biphosphinic palladacycle complex mediates lysosomal-membrane permeabilization and cell death in...

logy 542 (2006) 37–47www.elsevier.com/locate/ejphar

European Journal of Pharmaco

Biphosphinic palladacycle complex mediates lysosomal-membranepermeabilization and cell death in K562 leukaemia cells

Christiano M.V. Barbosa a, Carlos R. Oliveira b, Fábio D. Nascimento c, Mickaela C.M. Smith d,Daniela M. Fausto a, Marco Antonio Soufen a, Eliana Sena a, Ronaldo C. Araújo a,

Ivarne L.S. Tersariol a, Claudia Bincoletto a,⁎, Antonio C.F. Caires a

a Centro Interdisciplinar de Investigação Bioquímica (CIIB), Universidade de Mogi das Cruzes (UMC), Mogi das Cruzes, SP, Brazilb Instituto de Ciências Biomédicas IV, Universidade de São Paulo, São Paulo/SP, Brazil

c Departamento de Bioquímica, Universidade Federal de São Paulo, Escola Paulista de Medicina, São Paulo/SP, Brazild Departamento de Farmacologia, Faculdade de Ciências Médicas, UNICAMP, Campinas-SP, Brazil

Received 24 January 2006; received in revised form 24 May 2006; accepted 2 June 2006Available online 10 June 2006

Abstract

The cell death mechanism of cytotoxicity induced by the Biphosphinic Palladacycle Complex (BPC) was studied using a K562 leukaemia cellline. The IC50 values obtained for K562 cells post-72 h of BPC were less than 5.0 μM by using 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) and trypan blue assays. Using the Acridine Orange vital staining combining fluorescence microscopy it was observedthat the complex triggers apoptosis in K562 cells, inducing DNA fragmentation, as analysed through electrophoresis. Lysosomal-membranepermeabilization was also observed in K562 cells post-5 h of BPC, which suggests intralysossomal accumulation by proton-trapping, since its pKa

value ranged from 5.1 to 6.5. Caspase-3, and -6 activity induced by BPC in K562 cells was prevented by the cathepsin-B inhibitor [N-(L-3-trans-propylcarbamoyl-oxirane-2-carbonyl)-L-isoleucyl-L-proline] (CA074). These events occurred in the presence of endogenous bcl-2 and baxexpression. Acute toxicological studies demonstrated that BPC produces no lesions for liver and kidney fourteen-days after drug administration(100 mg/kg — i.p.). White and red blood cells of BPC-treated mice presented normal morphological characteristics. Taken together, these datasuggest a novel lysosomal pathway for BPC-induced apoptosis, in which lysosomes are the primary target and cathepsin B acts as death mediator.© 2006 Elsevier B.V. All rights reserved.

Keywords: Palladacycle; K562; Bcl-2/Bax; Apoptosis; Lysosomes; Acridine orange

1. Introduction

Deregulation of apoptosis can disrupt the delicate balancebetween cell proliferation and cell death and can lead to diseasessuch as cancer (Thompson, 1995; Danial and Korsmeyer,2004). Therefore drugs that restore the normal apoptoticpathway have the potential for effectively treating cancer thatdepend on aberrations of the apoptotic pathway to stay alive(Fesik, 2005).

⁎ Corresponding author. Universidade de Mogi das Cruzes (CIIB), Av. Dr.Candido Xavier de Almeida Souza, 200, CEP 08701-970, C.P. 411, Mogi dasCruzes/SP, Brazil. Tel./fax: +55 11 47987102.

E-mail address: [email protected] (C. Bincoletto).

0014-2999/$ - see front matter © 2006 Elsevier B.V. All rights reserved.doi:10.1016/j.ejphar.2006.06.004

Chronic myelogenous leukaemia is a haematologicaldisorder characterised by a translocation that creates a fusionbetween the bcr gene on chromosome 22 and the c-abl gene onchromosome 9 to form what is known as the Philadelphia t(9;22) chromosome (Ph1) (Mes-Masson et al., 1986). Thistranslocation produces a chimeric oncogene, bcr-abl, whichencodes a 210-kDa fusion protein (Bcr-abl) with unregulatedtyrosine kinase activity (Konopka et al., 1985). The tyrosinekinase activity of Bcr-abl, which is the principal driving forcebehind its oncogenic potential, is responsible for mediatingtyrosine phosphorylation of specific cellular proteins and Bcr-abl itself (Hantschel and Superti-Furga, 2004). Although thereis evidence that the Bcr-abl oncoprotein acts as a proliferativeactivator (Elefanty et al., 1990), its major function appears to be

mailto:[email protected]

http://dx.doi.org/10.1016/j.ejphar.2006.06.004

38 C.M.V. Barbosa et al. / European Journal of Pharmacology 542 (2006) 37–47

acting as an apoptotic suppressor (Dou et al., 1999). Moreover,the resulting Bcr-abl protein product is an oncoprotein thatconfers resistance to apoptosis induced by many anticancerdrugs (Bedi et al., 1994; McGahon et al., 1994; Bedi et al.,1995; Martins et al., 1997). Resistance to chemotherapy hasalso been reported to be associated mainly with bcl-2overexpression (Schimmer et al., 2001).

The Bcl-2 class of anti-apoptotic proteins are importantinhibitors of the mitochondria-mediated pathway of apoptosisand are common targets of novel therapeutic agents. Theseproteins inhibit apoptosis by interacting with Bax/Bak andforming inactivating heterodimers (Oltvai et al., 1993). Bcl-2also blocks the release of cytochromo c, thereby, preventing theactivation of caspase-9 and its downstream caspase, whichusually renders the cells insensitive to drug-induced apoptosis.Recently, Dai et al. (2004) reported that bcl-2 cooperates withbcr-abl to promote leukaemogenesis and a more aggressivetumour phenotype. Although increased bcl-2 expression hasbeen observed in imatinib-resistant K562 cells displaying lossof Bcr-abl (Donato et al., 2001), the functional role of thisphenomenon has not been investigated.

Emerging evidence argues that both classic apoptosispathways and lysosomal death pathways must be suppressedfor effective development and progression of cancer (Fehren-bacher and Jäättelä, 2005). The lysosomal proteases can bereleased from the lysosomes into the cytosol, where theycontribute to the apoptotic cascade upstream of mitochondria. Awide variety of death stimuli such as death-receptor activation,p53-induction microtubule-stabilising agents, oxidative stress,growth factor deprivation, and staurosporine can induce partiallysosomal-membrane permeabilization and the release ofcathepsins into the cytosol (Fehrenbacher and Jäättelä, 2005;Guicciardi et al., 2004). Depending on the extension of activecathepsins release to the cytoplasm, a variety of deathmorphologies from apoptosis can be triggered. Cathepsinsactivate the classical apoptosis event possibly by cleaving thepro-apoptotic Bcl-2 family member (Cirman et al., 2004).

Previous report has shown that the Biphosphinic Pallada-cycle Complex (BPC), a new organometallic complex, inducesapoptosis in HL60 and Jurkat leukaemia cells (Bincoletto et al.,2004), even in the presence of endogenous bcl-2/bax expres-sion. These studies suggest that BPC-induced apoptosisincludes a non-classical apoptosis pathway. Here, compellingevidence shows that BPC kills K562 cells, which are normallyresistant to chemotherapeutic agents (Martins et al., 1990). Thiseffect was also observed, even in the presence of endogenousbcl-2 family genes expression. Effectors caspase-3, and -6activation was prevented when BPC-treated K562 cells wereincubated previously with cathepsin-B inhibitor CA074 for 2 h.These results suggest that lyssosomal leakage and cathepsin Brelease into the cytosol are involved in K562 BPC-inducedapoptosis.

Since the toxicity of many drugs used in chemotherapy limitstheir clinical success, we also analysed here the acute toxicity ofBPC. Histopathological studies demonstrated that BPC(100 mg/kg — i.p.) produces any detectable lesion forimportant organs such as kidney and liver. Similar results

were observed in the peripheral blood cells morphology post-BPC treatment.

The results presented here introduce a novel lysosomalpathway for BPC-induced apoptosis. As metal complexes arenormally toxic for many tissues and suppress some biologicalprocess (Bakhtiar and Ochiai, 1999), further studies are alsonecessary to identify the toxic effects of BPC for normal tissues.

2. Materials and methods

2.1. Biphosphinic palladacycle complex [Pd(C2,N-(S(−) dmpa)(dppf)] Cl

Ionic compounds having chelating biphosphinic ligand withthe general structure [Pd(C2,N-dmpa)(L)] Cl (L=bidentate dppfligand) were synthesized from the reactions of the startingcyclopalladated complexes with the biphosphinic ligand (L).From the described starting compounds, cyclopalladatedcomplexes were synthesized by reactions with the 1,1′-bis(diphenylphosphine)ferrocene (dppf). The resulting productsdepended on the stoichiometry and solvents used. Ionic andmolecular complexes were isolated having one or two metalliccenters and containing the biphosphinic ligand coordinated inthe mono or bidentate way to the palladium(II) ion. A molarratio of 2:1 of biphosphinic ligand to palladium complex wasused. Thus, 0.2 mmol of dimeric cyclopalladated compoundswere partially dissolved in 50 ml of acetone and 0.4 mmol ofbiphosphinic ligand (L) were added to the resulting suspension.After constant agitation at room temperature, for 1 h, the solventwas evaporated under reduced pressure, and the reaction wasprecipitated by hexane addition. This solid was filtered, washedwith Et2O and dried under vacuum (Bincoletto et al., 2005).

2.2. [Pd(C2,N-(S(−)dmpa)(dppf)] Cl

Elemental analysis found % (calcd): C, 61.90 (62.50); H,4.94 (5.01), N, 1.53 (1.65). [1H] NMR (ppm): –CH–CH3⁎ (6H,d, 1.55); –N(CH3)2 (3H, s, 2.16); Cp (5H, m, 4.21) Cp(5H, m,4.49); –CH⁎–CH3 (2H, q, 3.97); H-aromatic rings (24, m,7.25–7.32. [31P]{1H} NMR (ppm): 2 singles: 23.0, 32.1.ΛM=51.1 S cm2/mol−1.

FTIR/ATR measurements were performed using a PerkinElmer (Spectrum One spectrometer) in the range of 4000–650 cm−1, using a 2 cm−1 resolution. ZnSe 45° monocrystalplate was used as an optical internal reflection element (Colthupet al., 1964). The pKa values of the samples were obtained fromchanges in IR absorbance at 2750 cm−1 and 2300 cm−1 as afunction of pH.

2.3. Cell cultures

K562 chronic myelogenous leukaemia cell line is derivedfrom a chronic myelogenous leukaemia patient and expressesthe Bcr-abl protein (McGahon et al., 1994). Previous studieshave shown that this cell line is particularly resistant to celldeath via apoptosis, irrespective to the inducing agent used(Martins et al., 1990, 1997; Bedi et al., 1994, 1995; McGahon et

39C.M.V. Barbosa et al. / European Journal of Pharmacology 542 (2006) 37–47

al., 1994). For the experiments, K562 cells line obtained fromthe Rio de Janeiro Cell Bank/RJ, Brasil) was cultured insuspensions in RPMI 1640 medium (Sigma Chemical Co., MO)supplemented with 10% fetal calf serum, 100 UI/ml ofpenicillin, and 100 μg/ml of streptomycin in a humidifiedatmosphere at 37 °C in 5% CO2. Cells were seeded(3×105 cells/ml) in 96 wells and incubated with differentconcentrations of BPC for 72 h. The complex was firstlydissolved in dimethyl sulfoxide (DMSO) and then in supple-mented medium. The final concentration of DMSO in the testmedium and controls was 0.1%. Cell viability was determinedby the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazoliumbromide reduction test (MTT) and the trypan blue assay, asdescribed previously (Melo et al., 2001). Each concentrationwas tested in three different experiments run on triplicates.

2.4. Reverse transcriptase-polymerase chain reaction(RT-PCR)

Total RNA of 72 h BPC-treated K562 cells (1.2, 3.6 and6.0 μM) and untreated control cells were performed usingTrizol® (GIBCO-BRL, Gaithersburgh, Md., USA), followingthe manufacturer's instruction. Expression of β-actin, bax andbcl-2 was monitored by the standard reverse transcriptase-polymerase chain reaction (RT-PCR) as previously described(Brito and Borojevic, 1997) using thirty amplification cycles.The sequence of primers used is listed in Table 1.

2.5. Assessment of apoptosis

For DNA fragmentation detection, K562 cells (106/ml)treated with BPC (1.2, 3.6 and 6.0 μM) for 72 h werecentrifuged at 300 ×g for 5 min, washed twice with ice-coldPBS, pelleted, and incubated in 200 μl of lysis buffer (10 mMTris–HCl, 10 mM EDTA, pH 8.0, 0.5% sodium sarcosinate and1 mg/ml proteinase K) for 3 h at 56 °C and treated with 0.5 mg/ml RNase for another hour at 56 °C. DNA was extracted withphenol/chloroform/isoamyl alcohol (25:24:1 v/v) before load-ing. Samples were mixed with loading buffer (50 mM Tris,10 mM EDTA, 1% [w/w] low-melting-point agarose, and0.025% [w/w] bromophenol blue) and loaded onto a pre-solidified 2% agarose gel containing 0.1 μg/ml ethidiumbromide. The agarose gels were run at 50 V for 90 min inTBE buffer, then observed and photographed under UV light.Acridine Orange (AO) combining fluorescence microscopy wasalso used to determine the morphological characteristic ofapoptotic cells. Acridine Orange is an intercalating, nucleic acid

Table 1RT-PCR primers used for the bcl-2 and bax expression-monitoring assay

Gene Primer sequence Reference

β-actin 5′GTGGGCCGCTCTAGGCACCA3′ Alonso et al.(1986)5′CTCTTTGATGTCACGCACGATTTC3′ 540 bp

Bcl-2 5′CGACGACTTCTCCCGCCGCTACCGC3′ Osorio et al.(1997)5′CCGCATGCTGGGGCCGTACAGTTCC3′ (319 bp)

Bax 5′GCTCTGAGCAGATCATGAAGACAG3′ Osorio et al.(1997)5′CACAAAGATGGTCACGGTCTGC3′ (488 bp)

specific, fluorochrome, which emits a green fluorescence whenit is bound to DNA. (Mishell et al., 1980, Mpoke and Wolfe,1997). Viewed by fluorescence microscopy, viable cells appearto have a bright green nucleus with intact structure whileapoptotic cells exhibit a bright green nucleus showingcondensation of chromatin as dense green areas. For theexperiments, briefly 1 μl of stock solution containing 100 μg/mlof acridine orange was added to 25 μl of K562 cell suspensionand viewed at fluorescent microscopy at a band fluoresceinfilter (520–560 nm).

2.6. Caspase activity

Direct measurements of caspase activity were performedusing colorimetric protease kits (R&D Systems, USA) accord-ing to the manufacturer's recommendations, after the incubationof cells with BCP for 72 h (1.2, 3.6 and 6.0 μM). As K562 cellsfail to undergo apoptosis during the first 4 to 24 h after treatmentwith a variety of stimuli (Martins et al., 1997), this evaluationwas also performed in K562 cells in both conditions, treatedwith BPC for 5 h and treated previously with cathepsin-Binhibitor [N-(L-3-trans-propylcarbamoyl-oxirane-2-carbonyl)-L-isoleucyl-L-proline] (CA074) for 2 h. The caspase activityassay is based on the spectrophotometer detection of thechromophore p-nitroanilide (pNA) after cleavage from thesubstrates X-pNA, where X stands for amino acid sequencesrecognized by the specific caspase-3, and -6. According to theprocedure, 2×106 cells were pelleted by centrifugation andlysed on ice. The protein concentration in the lysed wasmeasured using a Bio-Rad Protein assay (Bio-Rad Laboratories,Inc., USA). This assay is based on the method of Bradford, and200 μg of protein were incubated with each X-pNA substrate(200 μM final concentration) at 37 °C in a microtiter plate. Theoptic density of samples was measured at 405 nm. Aftersubtraction of the background, the increase in the caspaseactivity was determined by comparing these results with thelevels on the untreated control.

2.7. Lysosomal-membrane permeabilization evaluated by laserscanning confocal microscopy

The presence of hydrophobic groups as well as the proton-trapping amino group in the structure of BPC (Fig. 1) suggeststhat this molecule has lysosomotropic properties. So, the BPCmolecule, at the acidic lysosomal pH, can accumulate heavilyintralysosomally inducing membrane rupture and apoptosis. Inorder to observe the lysosomotropic properties of BPC moleculewe have used the acridine orange uptake and relocation methodsas described previously (Olsson et al., 1989; Rundquist et al.,1984; Zdolsek et al., 1999). Acridine orange, a metachromaticfluorophore, accumulates mainly in the acidic vacuolarapparatus, preferentially in secondary lysosomes. When excitedby blue light (relocation method) it shows red and greenfluorescences at high (lysosomal) or low (nuclear and cytosolic)concentrations, respectively. If however, green excitation lightis used (uptake method), only concentrated lysosomal acridineorange is demonstrated by its red or orange fluorescence.

Fig. 1. Structure of biphosphinic palladacycle complex [Pd(C2,N-(S(−) dmpa)(dppf)] (A). Estimated BPC pKa value ranged from 5.1 to 6.5 (B), which strongly suggeststertiary amine group protonation with intralysosomal accumulation by proton-trapping.


Rupture of initially acridine orange-loaded lysosomes may bemonitored as an increase in cytoplasmic diffuse green, or adecrease in granular red, fluorescence (Brunk and Svensson,1999; Antunes et al., 2001).

For imaging, K562 cells were grown on cover glasses andlabelled in vivo with 5 μg/ml of acridine orange in RPMI 1640medium without serum for 15 min at 37 °C in 5% CO2.Thereafter, the cells were washed with RPMI 1640 medium andthen exposed to 6.0 μM BPC for 5 h at 37 °C in 5% CO2. Thefluorescent signals of acridine orange were taken with a ZeissLSM 510 confocal microscope (Jena, Germany).

2.8. Acute toxicity evaluation

Swiss mice were treated with a dose of 100 mg/kg of BPC—i.p., which was dissolved in phosphate buffer, pH=7.4,containing DMSO (at a final concentration of 1%). Controlanimals received diluents only. After fourteen days of BPCadministration, the animals were sacrificed and followinganalyses performed.

2.8.1. Haematological evaluationsBlood from Swiss mice was collected by caudal puncture

using heparinized micro-capillaries for relative amounts (%) ofgranulocytes and lymphocytes upon the administration of BPC.Smears were prepared directly from venous blood and stainedwith Leishman's stain for differential leukocytes analysis andcytological observations, such as erythroid degenerativechanges, increased numbers of macroplatelets, spherocytosis,erythroblastemia, and toxic neutrophil morphology (Behmer etal., 1976).

2.8.2. Histopathological studiesIt was performed according to Dacie and Lewis (1975).

Briefly, fragments of liver and kidney of BPC-treated mice werefixed in a 10% buffered formaldehyde suspension. Aftermounting in paraffin blocks they were cut to a thickness of4 μm using a microtone Spencer 820 American Optical andsubsequently stained with HE technique. The tissue analyseswere performed using a Nicon Eclipse E-200 mod. OlympusBH-2 microscope.

2.9. Statistical analysis

Data for each assay mean=S.D. of three independentexperiments run in triplicate, were analysed statistically byanalysis of variance between groups (ANOVA). Multiplecomparisons among group mean differences were checkedwith Turkey posttest. Differences were considered significantwhen P-value was less than 0.05. The results were expressed aspercentage of the controls and the computer software package“Origin” was used to determine the IC50 values (concentrationthat exhibits a 50% inhibitory effect on the evaluatedparameter).

3. Results

3.1. pKa value of BPC

This assay was performed using the spectra comparison ofthe compound in pH band from one to twelve. Our results haveshown that in this pH range, multiple spectrum absorptionbands can be obtained between 2750 and 2300 cm−1, which

Fig. 2. Viability of K562 cells after treatment with BPC for 72 h. Endpointevaluated by MTT reduction endpoint screening and trypan blue exclusionassay. Each point represents the mean±S.D. of the three experiments with threereplicates. IC50% of 4.1 μM and 2.9 μM for MTT and trypan blue assays,respectively.


involve vibrational normal modes of −NH+ group. Thus, FTIR/ATR experiments showed that BPC presents an estimated pKa

that ranged from 5.1 to 6.5 (Fig. 1). This result could be

Fig. 3. DNA fragmentation from K562 cells after 72 h incubation with different BPC(C). Control BPC non-treated K562 cells (B). Note that the apoptosis process is cleobtained in three replicate experiments.

attributed to the Pd–N coordination bond breakage andrespective protonation of the tertiary amine group presents inthe palladium complex.

3.2. Cytotoxicity and apoptosis induction in K562 BPC-treatedcells

Measurement of the number of living cells using MTT orsimilar assays in drug-treated and control cultures is the mostcommonly used endpoint in cell-based screening experiments.A decrease in the cell number may be due to inhibition of cellproliferation or due to cell death (induction of apoptosis ornecrosis) (Erdal et al., 2005). Based on this finding, using theMTT endpoint screening and trypan blue exclusion assay, westudied the viability of K562 cells after 72 h in culture withBPC. The IC50 values for BPC in these cells were 4.1 and2.9 μM, respectively (Fig. 2). We next examined whether thecell death caused by BPC was due to apoptosis. The occurrenceof apoptosis was determined by morphological evaluation afteracridine orange staining, since the condensed nucleus ofapoptotic cells sequesters acridine orange (Lu and Wolfe,2001). As shown in Fig. 3B, untreated cells exhibit typical,

concentrations (A). Typical changes of apoptosis in K562 cells stained with AOarly presented in this cell line. The picture A is representative of similar results

Fig. 4. Activation of caspase-3, and -6 in K562 cells after 5 and 72 h incubationwith different BPC concentrations. Caspase activity was calculated as foldinduction of basal caspase-3, and -6 activity in non-treated K562 samples. Eachcolumn represents the mean±S.D. of the two experiments run in triplicate.aP<0.01 compared to control.

Fig. 5. RT-PCR showing the Bcl-2 and Bax expression of K562 cells.Leukaemic cells were treated with different BPC concentrations for 72 h (μM).All experiments used negative control (sample without RNA) (A). The picturesare representative of similar results obtained in the two experiments. β-actin wasused as an internal standard. Size marker used (ϕλ) (Life Technologies).Densitometry analysis (B). The results represent the ratio between Bcl-2, Baxand β-actin. Results are expressed as percentage of the non-treated K562 cells.


fairly round morphology 72 h culture. K562 BPC-treated cellsexhibited chromatin condensation, which is expressed by densegreen areas. Apoptotic bodies, which are membrane-enclosedvesicles that have budded of the cytoplasmatic extension (whitearrows), were also identified in BPC-treated cells (Fig. 3C).These results were corroborating by the DNA fragmentationassay after 72 h post-BPC exposure. As it is depicted in the Fig.3A, BPC exposure of K562 cells results in a classicalcharacteristic of DNA fragmentation with all concentrationsstudied (1.2, 3.6 and 6.0 μM). Taken together, these resultssuggest that the apoptotic process mediates BPC cytotoxicityfor K562 cells. Furthermore, determination of cell viabilityusing vital trypan blue assay, described above, indicated thatthey were not necrotizing.

3.3. Caspase activity

Previous studies have indicated that caspase activation playsa critical role in initiation of apoptosis active phase (Martin andGreen, 1995; Chinnaiyan et al., 1996, Liu et al., 1997). Theobservation prompted us to study the activation of effectorscaspase-3, and -6 in K562 cells. Both caspase studied wereactivated 5 and 72 h post-BPC exposure (Fig. 4). Interestingly,when we incubated the K562 cells with the cathepsin-Binhibitor (CA074) for 2 h previously BPC exposures(6.0 μM), caspase-3, and -6 activation was prevented, whichsuggests that this protease is a key of BPC-induced apoptosis.

3.4. Bcl-2 and bax expression

It has been suggested that the apoptotic regulator bcl-2 exertsits anti-apoptotic effects upstream of events that result inactivation of effector caspase (Kluck et al., 1997, Chinnaiyan etal., 1996). To assess the relevance of endogenous bcl-2expression for BPC-induced apoptosis, K562 cells were treatedwith 1.2, 3.6 and 6.0 μM of BPC for 72 h. Our resultsdemonstrated that there were no alterations in the endogenous

bcl-2 and bax expression, which presented similar to K562non-treated cells with all the concentrations assayed (Fig. 5).These results suggest that BPC appears to include a non-classical mechanism of apoptosis induction.

3.5. BPC uptake promotes leakage of lysosomes in K562 cells

The presence of multiple hydrophobic and proton-trappingbasic amino group in the structure of BPC suggests that thismolecule has lysosomotropic properties (De Duve et al., 1974).As a consequence, because of the acidic lysosomal pH, the BPCmolecule could accumulate heavily inside the organelleinducing a disruption of the lysosomal membrane. The BPCuptake-induced permeabilization of the endosomal/lysosomalmembranes might thus result in the leakage of the vesiclescontents to the cytosol, as previously described for othercationic molecules (Fuchs and Raines, 2004). We investigatedthis possibility by monitoring the fluorescent staining using thevital fluorogenic dye acridine orange, a substance thatpreferentially accumulates in acidic vesicles releasing a redfluorescence upon excitation with blue light, but a green ratherthan red fluorescence when it is presented in organelles ofneutral pH (Robbins and Marcus, 1963). The experiments werecarried out by loading the K562 cells with the endosomal/lysosomal marker acridine orange and, then, exposing them toBPC. A marked increase in green fluorescence was observedupon incubation with BPC, as seen by comparing the results

Fig. 6. Induction of LMP. A decrease in lysosomal (red) and an increase in cytosolic (green) fluorescence of AO-stained cells reflecting lysosomal rupture. K562 cellswere incubated with AO, washed, and treated with the BPC for 5 h. Untreated cells (A, B and C). (A) Intact lysosomes within most cells. (B) Low green fluorescencedue to the well-defined lysosomes membrane. (C) Absence of co-localization between red and green fluorescences. BPC-treated K562 cells (D, E and F). (D) Absenceof intact lysosomes expressed by an intense red fluorescence. (E) Increasing green fluorescence due to the AO release from lysosomes into the cytosol. (F) A clear co-localization between green and red fluorescences, which strongly suggest lysosomes membrane rupture.

Table 2Effects of BPC (100 mg/kg) on relative leukocyte count from peripheral bloodof mice fourteen days after drug administration

Groups Granulocytes (%) Lymphocytes (%)

Control 14.3±1.52 81.3±3.0BPC 30.5±9.6 a 63.3±5.7 a

a P=0.03 in relation to control — Student's t test).


shown in Fig. 6B and E, indicating leakage of the acridineorange from the lysosomes to the cytosol. Partial co-localizationof red and green fluorescences was observed in K562 cellstreated with BPC (Fig. 6F), strongly suggesting a lysosomalrupture with release of the lysosomal acridine orange to thecytosol. Note that untreated K562 cells stained with acridineorange showed a red fluorescence, which was restricted to thelysosomal vesicles (Fig. 6A). The green fluorescence observedin untreated K562 cells was localized in the cytoplasmic andnuclear compartments (Fig. 6B), without any noticeable co-localization of the red and green fluorescences in theseuntreated cells (Fig. 6C), indicating the integrity of thelysosomal membrane. Taken together, these results suggestthat BPC is capable of disrupting the lipid bilayer of lysosomalmembrane. The leakage of the lysosomes vesicles promotes thelysosomal contents spread to the cytoplasmic and nuclearcompartments.

3.6. Acute toxicological studies

Since the toxicity of chemotherapy drugs limits theirtherapeutic application, we also analysed here the acute toxicityof BPC fourteen-days after BPC administration (100 mg/kg —i.p.). Although this protocol of BPC-treatment producesalterations in the relative amounts of lymphocyte andgranulocyte (Table 2), absence of toxic neutrophil and atypicallymphocytes was noticed (data not shown). In addition, we havealso observed no changes in red blood cells morphology, suchas erythroid degenerations, spherocytosis and erythroblastemia

(data not shown). Moreover, no detectable lesions wereobserved in the liver and kidney of BPC-treated mice (Fig. 7)by histopathological analyses.

4. Discussion

Apoptosis is currently a subject of interest research, partiallybecause tumour cells are susceptible to death by apoptosis inresponse to a various drugs used in chemotherapy (Piwocka etal., 2001). For many years apoptosis research has focused oncaspase and their putative role as sole executioners ofprogrammed cell death. Accumulating information nowsuggests that lysosomal cathepsins are also pivotally involvedin this process, especially in pathological conditions (Guicciardiet al., 2004; Kroemer and Jäättelä, 2005). Lysosomes inadvanced tumour are abnormal in their content, sub-cellularlocalization and function, which offers an exciting possibility totarget them for the specific eradication of tumours (Kroemer andJäättelä, 2005). For example, enhancing the lysosomal celldeath pathway may be a therapeutic strategy to overcome theblocks in caspase-dependent cell death.

Fig. 7. Liver and kidney histopathological analysis (HE 400×). Note that thehepatocytes transoms (short arrow) (A) and kidney tubules and glomerule (B)are morphologically preserved.


Due to the BPC lysosomotropic properties, the goal of thepresent study was to elucidate the pathways that convey thecytotoxic signal by BPC to the death machinery using a Bcr-abl-expressing human chronic myelogenous leukaemia cell line(Martins et al., 1997), which fail to undergo apoptosis duringthe first 4 to 24 h after treatment with a variety of stimuli(Martins et al., 1990, 1997). The data obtained here clearlyshow that BPC is cytotoxic for this cell line presenting an IC50

of 2.9 and 4.1 μM using trypan blue exclusion and MTT assays,respectively, after 72 h incubation. Using two methods forpredict programmed cell death, we observed that BPC induced ahallmark of apoptosis such as dramatic morphological cellalterations, chromatin condensation, apoptotic bodies and DNAfragmentation. Interestingly, this apoptotic process was verifiedin K562 cells 5 h post-BPC incubation.

Recently, several studies have confirmed the involvement ofthe lysosomal proteases in apoptosis (Roberg et al., 1999;Roberg and Ollinger, 1998; Ishisaka et al., 1999; Guicciardi etal., 2000; Deiss et al., 1996; Vancompernolle et al., 1998).Cathepsin B, the most abundant in lysosomes (Turk et al., 2002)has been shown to play a dominant role in executing theapoptotic program in several tumour cell lines (Foghsgaard etal., 2001). Therefore, it seems that cathepsin B may play twoapposing roles in malignancy: as an executioner of apoptosis incytotoxic signalling cascades and as a mediator of tumoursinvasion (Guicciardi et al., 2004). It is unquestionable thatlysosomal enzymes, in order to participate to the apoptoticprocess, need to be translocated to the cytosol where most of thecellular proteins degraded during apoptosis are found. Owing to

its lysosomotropic properties, BPC accumulated within thelysosomes, where it permeabilized the lysosomal membrane, asshown by the relocation of AO marker from lysosomes into thecytosol. This event preceded caspase-3, and -6 activation, whichwas prevented when these cells were treated previously with thecathepsin-B inhibitor [N-(L-3-trans-propylcarbamoyl-oxirane-2-carbonyl)-L-isoleucyl-L-proline] (CA074) for 2 h. Theseresults strongly suggest that this protease is a key of BPC-induced apoptosis. These evidences are supported by the studyof Werneburg et al. (2002) demonstrating that cathepsin Bconfers increased resistance to lysosomal-membrane permea-bilization of hepatocytes, suggesting that lysosomal enzymesare not only passively released but can also participate to theprocess of membrane destabilisation from within the lysosome.

Apoptosis induced by active cathepsin B in turn promotesthe release of cytochromo c from mitochondria by cleaving oneor more still unidentified cytosolic substrates. Release ofcytochromo c results in cleavage of caspase-9 and caspase-3followed by further apoptotic changes (Guicciardi et al., 2004).Although we have not evaluated the cytochromo c release frommitochondria in BPC-treated K562 cells, we can not exclude theparticipation of this organelle in the results presented here, sinceit seems to have a central role in effector caspase activation(Guicciardi et al., 2004).

As proteins of the Bcl-2 family have an important role in theregulation of programmed cell death and also serve as potentialtargets for cancer therapy (Fesik, 2005), in this study, we havealso evaluated the levels of Bcl-2 and Bax oncoprotein mRNAin K562 BPC-treated cell. Our results demonstrated that BPCproduces no modulation in both genes expression, whichpresented similar to BPC-untreated K562 cells. Although theseresults suggest that alterations in these genes are not directmediators of BPC-induced apoptosis, the relationship of thisresult with the lysosome membrane permeabilization needsfurther investigation. For example, glicocorticoids, cAMP-modulating agents and flavopiridol induce apoptosis withoutthe downregulation of bcl-2 expression (Dowd and Miesfeld,1992; Achenbach et al., 2000). Currently, we cannot exclude thepossibility that BPC could affect the Bcl-2 protein at a post-transcriptional level, by altering its phosphorylation (May et al.,1993) or altering the expression of other apoptosis-related genesthat differentially regulate bcl-2 expression.

It is well documented that Bcr-abl can very potently inhibitsapoptotic induction by conventional chemotherapeutics (McGa-hon et al., 1994; Skorski, 2002). This resistance has beenattributed to a block in the promotion of mitochondriacytochromo c release, through both transcriptional and post-transcriptional regulation of bcl-2 members (Skorski, 2002). Asdemonstrated here, the apoptosis induced by BPC in K562 cellsseems not to be dependent from the bcl-2 family membersmodulation, which explain, at least in part, the results showingthat K562 cells are very susceptible to apoptosis induction byBPC in the first 5 h of incubation. Clearly, these results showthat BPC-induced lysosomal-membrane permeabilization canmediate K562 cells death in a bcl-2-independent manner.

It has been shown that cytosolic cysteine cathepsins couldalso process and activate Bid, a pro-apoptotic BH-3-only


protein of the bcl-2 family. Activation of Bid inducesmitochondrial outer-membrane permeabilization and celldeath (Cirman et al., 2004). Thus, the lysosomal-membranepermeabilization with consequently cytosolic cathepsins releasefrom lysosomes is not limited to activating intrinsic apoptosispathway (Kroemer and Jäättelä, 2005). In non-small-cell lungcancer (Broker et al., 2004) and in murine fibrosarcoma cells(Foghsgaard et al., 2001) cytosolic cysteine cathepsins caninduce apoptosis in a caspase-independent manner.

An elegant report of Holler et al. (2000) demonstrated thatlysosomal-membrane permeabilization could be induced bytumour necrosis factor receptor (TNFR-1), which requires thedeath domain-containing receptor-interacting protein 1 (RIP-1)and involves the generation of reactive oxygen species in acaspase-independent manner (Holler et al., 2000). Besidesextralysosomal signals, it is clear that many events occurringwithin the lysosome, i.e. iron-catalysed oxidative reactions, arealso very important to promote lysosomal-membrane permea-bilization. Indeed, oxidative stress together with intralysosomaliron which generates oxygen radicals through the Fentonreaction can promote oxidation of membrane lipids andlysosomal-membrane permeabilization (Werneburg et al.,2002). As BPC complex presents iron and palladium as partof its structure, our data show that besides lysosomotropicproperties of BPC complex, this molecule can also generatereactive oxygen species in lysosomes and induces lysosomal-membrane permeabilization.

Since the toxicity of many drugs limits their therapeuticapplication, it was also evaluated in this study, the acute toxicityof BPC. Histopathological analyses of kidney and liver frommice treated with 100 mg/kg (ip.) demonstrated that thiscomplex might not cause any detectable lesion in these tissues.Although this protocol of BPC-treatment produces alterations inthe relative amounts of lymphocyte and granulocyte, impair-ment in red and white blood cell morphologies was notobserved. Thus, further studies are necessary to better addressthe BPC toxicity for normal tissues.

Drug screens to identify molecules that induce lysosomal-membrane permeabilization and cell death in a p53-independentmanner may prove effective in cancer treatment, since the highfrequency of p53 mutations in human tumours is believed tocontribute to resistance to commonly used chemotherapeuticagents (Erdal et al., 2005). Tumour cells exhibit specificcharacteristics in their increased cysteine cathepsin levels,altered lysosomal trafficking, and shifts in different endolyso-somal populations; such changes in lysosomes may form an“Achilles heel” for cancer cells by sensitising them to deathpathways involving lysosomal-membrane permeabilization andthe release of cathepsins into the cytosol (Fehrenbacher andJäättelä, 2005).

The results presented here suggest that BPC triggerslysosomal-membrane permeabilization with release of lysoso-mal enzymes, mainly cathepsin B to the cytosol of K562 cells,which lack the oncoprotein p53 (Prokocimer et al., 1986). Thisfinding assumes particular importance in the point of view thatdevelopment of anticancer agents with different modes of actionis of key importance in overcoming clinical therapy resistance.

Acknowledgement

This work was supported by grants from the Fundação deAmparo a Pesquisa do Estado de São Paulo (Process 99/00639-2), Conselho Nacional de Desenvolvimento Científico eTecnológico (CNPq) and FAEP/Universidade de Mogi dasCruzes.

References

Achenbach, T.V., Muller, R., Slater, E.P., 2000. Bcl-2 independence offlavopiridol-induced apoptosis. Mitochondrial depolarization in the absenceof cytochrome c release. J. Biol. Chem. 275, 32089–32097.

Alonso, S., Minty, A., Bourlet, Y., Buckingham, M., 1986. Comparison of threeactin-coding sequences in the mouse; evolutionary relationships between theactin genes of warm-blooded vertebrates. J. Mol. Evol. 23, 11–22.

Antunes, F., Cadenas, E., Brunk, U.T., 2001. Apoptosis induced by exposure toa low steady-state concentration of H2O2 is a consequence of lysosomalrupture. Biochem. J. 356 (Pt 2), 549–555.

Bakhtiar, R., Ochiai, E., 1999. Pharmacological applications of inorganiccomplexes. Gen. Pharmacol. 32, 525–540.

Bedi, A., Zehnbauer, B.A., Barber, J.P., Sharkis, S.J., Jones, R.J., 1994.Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia. Blood83, 2038–2044.

Bedi, A., Barber, J.P., Bedi, G.C., el-Deiry, W.S., Sidransky, D., Vala, M.S.,Akhtar, A.J., Hilton, J., Jones, R.J., 1995. BCR-ABL-mediated inhibition ofapoptosis with delay of G2/M transition after DNA damage: a mechanism ofresistance to multiple anticancer agents. Blood 86, 1148–1158.

Behmer, A.O., Tolosa, E.M., Freitas, N.A.G., 1976. Manual de técnicas parahistologia normal e patológica. InEd. Art, São Paulo, p. 158.

Bincoletto, C., Smith, M.C., Oliveira, C.R., Justo, G.Z., Matsumoto, C.K.,Caires, A.C.F., Araújo, R.C., 2004. Biphosphinic palladacycle complexderived from n,n-dimethyl-1-phenethylamine and the ligand 1,1'bis(diphenylphosphine)ferrocene induces apoptosis in HL60 and Jurkat celllines in the presence of normal bcl-2 expression. Hematol. J. 5 (supl. 2),S181.

Bincoletto, C., Tersariol, I.L.S., Oliveira, C.R., Dreher, S., Fausto, D.M.,Soufen, M.A., Nascimento, F.D., Caires, A.C.F., 2005. Chiral cyclopalla-dated complexes derived from N,N-dimethyl-1-phenethylamine withbridging bis(diphenylphosphine)ferrocene ligand as inhibitors of thecathepsin B activity and as antitumoral agents. Bio. Med. Chem. 13,3047–3055.

Brito, J.M., Borojevic, R., 1997. Liver granulomas in schistosomiasis: mast cell-dependent induction of SCF expression in hepatic satellite cells is mediatedby TNF-alpha. J. Leukoc. Biol. 62, 389–396.

Broker, L.E., Huisman, C., Span, S.W., Rodriguez, J.A., Kruyt, F.A., Giaccone,G., 2004. Cathepsin B mediates caspase-independent cell death induced bymicrotubule stabilizing agents in non-small cell lung cancer cells. CancerRes. 64, 27–30.

Brunk, U.T., Svensson, I., 1999. Oxidative stress, growth factor starvation andFas activation may all cause apoptosis through lysosomal leak. Redox Rep.4, 3–11.

Chinnaiyan, A.M., Orth, K., O'Rourke, K., Duan, H., Poirier, G.G., Dixit, V.M.,1996. Molecular ordering of the cell death pathway. Bcl-2 and Bcl-xLfunction upstream of the CED-3-like apoptotic proteases. J. Biol. Chem.271, 4573–4576.

Cirman, T., Oresic, K., Mazovec, G.D., Turk, V., Reed, J.C., Myers, R.M.,Salvesen, G.S., Turk, B., 2004. Selective disruption of lysosomes in HeLacells triggers apoptosis mediated by cleavage of Bid by multiple papain-likelysosomal cathepsins. J. Biol. Chem. 279, 3578–3587.

Colthup, N.B., Daly, L.H., Wiberley, S.E., 1964. Introduction to Infrared andRaman Spectroscopy, 1st. Ed. Academic Press, New York. 282 pp.

Dacie, J.C., Lewis, S.M., 1975. Practical Haematology, 5th Ed. ChurchilLivingstone, London.

Dai, Y., Rahmani, M., Corey, S.J., Dent, P., Grant, S.A., 2004. Bcr/Abl-independent, Lyn-dependent form of imatinib mesylate (STI-571) resistance


is associated with altered expression of Bcl-2. J. Biol. Chem. 279,34227–34239.

Danial, N.N., Korsmeyer, S.J., 2004. Cell. death: critical control points. Cell.116, 205–219.

de Duve, C., de Barsy, T., Poole, B., Trouet, A., Tulkens, P., Van Hoof, F., 1974.Commentary. Lysosomotropic agents. Biochem. Pharmacol. 15,2495–2531.

Deiss, L.P., Galinka, H., Berissi, H., Cohen, O., Kimchi, A., 1996. Cathepsin Dprotease mediates programmed cell. death induced by interferon-gamma,Fas/APO-1 and TNF-alpha. EMBO J. 15, 3861–3870.

Donato, N.J., Wu, J.Y., Zhang, L., Kantarjian, H., Talpaz, M., 2001. Down-regulation of interleukin-3/granulocyte-macrophage colony-stimulatingfactor receptor beta-chain in BCR-ABL(+) human leukemic cells: associa-tion with loss of cytokine-mediated Stat-5 activation and protection fromapoptosis after BCR-ABL inhibition. Blood 97, 2846–2853.

Dou, Q.P., McGuire, T.F., Peng, Y., 1999. An B proteasome inhibition leads tosignificant reduction of Bcr-Abl expression and subsequent induction ofapoptosis in K562 human chronic myelogenous leukemia cells.J. Pharmacol. Exp. Ther. 289, 781–790.

Dowd, D.R., Miesfeld, R.L., 1992. Evidence that glucocorticoid-and cyclicAMP-induced apoptotic pathways in lymphocytes share distal events. Mol.Cell. Biol. 12, 3600–3608.

Elefanty, A.G., Hariharan, I.K., Cory, S., 1990. Bcr-abl, the hallmark of chronicmyeloid leukaemia in man, induces multiple haemopoietic neoplasms inmice. EMBO J. 9, 1069–1078.

Erdal, H., Berndtsson, M., Castro, J., Brunk, U., Shoshan, M.C., Linder, S., 2005.Induction of lysosomal membrane permeabilization by compounds that activatep53-independent apoptosis. Proc. Natl. Acad. Sci. U. S. A. 102, 192–197.

Fehrenbacher, N., Jäättelä, M., 2005. Lysosomes as targets for cancer therapy.Cancer Res. 65, 2993–2995.

Fesik, S.W., 2005. Promoting apoptosis as a strategy for cancer drugs discovery.Nat. Rev. 5, 876–885.

Foghsgaard, L., Wissing, D., Mauch, D., Lademann, U., Bastholm, L., Boes, M.,Elling, F., Leist, M., Jaattela, M., 2001. Cathepsin B acts as a dominantexecution protease in tumor cell apoptosis induced by tumor necrosis factor.J. Cell Biol. 153, 999–1010.

Fuchs, S.M., Raines, R.T., 2004. Pathway for polyarginine entry intomammalian cells. Biochemist 43, 2438–2444.

Guicciardi, M.E., Deussing, J., Miyoshi, H., Bronk, S.F., Svingen, P.A., Peters,C., Kaufmann, S.H., Gores, G.J., 2000. Cathepsin B contributes to TNF-alpha-mediated hepatocyte apoptosis by promoting mitochondrial release ofcytochrome c. J. Clin. Invest. 106, 1127–1137.

Guicciardi, M.E., Leist, M., Gores, G.J., 2004. Lysosomes in cell death.Oncogene. 23, 2881–2890.

Hantschel, O., Superti-Furga, G., 2004. Regulation of the c-Abl and Bcr-Abltyrosine kinases. Nat. Rev. Mol. Cell. Biol. 5, 33–44.

Holler, N., Zaru, R., Micheau, O., Thome, M., Attinger, A., Valitutti, S.,Bodmer, J.L., Schneider, P., Seed, B., Tschopp, J., 2000. Fas triggers analternative, caspase-8-independent cell death pathway using the kinase RIPas effector molecule. Nat. Immunol. 6, 489–495.

Ishisaka, R., Utsumi, T., Kanno, T., Arita, K., Katunuma, N., Akiyama, J.,Utsumi, K., 1999. Participation of a cathepsin L-type protease in theactivation of caspase-3. Cell Struct. Funct. 24, 465–470.

Kluck, R.M., Bossy-Wetzel, E., Green, D.R., Newmeyer, D.D., 1997. Therelease of cytochrome c from mitochondria: a primary site for Bcl-2regulation of apoptosis. Science 275, 1132–1136.

Konopka, J.B., Watanabe, S.M., Singer, J.W., Collins, S.J., Witte, O.N.,1985. Cell lines and clinical isolates derived from Ph1-positive chronicmyelogenous leukemia patients express c-abl proteins with a commonstructural alteration. Proc. Natl. Acad. Sci. U. S. A. 82, 1810–1814.

Kroemer, G., Jäättelä, M., 2005. Lysosomes and autophagy in cell death control.Nat. Rev., Cancer 5, 886–897.

Liu, X., Zou, H., Slaughter, C., Wang, X., 1997. DFF a heterodimeric proteinthat functions downstream of caspase-3 to trigger DNA fragmentationduring apoptosis. Cell 89, 175–184.

Lu, E., Wolfe, J., 2001. Lysosomal enzymes in the macronucleus ofTetrahymena during its apoptosis-like degradation. Cell Death Differ. 8,289–297.

Martin, S.J., Green, D.R., 1995. Protease activation during apoptosis: death by athousand cuts? Cell 82, 349–352.

Martins, S., Lennon, S., Bonham, A., Cotter, T., 1990. Induction of apoptosis(programmed cell death) in human leukemic cells by inhibitors of RNA orprotein synthesis. J. Immunol. 145, 1859–1867.

Martins, L.M., Kottke, T., Mesner, P.W., Basi, G.S., Sinha, S., Frigon Jr., N.,Tatar, E., Tung, J.S., Bryant, K., Takahashi, A., Svingen, P.A., Madden, B.J.,McCormick, D.J., Earnshaw, W.C., Kaufmann, S.H., 1997. Activation ofmultiple interleukin-1beta converting enzyme homologues in cytosol andnuclei of HL-60 cells during etoposide-induced apoptosis. J. Biol. Chem.272, 7421–7430.

May, W.S., Tyler, P.G., Armstrong, D.K., Davidson, N.E., 1993. Role for serinephosphorylation of bcl-2 in an antiapoptotic signalling pathway triggered byIL3. Blood 82, 438B Abstr.

McGahon, A., Bissonnette, R., Schmitt, M., Cotter, K.M., Green, D.R., Cotter,T.G., 1994. BCR-ABL maintains resistance of chronic myelogenousleukemia cells to poptotic cell death. Blood 83, 1179–1187.

Melo, P.S., Durán, N., Haun, M., 2001. Citotoxicity of derivatives fromdehydrocrotonin on V79 cells and Escherichia coli. Toxicology 159,135–141.

Mes-Masson, A.M., McLaughlin, J., Daley, G.Q., Paskind, M., Witte, O.N.,1986. Overlapping cDNA clones define the complete coding region for theP210c-abl gene product associated with chronic myelogenous leukemia cellscontaining the Philadelphia chromosome. Proc. Natl. Acad. Sci. U. S. A. 83,9768–9772.

Mishell, B.B., Shiiq, S.M., Henry, C., Chen, E.L., North, J., Gallily, R., Slomich,M., Miller, K., Marbrook, J., Parks, D., Good, A.H., 1980. In: Mishell, B.B.,Shiqi, S.M. (Eds.), Selected Methods in Cellular Immunology, pp. 21–22.

Mpoke, S.S., Wolfe, J., 1997. Differential staining of apoptotic nuclei in livingcells: application to macronuclear elimination in Tetrahymena. J. Histochem.Cytochem. 45, 675–683.

Olsson, G.M., Brunmark, A., Brunk, U.T., 1989. Acridine orange-mediatedphotodamage of microsomal- and lysosomal fractions. Virchows Arch., BCell Pathol. Incl. Mol. Pathol. 56, 247–257.

Oltvai, Z.N., Milliman, C.L., Korsmeyer, S.J., 1993. Bcl-2 heterodimerizes invivo with a conserved homolog, Bax, that accelerates programmed celldeath. Cell 74, 609–619.

Osorio, L.M., De Santiago, A., Aguilar-Santelises, M., Mellstedt, H., Jondal,M., 1997. CD6 ligation modulates the Bcl-2/Bax ratio and protects chroniclymphocytic leukemia B cells from apoptosis induced by anti-IgM. Blood89, 2833–2841.

Piwocka, K., Jaruga, E., Skierski, J., Gradzka, I., Sikora, E., 2001. Effect ofglutathione depletion on caspase-3 independent apoptosis pathway inducedby curcumin in Jurkat cells. Free Radic. Biol. Med. 31, 670–678.

Prokocimer, M., Shaklai, M., Bassat, H.B., Wolf, D., Goldfinger, N., Rotter, V.,1986. Expression of p53 in human leukemia and lymphoma. Blood 68,113–118.

Robbins, E., Marcus, P.I., 1963. Dynamics of acridine orange–cell interaction: I.interrelationships of acridine orange particles and cytoplasmic reddening.J. Cell Biol. 18, 237–250.

Roberg, K., Ollinger, K., 1998. Oxidative stress causes relocation of thelysosomal enzyme cathepsin D with ensuing apoptosis in neonatal ratcardiomyocytes. Am. J. Pathol. 152, 1151–1156.

Roberg, K., Johansson, U., Ollinger, K., 1999. Lysosomal release of cathepsin Dprecedes relocation of cytochrome c and loss of mitochondrial transmem-brane potential during apoptosis induced by oxidative stress. Free Radic.Biol. Med. 27, 228–237.

Rundquist, I., Olsson, M., Brunk, U., 1984. Cytofluorometric quantitation ofacridine orange uptake by cultured cells. Acta Pathol. Microbiol. Immunol.Scand. A 92, 303–309.

Schimmer, A.D., Hedley, D.W., Chow, S., Pham, N.A., Chakrabartty, A.,Bouchard, D., Mak, T.W., Trus, M.R., Minden, M.D., 2001. The BH3domain of BAD fused to the Antennapedia peptide induces apoptosis via itsalpha helical structure and independent of Bcl-2. Cell Death Differ. 8,725–733.

Skorski, T., 2002. BCR/ABL regulates response to DNA damage: the role inresistance to genotoxic treatment and in genomic instability. Oncogene 21,8591–8604.


Thompson, C.B., 1995. Apoptosis in the pathogenesis and treatment of disease.Science 267, 1456–1462.

Turk, B., Stoka, V., Rozman-Pungercar, J., Cirman, T., Droga-Mazovec, G.,Oresik, K., Turk, V., 2002. Apoptotic pathways: involvement of lysosomalproteases. Biol. Chem. 383, 1035–1044.

Vancompernolle, K., Van Herreweghe, F., Pynaert, G., Van de Craen, M., DeVos, K., Totty, N., Sterling, A., Fiers, W., Vandenabeele, P., Grooten, J.,1998. Atractyloside-induced release of cathepsin B, a protease with caspase-processing activity. FEBS Lett. 438, 150–158.

Werneburg, N.W., Guicciardi, M.E., Bronk, S.F., Gores, G.J., 2002. Tumornecrosis factor-alpha-associated lysosomal permeabilization is cathepsin Bdependent. Am. J. Physiol.: Gasterointest. Liver Physiol. 283, G947–G956.

Zdolsek, J.M., Olsson, G.M., Brunk, U.T., 1999. Photooxidative damage tolysosomes of cultured macrophages by acridine orange. Photochem.Photobiol. 51, 67–76.

biphosphinic palladacycle complex mediates lysosomal-membrane permeabilization and cell death in...

Documents