming unit fibroblasts (CFU-Fs) and osteoblasts (CFU-OBs) from bonemarrow cells. Bone marrow cells were isolated

from the femur of each rat and cultured in the presence of osteogenic medium for 12 and 24 days with densities of 1� 106 and 2.5� 106 cells per well in

six-well plates for CFU-Fs and CFU-OBs, respectively. (C ) Representatives of pictures of ALP and von Kossa staining for CFU-Fs and CFU-OBs in ex vivo bone

marrow cell cultures from Cas- and BB-fed rats. (D) Ex vivo osteoclastogenesis assay from bone marrow cells. Here, 1.0� 106 bone marrow cells per

well were cultured in 24-well plates for 13 days in the presence of osteoclastogenic medium. TRACPase-stained multinuclear giant cells were counted.

Data are mean� SEM. �p< .05, n¼ 9/group.


34 and 61 days of age (p< .05), implying impaired osteoclas-

togenesis (Supplemental Fig. S2).

P38 MAP kinase (MAPK)/Runx2/b-catenin-mediatedbone-forming effects of BB diets

The effects of the BB diet on the bone marrow b-catenin

pathway, a potent osteoblast differentiation signal, were

examined. Osteoblast differentiation–associated p38 MAPK

and osteoblast-specific transcription factors such as Runx2

andMsx2 also were explored. Total protein was isolated from the

femur following bone marrow aspiration. Nuclear and cytoplas-

mic protein extracts were separated and prepared. Western blot

analyses were performed for b-catenin in the total-protein

fraction and in cytosolic versus nuclear fractions of bone tissue.

The BB diet increased b-catenin expression (p< .05; Fig. 3A). This

was associated with accumulation of b-catenin in both the

nucleus and cytoplasm (Fig. 3A). The expression of Runx2, a

transcription factor that is absolutely required for osteoblast

differentiation, also was increased in rats fed the BB diet

compared with control rats (p< .05; Fig. 3A). On the other hand,

the expression of Msx2, a homeobox transcription factor that is

also thought to regulate osteoblast differentiation, was not

changed significantly by BB feeding (Fig. 3A). Since p38 MAPK

has been implicated in activation of canonic Wnt/b-catenin

signaling,(13) the phosphorylation status of p38 was studied. P38

was significantly more phosphorylated in the bone from BB diet–

fed rats compared with control rats (Fig. 3A). However, another

MAP kinase, ERK, showed no difference in its phosphorylation

status, indicating that it was not involved in BB-induced

osteoblast differentiation (Fig. 3A). These results suggest that

the signaling cascade associated with BB diet effects on bone

formation in vivo may be through phosphorylation of p38 MAPK,

leading to activation of Wnt/b-catenin and transcription of

Runx2 and resulting in stimulation of osteoblast differentiation.

To further confirm this, we used total RNA isolated from the

femur to examine the gene expression of commonly known

osteoblast makers ALP, OCN, and Runx2. Consistent with

previously measured bone-formation markers in serum, the

mRNA levels of ALP, OCN, and Runx2 all were significantly higher

in BB diet–fed rats (Fig. 3B). These results reflect the high-bone-

mass phenotype in these animals. Interestingly, the expression of

RANKL mRNA, an osteoclast differentiation marker, was found to

be lower in BB diet–fed female rats (p< .05; Fig. 3B), indicating

Fig. 3. (A) Western blot analysis of b-catenin (nuclear versus cytosolic fraction), Runx2, and Msx2 and status of phosphorylation of p38 and ERK. Proteins

were isolated from rat femur after aspiration of bone marrow cells. Western blots were repeated at least twice, and four animals per group are presented.

Data with densitometry and statistics are presented in Supplemental Fig. S4. (B) Real-time PCR for ALP, OCN, Runx2, and RANKL. Total RNA was isolated

from the femur of each rat with different diets. mRNA expression of each gene was normalized by housekeeping GAPDH mRNA. Data are mean� SEM.�p< .05, n¼ 9/group.


that BB diets also may impair osteoclast differentiation in vivo.

Similar results were obtained in male rats (Supplemental Fig. S3).

Serum from BB diet–fed rats induces osteoblastdifferentiation through p38/b-catenin signaling in vitro

We hypothesized that a bioactive compound derived from BB

diets appears in the peripheral circulation following digestion.

Thus serum from BB diet–fed rats was used to treat osteoblast

progenitor cells in vitro. First, ST2 cells, a well-known murine

bone marrow–derived stromal cell line that undergoes robust

osteoblastogenesis in response to Wnt,(22) were treated for

10 days with 7.5% FBS plus 2.5% serum either from control or BB

diet–fed rats. Serum treatment from both male and female BB

diet–fed rats increased osteoblast differentiation, as assessed by

an increase in ALP staining (p< .05; Fig. 4A). Additionally, total

RNA was isolated from ST2 cells treated with 2.5% BB or control

diet rat serum for 3 days. Serum from BB diet–fed rats not only

stimulated ALP and OCN osteoblast gene expression but also

upregulated mRNA expression of axin2 and osteoprotegerin

(OPG) (p< .05; Fig. 4B), two known target genes of the canonical

Wnt signaling pathway.(23) In vivo data suggested that BB

feeding activates Wnt signaling by actions upstream of b-catenin

(Fig. 3A). In agreement with this hypothesis, treatment of

ST2 cells with BB rat serum resulted in an increase in the

phosphorylation of glycogen synthase kinase 3b (GSK-3b) at

30minutes and 2 and 24 hours compared with cells treated

with control rat serum (Fig. 4C). Treatment with BB rat serum

activated b-catenin, and this was associated with accumulation

of b-catenin in the nucleus at 2 and 24 hours (Fig. 4C). In addition

to activation of b-catenin, there also was an increase in the

phosphorylation of p38 at 30minutes and 2 hours after

treatment of ST2 cells with BB rat serum (p< .05; Fig. 4C).

Furthermore, immunoprecipitation with an anti-b-catenin anti-

Fig. 4. (A) A 10-day culture of ST2 cells with 2.5% serum either from casein (Cas) or blueberry (BB) diet–fed 61-day-old male and female rats. ALP

staining –: cell cultured with 10% FBS as negative control.þ: cell culturedwith osteogenicmedium as positive control. (B) ST2 cells treatedwith 2.5% serum

from either Cas or BB diet–fed rats for 3 days; real-time PCR for ALP, OCN, axin2, and OPG gene expression are showed. Data are mean� SEM. �p< .05,

n¼ 3/group. (C ) Western blots for b-catenin (nuclear versus cytosolic fraction), phosphorylation of GSK-3b and p38 following treatment of ST2 cells with

serum from BB or Cas diet–fed rats for 30minutes and 2 and 24 hours. Western blots were repeated at least twice, and bands are representatives from

each duplicated treatments; bands in each row are from the same gel. Data with densitometry and statistics are presented in Supplemental Fig. S4.

(D) Coimmunoprecipitation of endogenous b-catenin and phosphorylated p38 in ST2 cells following 6 and 24 hours of treatment with serum from BB or

Cas diet–fed rats. Cell lysates from each treatment were first immunoprecipitated overnight by ab-catenin antibody; thenWestern blottingwas performed

using phospho-p38 antibody. (E ) The b-catenin gene was silenced using commercially available siRNA b-catenin in ST2 cells for 24 hours. After with or

without siRNA b-catrenin of ST2 cells for 24 hours, cells were treated with 2.5% serum from either Cas or BB diet–fed animals for an additional 24 hours.

Total RNA was isolated from cells, and real-time PCR was performed for ALP gene expression. Data are mean� SEM. �p< .05 versus control treatment by

t test with triplicates.


body and immunoblotting with an anti-phospho-p38 antibody

demonstrated that there is an association of phospho-p38 with

b-catenin, and BB rat serum treatment increased this phospho-

p38 and b-catenin complex (Fig. 4D). To directly determine

whether Wnt/b-catenin is involved in BB diet–induced osteo-

blastogenesis, we used electroporation to silence the b-catenin

gene in ST2 cells (Fig. 4E). We treated those b-catenin-silenced

cells with 2.5% serum from BB diet–fed rats. We found that serum

from BB diet–fed rats was no longer able to stimulate osteoblast

differentiation, which was evaluated by measurement of ALP

gene expression (Fig. 4E). These data indicate that serum from BB

diet–fed rats activates Wnt signaling, leading to osteoblast

differentiation ex vivo and that the machinery may be upstream

of b-catenin via activation of phosphorylation cascades involving

p38 MAPK and GSK-3b.

Phosphorylation of p38 is critical for b-catenin nuclearlocalization in osteoblasts

Although nuclear localization of b-catenin in response to Wnt is

essential for canonical signaling, mechanisms controlling this

process are not well understood. Whether Wnt components

interact with the MAPK family of proteins other than JNK remains

unknown.(12) It is also established that b-catenin/TCF-mediated

transcription is an essential requirement for promotion of

osteoblast differentiation by Wnt. To determine if BB diet–

induced p38 phosphorylation is critical for controlling b-catenin

nuclear translocation, we first generated a rat-origin full-length

wild-type b-catenin–GFP construct. We then used this plasmid to

transfect rat osteoblast-like UMR-106 cells. BB diet–fed rat serum

triggered more b-catenin nuclear translocation than serum from

control rats (Fig. 5A). UMR-106 cells also were transfected with

TOPFLASH TCF/LEF reporter plasmid. Treatment of transfected

cells with BB diet–fed rat serum stimulated TOPFLASH reporter

gene transcription compared with cells treated with serum from

control rats (Fig. 5C). Pretreatment of ST2 cells with p38 MAPK-

specific inhibitor SB 239063 decreased phosphorylation of GSK-

3b as well as p38 and blunted the activation of b-catenin (both

nuclear and cytosolic) induced by BB diet–fed rat serum (Fig. 6B).

BB diet–fed rat serum–induced b-catenin nuclear translocation

also was blocked in the presence of SB 239063 (Fig. 6A).

Furthermore, pretreatment of cells with SB 239063 inhibited

stimulation of TOPFLASH reporter gene transcription in osteo-

blasts in a dose-dependent manner (Fig. 6C). Thus activation of a

p38 MAPK/GSK-3b/b-catenin cascade appears responsible for BB

diet–induced canonical Wnt signaling in bone.

Polyphenol-derived phenolic acids in BB diet–fed ratserum stimulate osteoblast differentiation in vitro

To substantiate that the effect of a BB diet on bone formation is

due to bioactive components derived from BB appearing in the

circulation, we characterized and identified polyphenol-derived

phenolic acids in serum from rats fed either BB or casein control

diets using LC/MS (Fig. 7A). We found seven phenolic acids that

had a 6 to 10 times higher concentration in their free forms

associated with feeding the BB diet compared with control diet

(Fig. 7B). ST2 cells were treated with an artificial mixture of these

phenolic acids at concentrations equal to their appearance in BB

diet–fed rat serum. Both ALP and OCN gene expression were

significantly upregulated compared with cells treated with a

mixture containing the same phenolic acids at concentrations

equal to their appearance in control diet rat serum (p< .05;

Fig. 7C). Runx2 and b-catenin mRNA also were significantly

Fig. 5. (A) Osteoblastic UMR-106 cells were cotransfected with full-length b-catenin–GFP together with nuclear-targeted red fluorescent protein (nRFP).

Transfected cells were treated with control medium (2.5% FBS) or 2.5% serum from BB or Cas diet–fed rats for 4 hours. BB diet–fed rat serum–triggered b-

catenin (white arrows) nuclear translocationwas visualized under an immunofluorescencemicroscopy. (B) Percentage of cells with nuclear accumulation of

b-catenin expressed relative to the total number of transfected cells in each well was determined under a fluorescent microscopy. Data are mean� SEM of

triplicate determinations. �p< .05 versus control by t test. (C ) TCF/LEF-dependent transcription of a luciferase reporter gene (TOPFLASH) in UMR-106

osteoblastic cells compared with cells treated with serum from Cas diet–fed rats. Luciferase activity was measured after 24-hour treatment of triplicates.�p< .05 BB versus Cas. #p< .05 for negative versus positive control.


upregulated by the mixture (Fig. 7C), and osteoblastic cell

differentiation was stimulated in cultures of ST2 and neonatal rat

calvarial cells (p< .05; Fig. 7D). These results suggest, at least in

part, that the high bone mass observed in BB diet–fed rats may

be due to a high serum concentration of phenolic acids. These

phenolic acids are derived from polyphenol components of the

BB diet on metabolism by gut bacteria or during first-pass

metabolism in the intestinal mucosa or liver. To further examine

whether Wnt/b-catenin signaling is involved in the stimulation of

osteoblastic cell differentiation induced by phenolic acids, cell

proteins were isolated. As shown in the Western blot results in

Fig. 7E, the mixture of phenolic acids stimulated b-catenin

protein expression. Consistent with earlier in vivo and in vitro

results, increased nuclear fraction of b-catenin may associate

with early time points of p38 MAPK phosphorylation in

preosteoblasts (Fig. 7E).

Overall, the in vivo evidence, together with the ex vivo and in

vitro data, argues for a critical role of phenolic acids derived from

BB diet in p38 MAPK-mediated canonical Wnt signaling leading

to osteoblast differentiation and therefore bone formation.

Discussion

The results presented in this article have uncovered a novel

action of a BB diet and BB-derived phenolic acids on bone

formation. It is known that bone formation during childhood and

adolescence is critical, and nearly half of peak bone mass is

acquired during these years.(24) Theoretically, less bone mass

acquired in early life will be linked to a higher risk of osteoporosis

later in life. It is still not clear whether a BB-supplemented diet

consumed early in life would reduce the risk or degree of

osteoporotic bone loss later in life, but the data presented herein

indicate that a BB-supplemented diet has a positive effect on

building peak bone mass.

Bone loss occurs with increasing age and/or as a secondary

occurrence in chronic metabolic disease.(25) Recent population-

based longitudinal studies demonstrated that substantial

trabecular bone loss begins as early as the 20s in young men

and women, long before any hormonal changes.(26) To build

optimal peak bone mass or prevent bone loss, nutritional and

pharmacologic agents may be needed. Treatment of bone loss

(such as postmenopausal osteoporosis) has included the use of

drugs and hormone therapy, but each of the approved

treatments has specific side effects such as mastalgia, breast

cancer, and endometrial hyperplasia. None of these treatments

has been able to solve long-term problems of bone loss perfectly.

In an effort to search for an alternative treatment, foods of plant

origin, especially fruits, vegetables, and edible seaweed, have

drawn increased attention because of their potential benefits

and reduced adverse effects. In this report, a BB-supplemented

diet consistently increased bone mass with no gender difference

Fig. 6. (A) Osteoblastic UMR-106 cells were cotransfected with full-length b-catenin–GFP together with nuclear-targeted red fluorescent protein (nRFP).

Transfected cells were treated with 2.5% serum from BB diet–fed rats in the presence or absence of 50mM SB 239063 (SB) for 4 hours. (B) Western blot

analysis of b-catenin (nuclear versus cytosolic fraction) and phosphorylation status of GSK-3b and p38 in response to 2.5% serum from BB or Cas diet–fed

rats after the pretreatment of ST2 cells with SB 23063. Western blots were repeated at least twice, and bands are representatives from each duplicated

treatments; bands in each row under a single time point are from the same gel. Data with densitometry and statistics are presented in Supplemental

Fig. S5. (C) In the presence of both 20 and 50mMof SB 23063, serum from BB diet–fed rats failed to increase TCF/LEF-dependent transcription of a luciferase

reporter gene (TOPFLASH) in UMR-106 osteoblastic cells. �p< .05 for BB versus Cas by t test with triplicate treatments.


and without affecting normal growth. Moreover, there were no

differences in the levels of IGF1 between age-matched BB and

control diet groups in either gender, indicating no activation of

the somatotrophic axis, which has been implicated previously in

prenatal programming of skeletal development.(27) It is possible

that a BB diet may affect calcium homeostasis and utilization, for

example, via the parathyroid hormone (PTH) or PTH-related

peptide (PTHrP) pathway,(28) but this remains to be elucidated. It

is likely that the effect of BB on the skeleton is direct and at least

due to novel anabolic components rather than indirect hormonal

effects.

In contrast to the effect of some antiremodeling components

on bone, such as estradiol or phytoestrogens, we found that a BB

diet exerted an uncoupling effect on osteoblastogenesis and

osteoclastogenesis. Although suppressed osteoclastogenesis

might be equally important in determining increased bone

mass in BB diet–fed animals, in this article we focused primarily

on addressing the effect of BB on osteoblastogenesis. BB effects

on osteoblastogenesis were similar in both sexes at both ages.

Increased bone mass in BB diet–fed animals was associated with

increased osteoblast number, bone mineralization, and bone

volume, as well as increased osteoprogenitors in bone marrow.

Since there were no differences in total bone marrow cells in the

femur, the mechanism underlying increased osteoblastogenesis,

as reflected by increased osteoblast progenitors and CFU-OB

numbers, remains unknown. Possibilities are that BB-derived

factors increase the life span of osteoblastic stromal stem cells

and progenitor self-renewal or that BB-derived factors enhance

osteoblast commitment and differentiation. Our data suggest

that Wnt/b-catenin may be the key signaling pathway involved

in BB diet effects on bone formation.

Although the transcriptional cascade for osteoblastogenesis in

not fully defined, studies have provided insight into transcrip-

tional components regulating differentiation into osteoblasts.

The runt domain–containing transcription factor Runx2 is

required for osteoblast differentiation.(29) Msx2, another tran-

Fig. 7. (A) Polyphenol-derived phenolic acids in serum from BB or Cas diet–fed rats characterized by LC/MS. (B) The concentrations of total 13 phenolic

acids in the serum from BB diet–fed rats compared with the serum from their Cas diet–fed controls. For 7 phenolic acids (structures shown in panel A)

from a total of 13, the concentrations were roughly 10 times higher in rat serum after BB feeding than after casein feeding. Data aremean� SEM. (C) Effects

of an artificial mixture of seven phenolic acids presented in panel Amimicking their concentration in serum of rats fed a Cas or BB diet on ALP, OCN, Runx2,

and b-cateninmRNA expression in ST2 cells. ST2 cells were treated with a phenolic acid mixture at different concentrations based on their appearance in

serum from Cas or BB diet–fed rats for 3 days. Real-time PCR was performed. Data are mean� SEM. (D) Effects of an artificial mixture of seven phenolic

acids with concentration to mimic concentrations in serum of Cas or BB diet–fed rats on stimulating osteoblast differentiation were assessed by 10-day

culture of ST2 cells by ALP staining. (E ) Western blots demonstrating that an artificial mixture of seven phenolic acids with concentrations to mimic their

concentration in BB diet–fed rat serum activated b-catenin and phosphorylated p38 in ST2 cells relative to a similar mixture with concentrations to mimic

those found in the serum of Cas diet–fed rats. One Western blot from three repeated experiments is presented.


scription factor, is also thought to regulate osteoblast differ-

entiation.(30) However, it is not clear whether Msx2 lies upstream

of Runx2 or is independent of Runx2.(31) Nonetheless, one of the

main mechanisms by which Wnt/b-catenin signaling increases

bone mass is to increase the number of osteoblasts, which play a

critical role in bone formation. The relationships among Wnt/b-

catenin signaling, Runx2, and Msx2 still need to be investigated.

Data in this article indicate that BB diet–activated b-catenin was

associated with elevated Runx2 levels but not Msx2. Thus Msx2

may be not involved in the bone formation triggered by a BB

diet.

It is known that b-catenin needs to be stabilized in cytoplasm

before it localizes into the nucleus.(32) Factors that control b-

catenin nuclear translocation are not well known. A recent report

by Wu and colleagues demonstrated that Rac1 activation is

critical for this process in canonical Wnt signaling.(12) We have

shown that p38 MAPK was not only activated by the BB diet but

also that inhibition of p38 phosphorylation eliminated b-catenin

nuclear translocation in the set of in vitro studies. These results

indicate that activation of p38 MAPK potentiates downstream

Wnt signaling cascades and the activation of Runx2 in bone and

osteoblasts after BB feeding. P38 MAPKs are activated in

response to many extracellular stimuli, including growth factors,

cytokines, and environmental stress.(33) The p38 MAPK pathway

has been shown to be important for mineralization and

development of osteoprogenitors and bone regeneration of

mesenchymal stem cells.(34) Bikkavilli and colleagues recently

showed that p38 MAPK regulates canonical Wnt/b-catenin

signaling by inactivation of GSK-3b.(13)

Prompted by the discovery of resveratrol, a natural product

derived from grapes, and its cancer chemopreventive activity,(35)

we attempted to identify the biologically active components in

animal serum associated with a BB diet responsible for the bone

effects reported herein. We analyzed serum from BB diet–fed rats

and found a 10fold higher concentration of seven phenolic acid

metabolites of BB polyphenols compared with serum from

control rats. It is known that the prototypes of phenolic acids

from different diets or fruits are different. We have determined

the total phenolic acid profile in BB powder (data not shown). We

believe that most of the phenolic acids in the circulation of BB

diet–fed animals are either metabolites or breakdown products

of polyphenols and phenolic acids found in BB. Among seven

phenolic acids we have studied, only ferulic acid was detected

both in the serum of BB diet–fed animals and in BB powder.

Others, such as 3-hydroxybenzoic acid, may be breakdown

products from 3,4-dihydroxybenzoic acid that appears in BB

powder, and hippuric acid may be a metabolite from its

prototype chlorogenic acid that appears in BB powder. Since

there is no published study comparing the different concentra-

tions of phenolic acids in animal serum with different berries,

we believe that this profile of seven phenolic acids is unique to

BB feeding. Phenolic acids have been recognized to have

antioxidant properties, but evidence for effects on cell

differentiation is lacking. In particular, it has not been studied

whether individual phenolic acids promote osteoblastogenesis

or if a combination of different phenolic acids is required.

Data presented in this article show remarkable stimulation of

osteoblast differentiation by treatment with a synthetic mixture

of the seven phenolic acids at concentrations found in rat serum

after BB feeding. Moreover, we provide evidence that the

effect of the phenolic acid mixture in stimulating osteoblast

differentiation is mediated through cytoplasmic kinase and Wnt

signaling pathways. More detailed mechanistic studies are

planned, and further studies will determine if dietary phenolic

acids may be useful as a potential osteopenia treatment. In this

regard, it is of interest that a previous study by Sassa and

colleagues(36) reported the ability of ferulic acid to prevent

ovarectomy-induced bone loss in rats.

It is recognized that the amount of BB consumption in this

study is high, 10% of the diet. This is higher than the average

blueberry eater might consume. However, we noticed no signs of

toxicity at this high intake level, and growth, organ weights, and

hormone levels did not differ from controls. Importantly, the

results from this study demonstrate that dietary factors in BB

positively affect bone development, and careful future dose-

response studies of BB and the BB phytochemicals will be

necessary to determine the minimal effective dose required for

bone-enhancing effects.

In conclusion, we have demonstrated that a BB-supplemented

diet exerts significant effects on bone formation during the

rapidly growing phase of weanling rats that was gender-

independent and occurred without affecting growth rates. The

p38 MAPK/b-catenin signaling cascade appears to be a critical

molecular determinant of the positive skeletal effects of BB.

Phenolic acids derived from the breakdown of BB polyphenols

appear in the serum following BB consumption and stimulate

osteoblast differentiation through Wnt signaling, indicating their

potential in the prevention of bone loss.

Disclosures

All the authors state that they have no conflicts of interest.

Acknowledgments

We would like to thank the following people for their technical

assistance: Matt Ferguson, Trae Pittman, and Tammy Dallari. This

study was supported by ARS CRIS No. 6251-51000-005-03S.

References

1. Gilsanz V, Wren T. Assessment of bone acquisition in childhood andadolescence. Pediatrics. 2007;119:S145–149.

2. Novotny R, Daida YG, Grove JS, Acharya S, Vogt TM, Paperny D.

Adolescent dairy consumption and physical activity associated with

bone mass. Prev Med. 2004;39:355–360.

3. Tylavsky FA, Holliday K, Danish R, Womack C, Norwood J, Carbone L.

Fruit and vegetable intakes are an independent predictor of bone

size in early pubertal children. Am J Clin Nutr. 2004;79:311–317.

4. Lanham SA. Fruit and vegetables: the unexpected natural answer to

the question of osteoporosis prevention? Am J Clin Nutr. 2006;83:

1254–1255.

5. Wilson MA, Shukitt-Hale B, Kalt W, Ingram DK, Joseph JA, Wolkow CA.Blueberry polyphenols increase lifespan and thermotolerance in

Caenorhabditis elegans. Aging Cell. 2006;5:59–68.

6. DeFuria J, Bennett G, Strissel KJ, et al. Dietary blueberry attenuates

whole-body insulin resistance in high fat-fed mice by reducing


adipocyte death and its inflammatory sequelae. J Nutr. 2009;139:1510–1516.

7. Devareddy L, Hooshmand S, Collins JK, Lucas EA, Chai SC, Arjmandi

BH. Blueberry prevents bone loss in ovariectomized rat model of

postmenopausal osteoporosis. J Nutr Biochem. 2008;19:694–699.

8. Wu X, Rahal O, Kang J, Till SR, Prior RL, Simmen RC. In utero and

lactational exposure to blueberry via maternal diet promotes mam-

mary epithelial differentiation in prepubescent female rats. Nutr Res.2009;29:802–811.

9. Chen JR, Singhal R, Lazarenko OP, et al. Short term effects on bone

quality associated with consumption of soy protein isolate and other

dietary protein sources in rapidly growing female rats. Exp Biol Med(Maywood). 2008;233:1348–1358.

10. Chen JR, Lazarenko OP, Blackburn ML, Badeaux JV, Badger TM, Ronis

MJ. Infant formula promotes bone growth in neonatal piglets by

enhancing osteoblastogenesis through BMP2 signaling. J Nutr. 2009;139:1839–1847.

11. Huelsken J, Birchmeier W. New aspects of Wnt signaling pawthways

in higher vertebrates. Curr Opin Genet Dev. 2001;11:547–553.

12. Wu X, Tu X, Joeng KS, Hilton MJ, Williams DA, Long F. Rac1 activationcontrols nuclear localization of beta-catenin during canonical Wnt

signaling. Cell. 2008;133:340–353.

13. Bikkavilli RK, Feigin ME, Malbon CC. p38 mitogen-activated proteinkinase regulates canonical Wnt-beta-catenin signaling by inactiva-

tion of GSK3beta. J Cell Sci. 2008;121:3598–35607.

14. Reeves PG, Nielsen FH, Fahey GC Jr. AIN-93 purified diets for

laboratory rodents: final report of the American Institute of Nutritionad hoc writing committee on the reformulation of the AIN-76A

rodent diet. J Nutr. 1993;123:1939–1951.

15. Chen JR, Haley RL, Hidestrand M, et al. Estradiol protects against

ethanol-induced bone loss by inhibiting up-regulation of receptoractivator of nuclear factor-kappaB ligand in osteoblasts. J Pharmacol

Exp Ther. 2006;319:1182–1190.

16. Di Gregorio GB, Yamamoto M, Ali AA, et al. Attenuation of the self-renewal of transit-amplifying osteoblast progenitors in the murine

bone marrow by 17 beta-estradiol. J Clin Invest. 2001;107:803–812.

17. Chen JR, Plotkin LI, Aguirre JI, et al. Transient versus sustained

phosphorylation and nuclear accumulation of ERKs underlie anti-versus pro-apoptotic effects of estrogens. J Biol Chem. 2005;280:

4632–4638.

18. Chen JR, Lazarenko OP, Haley RL, Blackburn ML, Badger TM, Ronis MJ.

Ethanol impairs estrogen receptor signaling resulting in acceleratedactivation of senescence pathways while estradiol attenuates the

effects of ethanol in osteoblasts. J Bone Miner Res. 2009;24:221–230.

19. Wu X, Pittman Iii HE, Hager T, Hager A, Howard L, Prior RL. Phenolic

acids in black raspberry and in the gastrointestinal tract of pigsfollowing ingestion of black raspberry. Mol Nutr Food Res. 2009;53

(Suppl 1): S76–84.

20. Ronis MJ, Rowlands JC, Hakkak R, Badger TM. Inducibility of hepaticCYP1A enzymes by 3-methylcholanthrene and isosafrole differs in

male rats fed diets containing casein, soy protein isolate or wheyfrom conception to adulthood. J Nutr. 2001;131:1180–1188.

21. Gaddy-Kurten D, Coker JK, Abe E, Jilka RL, Manolagas SC. Inhibin

suppresses and activin stimulates osteoblastogenesis and osteoclas-

togenesis in murine bone marrow cultures. Endocrinology. 2002;143:74–83.

22. Tu X, Joeng KS, Nakayama KI, et al. Noncanonical Wnt signaling

through G protein-linked PKCdelta activation promotes bone for-mation. Dev Cell. 2007;12:113–127.

23. Jho EH, Zhang T, Domon C, Joo CK, Freund JN, Costantini F. Wnt/beta-

catenin/Tcf signaling induces the transcription of Axin2, a negative

regulator of the signaling pathway. Mol Cell Biol. 2002;22:1172–1183.

24. Shalet S. Adolescents with childhood-onset GHD: how do we getthem to peak bone mass? Horm Res. 2006;65:17–22.

25. Almeida M, Han L, Martin-Millan M, et al. Skeletal involution by age-

associated oxidative stress and its acceleration by loss of sex steroids.

J. Biol. Chem. 2007;282:27285–27297.

26. Riggs BL, Melton LJ, Robb RA, et al. A population-based assessment of

rates of bone loss at multiple skeletal sites: evidence for substantial

trabecular bone loss in young adult women and men. J Bone Miner

Res. 2008;23:205–214.

27. Tatara MR. Neonatal programming of skeletal development in sheep

is mediated by somatotrophic axis function. Exp Physiol.

2008;93:763–772.

28. Tobias JH, Cooper C. PTH/PTHrP activity and the programming of

skeletal development in utero. J Bone Miner Res. 2004;19:177–182.

29. Ducy P. Cbfa1: a molecular switch in osteoblast biology. Dev Dyn.

2000;219:461–471.

30. Nakashima K, Zhou X, Kunkel G, et al. The novel zinc finger-contain-

ing transcription factor osterix is required for osteoblast differentia-

tion and bone formation. Cell. 2002;108:17–29.

31. Acampora D, Merlo GR, Paleari L, et al. Craniofacial, vestibular andbone defects in mice lacking the Distal-less-related gene Dlx5.

Development. 1999;126:3795–3809.

32. Mizumoto K, Sawa H. Cortical beta-catenin and APC regulate asym-

metric nuclear beta-catenin localization during asymmetric cell

division in C. elegans. Dev Cell. 2007;12:287–299.

33. Martin-Blanco E. P38MAPK signaling cascades: ancient roles and newfunction. BioEssays. 2000;22:637–645.

34. Chang J, Sonoyama W, Wang Z, et al. Noncanonical Wnt-4 signaling

enhances bone regeneration of mesenchymal stem cells in cranio-facial defects through activation of p38 MAPK. J Biol Chem. 2007;

282:30938–30948.

35. Jang M, Cai L, Udeani GO, et al. Cancer chemopreventive activity of

resveratrol, a natural product derived from grapes. Science. 1997;275:218–220.

36. Sassa S, Kikuchi T, Shinoda H, Suzuki S, Kudo H, Sakamoto S.

Preventive effect of ferulic acid on bone loss in ovariectomized rats.

In Vivo. 2003;17:277–280.


dietary-induced serum phenolic acids promote bone growth via p38 mapk/β-catenin canonical wnt...

Documents