application and uses of biosensors

CHEMILUMINISCENE - BASED BIOSENSORS:APPLICATION AND USES OF BIOSENSORS

(Week 6)WCU Project ,

Centre for NanoBioengineering & Spintronics, ChungnamNational University,Daejeon,Korea

10/5/2009 1

[email protected]

What is Chemiluminescence?Why is Chemiluminescenceimportant?Where can Chemiluminescence be used?Some case StudiesConclusionsKey References

10/5/2009 2WCU Project,CNU,[email protected]

Light is a form of energyTo create light, another form of energy must be supplied

There are two common ways for this to occur:

Incandescence luminescence


IncandescenceIncandescence is light from heat energy

If we heat something to a high enough temperature,

it begins to glow

When an electric stove heater or metal in a flame

begins to glow "red hot", that is incandescence

When the tungsten filament of an ordinary

incandescent light bulb is heated still hotter, it

glows brightly "white hot" by the samemeans

The sun and stars glow by incandescence.


LuminescenceLuminescence is "cold light“ (cold body radiation), light

from other sources of energy, which can take place at normal

and lower temperatures (i.e. with limited generation of heat)

Matter is luminescent if it gives off energy in the formof light

In luminescence, some energy source kicks an electron of an

atom out of its "ground" (lowest‐energy) state into an

"excited" (higher‐energy) state; then the electron gives back

the energy in the form of light so it can fall back to its

"ground" state.


Luminescence

Luminescence is the emission of light by a substance.

It occurs when an electron returns to the electronic ground state from an excited stateand loses it's excess energy as a photon.

Luminescence spectroscopy is a collective name given to three related spectroscopictechniques.

•Molecular fluorescence spectroscopy•Molecular phosphorescence spectroscopy•Chemiluminescence spectroscopy

Types of luminescence

Chemoluminescence results from a chemical reaction

Electrochemiluminescence occurs via an electrochemical reaction

Photoluminescence caused by absorption of photonscauses re‐radiation of photons

Phosphorescence is delayed re‐radiationFluorescence results when the emitted photons are oflower energy than those absorbed.


Electroluminescence occurs in response to an electriccurrent passed through itCathodoluminescence results when a beam of electronsimpacts on a luminescent material such as a phosphor .Mechanoluminescence results from any mechanicalaction on a solidTriboluminescence: is generated when bonds in amaterial are broken when that material is scratched,crushed, or rubbed .Fractoluminescence is generated when bonds in certaincrystals are broken by fracturesPiezoluminescence is produced by the action of pressureon certain solids


Crystalloluminescence, is produced during crystallization.

Radioluminescence is produced in a material by thebombardment of ionizing radiation.

Sonoluminescence results from imploding bubbles in aliquid when excited by sound.

Thermoluminescence occurs when absorbed light is re‐emitted on heating.Bioluminescence results from the reactions occurring in aliving organism.


Photoluminescence•Fluorescence•Phosphorescence

results when certain materials are irradiated with light

Tribomoluminescence results from the crushing ofcrystals

Electroluminescence light created from a gas in the path of an electrical discharge

Chemiluminescence results from a chemical reaction

Bioluminescence results from a biologically catalyzed reaction

Types of luminescence

Fluorescence vs. Chemiluminescence vs. Bioluminescence

Chemiluminescence often considered advantageous to fluorescence:

Generates its own excitation source (no need for filter, stay light is eliminated asa source of limiting background signal)

Usually not a multi‐wavelength emitter so filter not needed

Reaction can be carried out in front of the detector (higher photon collection)

Fluorescence efficiency depends on the absorption and emission characteristicsof the excited molecule, the instrument geometry as well as analyte concentration

Higher complexity ‐‐> more complex instrumentation

Bioluminescence is really just an extremely efficient subclass of chemiluminescence

Luminescence differs from the sources of energy to obtain the exited state

Photochemiluminescence

Fluorescence

Phosphorescence

Electrochemiluminescence

Chemiluminescence

Biolumnescence10/5/2009 12WCU Project,CNU,[email protected]

ChemiluminescenceChemoluminescence

Chemi + luminescence

The term "chemiluminescence" was first coined by EilhardtWeidemann in 1888


Chemiluminescence is the generation of electromagnetic radiation aslight by the release of energy from a chemical reaction. The emissioncould proceed either from a singlet (fluorescence) or triplet(phosphorescence) state

The phenomenon occurs when a chemical reaction produces anelectronically excited species which emits a photon in order to reach tothe ground state

While the light can, in principle, be emitted in the ultraviolet, visible orinfrared region, those emitting visible light are the most common

Such radiation, whether ultraviolet, visible, or infrared, is most commonlygenerated by oxidation. The radiation can usually be ascribed to the transferof the oxidation energy to a molecule that is itself not undergoingoxidation. This molecule then loses the excitation energy by emitting lightof the proper wavelength10/5/2009 19WCU Project,CNU,[email protected]

ChemiluminescenceEmission of light as a result of a chemical reaction

Requirements:

1)Energy must be sufficient to produce electronically excited State

2) The reaction pathway must favour the formation of an electronically excited state. Theexcited state must luminesce or transfer its energy to another molecule that then luminesces.

Chemiluminescence is highly specific – very few reactions result in light emissionVery sensitive >> fluorescence (no stray light)

The light emitted in such reactions has differing degrees ofintensity and lifetime, thus in order to achieve the highest levels ofsensitivity, a chemiluminescent reaction must be asefficient as possible in generating photons of light

As the reaction progresses, the chemical composition changes, andthe light will begin to die off before fading away entirely as a resultof conversion. Often, chemiluminescence is very brief, atleast to the naked eye, although scientific tools can beused tomeasure the reaction as it continues.

A large number of substances (e.g., formaldehyde, paraldehyde,acrolein, lophine, glucose, lecithin, and cholesterol) luminesce ifslowly oxidized in alcoholic alkaline solution


Each chemiluminescent compound or group can produce no more thanone photon of light. A perfectly efficient reaction would have achemiluminescence quantum yield ΦCL of one, i.e. one photon/moleculereacted according to the equation:

ΦCL = ΦCE × ΦF × ΦR

where, ΦCE = chemiexcitation quantum yield (between 0 and 1)0 completely dark reaction1 all product molecules are generated in the

excited statemost useful chemiluminescent reactions have aΦCE of about 10‐3 or more

ΦF = fluorescence quantum yield is the probability of theexcited state emitting a photon by fluorescence rather than decaying byother processes (ranges 0 to 1)

ΦR = reaction quantum yield is the fraction of startingmolecules which undergo the luminescent reaction rather than a sidereaction (value is usually about 1)


It is possible to increase the yield of chemiluminescence when the emitter is

poorly fluorescent low ΦF. A highly fluorescent acceptor is used in these cases

in order to transfer the excitation energy from the primary excited state

compound to the fluorescent acceptor/emitter. The chemiluminescence

quantumyield is then determined by the equation:

ΦCL =ΦCE ×ΦR ×ΦET ×ΦF′

The energy transfer quantum yield ΦET expresses the efficiency of converting

the primary excited state formed in the reaction into the excited state of the

acceptor. This value is often near 1. The fluorescence quantum yield of the

acceptor/emitter ΦF′ should also be near 1


A wide variety of systems that use chemiluminescence orbioluminescence have been developed with the aim of detectinglow concentrations of biologically active molecules. Even whenemission efficiencies are <1%, chemiluminescence is a sensitive labeldetection method compared with isotopic methods in which very largenumbers of molecules must be present for each detecteddisintegration (e.g., about 1 × 107 atoms of 125I give 1 count/s)

The main importance of chemiluminescence is in the fact that it is acold system. Energy in the form of light is produced directly from thechemical reaction without first going through an intermediate stageinvolving heat.Chemiluminescent glow products never heat up, are not a source ofignition, and are non flammable. This is why modern science wishedto copy the firefly! Glow products have an abundance of uses as a cold,portable, light source and are an excellent source of SAFE FUN


Chemiluminescent reactions can be grouped into three types:

Chemical reactions using synthetic compounds and usually involving a highly

oxidized species such as a peroxide are commonly termed chemiluminescent

reactions

These sorts of reactions can be encountered in biological systems; the

effect is then known as bioluminescence. Light‐emitting reactions

arising from a living organism, such as the firefly or jellyfish (oxidation

of luciferin in the presence of an enzyme, luciferase), are commonly

termed bioluminescent reactions .

Light‐emitting reactions which take place by the use of electrical current

are designated electrochemiluminescent reactions.


The number of chemical reactions which produce

chemiluminescence is small. However, some of the compounds

which do react to produce this phenomenon are

environmentally significant.

Chemiluminescent and bioluminescent reactions usually

involve the cleavage or fragmentation of the O‐O bond an

organic peroxide compound. Peroxides, especially cyclic

peroxides, are prevalent in light emitting reactions because the

relatively weak peroxide bond is easily cleaved and the

resulting molecular reorganization liberates a large amount of

energy


Most chemiluminescence methods involve only a few chemical

components to actually generate light. Luminol chemiluminescence

and peroxyoxalate chemiluminescence are both used in bioanalytical

methods

In each system, a "fuel" is chemically oxidized to produce an excited state

product

In many luminol methods it is this excited product that emits the

light for the signal

In peroxyoxalate chemiluminescence, the initial excited state

product does not emit light at all and instead it reacts with

another compound, often a compound(a fluorescent dye) and it is

this fluorophore which becomes excited and emits light.10/5/2009 29WCU Project,CNU,[email protected]

Peroxyoxalate Peroxyoxalate Chemiluminescence

One of the suggested reaction sequences in the reaction ofperoxyoxalates, of which bis(2,4,6‐trichlorophenyl) oxlate (TCPO) isthe most prominent example

It involves the fuel (TCPO) plus the oxidant (H2O2) reacting toproduce an intermediate (shown here as 1,2‐dioxetanedione);although, the reaction probably produces many intermediates,such as hydroperoxyoxalate etc.


The intermediate excites a fluorophoreThe excited state product quickly emits light

Emission Spectrum of

Diphenylanthraceneas

Chemiluminescent Fluorophore

10/5/2009 31

Chemiluminescent Primer

The process of transferring the energy of the initial reaction,the chemical reaction of hydrogen peroxide with TCPO, tolight emission from the excited state fluorophore(fluorophore*) can be side‐tracked along the way by lossesin each step of the process.

The initial oxidation to produce the intermediate, thereaction of the intermediate with a fluorophore, and thereaction of the excited fluorophore to produce light.


The initial oxidation can yield the high energy intermediate orTCPO can be hydrolyzed instead orOxidation can occur that doesn't yield chemiluminescentproducts

The high energy intermediate can react to excite thefluorophore or

The intermediate can react with a quencher more easilyoxidized than the fluorophoreThe intermediate and fluorophore can react without yieldingexcited fluorophoreThe intermediate can decompose or be further oxidized byresidual H2O2

Finally the excited fluorophore can loose energy by emission oflight or

The excited fluorophore can de‐excited by production ofheat instead of light.10/5/2009 33

No excitation source (as does fluorescence and phosphorescence) .

Only a single light detector such as a photomultiplier tube required.

No monochromatic and often not even a filter.

No radioactivity or hazardous chemicals.

The chemiluminescence reagents are not hazardous to health.

Very sensitive in detection.

Why Chemiluminescence for Sensors ?


Luminol Chemiluminescence

10/5/2009 WCU Project,CNU,[email protected] 35

Luminol Chemiluminescence

Probably the most useful oxidant is hydrogen peroxide similar toperoxyoxalate chemiluminescence; however, other oxidants such asperborate, permanganate hypochlorite have also been used .

Luminol is also widely used as a chemiluminescent reagent, but unlikethe peroxyoxalate systems does not require an organic/mixedsolvent system thus, the chemiluminescent emitter is a "directdescendent" of the oxidation of luminol by an oxidant in basicaqueous solution.

Luminol (3‐aminophthalhydrazide) is a versatilechemical that exhibits chemiluminescence, with astriking blue glow (lasts for about 30 seconds),when mixed with an appropriate oxidizing agent.


http://upload.wikimedia.org/wikipedia/commons/c/ce/Luminol.svg

Luminol (C8H7N3O2) that exhibits chemiluminescence, with a striking blue glow, when mixed with an appropriate oxidizing agent. It is white to slightly yellow crystalline solid that is soluble in most polar organic solvents, but insoluble in water.

Luminol is used by forensic investigators to detect trace amounts of blood left at crime scenes as it reacts with iron found in hemoglobin. It is also used by biologists in cellular assays for the detection of copper, iron, and cyanides.


http://en.wikipedia.org/wiki/Chemiluminescence

http://en.wikipedia.org/wiki/Oxidizing_agent

http://en.wikipedia.org/wiki/Forensic

http://en.wikipedia.org/wiki/Blood

http://en.wikipedia.org/wiki/Crime_scene

http://en.wikipedia.org/wiki/Copper

http://en.wikipedia.org/wiki/Iron

http://en.wikipedia.org/wiki/Cyanide

To exhibit luminescence, the luminol must first be activated with anoxidant. Usually, a solution of hydrogen peroxide (H2O2) and ahydroxide salt in water is used as the activator. In the presence of acatalyst such as an iron compound, the hydrogen peroxide isdecomposed to form oxygen and water:

2 H2O2 → O2 + 2 H2O

When luminol reacts with the hydroxide salt, a dianion is formed.The oxygen produced from the hydrogen peroxide then reacts with theluminol dianion

The product of this reaction, an organic peroxide, is very unstable andimmediately decomposes with the loss of nitrogen to produce 3‐aminophthalic acid with electrons in an excited state

As the excited state relaxes to the ground state, the excess energy isliberated as a photon, visible as blue light.


4‐Aminophthalate


http://en.wikipedia.org/wiki/File:Luminol_chemiluminescence_molecular_representation.svg

Luminol can be the foundation of significantly differentanalytical determinations. For instance, this system canbe used:

To determine luminol itself by holding other variablesconstantTo determine luminol‐like derivatives

To determine hydrogen peroxide or the progress ofreactions that produce H2O2

To determine the concentrations of metal cations.To determine analytes that effect the concentration ofmetal catalysts


Light emission from 3-APA

λmax is atapproximately 445nm, slightly longerwavelength than theTCPO/DPA system


As the figure shows thelight intensity decays toapproximately 50% ofmaximum at about 8seconds

Iwata and Locker foundthat both the initialintensity and rate ofdecay in this kind ofsystem are dependenton Cu(II) content.

In the TCPO system described above, Orosz et al. (1996) reported thatdecay rate, rise constant, maximal light intensity, and quantumefficiency depended on hydrogen peroxide concentration.


Chemiluminescent assays Based on Enzymes

Glucose oxidase (GOX) is an enzyme that produces H2O2during a preincubation period that is appropriately selectedin order to increase the sensitivity of the system. GOXoxidizes glucose to yield H2O2which can be measured by CLreaction of TCPO/ ANS

3‐D‐Galactosidase (BGase) is an enzyme that catalyzes thehydrolysis of lactose to a‐D‐glucose and f3‐D‐galactose.Hydrogen peroxide generated from the coupled enzyme(GOX) reaction is measured by the CL reaction usingisoluminol/microperoxidase or peroxyoxalate/fluorescentdye.


Enhanced Chemiluminescence The series of compounds which, when added to the reaction, increase thelight emission by several orders of magnitude, are known as enhancersand the phenomenon is known as Enhanced Chemiluminescence

Enhancers act synergistically in the peroxidase—catalysed luminol—peroxide reaction. This reaction is catalyzed by metal ions at high pH,resulting in emission of blue light (emission peak about 425 nm). Atlower pH, the reaction is catalyzed by hemecontaining enzymes, such ashorseradish peroxidase, catalase, cytochrome C, and hemoglobin.However, the light output is low with a half‐life of a few seconds

The presence of any one of a series of “enhancer molecules” increases thelight emission from horseradish peroxidase by 1000‐fold or more, andalters the kinetics so that a steady glow is produced lasting several hours


Enhancer Effect of Fluorescein on the Luminol–H2O2–HorseradishPeroxidase Chemiluminescence:Energy Transfer Process

The maximum intesity and the total chemiluminescenceemission (between 380 and 580 nm) of luminol withfluorescein is more than three times greater than withoutfluorescein; however, the emission duration is shorter.

A. Navas Díaz1*, J. A. González García1 and J. Lovillo1, J BIOLUMIN CHEMILUMIN 1997: 12: 199–205


Chemiluminescent emission of the luminol–H2O2–horseradish peroxidase system againstwavelengths of emission at different concentrations of fluorescein:

(A) 0 mmol/L (B) 0.0067 mmol/L(C) 0.0667 mmol/L (D) 0.6233 mmol/L(E) 1.87 mmol/L (F) 6.2333 mmol/L

As the concentration of fluoresceinincreases, the total emission between380 nm and 580 nm is enhancedλem=425 nm corrosponds to emission

by aminophthalate & λem=535 nmcorrosponds to emission by fluoresceinThe intensity at 535 nm increases

while that at 420 nm decreases with anincrease in fluorescein concentrationEnergy transfer mechanism involving

transfer of energy from luminol (donor)to fluorescein (acceptor) occurs leadingto quenching of the luminolfluorescence


Chemiluminescent emission against time for solutions at pH 7.5 of:(A) luminol without fluorescein at λem =425 nm(B) luminol with fluorescein (0.67 mmol/L) at λem=425 nm(C) luminol with fluorescein (0.67 mmol/L) at λem=535 nm

Chemiluminescence enhancement byfluorescein can be observed but theemission is for a shorter duration thanwithout fluorescein

Fluorescein increases the conversion ofluminol to luminol radical (&aminopthalate, ), and so enhances thechemiluminescence of luminol. Theenhanced chemiluminescence of luminolis transferred to fluorescein, with a newemission maximum appearing around 525nm


First synthesized in Germany in 1902, but the compound was not namedluminol until the late 1920s.

Used to detect trace amounts of blood (even invisible) as it reacts with ironfound in haemoglobin.Also used by biologists in cellular assays for the detection of copper, iron,

and cyanides.Exhibits a blue‐green chemiluminescence when mixed with an appropriate

oxidizing agent.Glows in the dark.Is a relatively simple chemical containing only carbon, nitrogen, oxygen and

hydrogen and is a white to slightly yellow crystalline solid powder, soluble inwater and most polar organic solvents.

Luminol - Chemiluminescent Blood DetectorForensic Investigators' Essential Tool for Crime Scene Investigation

3 D model of the Luminol structure

C8 H7 N3 O4

Chemiluminescence of luminol.

5‐aminophthalic acid

2 H2O2 → O2 + 2 H2O

Oxidant‐H2O2Activator‐OH‐

Mechanism

Used by forensic investigators to detect trace amounts of blood left atcrime scenesMost sensitive presumptive blood testCan detect bloodstains diluted up to 300,000 times

Luminol for Blood Test

Enzyme LabelA common means for generating chemiluminescence is touse a label enzyme to catalyze a chemiluminescent reactionEach label can initiate multiple chemiluminescentreactions, so it is usually only necessary to incorporate oneor a few enzyme labels/analyte

Light intensity is alinear function of theamount of label enzyme

Representation of the time course of light emissionof a typical enzymatic chemiluminescent reaction


Some Factors in Choosing a Detection Reaction:Enzyme Label or Direct Label?

Components of a chemiluminescent (e.g.luminol) orbioluminescent reaction (e.g., a luciferase, aequorin) can be usedas a label, or a chemiluminescent or bioluminescent reaction canbe used to monitor an enzyme label or its productsDirectly labeled chemiluminescent systems produce <1photon/label and require complex chemical synthesis to produceeach new labeled molecule.Chemiluminescent detection of enzyme labels combines theadvantages of a high specific activity label with the convenienceof relatively simple coupling chemistries, which use commercialreagents


The intensity(the rate of emission of photons/s) is theproduct of the catalytic turnover of substrate E + S → E +S' (steps 1‐3 below) and the lifetime of the light‐producingcompound S'→ P* (step 4)

The lifetime of the excited state product P* → P (Step5) is extremely short in comparison to the other stepsand has no effect on the observed reaction kinetics.


Quantitative Determination of Blood Glucose Using Enzyme induced Chemiluminescence of Luminol

Debra T. Bostick and David M. Hercules, ANALYTICAL CHEMISTRY, VOL. 47, NO. 3, MARCH 1975

•The first reaction is highly specific for glucose.

•The second reaction is subject to several interferences from reducing substances, such as bilirubin, ascorbic acid, uric acid, and drug metabolites, which may depress results by either competing with the chromogen for peroxide or by reducing the chromogen.

Negative error may also be observed if the pH is too acidic for the enzymatic reactions. Under these conditions, peroxidase is inhibited by fluoride and chloride ions which may be present in the reaction media as serum preservatives

Glucose estimation may he pH dependent if the pH of the final solution remains above four, since the absorption maximum of the oxidized chromogen is pH dependent above this value.


It monitors hydrogen peroxide concentration using the chemiluminescence of luminol(5‐amino‐2,3‐dihyperoxidase drophthalazine‐1,4‐dionedione).

In the presence of certain metals (Cu(II), Co(II), Ni(II)) , peroxide reacts with luminol in basic media to form an excited aminophthalate anion, which returns to ground state by the emission of a photon.

In the glucose oxidase‐luminol coupled reaction sequence, the amount of lightemitted is proportional to @‐D‐glucose concentration.

y = 1.01 x ‐ 1.1 mg/dl.


• The linear range for glucose analysis is 10‐s‐10‐4M.

• Detection limit is 2 x 10‐8M glucose.


Immobilization of glucose oxidase on a support other than Sepharose. Sepharose beads are deformable under pressure; with continued use of the column, Further packing of the column results in increased back‐pressure.Modification

10/5/2009WCU Project,CNU,[email protected]

64

Classification of Biosensor

Calorimetric (detect on the basis of heat evolved in biologicalreaction)Piezoelectric (detect on the basis of electric dipoles generateddue mechanical stress)Electrochemical (potentiometric, conductometric andamperometric)Optical (detect on the basis of change in light received )


WCU Project,CNU,[email protected]/5/2009

Characteristics of a Biosensor

Specificity

Sensitive within biological range Stable for several monthsAble to be used 5000-10000 timesShelf- life should be at least six monthSenapable of miniaturizationFast responseMust not be poisonous

66

Broad Applications of Biosensors

Food and drink production and analysisMicrobiology: bacterial and viral analysisPharmaceutical and drug analysisIndustrial effluent controlPollution control and monitoringMining, industrial and toxic gasesMilitary applicationsClinical diagnosis and biomedicineFarm, garden and veterinary analysisProcess control: fermentation control and analysis


H2O2 + horse radish peroxidase (HRP)

catalyzes the oxidation of luminol.

Immediately following the oxidation of luminol,

an excited state,

then decays to the ground state by emitting light.

Using this method it is possible to detect antigens(EP/MP).

Principle of CL based technique


HRP + H2O2 Complex (I )+ H2O

Complex( I) + Luminol (LH2)

Complex (II) +Luminol Radical (LH‐)

Complex (II)+ Luminol Radical (LH‐ )

Compound 2 + Luminol (Fully Oxidized)

+ LIGHT


Direct LabelAnother way to use a chemiluminescent reaction for detecting ananalyte in an immunoassay is to covalently label one of thecomplementary binding partners directly with a chemiluminescentcompound. Triggering the chemiluminescent label to undergo thelight‐emitting reaction produces a signal for detecting the analyte

The label, upon triggering, should emit all of the light in the briefestpossible period of time

When the chemiluminescence is emittedgradually over a period of time, signalintensity (photons/sec) is diminished and,in the worst case, can be low enough toimpair detection sensitivity


This work has demonstrated that the selectivity of ECL‐based on the base‐pairprinciple could be improved by using hairpin DNA as a recognition element

The hairpin ECL biosensor presents relatively sensitive DNA detection and goodselectivity for discriminating complementary target ss‐DNA from bothnoncomplementary and singlebase mismatch ss‐DNA.

Binding strength and sensitivity are found to be dependent on the number of thematched bases. Changes in the length of the probe loop present a promisingalternative approach for improvement of the sensitivity and selectivity of DNAhybridization assays. It appears that relatively longer length loops may benefit theselectivity and sensitivity of ECL‐based biosensors for the detection ofcomplementary target DNA

The ability to discriminate the complementary from singlebase mismatchDNA is the gold standard of DNA biosensors, and the ability to sensitivelydetect single‐base mutation is crucial to gene detection in early stagediagnosis.


Electrogenerated Chemiluminescence DNA Biosensor Based on Hairpin DNA Probe Labeled with Ruthenium Complex

A highly selective electrogenerated chemiluminescence (ECL) biosensorfor the detection of target single‐strand DNA (ss‐DNA) has beendeveloped using hairpin DNA as the recognition element andruthenium complex as the signal producing compound.An ECL probe (P1), thiolated hairpin DNA tagged with rutheniumcomplex, is self‐assembled on the surface of a gold electrode

The hybridization kinetics of the ECL biosensor is found to bedependent on the concentration of probe, loop length and the structuresof both DNA probe and target ss‐DNA.

Jing Zhang, Honglan Qi, Yan Li, Jia Yang, Qiang Gao, and Chengxiao Zhang, Anal. Chem. 2008, 80, 2888‐2894


Table 1. DNA Hairpin Probes and Their Targetsname sequenceH1 5¢‐SH‐(CH2)6‐GTGAGCCAAGACGGAAAGACCCGCTCAC‐(CH2)6‐NH2‐3¢,loop 16, bases, stem 6 2H2 5¢‐SH‐(CH2)6‐GTGAGCAACACCTTCTACACCTCCATAGCTCAC‐(CH2)6‐NH2‐3¢,loop 21, bases, stem 6 2H3 5¢‐SH‐(CH2)6‐GTGAGCTCATAACCTTCAGCAAGCTTTAACTCATAGGCTCAC‐(CH2)6‐NH2‐3¢,loop 30, bases, stem 6 2T1 (H1 complement) 5¢‐GGGTCTTTCCGTCTTG‐3¢ (16 bases)T2 (H2 complement) 5¢‐TATGGAGGTGTAGAAGGTGTT‐3¢ (21 bases)T3 (H3 complement) 5¢‐CTATGAGTTAAAGCTTGCTGAAGGTTATGA‐3¢ (30 bases)T1M1 (single mismatch of H1) 5¢‐GGGTCTTTGCGTCTTG‐3¢ (16 bases)NT1(noncomplementary of H1) 5¢‐CAGGAAACAGCTATGA‐3¢ (16 bases)


In the absence of target ss‐ DNA, the ECL probe immobilized on the surface of theelectrode is in the folded configuration in which its termini are held in closeproximity to the electrode, and thus a strong ECL signal could be generated.

In the presence of target ss‐DNA, a stem‐loop of the ECL probe on the electrode isconverted into a linear double‐helix configuration due to hybridization,resulting in the tag moving away from the electrode surface, which in turn decreasesthe ECL signal10/5/2009 74WCU Project,CNU,[email protected]

http://pubs.acs.org/action/showImage?doi=10.1021/ac701995g&iName=master.img-000.png&type=master

Characterization of the ECL Probe

The ECL‐potential profiles ofRu(bpy)2(dcbpy)NHS and P1 with a scanrate of 50 mV s‐1 in 0.10 M PBS containing0.10 M TPAa) 3.8 × 10‐8 M Ru(bpy)2(dcbpy)NHSb) 8.5 × 10‐8 M P1

Both ECL peaks appear at near +900mV, indicating that the ECL behaviorof P1 is similar to that ofRu(bpy)2(dcbpy)NHS andRu(bpy)2(dcbpy) NHS is attached toss‐ DNA

The ECL intensity ofRu(bpy)2(dcbpy)NHS is nearly 4‐fold higher than that of ECL probeP1 at the same concentration.It indicates that the ECL efficiency of

ECL probe P1 decreases, which may bededuced by the fact that the diffusioncoefficient of P1 decreases due tothe increase of the molecularweight of P1.



Effect of applied potential on ECL intensity in 0.10 M PBS containing 0.10 M TPA,8.5 × 10‐6 M P1, and 1.0 × 10‐8 M T1

1) Before hybridization2) After hybridization3) ΔI

With an increase in applied potentialfrom +0.7 to +0.9 V, ΔI(curve 2) increasesand reaches the maximum at about +0.9 V

This is attributed to increasing numberof excited‐state molecules producedduring an electrochemically initiatedreaction.

With further increase of the appliedpotential, however, ΔI decreases due to theoxidative deadsorption of thiol.



Effect of hybridization timeon normalized ECL intensity.a) 8.5 × 10‐6 M P1; 4.0 10‐8M T1b) 5.5 × 10‐6 M P3; 4.0 10‐8 M T3

The hybridization time is optimized using twoECL biosensors by:

a) P1 (loop 16‐mer, stem 6)b) P3 (loop 30 mer, stem 6)

for their complementary target ss‐DNA T1 and T3,respectively

ECL signal decreases sharply with an increase ofthe hybridization time.

A 50% decrease was observed in theapproximately 10 min after hybridization, and asteady state was reached in less than 30 min forP1‐T1 (curve a), whereas P3‐ T3 reached its steadystate in about 90 min (curve b)

This suggests that the initial hybridizationreaction proceeds quickly for P1‐T1 and thehybridization reaction is completed in about 30min (owing to faster duplex formation due tolesser steric crowding)



Comparison of hybridization eventsof 8.5 × 10‐6 M P1 with different targetss‐DNAa) blankb) 4.0 × 10‐6 M NT1c) 4.0 × 10‐8 M T1

To evaluate the specificity of the ECL biosensor,one of the sensors assembled with P1 forcomplementary target ss‐DNA (T1) isinvestigated and another one is tested for thenoncomplementary target one (NT1).

ECL peak of the biosensor in the absence oftarget ss‐DNA is significantly higher since P1 isnearly the same as that without hybridization.This is ascribed to no change of P1 formation

Comparing peak c with peak b in Fig the ratio ofECL intensity decreased was 65% for 4.0 × 10‐8M complementary target DNA while the ECLintensity decreases to about 1.3% for a 100‐foldhigher level of non‐complementary target DNA(4.0 × 10‐6 M) showing that duplex formationfree energy between duplex H1T1 is much lowerthan that in H1‐NT1.



Kinetic response of 8.5 × 10‐6 M P1 to different targetsa) blankb) single‐base mismatch sequence (T1M1): 4.0 × 10‐8 Mc) single‐base mismatch sequence (T1M1): 4.0 × 10‐6 Md)complementary sequence (T1): 4.0 × 10‐8 Me) complementary sequence (T1): 4.0 × 10‐6 M

The ECL intensity‐decreasedratio:5.5% for 4.0 × 10‐8 M single‐

base mismatch target DNA12% for 4.0 × 10‐6 M single base

mismatch target DNA65% for 4.0 × 10‐8 M

complementary target DNA95% for 4.0 × 10‐6 M

complementary target DNA

An 8‐12‐fold(65%/5.5%‐95%/12%) in the decrease of ECL intensity for the single mismatched target compared with the perfect match observed the experiment is even higher than that observed (2.8‐12 fold) in fluorescence chip.



Chemiluminescence Based Immunosensors


Electrochemiluminescence Based Immunosensor ?

Electrochemiluminescence is a relative latecomer among the detection techniquesused in the field of bioaffinity assays.

Generally, electrochemiluminescent labels have the same benefits asphotoluminescent labels

long shelf -life of reagentsno interference with biological compoundswide dynamic rangehigh sensitivity

No excitation optics are need

Can be very useful, especially in microanalytical systems of the future.

Electrochemical luminescence immunosensor for α‐fetoprotein

Sensors and Actuators B 35‐36 (1996) 458‐‐462

Development of a homogeneous electrochemical luminescence (ECL) immunoassay for lgG based on ECL quenching through antigen‐binding

Hydrogen peroxide concentraliondependence on the lumtnol ECL, A potentialof 800 mV versus Ag/AgC! was applied for60 s. A luminol concentration of 1,0 10 -6M in O i M PB solution was used.

Luminol concentration dependence on ECL. Apotential of 900 mV versus AglAgC! was applied for60 s. A hydrogen peroxide concentration of 1.0 mMin O. I M PB solution was used.

Time course of ECL response for immunoreaction. A luminollabeled antibody concentration of 1.0 x 10-7g ml -I in 0.1 M PB solution was used.

Calibration curve of homogeneous ECL immunoassay for AFP in buffer. A luminol-labeled antibody concentration of 1.0 10-Tg ml -I in 0.1 M PB solution was used.

ECL of luminol-labeled antibody. A potential of 900mV versus Ag/AgCI was applied for 60 s. A ydrogenperoxide concentration of ! .0 mM in 0. ! M PBsolution was used.

Calibration curve of homogeneous ECLinnnuuoassay for AFP in control human serum,Incubation time was 10 rain. A luminollabeledantibody concentration of 1.25 x 10-7g ml -I inO.IM PB solution containing 0. 1% controlhuman serum was used.

AFP with a detection limit : 10‐11 g ml‐1

CdS Nanocrystal‐Based Electrochemiluminescence Biosensor for the Detection of Low‐Density Lipoprotein by Increasing Sensitivity with Gold Nanoparticles Amplification

Mercaptoacetic acid (RSH)‐capped CdS nanocrystals (NCs) is electrochemicallyreduced during potential scan and react with the coreactant S2O8

2‐ to generatestrong electrochemiluminescence (ECL) in aqueous solution

Based on the ECL, a novel non‐labeled ECL biosensor has been successfullyfabricated by a self‐assembly technique for LDL determination.

Guifen Jie, Bo Liu, Hongcheng Pan, Jun‐Jie Zhu,* and Hong‐Yuan Chen, Anal. Chem. 2007, 79, 5574‐5581


Fabrication of Gold Nanoparticles Based CL BiosensorThe gold nanoparticles first assembled onto a cysteamine monolayer on the gold

electrode surface

This gold nanoparticle‐covered electrode is treated with cysteine and then reacted

with CdS NCs to afford a CdS NC‐electrode

Finally, apoB‐100 (ligand of LDL receptor is covalently conjugated to the CdS NC‐

electrode

The resulting modified electrode is tested as ECL biosensor for LDL detection. The

LDL concentration was measured through the decrease in ECL intensity resulting

from the specific binding of LDL to apoB‐100


Inset: Cyclic voltammogram on the CdS NCs/cysteine/gold nanoparticles/cysteamine/Auelectrode. 0.1 M PBS (pH 7.4) containing 0.1 M K2S2O8 and 0.1 M KCl. Scan rate, 100 mV s‐1

(a) On the bare Au electrode(b)On cysteamine/Au electrode(c) On the gold

NP/cysteamine/Au electrode(d)On the cysteine/goldNP/

cysteamine/ Au electrode(e)On the CdS NCs/cysteine/Au

electrode(f) On the CdS NCs/cysteine/gold

nanoparticles/cysteamine/Auelectrode

Electrochemeluminescence intensity versus Potential


ECL Behaviors of the CdS NanocrystalsIt has been found that all the background ECL signals from the Auelectrode without CdS NCs are very low, indicating that thecysteamine, cysteine, and gold nanoparticles could not generate ECL.Thus, ECL is from the CdS NCs

However, ECL intensity of CdS NCs on the bare Au electrode isenhanced by 1.6 orders of magnitude on the gold nanoparticle‐modifiedelectrode, demonstrating that the gold nanoparticles amplify ECLsignal of CdS NC


ECL Characteristic of the BiosensorECL emission from the biosensor undercontinuous potential scanning for 10cyclesStable and high ECL signals areobserved suggesting that the biosensor issuitable for ECL detectionThe ECL intensity from the biosensoris found to be lower than that fromthe CdS NC‐modified electrode.The immobilization of the apoB‐100and BSA on the electrode surface,which hinders the ECL reaction resultingin the decreased ECL intensity of thebiosensor

ECL emission from the biosensor inpH 7.4 PBS containing 0.1 M KCland 0.1 M K2S2O8 under continuouscyclic voltammetry for 10 cycles.Scan rate, 100 mV s‐1


LDL Detection by ECL It can be seen that the ECL intensity in thepresence of LDL (b) is lower than that in theabsence of LDL (a), and the ECL intensitydecreases gradually with increasingconcentrations of LDL (b‐g)

The reason is that the specific binding ofapoB‐100 with LDL greatly inhibits the ECLreaction of CdS NCs on the electrode, andthus decreases the ECL intensity, whichsuggests that the LDL concentration canbe determined by the ECL measurementof the biosensor

ECL profiles of the biosensor in the absence (a) and presence (b‐g) of different concentrations of LDL in pH7.4 PBS containing 0.1 M KCl and 0.1 M K2S2O8Inset: calibration curve for LDL determination. LDL concentration (µg mL‐1): (a) 0, (b) 0.025, (c) 2, (d) 6, (e)10, (f) 12, and (g) 14. Scan rate, 100 mV s‐1



•The ECL intensity decreased linearly with the LDL concentration from 0.025 to 16 ng mL‐1 with a detection limit of 0.006 ng mL‐1. • Linearity : 5210‐324C (unit of C is ng mL‐1), and the correlation coefficient : 0.9962.

•Higher plasma LDL levels can be detected by an appropriate dilution with pH 7.4 PBS.

• The relative errors were 1.6 and 2.5%, respectively. Thus, the proposed biosensor could be satisfactorily applied to the clinical determination of LDL levels in human plasma.

•The biosensor was used for 20 times, the analytical performances did not show an obvious decline, demonstrating that the sensing layers of the biosensor possessed good stability.

PESTICIDE BIOSENSORS


M.S.Thakur et al Biosensors and Bioelectronics 21 (2006) 1264–1271

Detection of methyl parathion using immuno‐chemiluminescence based image analysis using charge coupled device

The commonly used analytical methods for pesticide analysis include liquid chromatography, gas chromatography and ELISA methods

These conventional methods are sensitive up to ppb level,time consuming, laborious, and require skilled techniciansand expensive instrumentation


Methyl parathion is an organophosphate (OP) insecticide that has caused many health problems ‐ particularly in developing countries ‐ since its introduction onto the market in the early 1950s. Methyl parathion was originally developed by the German pesticide company Bayer. It is a non‐systemic pesticide that kills pests by acting as a stomach poison.

It is used to control chewing and sucking insects in a wide range of crops, including cereals, fruit, vines, vegetables, ornamentals, cotton and field crops(1).

Methyl parathion is generally applied as a spray, mainly as an emulsifiable concentrate formulation. The recommended application rates are 15‐25g of active ingredient per 100 litres(2).

UsageThe basic manufacturers of methyl parathion are All India Medical Co (India), Bayer India, Bayer Mexico, Cheminova (Denmark), Rallis India and Sundat (Singapore)(3). In 1993, other production facilities existed in Brazil, the former East Germany, China and the former USSR. Although not used in the UK, methyl parathion is widely used throughout the world, and is registered in at least 38 countries(4).Information on global sales and production data are not widely available. For the financial year 1995‐96, India produced an estimated 2,200 tonnes of technical grade methyl parathion(5).Acute toxicityThe World Health Organisation classifies methyl parathion as a class Ia 'extremely hazardous' pesticide. It is highly toxic by inhalation and ingestion, and moderately toxic by dermal adsorption (it is also readily adsorbed through the skin). The oral LD50 in rats is 2.9 mg/kg, in mice is 33.1‐119.5 mg/kg, in rabbits is 19‐420 mg/kg and dogs is 50 mg/kg(9). The dermal rat LD50 is 44‐67mg/kg.

Like other organophosphate insecticides, methyl parathion is a cholinesterase When inhaled, the first adverse effects are a bloody or runny nose, coughing, chest discomfort and difficulty breathing. Skin contact may cause localised sweating and involuntary muscle contractions. Following exposure by any route, other systemic effects may begin within a few minutes, or be delayed for up to 12 hours. These may include pallor, nausea, vomiting, diarrhoea, abdominal cramps, headache, dizziness, eye pain, blurred vision,constriction or dilation of the pupils, tears, salivation, sweating and confusion. In severe cases, poisoning will affect the central nervous system, producing in‐coordination, slurred speech, loss of reflexes, weakness, fatigue, and eventual paralysis of the body extremities and respiratory muscles. Death may be caused by respiratory failure or cardiac arrest.

What is Methyl parathion?

10/5/2009 97

Electrochemical

Optical

Calorimetric

Piezoelectric

Amperometric

Potentiometric

Conductometric

Absorbance

Fluorescence

Luminescence

Reflectance

Scattering

MechanicalDevices10/5/2009 99WCU Project,CNU,[email protected]

Chemiluminescence based biosensor device being developed at CFTRI for pesticide analysis


8. CL Reactants Cuvettee (Conjugate+Urea +H2O2+Luminol)

9. Photo Multiplier Tube (PMT)

10. Peristaltic Pump

11. Preamplifier

12. Computer

Schematic diagram for Quantitative Analysis of Pesticides using Chemiluminescence

Antibody

Exploded View of Immobilizedantibody column

Sepharose

HRP-Conjugate

7

6

12

34

5

10

10

11

12

11I-V8 9

1. Phosphate Buffer (Washing)

2. Pesticide ( Sample)3. HRP-Conjugate4. PBS BSA Buffer5. PBS+Tween Buffer6. Immobilized Antibody

Column7. Unbound Conjugate

Fraction


Chemiluminescence based biosensor system : Simple FIA device


Chemiluminescence at different concentrations of Methyl Parathion

0

20

40

60

80

100

120

140

0 100 200 300 400 500 600 700

Time (sec)

Che

milu

min

esce

nce

Units

500ppb500ppb100ppb100ppb250ppt250ppt10ppt1ppt1ppt0ppt0ppt


100ppb

1ppb 500ppt 10ppt Zero

Gradation in light intensity with different pesticide concentrations


Ultrasensitive detection of TNT in soil, water, using enhanced electrogenerated

chemiluminescence

Analytica Chimica Acta 632 (2009) 197–202

Schematic diagram showing the general principle of ultrasensitive ECL detection of TNT at high amplification with Ru(bpy)3 2+ ‐containing polystyrene beads.

(a) CV and ECL responses obtainedfrom a 2mm diameter Pt electrodeplaced in contact with a 0.10MTPrA–0.055MTFAA–0.10M(TBA)BF4MeCN reaction medium containingdissolved PSB < TNT >MBaggregates formed in the presence of1.0 ppt TNT. The scan rate used was50mVs−1. (b) ECL response shown in(a) as a function of time.

Relationship between the standard TNT concentration and the integratedECL intensity. Experimental conditions used were as in Fig. 2. For comparison, thebackground ECL that was obtained in the absence of added TNT is also included.

Standard addition method of ECL determination of TNTextracted from a soil sample collected from a firing range atCamp Shelby Military Base. The original concentration ofTNT in the soil sample was calculated to be 2.4gg−1 soil.

Standard addition method of ECL determination of TNT in awater sample collected from a nearby creek of a firing rangeat Camp Shelby Military Base. The original concentration ofTNT in water was calculated to be 0.45 ppb.

Detectio\n limit 0.10±0.01 ppt TNT (n = 3)

ConclusionsThis approach has the advantage of being more straightforward and avoids the need to use large, relatively "sticky" labelsCL method has numerous advantages such as sensitivity, rapid assay.The chemiluminescence (CL) based methods are very sensitive to detect desired analytes even at very low concentrations.There is possibility of robust and inexpensive instrumentation.It may become an attractive analytical tool in biosensorsLimitations


Key References (Week 6)Hypohalites and related oxidants as chemiluminescence reagents: a review

CdS Nanocrystal‐Based Electrochemiluminescence Biosensor for the Detection of Low‐Density Lipoprotein by Increasing Sensitivity with Gold Nanoparticle Amplification Guifen Jie, Bo Liu, Hongcheng Pan, Jun‐Jie Zhu,* and Hong‐Yuan Chen, Analytical Chemistry 2007, 79, 5574‐5581

Electrogenerated Chemiluminescence DNA Biosensor Based on Hairpin DNA Probe Labeled with Ruthenium Complex, Jing Zhang, Honglan Qi, Yan Li, Jia Yang, Qiang Gao, and Chengxiao Zhang, Analytical Chemistry, 2008, 80, 2888‐2894.

Detection of methyl parathion using immuno‐chemiluminescence based image analysis using charge coupled device, R.S. Chouhan, K. Vivek Babu , M.A. Kumar, N.S. Neeta , M.S. Thakur ,B.E. Amitha Rani , Akmal Pasha , N.G.K. Karanth , N.G. Karanth, Biosensors and Bioelectronics 21 (2006) 1264–1271

Electrochemical biosensor for pesticides based on acetylcholinesterase immobilized on polyaniline deposited on vertically assembled carbon nanotubes wrapped with ssDNA, Subramanian Viswanathan, Hanna Radecka, Jerzy Radecki ,Biosensors and Bioelectronics 24 (2009) 2772–2777.

Iron oxide‐chitosan hybrid nanobiocomposite based nucleic acid sensor for pyrethroid detection,AjeetKaushika,b, Pratima R. Solankib, Anees A. Ansari, Bansi D. Malhotra, Sharif Ahmad, Biochemical Engineering Journal,2009, 46 ,132–140

Label‐free ultra‐sensitive detection of atrazine based on nanomechanics, C Raman Suri, Jasdeep Kaur, SonuGandhi and Gajendra S Shekhawat, Nanotechnology 19 (2008) 235502 (6pp) (Week5)


?


application and uses of biosensors

Documents