contiguous gene deletion of elovl7, ercc8 and ndufaf2 in a patient with a fatal multisystem disorder

1

© The Author 2009. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected]

Contiguous gene deletion of ELOVL7, ERCC8, and NDUFAF2 in a patient with a

fatal multisystem disorder

Rolf J.R.J. Janssen1, Felix Distelmaier2,3, Roel Smeets1, Tessa Wijnhoven2, Elsebet Østergaard4,

Nicolaas G.J. Jaspers5, Anja Raams5, Stephan Kemp6, Richard J.T. Rodenburg1, Peter H.M.G.

Willems2, Lambert P.W.J. van den Heuvel1, Jan A.M. Smeitink1 and Leo G.J. Nijtmans1*

1 Nijmegen Center for Mitochondrial Disorders at the Department of Pediatrics, Laboratory of

Pediatrics and Neurology, Radboud University Nijmegen Medical Centre, Nijmegen, The

Netherlands 2 Department of Biochemistry, Nijmegen Centre for Molecular Life Sciences, Radboud

University Nijmegen Medical Centre, Nijmegen, The Netherlands 3 Department of General Pediatrics, Heinrich-Heine-University, Düsseldorf, Germany 4 Department of Clinical Genetics, National University Hospital Rigshospitalet, Copenhagen,

Denmark 5 Department of Genetics, Erasmus Medical Centre, Rotterdam, The Netherlands 6 Laboratory Genetic Metabolic Diseases, Academic Medical Center, University of

Amsterdam, Amsterdam, The Netherlands

The authors wish it to be known that, in their opinion, the first two authors should be regarded

as joint First Authors.

(*) Correspondence to: Leo G.J. Nijtmans, Nijmegen Center for Mitochondrial Disorders,

Department of Pediatrics, Radboud University Nijmegen Medical Centre, PO Box 9101, 6500

HB Nijmegen, The Netherlands. Phone: +31-24-3619470/15251; Fax: +31-24-3668532; E-

mail: [email protected]

HMG Advance Access published June 12, 2009 by guest on June 1, 2013

http://hmg.oxfordjournals.org/

Dow

nloaded from


2

Abstract

Contiguous gene syndromes affecting the mitochondrial oxidative phosphorylation system

have been rarely reported. Here, we describe a patient with apparent mitochondrial

encephalomyopathy accompanied by several unusual features, including dysmorphism and

hepatopathy, caused by a homozygous triple gene deletion on chromosome 5. The deletion

encompassed the NDUFAF2, ERCC8, and ELOVL7 genes, encoding complex I assembly

factor 2 (also known as human B17.2L), a protein of the transcription-coupled nucleotide

excision repair (TC-NER) machinery, and a putative elongase of very long-chain fatty acid

synthesis, respectively. Detailed evaluation of cultured skin fibroblasts revealed disturbed

complex I assembly, depolarization of the mitochondrial membrane, elevated cellular

NAD(P)H level, increased superoxide production, and defective TC-NER. ELOVL7 mRNA

was not detectable in these cells and no alterations in fatty acid synthesis were found. By

means of baculoviral complementation we were able to restore the aberrations, thereby

establishing causative links between genotype and cell-physiological phenotype. This first

chromosomal microdeletion illustrates that beside primary defects in mitochondrial genes also

additional genes possibly contribute to the disease phenotype, providing an additional

explanation for the broad clinical symptoms associated with these disorders.

by guest on June 1, 2013http://hm

g.oxfordjournals.org/D

ownloaded from


3

Introduction

Contiguous gene syndromes are rare disorders characterized by apparently unrelated clinical

signs and symptoms, which are caused by deletion of two or more genes that are adjacent to

one another on a chromosome. Each of the individual genes involved may give rise to distinct

clinical and biochemical features. Numerous examples of such syndromes have been

described in literature (1-5). Investigation of these disorders on the molecular level offers

unique insights into the function of affected genes and their relation to the disease phenotype.

To date, contiguous gene syndromes affecting mitochondrial oxidative phosphorylation

(OXPHOS) have been rarely reported (6). Disturbances of the OXPHOS system are the cause

of a broad spectrum of disorders that are often referred to as mitochondrial

encephalomyopathies because of the prominent involvement of the nervous system and

striated muscle (7). With an incidence of 1 in 5,000 live births, OXPHOS disorders are

amongst the most frequent inborn errors of metabolism (8). The OXPHOS system comprises

five membrane-bound multiprotein complexes (complex I-V) and two mobile electron carriers

that transfer electrons from NADH and succinate to molecular oxygen. Simultaneously,

protons are translocated across the mitochondrial inner membrane; thereby creating a

membrane potential, which is the driving force of ATP production. Complex I (CI), or

NADH:ubiquinone oxidoreductase (ENZYME, EC 1.6.5.3), represents the main entry point

of the OXPHOS system, as it initiates electron transfer by oxidizing NADH. In mammals, CI

consists of 45 subunits of which seven are encoded by the mitochondrial DNA (mtDNA) and

38 by the nuclear genome (9) . Dysfunction of CI is accountable for several severe disorders

with variable onset, ranging from infancy to late adulthood. So far, disease-causing mutations

have been found in each of the seven mtDNA-encoded subunits and in twelve of the nuclear

genes encoding structural components of CI (10-12). In addition, mutations in genes encoding

proteins that are required for CI assembly were recently implicated in severe childhood

disorders (13-17).

A possible explanation for the rare implication of OXPHOS defects in contiguous gene

syndromes might be that OXPHOS deficiencies may result in variable and often severe

clinical manifestations, affecting different age groups and involving different organs and

tissues. Therefore, characteristic constellations of symptoms and anomalies may be under-

recognized. In addition, mutations in nuclear structural genes of CI are usually associated

with devastating clinical phenotypes (e.g. Leigh syndrome or fatal infantile lactic acidosis)

resulting in early death, and accordingly, the involvement of other genes with less severe

clinical manifestations may be overshadowed (18). To date, no contiguous gene syndromes



ownloaded from


4

associated with isolated CI deficiency are known. In this report, we describe a girl who

presented with an apparent mitochondrial encephalomyopathy accompanied by several

abnormal dysmorphic features and hepatopathy, which was caused by a homozygous triple

gene deletion on chromosome 5. The deletion encompassed the NDUFAF2 gene (GenBank,

NM_174889), encoding CI assembly factor 2, the ERCC8 gene (GenBank, NM_000082),

involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway, and

ELOVL7 (GenBank, NM_024930), a member of the elongase (ELOVL: elongation of very

long-chain fatty acids) gene family. We investigated the consequences of the lack of

chaperone NDUFAF2 for the biogenesis and functioning of the OXPHOS system and

established downstream alterations in mitochondrial physiology. Moreover, we confirmed

Cockayne syndrome type A (CS-A; MIM 216400) deficiency, as a result of the ERCC8

deletion, by analysis of the NER system. No specific alterations in fatty acid synthesis as a

consequence of the ELOVL7 deletion could be determined in the patient’s fibroblasts, which

can easily be explained by the lack of any detectable ELOVL7 expression in healthy human

fibroblasts.



ownloaded from


5

Results

Enzyme activity measurements of OXPHOS complexes

Spectroscopy measurement of the enzyme activities of all five OXPHOS complexes revealed

a significant decrease for CI in the patient’s fibroblasts (45 % of lowest control value),

whereas all other complexes (CII-V) showed normal values (Table 1).

Complex I deficiency confirmed by decreased amounts of fully assembled complex I

To investigate the CI deficiency on protein level, mitochondrial fractions of the patient and

healthy control fibroblasts were subjected to BN-PAGE analysis by means of an in-gel

activity assay and western blotting using antibodies directed against CI-III (Fig 1A). The

patient’s fibroblasts showed a severe decrease in both CI activity and protein amount

compared to two control fibroblasts cell lines, whereas normal control levels were shown for

CII and CIII. Furthermore, SDS-PAGE analysis of these fractions revealed significant

decreases in the protein levels of CI subunits NDUFS3, NDUFA9, and NDUFB6, as well as

CI assembly factor NDUFAF1, whereas a relatively mild decrease was observed for subunit

NDUFS2 (Fig 1B). Strikingly, no protein at all was detected for the CI assembly factor

NDUFAF2 in the patient’s fibroblasts. In contrast, normal NDUFAF2 protein levels were

observed for two CI-deficient patients with unknown mutations. In addition, all patients

showed normal levels of subunit SDHA of CII.

Mutational analysis

Extensive mutational analysis performed on the patient⎯i.e., screening for mtDNA

rearrangements (deletions, insertions or duplications) and common mtDNA point mutations,

and screening of all 38 nuclear genes and seven mitochondrial ND genes encoding the 45 CI

subunits for mutations⎯did not reveal the molecular defect. Because NDUFAF2 protein was

undetectable, we investigated the corresponding NDUFAF2 mRNA sequence. Analysis of

PCR amplification of cDNA derived from the patient’s fibroblasts did not reveal a PCR

product for the NDUFAF2 sequence, suggesting a destabilized mRNA, promoter mutation or

gene deletion. Subsequent PCR amplification of the patient’s genomic DNA failed to retrieve

the NDUFAF2 gene, indicating a (total) gene deletion. PCR analysis using specific primer

sets in region surrounding the NDUFAF2, led to the detection of a homozygous deletion of

~450 kb on chromosome 5. The location was refined by direct sequencing using chromosome

map markers at 5q12.1 ranging from nucleotide 60,082,769 to 60,530,221 (UCSC Genome

Browser, March 2006 assembly). This deletion encompassed the full sequence of three known



ownloaded from


6

genes, i.e., ELOVL7 (60,083,373 - 60,175,858; minus strand), ERCC8 (60,205,416 –

60,276,662; minus strand) and NDUFAF2 (69,276,713 – 60,484,621; plus strand). Single

polymorphism microarray analysis revealed no major chromosomal rearrangements other

than the described deletion in this patient. Screening of genomic DNA, isolated from blood

samples of the clinically unaffected patient’s relatives, revealed that both parents, two

brothers and a sister were heterozygous for the deletion.

Complementation of the complex I defect with wild-type NDUFAF2

To prove the pathogenicity of the NDUFAF2 deletion, functional complementation of the CI

defect was carried out by means of baculoviral transduction of patient and healthy control

fibroblasts with constructs expressing either GFP-tagged NDUFAF2 protein or COX8 leader

peptide fused to GFP. BN-PAGE analysis of mitochondrial fractions at three days after

transduction revealed full restoration of CI activity and protein amount in the index patient’s

cells transduced with the NDUFAF2-GFP virus (Fig 2A). In contrast, no change was

observed in the patient’s cells transduced with the COX8-GFP virus or in either NDUFAF2-

GFP or COX8-GFP transduced healthy control cells. In addition, protein levels of CII and

CIII remained unaffected. Importantly, two other CI-deficient patient cell lines, bearing

mutations in the NDUFS4 or NDUFS7 gene, showed no changes in CI activity or CI protein

amount⎯or the 830-kDa subcomplex of CI, which is normally observed in NDUFS4

patients⎯following transduction with NDUFAF2-GFP, demonstrating the specificity of the

complementation.

Complex I assembly profile

More insight in the CI assembly profile of the index patient can be achieved by subjecting

first dimension BN-PAGE-separated complexes to second dimension SDS-PAGE (2D

BN/SDS-PAGE) followed by western blotting and immunodetection with CI antibodies (Fig

3). Disturbance of CI assembly in the patient was demonstrated by accumulation of low-

molecular weight CI subcomplexes, containing subunits NDUFS2, NDUFS3 (sub 2-5), and

ND1 (sub 4, 5), which correspond to CI assembly intermediates 2, 3, 4, and 5 of the model for

human mitochondrial CI assembly proposed by Vogel et al. (19)The accumulation of a high-

molecular weight subcomplex containing subunits NDUFB6 and ND1 was also more

pronounced in the patient when compared to control fibroblasts. This subcomplex

corresponds to the ‘appearing subcomplex’ a1 of the model. In addition, there was a decrease

in NDUFAF1 associated with the ~500-kDa complex, which was described before in CI-



ownloaded from


7

deficient patients with mutations in structural complex I subunits (20). As expected, no

change in CIV was observed with anti-COXII antibody.

Lack of NDUFAF2 alters mitochondrial physiology and function

To investigate the effects of the CI deficiency on mitochondrial physiology, several cell-

physiological parameters were measured in control and patient fibroblasts. The first

parameter, mitochondrial membrane potential, is tightly linked to accurate functioning of

complex I. Microscopic analysis of the mitochondrial accumulation of fluorescent tetramethyl

rhodamine methyl ester (TMRM), as an estimate of mitochondrial membrane potential,

revealed a significant decrease in fibroblasts of the index patient compared to healthy control

fibroblasts, indicative of depolarization of the mitochondrial membrane (Fig 4A) (21).

Depolarization was also measured for cells of the CI-deficient NDUFS7 patient. Strikingly,

transduction with the NDUFAF2-GFP virus almost completely restored TMRM accumulation

in the cells of the index patient, whereas no significant effect could be observed for the

NDUFS7 patient.

Besides depolarization of the mitochondrial membrane, increase in NAD(P)H level is another

hallmark of CI dysfunction (22). Measurement of NAD(P)H autofluorescence revealed a

marked increase in fibroblasts of the index patient compared to healthy control fibroblasts and

was considerably higher than in cells of an NDUFS2 patient (Fig 4B). After NDUFAF2-GFP

transduction, NAD(P)H autofluorescence almost completely normalized in cells of the index

patient, but not in cells of the NDUFS2 patient.

A third common feature of fibroblasts harboring CI deficiency is increased superoxide

production, which was determined by quantification of fluorescent hydroethidine (HEt)

oxidation products (23). Fibroblasts of the index patient demonstrated remarkably high

superoxide levels compared to healthy control cells and cells of the NDUFS7 patient (Fig

4C). Again, a nearly complete restoration was observed for the index patient after

transduction with the NDUFAF2-GFP virus, whereas transduction did not affect superoxide

levels in the NDUFS7 patient.

Investigation of the nucleotide excision repair mechanism

The ERCC8 gene is essential for TC-NER of UV-induced DNA damage and is typically

defective in patients with Cockayne syndrome belonging to complementation group A (CS-A;

MIM 216400) (24,25). Since the ERCC8 gene is located in the deleted area, fibroblasts of the

index patient were subjected to NER analysis. Fibroblasts displayed lowered TC-NER and



ownloaded from


8

normal global genome (GG) NER activities compared to healthy control fibroblasts after

exposure to UV radiation (Fig 5A), indicating defective TC-NER but proficient GG-NER.

Analysis of cellular survival after exposure to increasing UV doses revealed a UV sensitivity

of the index patient’s cells that is characteristic of CS-A patients (Fig 5B). Importantly, after

fusion with a known Cockayne syndrome type B (CS-B; MIM 133540) cell strain (defective

in the ERCC6 gene), but not with a CS-A strain, RNA synthesis rates of all heterokaryons

were restored to normal levels, proving that the TC-NER defect could be complemented by

CS-B cells, but not by cells from a CS-A patient. These repair parameters in combination with

the genetic complementation analysis unequivocally demonstrate an ERCC8/CSA defect in

fibroblasts of the index patient.

Analysis of fatty acid levels

Proteins belonging to the ELOVL family are required for the first reaction in the elongation

cycle of very long-chain fatty acid (VLCFA) synthesis (26,27). To examine the effect of the

deletion of the ELOVL7 gene on fatty acid biosynthesis, endogenous levels of saturated

(C14:0–C28:0), mono-unsaturated (C18:1–C28:1) and poly-unsaturated (omega-3 and omega-

6 series) fatty acids were determined in fibroblasts of the index patient, of two healthy control

cell lines, and of four complex I-deficient patient cell lines with mutations in the NDUFAF2,

NDUFS4 (two cell lines) and NDUFS7 genes. No differences could be observed in fatty acid

levels between patient and control fibroblasts. To establish whether this could be due to a low

expression level of ELOVL7 in human fibroblasts, we performed PCR analysis using mRNA

derived from a neuroblastoma cell line (SK-N-BE(2)c) as a positive control. This revealed

that ELOVL7 is highly expressed in SK-N-BE(2)c cells, but not in human primary fibroblasts

(unpublished data S. Kemp).



ownloaded from


9

Discussion

We describe a patient with an unusual mitochondrial clinical presentation, including

dysmorphic features, a generalized CNS involvement and lipid storage in the liver. Almost 20

years after the unclear death of the index patient we could finally make a diagnosis. The

disease was caused by a homozygous triple gene deletion encompassing the genes

NDUFAF2, ERCC8 and ELOVL7. This first report of a homozygous chromosomal

microdeletion associated with a mitochondrial phenotype and isolated complex I deficiency,

allowed us to investigate the consequences of each gene in this deleted region for the

molecular mechanisms of cellular metabolism in which they exert their functions, and

evaluate their possible contribution to the unique phenotype of the index patient.

Based on the early-onset encephalomyopathy with lactic acidemia, disturbance of the

OXPHOS system was believed to play a major role in the pathology of the index patient.

Indeed, enzyme activity measurements revealed a severe CI deficiency and subsequent

screening of candidate genes revealed the absence of NDUFAF2. Further characterization of

this gene disclosed the microdeletion of a region encompassing the genes ERCC8 and

ELOVL7. So far, the complex I assembly factor NDUFAF2 has been implied in complex I

deficiency in three described patients (13,28). To establish the contribution of chaperone

NDUFAF2 on the disturbance of CI assembly we performed baculoviral expression of wild-

type NDUFAF2. NDUFAF2-GFP recombinant protein specifically restored protein amount

and in-gel activity of fully assembled CI in the patient’s fibroblasts. This illustrates that, as

may be expected, the NDUFAF2 gene is solely responsible for the CI deficiency in these

cells. Further characterization of the complex I assembly status in the patient’s fibroblasts by

two dimensional blue native/SDS electrophoresis revealed that the amount of fully assembled

CI is severely reduced but not completely absent. This proves that assembly of CI is not

entirely prevented by the complete lack of NDUFAF2 protein and demonstrates that the

residual CI activity in described patients with a point mutation (13,28) is unlikely caused by

small amounts of (truncated) NDUFAF2 protein. Consistent with the findings of Ogilvie and

colleagues (13) we demonstrate accumulation of 380- and 480- kDa CI subcomplexes

(subcomplex 4 and 5 (see Fig. 3)) in the absence of NDUFAF2 and with the use of different

antibodies we allowed us to observe the accumulation other early assembly intermediates,

subcomplex 2 and 3 (Fig. 3) of the human CI assembly pathway model (19). In addition to the

report of NDUFAF2 association with an 830-kDa CI subcomplex in certain patients (13) our

preliminary experiments revealed that NDUFAF2-GFP also specifically associates with this

830-kDa subcomplex in healthy control fibroblasts but not with smaller subcomplexes



ownloaded from


10

(unpublished data R. Janssen). These results are in line with a chaperone role for NDUFAF2

in a late stage of the CI assembly process, possibly by catalyzing an assembly step or by

stabilizing an assembly intermediate, as has been argued before (13, 29).

OXPHOS dysfunction has been demonstrated to have evident effects on several aspects of

mitochondrial and cellular functioning, including mitochondrial membrane potential, cellular

NAD(P)H levels and cellular superoxide production (30,31). All three parameters were

altered in fibroblasts of the index patient, demonstrating the consequences of the NDUFAF2

deletion for cell metabolism. Importantly, all alterations could be restored upon baculoviral

complementation with wild-type NDUFAF2, while no recovery was observed in fibroblasts of

CI-deficient patients with mutations in the NDUFS7 or NDUFS2 subunits. These findings

clearly establish the pathogenicity of the NDUFAF2 deletion for impaired CI functioning and

disturbed cellular physiology in our index patient.

The ERCC8 gene encodes a protein involved in DNA repair and mutations of the gene cause

Cockayne syndrome type A. In mammalian cells, various DNA repair systems exist in order

to cope with attacks of endogenous and environmental genotoxic agents on their genomes.

One of them is the nucleotide excision repair (NER) pathway, a complex system that removes

chemically and UV-induced helix-distorting lesions. The transcription-coupled repair

subpathway of the NER (TC-NER) is a mechanism that specifically removes transcription-

blocking lesions from the transcribed strands of actively transcribed genes (24,25). Cockayne

syndrome type A, a rare autosomal recessive disorder characterized by UV sensitivity, severe

neurological abnormalities, and progeriod symptoms, is caused by mutations in the ERCC8

gene, which encodes the Cockayne syndrome type A protein (CSA) that is part of the core of

the TC-NER machinery (32). CS is primarily characterized by mild cutaneous

photosensitivity, postnatal growth failure, progressive neurological dysfunction, and

symptoms reminiscent of segmental accelerated ageing. This progressive disorder generally

manifests at 1-2 years of age and results in death at puberty or early adulthood (32,33). In

addition to this classic CS, called type I, there is a less common early-onset form of CS, called

type II, with more severe symptoms that already present at birth. Moreover, CS may be

associated with additional clinical features, including microcephaly, retinal degeneration,

deafness, and skeletal abnormalities such as osteoporosis and a bird-like face (32,33). In

fibroblasts of our index patient we clearly demonstrated the presence of the distinct repair

defect of CS patients. Against this background, some of the symptoms, such as microcephaly,

reduced birth weight, facial dysmorphia, and dry skin, may well be compatible with CS type

II. However, we cannot dismiss the possibility that the patient’s early demise at 14 months



ownloaded from


11

prevented any clear typical signs associated with the more common CS type I to become

manifest. Finally, the option of an interaction between CS and the phenotypes associated with

the other gene defects remains fully open.

The ELOVL7 gene encodes a putative elongase of VLCFA synthesis and has not been linked

with pathogenic mutations and/or deletions before. In mammals, fatty acids consisting of up

to 16 carbons in length, which are synthesized by the cytosolic fatty acid synthase (FAS)

complex, as well as fatty acids taken up from the diet, are further elongated into long-chain

fatty acids containing up to 20 carbon atoms, and/or into very long-chain fatty acids

(VLCFAs) with over 20 carbon atoms (26). Synthesis of VLCFAs takes place at the

cytoplasmic side of the endoplasmic reticulum (ER) and involves four successive enzymatic

steps, which are carried out by individual membrane-bound proteins. The first regulatory

reaction step in the elongation cycle, the condensation of a fatty acyl-CoA and malonyl-CoA,

is the rate-limiting step, and is performed by members of the ELOVL protein family. To date,

seven enzymes, elongases termed ELOVL1-7, have been identified in mammals and are

suggested to perform the condensation reaction in the elongation cycle (26,27). The substrate

specificity for all of the seven ELOVL proteins has not been determined yet, and mutations of

the ELOVL7 gene have not been reported before.

Importantly, PCR analysis did not reveal any detectable expression of the ELOVL7 gene in

human skin fibroblasts. In addition, no significant differences in fatty acid synthesis were

observed between the index patient, healthy control subjects and CI-deficient patients with

single mutations in the NDUFS4 and NDUFS7 subunits. Considering the tissue specificity of

the ELOVL family members, it is plausible that ELOVL7 does not have a function in skin

fibroblasts, but exerts its function⎯and consequently displays its defect⎯in other tissues. For

instance, the apparent lipid inclusions observed in the ER of a liver biopsy of the patient could

be indicative of disturbance of fatty acid metabolism, which could mean a possible

involvement of the ELOVL7 deletion in the pathology. This hypothesis is supported by the

observation of Ikeda et al, that ELOVL7 has a preference for interaction with 3-hydroxyacyl-

CoA dehydratase 3 (HACD3), another enzyme of the elongation cycle, which exhibits a

remarkably high expression in liver (34). Unfortunately, since the patient was examined many

years ago, there is no material left to perform additional liver function studies.

In conclusion, we present here a unique case of deletion of three genes with distinct functions,

in which all three possibly contribute to the pathology of the patient. Involvement on the cell-

physiological level was demonstrated for NDUFAF2 and ERCC8 by complementing the



ownloaded from


12

defects in their individual biochemical pathways, whereas involvement of the ELOVL7

deletion can be presumed.

From a medical perspective it is a difficult task to establish distinct genotype-phenotype

correlations for each of the three deleted genes. It is quite plausible that the most severe defect

with the earliest onset of symptoms and the fastest progression might overshadow the clinical

features of the defects with a later onset and slower progression. Nevertheless, it seems

striking that the clinical presentation of our patient was distinctively different from the three

other reported patients with defects in NDUFAF2 (13,28). These children were born at term,

had an uneventful perinatal course and did not show any dysmorphic features. Onset of first

symptoms ranged form 8 moths to 3 years and included respiratory irregularities, muscular

hypotonia, ataxia and nystagmus. On MRI, all patients had characteristic symmetric lesions in

the mamillothalamic tracts, substantia nigra/medial lemniscus, medial longitudinal fasciculus,

the corpus medullare and the cerebellum, with relative sparing of the cortex and subcortical

white matter. Although we do not have brain MRI images in our index patient, the clinical

features and the autopsy results show clear differences compared to these findings (for details

see case report). Especially the dysmorphic features, the more severe and generalized CNS

involvement with spongiform demyelination of the white matter and the lipid storage in the

liver might indicate the involvement of additional factors beyond a purely mitochondrial

disease. These finding have two important implications. Firstly, considering the broad clinical

spectrum of mitochondrial disorders and the discrepancy in symptoms amongst patients with

the same gene defects, it should be kept in mind that additional gene defects may be present

next to the main mitochondrial defect and influence the clinical outcome. Especially when

consanguinity is involved as is the case for many mitochondrial patients. Secondly, despite

the presence of atypical features still mitochondrial OXPHOS defects should be considered as

a genetic cause.

Materials and Methods

Case report

The girl was the second child of healthy consanguineous parents (first cousins) of Pakistani

(Moslem) descent. Family history was unremarkable (one older sister and two younger

brothers not affected). Prenatal ultrasound screening revealed intrauterine growth retardation.

The patient was born at 38 weeks of gestation by caesarean section. Birth weight was 1.815

kg (~0.5 kg <3rd percentile), length 45 cm (~1 cm <3rd percentile) and head circumference 31

cm (~0.5 cm <3rd percentile). APGAR scores were 6/8/10. Postpartally, the girl appeared



ownloaded from


13

dysmature and developed respiratory distress. Apart from microcephaly, several abnormal

features including long philtrum, micrognathia, low-set ears and unusually dry skin were

noted. Laboratory investigations revealed elevated levels of lactate (2.5-3.4 mmol/L; normal

range 0.6-1.8) and alanine in blood (1046 µmol/L; normal range <450). Urine screening was

normal, except for increased alanine excretion. Cranial ultrasound and a computed

tomography scan of the brain detected no obvious pathology. Abdominal ultrasound

demonstrated hepatomegaly. Opthalamological examinations at age 10 days and 2

months revealed small eye slits and bulbi. In addition, hypermetropia was suspected. Fundus

examination was reported to be normal. The further clinical course of the patient was

characterized by severe developmental delay, failure to thrive, progressive microcephaly,

growth retardation, hepatomegaly, myoclonic epilepsy, pyramidal signs and spasticity. The

girl repeatedly developed aspiration pneumonias and finally died at the age of 14 months due

to cardiorespiratory failure. Autopsy revealed severe, spongiform demyelination of the white

matter, which was most pronounced in the occipital region and the cerebellum. Investigation

of liver tissue demonstrated hepatic steatosis and electron microscopy (EM) studies revealed

abnormally swollen mitochondria and inclusions of granular material in the endoplasmic

reticulum, possibly accumulations of lipids. Moreover, accumulation of secondary

lysomosomes around the sinusoides was observed. Histological evaluation of muscle tissue

showed few small atrophic fibers, but was otherwise normal. No ragged red fibers or

cytochrome c oxidase-negative fibers were seen. However, also in this tissue, ultrastructural

studies by EM demonstrated swollen mitochondria.

Cell culture and OXPHOS enzyme activity measurements

Fibroblasts were obtained from skin biopsies according to the relevant institutional review

boards and cultured in medium 199 with Earle's salt (M199; Invitrogen) supplemented with

10% (v/v) fetal bovine serum (Greiner Bio-One), penicillin and streptomycin (Invitrogen) in a

humidified atmosphere of 95% air and 5% CO2 at 37 °C. Measurement of OXPHOS enzyme

activities in skin fibroblasts and muscle tissue were performed as described previously (35).

Sodium dodecyl sulfate and blue native polyacrylamide gel electrophoresis and western

blotting

Sodium dodecyl sulfate (SDS) and blue native (BN) polyacrylamide gel electrophoresis

(PAGE) of mitochondria-enriched fractions was performed as described previously (36).

Briefly, 20 and 40 µg of mitochondrial protein was loaded on 10% polyacrylamide gels for



ownloaded from


14

SDS-PAGE and 5-15% polyacrylamide gradient gels for BN-PAGE, respectively. For second

dimension SDS-PAGE, first dimension BN-PAGE lanes were excised and placed on top of a

10% polyacrylamide SDS-gel and run as described previously (36). SDS- and BN-gels were

subjected to western blotting using nitrocellulose membranes (Schleicher and Schuell).

Immunodetection was performed using antibodies directed against CI subunits NDUFA9

(Invitrogen), NDUFB6 (MitoSciences), NDUFS2 (Prof B. Robinson, Toronto), NDUFS3

(Invitrogen) and ND1 (Dr A. Lombes, Paris), CII subunit SDHA (Invitrogen), CIII subunit

Core2 (Invitrogen), CIV subunit COXII (Invitrogen), and CI assembly chaperones NDUFAF1

(our laboratory; (37)) and NDUFAF2 (Prof M. Tsuneoka, Kurume). Peroxidase-conjugated

anti-mouse and anti-rabbit IgGs (Invitrogen) were used as secondary antibodies. Signals were

generated by means of ECL plus (Amersham Biosciences) and autoradiography.

Complex I in-gel activity measurement

CI in-gel activity was detected as NADH:nitrotetrazolium blue oxidoreductase activity by

incubation of BN-gels in the presence of 0.15 mM NADH (Roche), 3 mM nitrotetrazolium

blue chloride (NTB; Sigma-Aldrich) and 2 mM tris-HCl (Sigma-Aldrich) at pH 7.4, for 1 h

protected from light (38).

RNA isolation, PCR amplification, DNA sequencing and genome wide single nucleotide

polymorphism microarray.

Total DNA and mRNA was isolated from fibroblasts and blood samples according to standard

procedures. cDNA was obtained by reverse transcriptase-polymerase chain reaction (RT-

PCR) of mRNA according to the manufacturer’s protocol (Promega) and subsequently

amplified by PCR with a primer set encompassing the total NDUFAF2 mRNA sequence

(GenBank, NM_174889; forward (5’→3’) CTGGAGCATTACCCCTACTGCG, reverse

(5’→3’) TAGTCACATCCATATACATGAAAAG). PCR products were cycle-sequenced

using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied

Biosystems) and analyzed by a 3130xl Genetic Analyzer (Applied Biosystems), according to

the manufacturer’s protocol. Genome wide single nucleotide polymorphism microarray was

performed using Affymetrix 500kSNP microarrays as described elsewhere (39).

Cloning of baculoviral constructs and generation of recombinant baculoviruses

The cDNA sequences of the coding region of the NDUFAF2 gene and the mitochondrial

targeting sequence of the gene encoding subunit VIII of cytochrome c oxidase (COX8) were



ownloaded from


15

cloned into a pFastBacTMDual vector (Invitrogen), modified for the expression of proteins in

mammalian cells, behind a cytomegalovirus promoter and adjacent to a c-terminal GFP-tag

sequence as described before (40). The obtained baculoviral vector constructs were used to

generate infectious recombinant baculoviruses by site-specific transposon-mediated insertion

into a baculovirus genome (bacmid) propagated in Escherichia coli cells. Isolated

recombinant bacmids were used to infect Spodoptera frugiperda 9 (Sf9) insect cells for

amplification of viruses.

Transduction of complex I-deficient fibroblasts with baculoviral constructs

Fibroblasts, cultured in 25-cm2 tissue culture flasks (NUNC) to ~70% confluence, were

transduced with the appropriate baculovirus (virus titer: 3*107) at a multiplicity of infection of

~10 in a total volume of 1.6 mL M199 for 3 h at 37 °C. After incubation, the virus-containing

medium was discarded and replaced by normal growth medium. The next day, 5 mM sodium

butyrate (Sigma-Aldrich) was added to the medium to enhance protein expression and 3 days

after transduction cells were harvested.

Fluorescence microscopy of TMRM, NAD(P)H and HEt oxidation products

For microscopy analysis of tetramethyl rhodamine methyl ester (TMRM, Invitrogen)

fluorescence, NAD(P)H autofluorescence, and hydroethidine (HEt, Molecular Probes)

oxidation product fluorescence, fibroblasts, cultured on glass coverslips (Ø 24 mm) to ~70%

confluence, were incubated with the appropriate dye and imaged with an Axiovert 200M

inverted microscope (Carl Zeiss) equipped with a 40×/1.3 NA (HEt oxidation products and

NAD(P)H) or a 63x/1.25 NA (TMRM) Plan NeoFluar objective (Carl Zeiss), as described

previously (21-23). All measurements were performed in HEPES-Tris medium (132 mM

NaCl, 4.2 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 5.5 mM D-glucose and 10 mM HEPES at pH

7.4) at 37 °C. Quantification of fluorescence intensities was performed as described before

(21-23,31,41). In each experiment, the average value obtained with control cells was set at

100%, to which all other values were related. Values from multiple experiments were

expressed as means ± SEM. Statistical significance (Bonferroni corrected) was assessed using

Student’s t-test.

Nucleotide excision repair assays

Transcription-coupled NER (TC-NER) and global genome NER (GG-NER) activities of

cultured fibroblasts after exposure to germicidal UV-C rays were assayed using standard



ownloaded from


16

autoradiographic methods described elsewhere (42) and expressed as a percentage of the

activities of UV-exposed normal control cells. Overall cell survival was routinely assayed by

global incorporation of tritiated thymidine 4 days after exposure to graded UV doses (43).

Standard complementation analysis was performed as described before (42). Fibroblast strains

were preloaded with distinct types of cytoplasmic beads and fused using inactivated Sendai

virus. After appropriate incubation time, the mixture of unfused cells and fused multikaryons

was exposed to UV radiation and assayed for TC-NER and GG-NER activities.

Measurement of very long-chain fatty acid levels

Total cellular fatty acids were analyzed using the electrospray ionization mass spectrometry

(ESI-MS) method described previously (44).



ownloaded from


17

Funding

This work has been supported by The Netherlands Organization for Scientific Research

(NWO; grant numbers: 901-03-156 and 016.086.328), the European Leukodystrophy

Association (ELA: 2006-031I4) and by the European Union's 6th Framework Programme,

Priority 1 “Life Sciences, Genomics and Biotechnology for Health” (contract no. LSHM-CT-

2004-503116, entitled EUMITOCOMBAT).

Acknowledgements

The authors would like to thank Prof Makato Tsuneoka (Kurume University School of

Medicine, Kurume, Japan) for providing anti-NDUFAF2 antibody and Dr Rolph Pfund

(Department of Human Genetics, Radboud University Nijmegen Medical Centre, Nijmegen,

the Netherlands) for performing the molecular karyotyping.

The authors state that there is no conflict of interest.



ownloaded from


18

References

1. Greenberg,F., Guzzetta,V., Montes,d.O.-L., Magenis,R.E., Smith,A.C., Richter,S.F.,

Kondo,I., Dobyns,W.B., Patel,P.I., Lupski,J.R. (1991) Molecular analysis of the Smith-

Magenis syndrome: a possible contiguous-gene syndrome associated with

del(17)(p11.2). Am. J. Hum. Genet., 49, 1207-1218.

2. Cassidy,S.B., Dykens,E., Williams,C.A. (2000) Prader-Willi and Angelman syndromes:

sister imprinted disorders. Am. J. Med. Genet., 97, 136-146.

3. Cardoso,C., Leventer,R.J., Ward,H.L., Toyo-Oka,K., Chung,J., Gross,A., Martin,C.L.,

Allanson,J., Pilz,D.T., Olney,A.H., et al. (2003) Refinement of a 400-kb critical region

allows genotypic differentiation between isolated lissencephaly, Miller-Dieker

syndrome, and other phenotypes secondary to deletions of 17p13.3. Am. J. Hum. Genet.,

72, 918-930.

4. Tassabehji,M. (2003) Williams-Beuren syndrome: a challenge for genotype-phenotype

correlations. Hum. Mol. Genet., 12 Spec No 2, R229-R237.

5. Kobrynski,L.J., Sullivan,K.E. (2007) Velocardiofacial syndrome, DiGeorge syndrome:

the chromosome 22q11.2 deletion syndromes. Lancet, 370, 1443-1452.

6. Parvari,R., Brodyansky,I., Elpeleg,O., Moses,S., Landau,D., Hershkovitz,E. (2001) A

recessive contiguous gene deletion of chromosome 2p16 associated with cystinuria and

a mitochondrial disease. Am. J. Hum. Genet., 69, 869-875.

7. Smeitink,J., van den Heuvel,L., DiMauro,S. (2001) The genetics and pathology of

oxidative phosphorylation. Nat. Rev. Genet., 2, 342-352.

8. Skladal,D., Halliday,J., Thorburn,D.R. (2003) Minimum birth prevalence of

mitochondrial respiratory chain disorders in children. Brain, 126, 1905-1912.

9. Carroll,J., Fearnley,I.M., Skehel,J.M., Shannon,R.J., Hirst,J., Walker,J.E. (2006) Bovine

complex I is a complex of 45 different subunits. J. Biol. Chem., 281, 32724-32727.



ownloaded from


19

10. Janssen,R.J., Nijtmans,L.G., van den Heuvel,L.P., Smeitink,J.A. (2006) Mitochondrial

complex I: structure, function and pathology. J. Inherit. Metab. Dis., 29, 499-515.

11. Fernandez-Moreira,D., Ugalde,C., Smeets,R., Rodenburg,R.J., Lopez-Laso,E., Ruiz-

Falco,M.L., Briones,P., Martin,M.A., Smeitink,J.A., Arenas,J. (2007) X-linked

NDUFA1 gene mutations associated with mitochondrial encephalomyopathy. Ann.

Neurol., 61, 73-83.

12. Berger,I., Hershkovitz,E., Shaag,A., Edvardson,S., Saada,A., Elpeleg,O. (2008)

Mitochondrial complex I deficiency caused by a deleterious NDUFA11 mutation. Ann.

Neurol., 63, 405-408.

13. Ogilvie,I., Kennaway,N.G., Shoubridge,E.A. (2005) A molecular chaperone for

mitochondrial complex I assembly is mutated in a progressive encephalopathy. J. Clin.

Invest., 115, 2784-2792.

14. Dunning,C.J., McKenzie,M., Sugiana,C., Lazarou,M., Silke,J., Connelly,A.,

Fletcher,J.M., Kirby,D.M., Thorburn,D.R., Ryan,M.T. (2007) Human CIA30 is involved

in the early assembly of mitochondrial complex I and mutations in its gene cause

disease. EMBO J., 26, 3227-3237.

15. Saada,A., Edvardson,S., Rapoport,M., Shaag,A., Amry,K., Miller,C., Lorberboum-

Galski,H., Elpeleg,O. (2008) C6ORF66 is an assembly factor of mitochondrial complex

I. Am. J. Hum. Genet., 82, 32-38.

16. Pagliarini,D.J., Calvo,S.E., Chang,B., Sheth,S.A., Vafai,S.B., Ong,S.E., Walford,G.A.,

Sugiana,C., Boneh,A., Chen,W.K., et al. (2008) A mitochondrial protein compendium

elucidates complex I disease biology. Cell, 134, 112-123.

17. Sugiana,C., Pagliarini,D.J., McKenzie,M., Kirby,D.M., Salemi,R., bu-Amero,K.K.,

Dahl,H.H., Hutchison,W.M., Vascotto,K.A., Smith,S.M., et al. (2008) Mutation of

C20orf7 disrupts complex I assembly and causes lethal neonatal mitochondrial disease.

Am. J. Hum. Genet., 83, 468-478.

18. Loeffen,J.L., Smeitink,J.A., Trijbels,J.M., Janssen,A.J., Triepels,R.H., Sengers,R.C.,

van den Heuvel,L.P. (2000) Isolated complex I deficiency in children: clinical,

biochemical and genetic aspects. Hum. Mutat., 15, 123-134.



ownloaded from


20

19. Vogel,R.O., Dieteren,C.E., van den Heuvel,L.P., Willems,P.H., Smeitink,J.A.,

Koopman,W.J., Nijtmans,L.G. (2007) Identification of mitochondrial complex I

assembly intermediates by tracing tagged NDUFS3 demonstrates the entry point of

mitochondrial subunits. J. Biol. Chem., 282, 7582-7590.

20. Vogel,R.O., van den Brand,M.A., Rodenburg,R.J., van den Heuvel,L.P., Tsuneoka,M.,

Smeitink,J.A., Nijtmans,L.G. (2007) Investigation of the complex I assembly

chaperones B17.2L and NDUFAF1 in a cohort of CI deficient patients. Mol. Genet.

Metab, 91, 176-182.

21. Distelmaier,F., Koopman,W.J., Testa,E.R., de Jong,A.S., Swarts,H.G., Mayatepek,E.,

Smeitink,J.A., Willems,P.H. (2008) Life cell quantification of mitochondrial membrane

potential at the single organelle level. Cytometry A, 73, 129-138.

22. Verkaart,S., Koopman,W.J., Cheek,J., van Emst-de Vries SE, van den Heuvel,L.W.,

Smeitink,J.A., Willems,P.H. (2007) Mitochondrial and cytosolic thiol redox state are not

detectably altered in isolated human NADH:ubiquinone oxidoreductase deficiency.

Biochim. Biophys. Acta, 1772, 1041-1051.

23. Verkaart,S., Koopman,W.J., van Emst-de Vries SE, Nijtmans,L.G., van den

Heuvel,L.W., Smeitink,J.A., Willems,P.H. (2007) Superoxide production is inversely

related to complex I activity in inherited complex I deficiency. Biochim. Biophys. Acta,

1772, 373-381.

24. Troelstra,C., van Gool,A., de Wit,J., Vermeulen,W., Bootsma,D., Hoeijmakers,J.H.

(1992) ERCC6, a member of a subfamily of putative helicases, is involved in

Cockayne's syndrome and preferential repair of active genes. Cell, 71, 939-953.

25. de Waard,H., de Wit,J., Andressoo,J.O., van Oostrom,C.T., Riis,B., Weimann,A.,

Poulsen,H.E., van Steeg,H., Hoeijmakers,J.H., van der Horst,G.T. (2004) Different

effects of CSA and CSB deficiency on sensitivity to oxidative DNA damage. Mol. Cell

Biol., 24, 7941-7948.

26. Jakobsson,A., Westerberg,R., Jacobsson,A. (2006) Fatty acid elongases in mammals:

their regulation and roles in metabolism. Prog. Lipid Res., 45, 237-249.



ownloaded from


21

27. Denic,V., Weissman,J.S. (2007) A molecular caliper mechanism for determining very

long-chain fatty acid length. Cell, 130, 663-677.

28. Barghuti,F., Elian,K., Gomori,J.M., Shaag,A., Edvardson,S., Saada,A., Elpeleg,O.

(2008) The unique neuroradiology of complex I deficiency due to NDUFA12L defect.

Mol. Genet. Metab., 94, 78-82.

29. Lazarou,M., McKenzie,M., Ohtake,A., Thorburn,D.R., Ryan,M.T. (2007) Analysis of

the assembly profiles for mitochondrial- and nuclear-DNA-encoded subunits into

complex I. Mol. Cell Biol., 27, 4228-4237.

30. Vogel,R.O., Janssen,R.J., van den Brand,M.A., Dieteren,C.E., Verkaart,S.,

Koopman,W.J., Willems,P.H., Pluk,W., van den Heuvel,L.P., Smeitink,J.A.,

Nijtmans,L.G. (2007) Cytosolic signaling protein Ecsit also localizes to mitochondria

where it interacts with chaperone NDUFAF1 and functions in complex I assembly.

Genes Dev., 21, 615-624.

31. Hoefs,S.J., Dieteren,C.E., Distelmaier,F., Janssen,R.J., Epplen,A., Swarts,H.G.,

Forkink,M., Rodenburg,R.J., Nijtmans,L.G., Willems,P.H., et al. (2008) NDUFA2

complex I mutation leads to Leigh disease. Am. J. Hum. Genet., 82, 1306-1315.

32. Nance,M.A., Berry,S.A. (1992) Cockayne syndrome: review of 140 cases. Am. J. Med.

Genet., 42, 68-84.

33. Andressoo,J.O., Hoeijmakers,J.H. (2005) Transcription-coupled repair and premature

ageing. Mutat. Res., 577, 179-194.

34. Ikeda,M., Kanao,Y., Yamanaka,M., Sakuraba,H., Mizutani,Y., Igarashi,Y., Kihara,A.

(2008) Characterization of four mammalian 3-hydroxyacyl-CoA dehydratases involved

in very long-chain fatty acid synthesis. FEBS Lett., 582, 2435-2440.

35. Smeitink,J., Sengers,R., Trijbels,F., van den Heuvel,L. (2001) Human

NADH:ubiquinone oxidoreductase. J. Bioenerg. Biomembr., 33, 259-266.

36. Calvaruso,M.A., Smeitink,J., Nijtmans,L. (2008) Electrophoresis techniques to

investigate defects in oxidative phosphorylation. Methods, 46, 281-287.



ownloaded from


22

37. Vogel,R.O., Janssen,R.J., Ugalde,C., Grovenstein,M., Huijbens,R.J., Visch,H.J., van den

Heuvel,L.P., Willems,P.H., Zeviani,M., Smeitink,J.A., Nijtmans,L.G. (2005) Human

mitochondrial complex I assembly is mediated by NDUFAF1. FEBS J., 272, 5317-

5326.

38. Nijtmans,L.G., Henderson,N.S., Holt,I.J. (2002) Blue Native electrophoresis to study

mitochondrial and other protein complexes. Methods, 26, 327-334.

39. McMullan,D.J., Bonin,M., Hehir-Kwa,J.Y., de Vries,B.B., Dufke,A., Rattenberry,E.,

Steehouwer,M., Moruz,L., Pfundt,R., de Leeuw,N. et al. (2009) Molecular karyotyping

of patients with unexplained mental retardation by SNP arrays: A multicenter study.

Hum. Mutat. (Epub ahead of print).

40. Visch,H.J., Rutter,G.A., Koopman,W.J., Koenderink,J.B., Verkaart,S., de Groot,T.,

Varadi,A., Mitchell,K.J., van den Heuvel,L.P., Smeitink,J.A., Willems,P.H. (2004)

Inhibition of mitochondrial Na+-Ca2+ exchange restores agonist-induced ATP

production and Ca2+ handling in human complex I deficiency. J. Biol. Chem., 279,

40328-40336.

41. Komen,J.C., Distelmaier,F., Koopman,W.J., Wanders,R.J., Smeitink,J., Willems,P.H.

(2007) Phytanic acid impairs mitochondrial respiration through protonophoric action.

Cell Mol. Life Sci., 64, 3271-3281.

42. Jaspers,N.G., Raams,A., Silengo,M.C., Wijgers,N., Niedernhofer,L.J., Robinson,A.R.,

Giglia-Mari,G., Hoogstraten,D., Kleijer,W.J., Hoeijmakers,J.H., Vermeulen,W. (2007)

First reported patient with human ERCC1 deficiency has cerebro-oculo-facio-skeletal

syndrome with a mild defect in nucleotide excision repair and severe developmental

failure. Am. J. Hum. Genet., 80, 457-466.

43. Jaspers,N.G., Raams,A., Kelner,M.J., Ng,J.M., Yamashita,Y.M., Takeda,S.,

McMorris,T.C., Hoeijmakers,J.H. (2002) Anti-tumour compounds illudin S and

Irofulven induce DNA lesions ignored by global repair and exclusively processed by

transcription- and replication-coupled repair pathways. DNA Repair (Amst), 1, 1027-

1038.



ownloaded from


23

44. Valianpour,F., Selhorst,J.J., van Lint,L.E., van Gennip,A.H., Wanders,R.J., Kemp,S.

(2003) Analysis of very long-chain fatty acids using electrospray ionization mass

spectrometry. Mol. Genet. Metab, 79, 189-196.



ownloaded from


24

Figure legends

Figure 1. BN- and SDS-PAGE analysis of patient and control fibroblasts. A. 1D BN-PAGE

shows a decrease in fully assembled CI activity and protein amount for the index patient

(P(del)) in duplicate, compared to control fibroblasts (C1 and C2). Subunits against which the

antibodies are used are depicted in between brackets. B. SDS-PAGE shows decreased levels

of CI subunits in the patient and a total lack of assembly chaperone NDUFAF2. Two CI-

deficient patients with unknown mutations are also shown (lanes 2 and 3). IGA: in-gel

activity assay

Figure 2. Complementation of the CI defect with wild-type NDUFAF2. A. BN-PAGE

analysis of transduction of patient and control fibroblasts with baculoviral constructs

encoding either wild-type GFP-tagged NDUFAF2, or GFP targeted to mitochondria by the

COX8 leader peptide. CI activity as well as protein amount have specifically been restored to

normal control levels for the index patient (P(del)) upon NDUFAF2 transduction, when

compared to transduction with COX8-GFP. Healthy control fibroblasts (C1 and C2) show no

changes in CI activity and protein amount after transduction with wild-type NDUFAF2. The

CI defect in patients with mutations in the NDUFS4 (P(S4)) and NDUFS7 (P(S7)) subunits

cannot be complemented by wild-type NDUFAF2. Levels of CII and CIII remain unaffected

upon transduction in each cell line. Subunits against which the antibodies are used are

depicted in between brackets. B. SDS-PAGE analysis of expression of NDUFAF2-GFP and

COX8-GFP constructs in patient and control fibroblasts using polyclonal anti-EGFP antibody.

untr: untransduced; AF2: NDUFAF2-GFP transduced; COX8: COX8-GFP transduced;

830kD: 830-kDa subcomplex of CI; IGA: in-gel activity assay

Figure 3. Complex I assembly profile of patient and control fibroblasts. 2D BN/SDS-PAGE

shows accumulation of low-molecular weight subcomplexes 1-5 in the index patient’s

fibroblasts (P(del)) and a decrease in the NDUFAF1-containing complex (see *), compared to

control fibroblasts (C2). Subcomplexes have been numbered according to the human CI

assembly pathway model described before (19). Accumulation of ‘appearing subcomplex 1’

(a1) is also more pronounced for the patient. Normal levels of COXII demonstrate

undisturbed CIV assembly.



ownloaded from


25

Figure 4. Measurement of mitochondrial membrane potential, cellular NAD(P)H and cellular

superoxide levels. Measurements were performed on patient and control fibroblasts that

remained untransduced or had been transduced with the NDUFAF2-GFP baculoviral

construct. Measurements of all transduced and untransduced patient cells have been

normalized to the average values of the corresponding transduced and untransduced healthy

control cells, respectively. A. Mitochondrial membrane potential of patient (P(del), n=68;

P(S7), n=31) and control (C1, n=58) fibroblasts was estimated from the average measured

TMRM fluorescence pixel intensity. Wild-type NDUFAF2 almost completely restores

membrane potential to normal control levels (C1, n=55) in the index patient (P(del), n=87),

whereas no significant effect can be observed for the complex I-deficient NDUFS7 patient

(P(S7), n=82). B. Cellular NAD(P)H levels of patient (P(del), n=34; P(S2), n=57) and control

(C1, n=57) fibroblasts were measured as average NAD(P)H autofluorescence intensity.

NAD(P)H levels have significantly been reduced in the index patient (P(del), n=84) upon

NDUFAF2-GFP transduction, but have not been changed for an NDUFS2 patient (P(S2),

n=59). Control: C1, n=44. C. Cellular superoxide levels of patient (P(del), n=130; P(S7),

n=89) and control fibroblasts (C1, n=388) were measured as rates of HEt oxidation. The

levels of superoxide production have significantly been reduced in the index patient (P(del),

n=145) upon NDUFAF2-GFP transduction, but have not been changed for the NDUFS7

patient (P(S7), n=157). Control: C1, n=215. P values < 0.01 (**) and < 0.001 (***) were

considered significantly different from corresponding control.

Figure 5. NER analysis of patient and control fibroblasts after exposure to UV radiation. A.

NER activities of the index patient have been expressed as percentages of UV-exposed

healthy control cells tested in the same experiment. Global genome NER (GG) was measured

autoradiographically as ‘unscheduled DNA synthesis’ and transcription-coupled NER (TC)

by recovery of overall RNA synthesis after UV exposure as described elsewhere (24). B.

Overall cell survival after exposure to graded UV doses (25). Proliferative activity of patient

and control fibroblasts after UV exposure has been expressed as a percentage of unirradiated

cells. The UV-survival curve of the index patient matches the curve of a known CSA patient.

NER: nucleotide excision repair



ownloaded from


26

Table 1. OXPHOS enzyme activities in fibroblasts

Enzyme activitiesa Activity (Reference

Complex I 49 (110-260)

Complex II 871 (536-1027)

Complex III 2170 (1270-2620)

Complex II+III (Succ:cyt c oxidoreductase; 189 (160-440)

Complex IV (Cytochrome c oxidase) 801 (680-1190)

Complex V (ATP synthase) 421 (209-935)

Citrate synthase 250 (144-257)

aEnzyme activities are expressed in mU/mU COX except for complex IV,

which is expressed in mU/mU CS, and citrate synthase (CS), which is

expressed in mU/mg protein. COX and CS levels were normal in the patient.

Enzymatic activities were measured in triplicate in at least two independent

patient-derived samples.



ownloaded from


27

Figure 1



ownloaded from


28

Figure 2



ownloaded from


29

Figure 3



ownloaded from


30

Figure 4



ownloaded from


31

Figure 5



ownloaded from


contiguous gene deletion of elovl7, ercc8 and ndufaf2 in a patient with a fatal multisystem disorder

Documents