antiviral effects of antisense morpholino oligomers in murine coronavirus infection models
TRANSCRIPT
1
Antiviral effects of antisense morpholino oligomers in murine 1
coronavirus infection models 2
3
4
5
6
Renaud Burrer1§
, Benjamin W. Neuman1, Joey P. C. Ting
1, David A. Stein
3, Hong M. 7
Moulton3, Patrick L. Iversen
3, Peter Kuhn
2 and Michael J. Buchmeier
1,*. 8
9
10
The Scripps Research Institute, Department of Molecular and Integrative Neurosciences1, 11
and Department of Cell Biology2, 10550 North Torrey Pines Rd., La Jolla, California 12
92037 13
14
AVI Biopharma Inc., 4575 SW Research Way, Corvallis, Oregon 973333. 15
16
§ Present address: Centre d’Immunologie de Marseille-Luminy, Marseille, France 17
18
*Corresponding author: 19
Mailing address: The Scripps Research Institute, Department of Molecular and 20
Integrative Neurosciences, Mail drop SP30-2020, 10550 N. Torrey Pines Rd., La Jolla, 21
CA 92037. 22
Phone: (858) 784 7164. Fax: (858) 784 7369. 23
E-mail [email protected]. 24
25
26
Running title: Inhibition of MHV by morpholino oligomers in vivo 27
ACCEPTED
Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.02360-06 JVI Accepts, published online ahead of print on 7 March 2007
2
ABSTRACT 1
2
3
The recent emergence of novel pathogenic human and animal coronaviruses has 4
highlighted the need for antiviral therapies that are effective against a spectrum of 5
these viruses. We have used several strains of murine hepatitis virus (MHV) in cell 6
culture and in vivo in mouse models to investigate the antiviral characteristics of 7
peptide-conjugated antisense phosphorodiamidate morpholino oligomers (P-PMO). 8
Ten P-PMO directed against various target sites in the viral genome were tested in 9
cell culture and one of these (5TERM), complementary to the 5’-terminus of the 10
genomic RNA, was effective against six strains of MHV. Further studies were 11
carried out with various arginine-rich peptides conjugated to the 5TERM PMO 12
sequence, in order to evaluate efficacy and toxicity, and thereby select candidates 13
for in vivo testing. In uninfected mice, prolonged P-PMO treatment did not result in 14
weight loss or detectable histopathologic changes. 5TERM P-PMO treatment 15
reduced viral titers in target organs, and protected against virus-induced tissue 16
damage. Prophylactic 5TERM P-PMO treatment decreased the amount of weight 17
loss associated with infection under most experimental conditions. Treatment also 18
prolonged survival in two lethal challenge models. In some cases of high-dose viral 19
inoculation followed by delayed treatment, 5TERM P-PMO was not protective, and 20
increased morbidity in the treated group, suggesting that P-PMO may cause toxic 21
effects in the diseased mouse that were not apparent in the uninfected animal. 22
However, the strong antiviral effect observed suggests that with further 23
development, P-PMO may provide an effective therapeutic approach against a 24
broad range of coronavirus infections. 25
ACCEPTED
3
INTRODUCTION 1
2
In 2002-2003, the Severe Acute Respiratory Syndrome (SARS) outbreak resulted in over 3
8000 cases and more than 770 fatalities worldwide, and focused attention on the potential 4
pathogenicity of human coronaviruses. The responsible agent, SARS-CoV, was 5
transmitted to humans from its bat reservoir (17) by an intermediate host, the palm civet 6
and possibly other animal vectors (9). Once established in humans, the infection spread 7
directly from person to person by aerosol or droplet. Although future re-emergence of 8
SARS-CoV remains possible, the virus has not reappeared since the last documented case 9
in 2003, except for sporadic (18) or lab-related cases (26). However, two other new 10
human coronaviruses, CoV-NL63 (33), a group 1 coronavirus associated with 11
bronchiolitis and lower respiratory tract infections, and CoV-HKU1 (35), a group 2 12
coronavirus associated with pneumonia, have been identified in the interval, and the 13
previously known human coronavirus 229E and OC43 continue to circulate. The 14
development of antiviral drugs that could be used to treat coronavirus-infected patients 15
thus remains of significant importance to public health. 16
17
Murine hepatitis virus (MHV), is the nearest phylogenetic relative of SARS-CoV; both 18
are currently classified within the group 2 coronaviruses (8). Depending on the route of 19
infection, different MHV strains can be used as disease models for hepatitis, 20
encephalomyelitis, gastrointestinal infection and upper respiratory disease in mice: 21
MHV-A59, MHV-2 and MHV-3 injected intraperitoneally (i.p.) provoke hepatitis (1, 22). 22
Intranasal (i.n.) or intracranial (i.c.) injection of neurotropic strains including MHV-A59 23
and MHV-4 (JHM), results in acute encephalitis, followed by a demyelinating disease 24
that resembles multiple sclerosis in some surviving mice (14). MHV-1 has recently been 25
reported to replicate in the lungs of several mouse strains after i.n. inoculation, producing 26
an upper respiratory syndrome that resembles SARS-CoV infection in humans (40). 27
28
Phosphorodiamidate morpholino oligomers (PMO) are single-stranded DNA-like 29
compounds that bind to mRNA by Watson-Crick base pairing and can inhibit gene 30
expression by steric blockade of complementary RNA (31). PMO have been used widely 31
ACCEPTED
4
for several years to specifically interfere with the expression of cellular genes (11). 1
Conjugation of various arginine-rich peptides to PMO has routinely been used to increase 2
PMO uptake into mammalian cells, and offers the additional advantage of increased 3
antisense efficacy once duplexed with target RNA, compared to nonconjugated PMO 4
(23). Several recent studies have also demonstrated the potential of PMO and peptide-5
PMO (P-PMO) compounds to be used as antiviral agents, with activity against several 6
flaviviruses (5, 12, 13), arteriviruses (32, 39) and influenza virus (7) in cell culture, and 7
against Ebola virus (6, 34) and Coxsackie virus B3 (CVB3) (38) both in cell culture and 8
in vivo. 9
10
Our laboratory has previously reported that antisense P-PMO can inhibit coronavirus 11
replication in cell culture. P-PMO complementary to the genomic RNA of MHV (25) or 12
SARS CoV (24) were shown to be effective, with IC50 values in the low micromolar 13
range. In the present study, we extend these previous findings and report the 14
investigation of the effects of PMO compounds on MHV replication and disease in vivo. 15
We evaluated 10 MHV P-PMO in cell culture experiments and found that one, with a 16
sequence complementary to the 5’-terminal sequence of the viral genome (5TERM), 17
consistently generated the highest specific inhibition against each MHV strain 18
challenged. In vivo, 5TERM P-PMO decreased viral replication in the liver of animals 19
infected with various strains of MHV. Histologic examination revealed that the reduction 20
in the severity of liver tissue damage was found to correspond with decreased viral load. 21
Prophylactic treatment with 5TERM P-PMO resulted in improved clinical status of 22
animals after i.p. challenge with each of three strains of MHV, at all the inoculum doses 23
tested. However, morbidity and mortality paradoxically increased when administration 24
of P-PMO treatment was delayed until 1 day after infection with high doses of MHV-25
Alb139 virus. Similar results were obtained with MHV-1 in the lung where certain 26
antiviral and ineffective P-PMO regimens aggravated clinical disease compared to 27
infected controls irrespective of the level of viral replication. These results collectively 28
reveal both the antiviral activity and potential toxicity of P-PMO treatment in 29
therapeutically relevant MHV challenge models. 30
31
ACCEPTED
5
1
2
MATERIALS AND METHODS 3
4
Cells and Viruses 5
DBT and Vero-E6 cells were cultured in DMEM containing 10% fetal bovine serum, .01 6
M HEPES, penicillin and streptomycin for general growth and maintenance, or in serum-7
free medium (VP-SFM; Invitrogen) supplemented with L-glutamine, and antibiotics 8
during P-PMO studies. MHV-1 was obtained from ATCC. MHV-2, MHV-3, MHV-4 9
(JHM) and MHV-A59 were from sources described previously (27). Alb139 (4, 19) was 10
obtained from Dr. P. Rottier. MHV stocks were produced on 17Cl-1 cells (MHV-1) or 11
DBT (all the other strains), and titers were determined by plaque assay as previously 12
described (25). SARS-CoV-Tor2 was cultivated on Vero-E6 cells as previously described 13
(24). 14
15
PMO and P-PMO Design and Synthesis. 16
PMO (30), P-PMO with a thioether linker (20, 21, 23) and P-PMO with an amide linker 17
(2) were produced at AVI BioPharma Inc. (Corvallis, OR) by previously described 18
methods. PMO sequences and target locations in MHV or SARS are specified in Table 1 19
and represented schematically in Fig. 1A. Previous studies with SARS-CoV (24) and 20
Equine Arteritis virus (32) demonstrated that P-PMO targeting conserved sequence 21
elements of the genomic 5’-untranslated region reduced viral replication. Therefore, 22
several PMO were designed against sequence in the 5’ UTR of MHV or SARS (the first 23
six and last two entries of Table 1, respectively) to potentially interfere with translation of 24
the viral replicase polyprotein, pp1ab. A previous study (24) also demonstrated that a P-25
PMO complementary to the ribosomal frameshift signal between the 1a and 1b open 26
reading frames inhibited SARS replication, and therefore a PMO was designed to 27
interrupt ribosomal frameshifting of MHV (1ABFS). Another PMO (MBTRS) was 28
designed complementary to the ‘body TRS’ region of RNA coding for the structural 29
protein M, to potentially interfere with discontinuous synthesis of the subgenomic RNA 30
ACCEPTED
6
containing the M coding sequence. PMO were also designed to duplex to the 3’-termini 1
of (-)-sense genomic and subgenomic viral RNAs ((-)3TERM and (-)19-40, respectively). 2
Several arginine-rich cell penetrating peptides (CPP) were prepared, conjugated to PMO 3
and evaluated for functional efficiency. In an initial screening, all PMO were conjugated 4
with the oligoarginine peptide R9F2. The CPP (RXR)4XB (X = 6-aminohexanoic acid, B 5
= beta-alanine) has been reported as more stable (23, 37), less toxic (2, 7) and more 6
efficient at delivering PMO to the cell nucleus (2) than R9F2. Therefore, subsequent 7
experiments utilized a panel of CPP having two to four repeats of the peptide motif RXR 8
conjugated to PMO through one of two linkers, a thioether bond between the HS- group 9
of the cysteine (C) and PMO, or an amide bond between the carboxyl group of beta-10
alanine and PMO. The series of peptide/linker compositions were designed to investigate 11
the effect of RXR repeat number and linker make-up on the ability to deliver PMO into 12
cells, and the relative toxicities of the various conjugates. 13
14
It has been shown that liver uptake of peptide nucleic acids (PNA) (10) and a triplex-15
forming oligonucleotide (36) were enhanced by glycosylation. Therefore, two 16
mannosylated conjugates, Man-(RXR)4XB-5TERM and Man-(RX)4C-5TERM, in 17
addition to the corresponding non-mannosylated conjugates, were evaluated both in cell 18
culture and in mice to determine the effect of the carbohydrate-modification on the 19
activitiy of both P-PMO. The mannose-modified P-PMO conjugates (mP-PMOs) were 20
synthesized as described below. Three acetyl-protected and FMOC-modified mannosyl 21
serine (Sussex, Ottawa, ON, Canada) were sequentially appended to the N-terminus of 22
(RX)4B or (RXR)4XB peptide using standard FMOC chemistry. Using the method 23
described previously (2), the acetyl-protected mannose-modified peptides were 24
conjugated to PMO and the conjugates purified. Removal of acetyl protection groups 25
from the mannoses of a conjugate was carried out by dissolving the conjugate in a 26
DMSO/methanol (1/1, v/v) solution (700 µM), followed by incremental addition of 0.2 M 27
CH3ONa (in CH3OH) to bring the pH of the solution to 11.5-12.5. The mannosyl (RX)4-28
PMO or (RXR)4-PMO solution was stirred at room temperature for 2 or 1 hr, 29
respectively. The solutions were neutralized with 0.2M CH3COOH and purified by 30
cationic exchange and reverse phase chromatography as described elsewhere (21). The 31
ACCEPTED
7
mass of each mP-PMO was confirmed by matrix assisted laser desorption ionization-time 1
of flight mass spectrometry and purities were about 85% as analyzed by high pressure 2
liquid chromatography. 3
4
Cell-free translation assays 5
The protein-coding sequence for firefly luciferase, without the translation initiator-Met 6
codon, was subcloned into the multiple cloning site of plasmid pCiNeo (Promega) at the 7
Sal I and Not I sites. Subsequently, complementary oligonucleotides encoding the 8
complete MHV-A59 (GenBank accession NC_001846) 5’-untranslated region and first 9
42 nt of coding sequence were duplexed and subcloned into the Nhe I and Sal I sites, 10
creating pM5’luc. RNA was in vitro transcribed and cell-free translation inhibition 11
assays were carried out with rabbit reticulocyte lysate as previously described (25). 12
13
Virus Multiplication Assay 14
DBT or Vero-E6 cells were seeded at a density of 5 × 105 cells per 25 cm
2 tissue culture 15
flask and allowed to adhere overnight at 37°C, 5% CO2. Cells were incubated for at least 16
3 h with 1 ml VP-SFM containing the specified treatment. After removal of treatment-17
containing medium, cells were inoculated with MHV or SARS-CoV and placed at 37°C 18
for 1 h. Inoculum was removed and replaced with fresh treatment-containing VP-SFM as 19
specified. 20
21
Plaque Assay 22
For titration of infectious virus, DBT cells (for MHV) or Vero-E6 cells (for SARS-CoV) 23
were seeded in 12-well tissue culture plates at 2×105 cells per well and allowed to adhere 24
overnight at 37°C, 5% CO2. Culture medium was removed and replaced with 0.5 ml of 25
cell-culture supernatant or tissue homogenate from viral experiments. A 0.7% agarose 26
overlay containing 2% fetal bovine serum was applied to cells 1 h after inoculation. 27
After 72 h, cells were fixed by immersion in 10% formaldehyde in phosphate buffered 28
saline for 24 h, agarose plugs were removed and cells were stained with 0.1% crystal 29
violet. Plaque size reduction assays were performed with untreated cells that were 30
inoculated with fixed doses of MHV, and after 1 h, treated with P-PMO as previously 31
ACCEPTED
8
described (24). A single dose of P-PMO was applied together with the agarose overlay. 1
Plaque diameters were measured with a ruler to the nearest 0.5 mm. 2
3
Resistance Studies 4
Plaque-purified MHV-A59 was passaged ten times on fresh DBT cells subject to 5
treatment with 10 µM P-PMO for 4 h before each infection period. 24 h after 6
inoculation, cell culture medium was removed and either aliquoted for plaque assay 7
titration or used to initiate the subsequent round of infection of P-PMO-treated cells. 8
9
Infections and treatment in mouse models 10
Five week-old male C57Bl6 mice were obtained from The Scripps Research Institute’s 11
breeding facility. Viruses were diluted in saline and injected either intraperitoneally (i.p.) 12
in a total volume of 250 µl for the hepatitis models, or intranasally (i.n.) in 20 µl saline 13
for the respiratory infection model. For each experiment, PMO/P-PMO were diluted in 14
0.9% saline and injected i.p., except where specified. For viral growth and 15
histopathology experiments where mice were sacrificed at day 4 post-infection (p.i)., 16
each mouse received one dose (20 nanomoles of nonconjugated PMO or 8 nanomoles of 17
P-PMO) 5 hours before, and 24 h and 48 h after infection, for a total of 3 doses per 18
animal per experiment. For survival experiments, animals were treated starting either 5 19
hours before the infection (prophylactic regimen), or at day 1 or 2 after the infection 20
(therapeutic regimen). In either case, PMO/P-PMO treatment was then further 21
administered to the mice on a daily basis until the animals began to regain lost weight. 22
The weight of each animal was recorded daily before drug injection. 23
24
Tissue collection and histology 25
Mice were euthanized with a solution of 2% (w/v) chloral hydrate in PBS, and then 26
perfused with 10 ml PBS to prevent a possible contamination of organ samples by virus 27
circulating in the blood. Tissues samples, taken from the same organ region of each 28
animal, were collected for histology studies or frozen at -80°C for subsequent virus 29
titration. Frozen tissues were weighed, homogenized in 1.2 ml of DMEM using a Mini-30
Bead-Beater (Biospec), and viral titers determined by plaque assay. Samples collected 31
ACCEPTED
9
for histology studies were preserved in 10% buffered formalin. Fixed tissues were 1
embedded in paraffin, sectioned and stained with hematoxylin and eosin (H&E). To 2
quantify pathologic changes in the livers, necrotic lesions were counted over an entire 3
section chosen randomly for each animal. The area of each section was determined using 4
a scanned image of the microscope slide and the ImageJ software (NCBI). The upper 5
limit of the number of lesions that could accurately be counted was estimated to be 6
approximately 7 to 8 per mm2. Individual lesions were not counted for sections that 7
showed confluent necrosis. 8
9
10
RESULTS 11
12
Inhibition of translation in cell-free assay. 13
P-PMO complementary to sequence in the MHV 5’-untranslated region (Table 1 and Fig. 14
1A) were evaluated in a translation inhibition assay. In vitro translation reactions were 15
programmed with RNA in vitro transcribed from a plasmid containing the entire 5’-16
untranslated region and coding sequence for the first 14 amino acids of MHV-A59 pp1ab 17
fused upstream of a luciferase reporter gene. Two P-PMO binding near the 5’-terminus 18
(5TERM and (+)18-39), and one complementary to the pp1ab AUG translation initiation 19
region (AUG), were effective at sub-micromolar concentrations (Fig. 1B). Two P-PMO 20
complementary to the transcription regulatory sequence (TRS) region of the MHV leader 21
(TRS1 and TRS2) were relatively ineffective at reducing luciferase expression, whereas 22
previous studies with analogous P-PMO against wild-type SARS-CoV had suggested the 23
TRS to be an excellent P-PMO target region (24). 24
25
Inhibition of MHV in infected cells 26
P-PMO were tested for three correlates of antiviral activity in cell culture: reduction of 27
viral cell-to-cell spread, cytopathology, and viral replication. R9F2-P-PMO were added to 28
the overlay of an MHV-A59 plaque assay to investigate effects on the rate expansion 29
from an infectious center (Fig. 2A). The P-PMO binding the viral 5’-terminus (5TERM) 30
was most effective, followed closely by TRS-1. Other P-PMO targeting the 5’-31
ACCEPTED
10
untranslated region, and the frameshift region (1ABFS), were moderately inhibitory. 1
Two P-PMO were completely ineffective in reducing cytopathology and spread from an 2
infectious center (MBTRS and (-)3TERM), and two others ((+)18-39 and (-)18-39) 3
appeared to generate inordinate cytotoxicity, as indicated by severe, concentration-4
dependent cell depletion over the course of a three-day plaque size reduction assay 5
relative to untreated and RND P-PMO-treated controls (data not shown). Ineffective and 6
cytotoxic P-PMO were excluded from further study. 7
8
R9F2-P-PMO were next tested in DBT cells infected with MHV-1, MHV-2, MHV-3, 9
MHV-4 and MHV-A59. Virus-induced cytopathic effects including syncytium formation 10
(MHV-1, MHV-3, MHV-4 and MHV-A59), rounding and detachment (MHV-2) and 11
rapid cellular lysis (MHV-3) were reduced most consistently with 5TERM P-PMO (Fig. 12
2B and data not shown). TRS-1 P-PMO also provided an intermediate level of 13
protection, likely through a mechanism other than direct inhibition of pp1ab translation 14
(compare Figs. 1B and 2B). 15
16
Peptide-conjugate selection 17
The most effective P-PMO sequence from the initial studies, 5TERM, was conjugated to 18
several novel delivery peptides and tested for reduction of release of infectious MHV-19
A59 from cells 24 h after inoculation (Fig. 2C). Two conjugates were the most effective: 20
the R9F2 peptide used above, which was previously employed for MHV and SARS-CoV 21
antiviral studies (24, 25), and a peptide consisting of four repeats of arginine - 6-amino-22
hexanoic acid (X) – arginine, (RXR)4, followed by a either a cysteine (C) or another 23
single X residue and a beta-alanine (B) to serve as respective linkers (Fig. 2C). Further 24
studies did not reveal differences in (RXR)4-5TERM P-PMO effectiveness or toxicity 25
related to linker composition, so the (RXR)4XB conjugate, referred to hereafter simply as 26
(RXR)4, was selected for further experimentation, due to relative ease and efficiency of 27
synthesis. Conjugates with fewer arginine residues, or with mannose modification, were 28
far less effective in this assay. 29
30
ACCEPTED
11
Dose-efficacy determinations were performed on MHV-A59 for several of the most 1
promising P-PMO. 5TERM PMO conjugated to R9F2 and (RXR)4 were equally effective 2
in reducing viral titer. A randomized PMO (RND) conjugated to the (RXR)4 peptide 3
showed only mild nonspecific effects relative to the cognate R9F2-RND control conjugate 4
(Fig. 2D). Therefore both R9F2-5TERM and (RXR)4-5TERM were selected for further 5
testing in cell culture and in vivo. 6
7
Broad-spectrum inhibition of MHV strains 8
The relative effectiveness of R9F2-5TERM, R9F2-TRS1 and R9F2-RND was tested against 9
a panel of MHV strains. Pre-infection treatment of cells with R9F2-5TERM reduced titers 10
of five MHV strains by over 10-fold, with the strongest effects observed against MHV-11
A59 and MHV-3, respectively (Fig. 3A). As in previous assays, R9F2-TRS1 treatment 12
was less effective than R9F2-5TERM at reducing viral titer, and R9F2-RND treatment 13
slightly increased the release of infectious virus in several cases (Table 2). 14
15
These results showed that 5TERM P-PMO was effective against several laboratory 16
strains of MHV in cell culture. This multi-strain inhibition was not surprising, as, 17
according to available sequence information, the MHV strains tested likely have perfect 18
sequence identity at the 5TERM target site (data not shown). In order to determine 19
whether the genomic 5’-terminus represents a highly effective P-PMO target site for 20
coronaviruses in general, the corresponding challenge was carried out with SARS-CoV 21
and a SARS-CoV-specific 5TERM P-PMO analog. However, dose-response testing 22
revealed that a previously described P-PMO, complementary to the SARS TRS region 23
(SARS-TRS1) (24), was more effective than SARS-5TERM P-PMO (Fig. 3B). 24
25
The effects of repetitive R9F2-PMO treatments on viral titer were also examined. Cell 26
cultures were treated with those P-PMO before inoculation with a freshly plaque-purified 27
strain of MHV-A59. A 10 µM P-PMO concentration was selected for testing based on a 28
similar published study with SARS-CoV (24). Serial treatment with 5TERM or TRS1 P-29
PMO resulted in extinction of MHV-A59, while treatment with less effective P-PMO did 30
not strongly inhibit virus growth (Fig. 3C). While it is likely that sustained treatment 31
ACCEPTED
12
with lower concentrations of 5-TERM R9F2-PMO would have eventually produced P-1
PMO-resistant virus, in a manner similar to that observed previously (24), this 2
experiment demonstrated that repeated short-term treatments with an effective P-PMO 3
can exert a cumulative effect on MHV replication. 4
5
In vivo P-PMO dose determination 6
For our experiments in vivo, we selected somewhat lower PMO and P-PMO dosing levels 7
in comparison to those employed in other PMO/P-PMO in vivo studies (~20-33 mg/kg of 8
nonconjugated PMO was reported in references (6) and (34) and 10 mg/kg P-PMO was 9
reported in reference (38)), in order to minimize the potential for side effects. To 10
evaluate the toxicity of a particular dose-level for MHV PMO and P-PMO, mice were 11
injected i.p. once per day for 4 days with 20 nanomoles of nonconjugated PMO or 8 12
nanomoles of P-PMO (equivalent to approximately 6.5 to 7.0 mg/kg PMO, or 3.6 to 3.8 13
mg/kg P-PMO) in the absence of virus. P-PMO-treated and saline-injected control 14
animals did not differ in appearance, behavior, or relative weight gain during or 15
following treatment (data not shown). Moreover, H&E-stained liver sections obtained 16
from these mice on the last day of the experiment did not exhibit any unusual features or 17
apparent histopathology compared to saline-injected controls (see examples included 18
below in Figs. 5, and data not shown). Based on these results, doses of 20 nanomoles of 19
nonconjugated PMO or 8 nanomoles of P-PMO were utilized throughout the remainder 20
of the studies. 21
22
Conjugate selection in vivo 23
In order to select an appropriate measurement for in vivo antiviral activity, replication of 24
MHV-A59 was evaluated in selected organs. Mice were inoculated i.p. with MHV-A59 25
and 4 days after the infection, blood was collected by cardiac puncture and samples were 26
taken from kidney, intestine and liver tissue. Viral titers were consistently near or below 27
the limit of detection in kidney, intestine and blood samples, making it impossible to 28
assess a potential antiviral activity of the P-PMOs in these organs (data not shown). 29
Titers approached 106 plaque-forming units per gram of liver tissue at day 4 p.i. (data not 30
shown), and published studies with a similar class of morpholino oligomers had 31
ACCEPTED
13
previously demonstrated high activity in the liver (29), hence reduction of liver titer was 1
chosen as the primary test for antiviral activity. 2
3
We next examined the effect of 5TERM PMO and P-PMO treatment on MHV replication 4
in vivo. Initial in vivo testing of each delivery conjugate was limited to two mice per 5
treatment group. Treatment with the R9F2, (RXR)4XB and (RXR)4C 5TERM P-PMO 6
reduced MHV-A59 titer in the liver by approximately 100-fold, but the other 7
conjugations including Man-(RXR)4XB reduced titer by less than 10-fold compared to 8
mock-treated controls (data not shown). These results were generally consistent with 9
previous results from cell culture assays (Fig. 2C), and established the (RXR)4 conjugates 10
as the most effective. Additional experiments confirmed that treatment with 11
nonconjugated, R9F2 or (RXR)4 5TERM PMO formulations reduced liver titers by at 12
least 100-fold relative to controls at day 4 p.i. (Fig. 4A). The (RXR)4-5TERM treatment 13
reduced liver titers by at least 1000-fold at the selected treatment dose, and was therefore 14
selected for subsequent i.p. challenge experiments. 15
16
Reduction of viral load in livers infected by different MHV strains 17
Livers were collected from P-PMO-treated mice 2, 4 and 6 days after inoculation with 18
1000 PFU MHV-A59 and mock- or P-PMO treatments on days 0, 1, and 2. The titers of 19
(RXR)4-5TERM treated mice were strongly reduced compared to controls, at all three 20
time points assayed (Fig. 4B). Although treatment ceased on day 2 p.i., MHV titer 21
remained strongly suppressed at day 6 p.i. (Fig. 4B). The effect of (RXR)4-5TERM P-22
PMO treatment on replication of different strains of MHV was then examined. Mice 23
were inoculated i.p. with 100 PFU of MHV-2, MHV-3 (20 LD50) or MHV-Alb139 24
(5*10-3
LD50) and treated, as above, with three doses of 5TERM P-PMO, RND P-PMO 25
or saline vehicle. Liver titers were determined at 4 days p.i. (Fig. 4C). The titer of 26
Alb139, MHV-3 and MHV-4 were highly, moderately, and mildly reduced, respectively, 27
compared to controls. Titers of MHV-2 were not reduced, in contrast to the effects of 28
R9F2-5TERM P-PMO on this strain previously observed in cell-culture (Fig. 3A). 29
Conversely, a small but reproducible increase of the liver MHV-2 titer compared to the 30
mock-treated controls was observed following 5TERM and RND P-PMO treatment (Fig. 31
ACCEPTED
14
4C). These results indicated that P-PMO treatment was effective against challenge with 1
most, but not all, strains of MHV in vivo. 2
3
Reduction of liver pathology 4
H&E-stained liver sections from the mice used in the above experiments were examined 5
to determine the effects of P-PMO treatment on histopathology in MHV-infected mice. 6
Figure 5A shows a quantitative representation of the necrotic lesions in livers from mock-7
treated or P-PMO-treated, MHV-infected mice. Very few lesions were observed in the 8
sections obtained from MHV-A59 infected control mice at 2 and 4 days p.i., thus making 9
the absence of any lesions in the (RXR)4-5TERM-treated mice at these time points 10
inconclusive (data not shown). The frequency of lesions was significantly reduced at day 11
6 in (RXR)4-5TERM-treated mice compared to controls (Fig. 5A and 5D-E). (RXR)4-12
5TERM treatment also reduced the number of lesions in animals infected with MHV-3 13
and Alb139 (Fig. 5A), and with MHV-4 (data not shown). The effects of P-PMO 14
treatment were particularly striking in MHV-3-infected mice. The liver parenchyma 15
from each of the 6 control animals displayed few recognizable hepatocytes (>90% of the 16
section surface was necrotic in each sample), while livers from (RXR)4-5TERM-treated 17
mice showed low numbers of non-confluent foci (Fig. 5F-G). In the case of MHV-2, 18
although 2 out the 4 controls had too many lesions to allow quantitation, the other 2 19
controls displayed numbers similar to those the of the (RXR)4-5TERM-treated animals. 20
Where necrotic lesions were present, the treatment with 5TERM P-PMO resulted in no 21
difference in the average diameter of individual lesions (data not shown), suggesting that 22
5TERM P-PMO was most protective early in infection, but was less effective in 23
preventing the spread of an established infection foci. Overall, the level of liver 24
histopathology in the various groups was accurately predicted by the previous viral titer 25
experiments (Fig. 4). 26
Liver sections from P-PMO- and mock-treated infected mice were examined for 27
qualitative differences in the severity of hepatitis (Fig. 5H). The portal architecture was 28
generally preserved in each infection model, but the type and degree of lymphocytic 29
infiltration and necrosis in the parenchyma varied by MHV strain, as described in the 30
literature (15). MHV-Alb139 and A59-infected livers displayed lesions of ballooning 31
ACCEPTED
15
necrosis with a marked lymphoid response regardless of treatment (Fig. 5H). Livers from 1
mock-treated and RND P-PMO-treated mice infected with MHV-3 displayed widespread 2
coagulation necrosis with moderate inflammation. Treatment of MHV-3-infected mice 3
with 5TERM P-PMO produced smaller areas of necrosis, which were similar in 4
appearance to those observed in Alb139-infected mice (Fig. 5H). Overall, no qualitative 5
differences in the hepatic lesions were noted between the untreated, mock-treated and 6
RND P-PMO-treated groups. 7
8
Effects of treatment on disease outcome 9
The effects of P-PMO treatment on clinical disease in MHV-induced hepatitis were 10
examined. Continuous daily treatment failed to protect mice inoculated with 10 PFU of 11
MHV-3. Indeed, (RXR)4-5TERM PMO-treated mice typically only outlived the controls 12
by an average of about 1 day, a delay that was modest but statistically significant (Fig. 13
6A). This result suggested that reduction of viral titer was insufficient to prevent 14
initiation of the coagulation cascade by MHV-3 (15). 15
16
Mice infected with up to 1000 PFU MHV-A59 developed undetectable or modest clinical 17
signs of disease. At this dose, a qualitative benefit of (RXR)4-5TERM treatment was still 18
observed, as the mice treated with the 5TERM P-PMO started to regain lost weight at day 19
5 p.i. after dropping to 96% of their initial weight, while mock- and RND P-PMO-treated 20
mice continued to lose weight down to 92% and 91% on average at day 7 p.i., 21
respectively (data not shown). Similar results, i.e. a faster recovery of 5TERM P-PMO-22
treated mice, were also obtained after infection with 100 PFU (Fig. 6B) or 1000 PFU 23
Alb139 (data not shown). When injected with 10,000 PFU Alb139, a clear beneficial 24
effect of the prophylactic treatment with (RXR)4-5TERM was also observed (Fig. 6C). 25
Indeed, the average weight loss was limited to 7% in the 5TERM-treated mice, while the 26
average weight of mock-treated controls decreased by up to 18% (Fig. 6C). All mice 27
treated with (RXR)4-5TERM before inoculation and all mice in the mock-treated control 28
group survived the experiment. Notably, when (RXR)4-5TERM treatment was delayed 29
until the first day after the infection, the mice lost weight more rapidly than the controls 30
and eventually all succumbed between days 5 and 8 p.i. (Fig. 6C). Similarly, mice that 31
ACCEPTED
16
had received the RND-P-PMO lost weight more rapidly than the mock-treated animals, 1
and 2/3 died on day 5, while the last one survived the experiment (Fig. 6C). 2
3
At a 5-fold higher dose of Alb139, which proved to be lethal in all the mock-treated 4
controls between day 5 and 7 p.i., the prophylactic treatment with (RXR)4-5TERM 5
increased survival by only one additional day on average (Fig. 6D). Again, mice treated 6
with (RXR)4-RND lost weight significantly more rapidly than mock-treated controls and 7
all died by day 6 p.i. (Fig. 6D). To summarize, these experiments show that treatment 8
with 5TERM P-PMO displayed a beneficial effect when the inoculum dose was relatively 9
low, or when the drug was administered before infection in those cases where a relatively 10
high dose of virus was used. In the latter experiments, delayed treatment with the 11
antiviral P-PMO or administration of non-specific P-PMO adversely affected the 12
outcome of clinical disease (Fig. 6C-D). 13
14
15
Effects of treatment on respiratory MHV infection 16
We then evaluated the potential of PMO in the treatment of a coronavirus infection in the 17
central nervous system (CNS). Mice were treated i.p. with PMO or (RXR)4-PMO 5 h 18
before, 24 h after and 48 h after i.c. inoculation with 10 PFU (0.1 LD50) MHV-A59. The 19
average virus load per gram of brain tissue at day 4 p.i. was not affected by PMO or P-20
PMO treatment (data not shown). This result indicates that the amount of PMO and P-21
PMO delivered to the CNS after i.p. treatment was insufficient to exert a detectable 22
antiviral effect, in accordance with the literature (29), and no further experiments were 23
performed with this model. 24
25
To evaluate the potential of P-PMO in the treatment of a coronavirus infection of the 26
respiratory system, we infected A/J mice i.n. with 100 PFU MHV-1, a dose that was 27
selected to produce a severe but non-lethal disease, and treated them with P-PMO or 28
vehicle either administered i.n. or by i.p. injection. As shown on figure 8A, lung viral 29
titers in animals treated prophylactically with (RXR)4-5TERM administered i.n. were 30
reduced over ten-fold compared to controls, while corresponding i.p. treatment resulted in 31
ACCEPTED
17
only a two-fold decrease of viral titer. Mice treated with (RXR)4-5TERM i.n. starting on 1
day 1 p.i. displayed a five-fold reduction of the viral titers (Fig. 7A). Examination of the 2
lung histopathology at day 4 p.i. showed mild focal inflammation and edema in most of 3
the animals, but did not reveal any consistent difference between the antisense-treated 4
and control groups (data not shown). 5
6
Finally, the effects of P-PMO treatment on the clinical health of the mice in the 7
respiratory model were examined. As shown on figure 7B, mice in both P-PMO-treated 8
groups continued to lose weight from day 4 to 6 p.i., while the mock-treated controls 9
started to regain lost weight at this stage. All mice eventually recovered from the 10
infection in this experiment. Thus, although antiviral effects of P-PMO treatment were 11
observed in the MHV-1 respiratory disease model, P-PMO treatment also apparently 12
resulted in an exacerbation of clinical disease. 13
14
15
DISCUSSION 16
17
This study documents that a P-PMO (5TERM) designed to duplex with the 5’- terminal 18
sequence of the MHV genome was able to inhibit viral replication both in cell culture and 19
in vivo. The 5TERM P-PMO had antiviral efficacy against six strains of MHV in cell 20
culture, and was active against five of those strains in mice. In contrast to a previous 21
study (24), preliminary screening of various P-PMO in a cell-free translation assay did 22
not accurately predict the relative efficacies of those P-PMO against whole virus in cell 23
culture. TRS1 P-PMO, which was only marginally active in cell-free translation 24
inhibition assays, was relatively potent in antiviral assays (Table 2). These data suggest 25
that varying levels of interference with viral RNA synthesis, rather than inhibition of 26
replicase translation, may differentiate the activity of various P-PMO with partially 27
overlapping target sequences in the leader TRS region. 28
29
The 72 nt leader regions of MHV and SARS-CoV have low sequence identity (32 %), 30
although the leader TRS sequence of each virus is positioned similarly: positions 66-72 31
ACCEPTED
18
for MHV, and 67-72 for SARS-CoV. In cell culture assays, MHV-TRS1 (target nt 51-1
72) and SARS-TRS2 (target nt 56-76) (24) respectively, were considerably more active 2
than MHV-TRS2 (target nt 60-82) and SARS-TRS1 (target nt 53-72). Further 3
experimentation will be required to determine where viral enzymes, such as nsp15 4
uridylate-specific endonuclease (3), footprint on the replicative form RNA during the 5
discontinuous phase of coronavirus negative-strand RNA synthesis (28). Such studies 6
may provide a rational explanation for the differential activity of P-PMO complementary 7
to various locations in the TRS region. 8
9
A P-PMO complementary to the 5’ terminal region of MHV genomic RNA produced the 10
most robust antiviral activity against MHV. However, a P-PMO complementary to the 11
TRS region of SARS coronavirus displayed a higher antiviral activity than the SARS-12
CoV 5TERM P-PMO in cell culture experiments with wild-type virus (Fig. 3B). Thus, 13
while the available data were sufficient to infer that the 5’-terminus and TRS region 14
contain P-PMO targets with a high potential for antiviral activity, preliminary screening 15
of P-PMO against live virus in cell culture appears to be necessary for accurate 16
evaluation of efficacy, and for the selection of candidates for in vivo testing. 17
18
Composition of the delivery peptide conjugated to the 5TERM PMO was a critical 19
determinant of antiviral activity in cell culture and in vivo. Generally, conjugates with 20
eight or nine arginines outperformed conjugates with fewer arginines in cell culture 21
assays (Fig. 2C), consistent with an earlier report (21). Despite the apparent equivalency 22
of the R9F2 and (RXR)4 peptide conjugates in cell culture (Fig. 2D), (RXR)4 conjugates 23
were more active in mice (Fig. 4A). The greater activity of (RXR)4 conjugates may be 24
due to their higher metabolic stability in circulation (37) and lesser trapping in 25
endosomes/lysosomes (2) than the R9F2 conjugate. These results suggest that insertion of 26
6-aminohexanoic acid within polyarginine or polybasic tracts may confer greater potency 27
to a P-PMO through enhanced stability and/or intracellular behavior, although further 28
experimentation will be required to determine the mechanism resulting in superior 29
activity. In contrast to the reports that showed enhanced liver uptakes of PNA and TFO 30
through their conjugation to carbohydrates (10, 36), mannose modification reduced the 31
ACCEPTED
19
activity of (RXR)4-5TERM significantly both in cell culture and in vivo. In addition, 1
mannose modification of the (RXR)4-5TERM conjugate did not enhance the activity(data 2
not shown). We can offer several plausible explanations for these observations. The 3
bulkiness of three mannose modified serine residues may have inhibited the delivery of 4
these compounds into cells by interfering with P-PMO association with cell surface 5
proteoglycans important for cellular uptake of an (RXR)4- PMO conjugate (2). Similarly, 6
the P-PMO portion of the mannosylated-P-PMO may interfere with the binding of 7
mannose to cognate receptors. It is also possible that the mannose moiety may enhance 8
uptake of P-PMO preferentially into cell types insignificant to viral pathology. It is 9
noteworthy that although nonconjugated PMO generated substantial antiviral activity in 10
vivo, (RXR)4- PMO was approximately ten times as effective at approximately half the 11
concentration (Fig. 4A). 12
13
5TERM P-PMO treatment reduced MHV titers in the liver. When using MHV-A59, we 14
found that administration of three doses of 5TERM P-PMO early in infection resulted in 15
long-lasting suppression of viral replication. Similar observations were reported in recent 16
studies with PMO compounds specific to Ebola virus (34) and CVB3 (38). (RXR)4-17
5TERM was active against all the strains tested in mice except MHV-2. On contrary, 18
liver titers in MHV-2 infected animals treated with either the control or virus-specific P-19
PMO were significantly higher than in mock-treated controls. MHV-2 is the strain that 20
replicated to the highest titers in the liver, and rapid replication and high viral load in this 21
organ could explain the discrepancy with the data obtained in cell culture, where 5TERM 22
P-PMO was nearly as effective against MHV-2 as against the other MHV strains. 23
Despite repeated attempts, we were unable to sequence the 5’ terminal region of the 24
genomic RNA of the MHV-2 isolate used in this study. However, the 5TERM PMO 25
binding site is absolutely conserved among the other strains of MHV for which sequence 26
information was available, and therefore sequence variance is unlikely to account for the 27
discrepancy between the results of cell culture and animal experiments. 28
29
MHV-3-infected mice succumb to a fulminant hepatitis, where cellular damage is 30
provoked not only by the virus, but also through activation of the coagulation cascade in 31
ACCEPTED
20
response to infection (15). Treatment with dmPGE2, a prostaglandin analog, has been 1
reported to reduce liver damage in MHV-3-susceptible mice, despite negligible effects on 2
the level of viral replication (1). However, in those studies, both the dmPGE2-treated 3
mice and the controls died at day 5 (1). In a separate report, ribavirin treatment during 4
MHV-3 infection prolonged survival, but again only to day 5 (16). Likewise, in our 5
experiments, reduced viral titers were found to result in a reduction of liver necrosis, yet 6
the lethal outcome was only slightly delayed. 7
8
MHV-A59 has been reported to provoke a fatal murine hepatitis. Our laboratory-adapted 9
MHV-A59 displayed lower pathogenicity in vivo, compared to a wild-type clone of A59, 10
MHV-Alb139 (4). It has been reported that mutations in the sequence coding for the 11
spike protein, resulting from in vitro adaptation to growth in glial cells, may result in 12
attenuation in the liver (22), and this may constitute an explanation for the attenuated 13
phenotype of our isolate of MHV A59. Experiments to characterize mutations involved 14
in the further attenuation of MHV-A59 are ongoing, and will be reported elsewhere. We 15
thus used Alb139 to obtain a more virulent, though not fulminant, hepatitis. Treatment 16
with 5TERM P-PMO limited the weight loss of mice that had received prophylactic 17
treatment and inoculation up to 104 PFU. However a noticeable exacerbation of the 18
clinical disease was observed both in the group where treatment with 5TERM P-PMO 19
was delayed until day 1 after inoculation and in the group that received the RND P-PMO 20
with the highest doses of Alb139. Likewise, despite a positive antiviral effect of P-PMO 21
observed in the lungs of MHV-1 infected mice, their clinical status was found to be 22
slightly worsened in all the P-PMO-treated groups compared to the mock-treated 23
controls. 24
25
As a small increase of the viral titers in presence of the RND-PMO was observed in 26
experiments in vitro (table 2) and in vivo (Fig. 4A, MHV-2 in 4C, and 6C-D) 27
experiments, and as an exacerbation of the clinical disease was observed both in delayed 28
5TERM-PMO treatment groups (Fig. 6C and 7B), we hypothesized that P-PMO, 29
irrespective of the sequence, may have a nonspecific enhancing effect on viral 30
replication. This effect could not have been detected after treatment with effective doses 31
ACCEPTED
21
of antiviral P-PMO, only becoming noticeable when the sequence of the PMO was 1
devoid of antiviral activity, or when the MHV titer was too high to be contained by the 2
treatment. To test this hypothesis, mice were inoculated with increasing doses of Alb139 3
(10, 100, 1000 or 10,000 PFU), and received (RXR)4-5TERM P-PMO or saline vehicle 4
starting at day 1. While the drug was still able to decrease the viral titer by ten-fold for 5
the lowest dose of virus at 4 days p.i., we were unable to detect any significant difference 6
between the viral loads in the livers of the two groups of animals at the three highest 7
doses (data not shown, n = 3-4/group). Thus, ineffective P-PMO treatment did not 8
detectably enhance the levels of viral replication under these conditions. We are 9
currently investigating how the choice of delivery peptide and PMO sequence affects the 10
disease augmentation. To determine if the exacerbated disease is specific to the 11
coronaviruses, we also are examining the effects of control and antiviral P-PMO in 12
infection models using viruses from other families. 13
14
In summary, treatment with anti-coronaviral P-PMO reduced viral titers both in vitro and 15
in vivo. However, some treatment-related toxicity was evident under conditions where 16
high loads of virus were present in the infected organs. These limitations may preclude 17
wider therapeutic use of (RXR)4- PMOs. The available data suggests that the present 18
formulation of P-PMO may still prove useful as prophylactic treatment for coronaviruses, 19
or if used as part of a combined antiviral therapy. 20
21
Acknowledgments 22
The authors wish to thank the Chemistry Group at AVI BioPharma for expert production 23
of all PMO compounds, Radin Aur, Andrew Kroeker, and Michelle Nelson for technical 24
assistance, and Dr. Howard S. Fox for histopathology advice. These studies were 25
supported by NIH grants AI25913 and AI059799 to MJB and NIH-NIAID contract 26
HHSN 266200400058C, “Functional and Structural Proteomics of SARS-CoV”. This is 27
TSRI manuscript N°18467. 28
ACCEPTED
22
REFERENCES 1
2
1. Abecassis, M., J. A. Falk, L. Makowka, V. J. Dindzans, R. E. Falk, and G. A. 3
Levy. 1987. 16, 16 Dimethyl prostaglandin E2 prevents the development of 4
fulminant hepatitis and blocks the induction of monocyte/macrophage 5
procoagulant activity after murine hepatitis virus strain 3 infection. J Clin Invest 6
80:881-9. 7
2. Abes, S., H. M. Moulton, P. Clair, P. Prevot, D. S. Youngblood, R. P. Wu, P. 8
L. Iversen, and B. Lebleu. 2006. Vectorization of morpholino oligomers by the 9
(R-Ahx-R)4 peptide allows efficient splicing correction in the absence of 10
endosomolytic agents. J Control Release 116:304-13. 11
3. Bhardwaj, K., J. Sun, A. Holzenburg, L. A. Guarino, and C. C. Kao. 2006. 12
RNA recognition and cleavage by the SARS coronavirus endoribonuclease. J Mol 13
Biol 361:243-56. 14
4. de Haan, C. A., M. de Wit, L. Kuo, C. Montalto-Morrison, B. L. Haagmans, 15
S. R. Weiss, P. S. Masters, and P. J. Rottier. 2003. The glycosylation status of 16
the murine hepatitis coronavirus M protein affects the interferogenic capacity of 17
the virus in vitro and its ability to replicate in the liver but not the brain. Virology 18
312:395-406. 19
5. Deas, T. S., I. Binduga-Gajewska, M. Tilgner, P. Ren, D. A. Stein, H. M. 20
Moulton, P. L. Iversen, E. B. Kauffman, L. D. Kramer, and P. Y. Shi. 2005. 21
Inhibition of flavivirus infections by antisense oligomers specifically suppressing 22
viral translation and RNA replication. J Virol 79:4599-4609. 23
6. Enterlein, S., K. L. Warfield, D. L. Swenson, D. A. Stein, J. L. Smith, C. S. 24
Gamble, A. D. Kroeker, P. L. Iversen, S. Bavari, and E. Mühlberger. 2006. 25
VP35 Knockdown Inhibits Ebola Virus Amplification and Protects against Lethal 26
Infection in Mice. Antimicrob Agents Chemother 50:984-993. 27
7. Ge, Q., M. Pastey, D. Kobasa, P. Puthavathana, C. Lupfer, R. K. Bestwick, P. 28
L. Iversen, J. Chen, and D. A. Stein. 2006. Inhibition of Multiple Subtypes of 29
Influenza A Virus in Cell Cultures with Morpholino Oligomers. Antimicrob 30
Agents Chemother. 31
8. Gorbalenya, A. E., E. J. Snijder, and W. J. Spaan. 2004. Severe acute 32
respiratory syndrome coronavirus phylogeny: toward consensus. J Virol 78:7863-33
7866. 34
9. Guan, Y., B. J. Zheng, Y. Q. He, X. L. Liu, Z. X. Zhuang, C. L. Cheung, S. 35
W. Luo, P. H. Li, L. J. Zhang, Y. J. Guan, K. M. Butt, K. L. Wong, K. W. 36
Chan, W. Lim, K. F. Shortridge, K. Y. Yuen, J. S. Peiris, and L. L. Poon. 37 2003. Isolation and characterization of viruses related to the SARS coronavirus 38
from animals in southern China. Science 302:276-8. 39
10. Hamzavi, R., F. Dolle, B. Tavitian, O. Dahl, and P. E. Nielsen. 2003. 40
Modulation of the pharmacokinetic properties of PNA: preparation of galactosyl, 41
mannosyl, fucosyl, N-acetylgalactosaminyl, and N-acetylglucosaminyl derivatives 42
of aminoethylglycine peptide nucleic acid monomers and their incorporation into 43
PNA oligomers. Bioconjug Chem 14:941-54. 44
ACCEPTED
23
11. Heasman, J. 2002. Morpholino oligos: making sense of antisense? Dev Biol 1
243:209-14. 2
12. Holden, K. L., D. A. Stein, A. A. Pierson, K. Ahmed, P. Clyde, P. L. Iversen, 3
and E. Harris. 2006. Inhibition of dengue virus translation and RNA synthesis by 4
a morpholino oligomer targeted to the top of the terminal 3' stem-loop structure. 5
Virology 344:439-52. 6
13. Kinney, R. M., C. Y. Huang, B. C. Rose, A. D. Kroeker, T. W. Dreher, P. L. 7
Iversen, and D. A. Stein. 2005. Inhibition of dengue virus serotypes 1 to 4 in 8
vero cell cultures with morpholino oligomers. J Virol 79:5116-28. 9
14. Lane, T. E., and M. J. Buchmeier. 1997. Murine coronavirus infection: a 10
paradigm for virus-induced demyelinating disease. Trends Microbiol 5:9-14. 11
15. Levy, G., and M. Abecassis. 1989. Activation of the immune coagulation system 12
by murine hepatitis virus strain 3. Rev Infect Dis 11 Suppl 4:S712-21. 13
16. Levy, G. A., G. Adamson, M. J. Phillips, L. A. Scrocchi, L. Fung, P. Biessels, 14
N. F. Ng, A. Ghanekar, A. Rowe, M. X. Ma, A. Levy, C. Koscik, W. He, R. 15 Gorczynski, S. Brookes, C. Woods, I. D. McGilvray, and D. Bell. 2006. 16
Targeted delivery of ribavirin improves outcome of murine viral fulminant 17
hepatitis via enhanced anti-viral activity. Hepatology 43:581-91. 18
17. Li, W., Z. Shi, M. Yu, W. Ren, C. Smith, J. H. Epstein, H. Wang, G. 19
Crameri, Z. Hu, H. Zhang, J. Zhang, J. McEachern, H. Field, P. Daszak, B. 20 T. Eaton, S. Zhang, and L. F. Wang. 2005. Bats are natural reservoirs of SARS-21
like coronaviruses. Science 310:676-679. 22
18. Liang, G., Q. Chen, J. Xu, Y. Liu, W. Lim, J. S. Peiris, L. J. Anderson, L. 23
Ruan, H. Li, B. Kan, B. Di, P. Cheng, K. H. Chan, D. D. Erdman, S. Gu, X. 24
Yan, W. Liang, D. Zhou, L. Haynes, S. Duan, X. Zhang, H. Zheng, Y. Gao, S. 25 Tong, D. Li, L. Fang, P. Qin, and W. Xu. 2004. Laboratory diagnosis of four 26
recent sporadic cases of community-acquired SARS, Guangdong Province, China. 27
Emerg Infect Dis 10:1774-81. 28
19. Masters, P. S. 1999. Reverse genetics of the largest RNA viruses. Adv Virus Res 29
53:245-64. 30
20. Moulton, H. M., M. C. Hase, K. M. Smith, and P. L. Iversen. 2003. HIV Tat 31
peptide enhances cellular delivery of antisense morpholino oligomers. Antisense 32
Nucleic Acid Drug Dev 13:31-43. 33
21. Moulton, H. M., M. H. Nelson, S. A. Hatlevig, M. T. Reddy, and P. L. 34
Iversen. 2004. Cellular uptake of antisense morpholino oligomers conjugated to 35
arginine-rich peptides. Bioconjug Chem 15:290-9. 36
22. Navas-Martin, S., S. T. Hingley, and S. R. Weiss. 2005. Murine coronavirus 37
evolution in vivo: functional compensation of a detrimental amino acid 38
substitution in the receptor binding domain of the spike glycoprotein. J Virol 39
79:7629-40. 40
23. Nelson, M. H., D. A. Stein, A. D. Kroeker, S. A. Hatlevig, P. L. Iversen, and 41
H. M. Moulton. 2005. Arginine-rich peptide conjugation to morpholino 42
oligomers: effects on antisense activity and specificity. Bioconjug Chem 16:959-43
966. 44
24. Neuman, B. W., D. A. Stein, A. D. Kroeker, M. J. Churchill, A. M. Kim, P. 45
Kuhn, P. Dawson, H. M. Moulton, R. K. Bestwick, P. L. Iversen, and M. J. 46
ACCEPTED
24
Buchmeier. 2005. Inhibition, escape, and attenuated growth of severe acute 1
respiratory syndrome coronavirus treated with antisense morpholino oligomers. J 2
Virol 79:9665-76. 3
25. Neuman, B. W., D. A. Stein, A. D. Kroeker, A. D. Paulino, H. M. Moulton, P. 4
L. Iversen, and M. J. Buchmeier. 2004. Antisense morpholino-oligomers 5
directed against the 5' end of the genome inhibit coronavirus proliferation and 6
growth. J Virol 78:5891-9. 7
26. Normile, D. 2004. Infectious diseases. Mounting lab accidents raise SARS fears. 8
Science 304:659-61. 9
27. Parker, S. E., T. M. Gallagher, and M. J. Buchmeier. 1989. Sequence analysis 10
reveals extensive polymorphism and evidence of deletions within the E2 11
glycoprotein gene of several strains of murine hepatitis virus. Virology 173:664-12
73. 13
28. Pasternak, A. O., W. J. Spaan, and E. J. Snijder. 2006. Nidovirus 14
transcription: how to make sense...? J Gen Virol 87:1403-21. 15
29. Sazani, P., F. Gemignani, S. H. Kang, M. A. Maier, M. Manoharan, M. 16
Persmark, D. Bortner, and R. Kole. 2002. Systemically delivered antisense 17
oligomers upregulate gene expression in mouse tissues. Nat Biotechnol 20:1228-18
33. 19
30. Summerton, J., and D. Weller. 1997. Morpholino antisense oligomers: design, 20
preparation, and properties. Antisense Nucleic Acid Drug Dev 7:187-95. 21
31. Summerton, J. J. 1999. Morpholino antisense oligomers: the case for an RNase 22
H-independent structural type. Biochim Biophys Acta 1489:141-158. 23
32. van den Born, E., D. A. Stein, P. L. Iversen, and E. J. Snijder. 2005. Antiviral 24
activity of morpholino oligomers designed to block various aspects of Equine 25
arteritis virus amplification in cell culture. J Gen Virol 86:3081-3090. 26
33. van der Hoek, L., K. Pyrc, M. F. Jebbink, W. Vermeulen-Oost, R. J. 27
Berkhout, K. C. Wolthers, P. M. Wertheim-van Dillen, J. Kaandorp, J. 28 Spaargaren, and B. Berkhout. 2004. Identification of a new human coronavirus. 29
Nat Med 10:368-373. 30
34. Warfield, K. L., D. L. Swenson, G. G. Olinger, D. K. Nichols, W. D. Pratt, R. 31
Blouch, D. A. Stein, M. J. Aman, P. L. Iversen, and S. Bavari. 2006. Gene-32
Specific Countermeasures against Ebola Virus Based on Antisense 33
Phosphorodiamidate Morpholino Oligomers. PLoS Pathog 2:e1. 34
35. Woo, P. C., S. K. Lau, C. M. Chu, K. H. Chan, H. W. Tsoi, Y. Huang, B. H. 35
Wong, R. W. Poon, J. J. Cai, W. K. Luk, L. L. Poon, S. S. Wong, Y. Guan, J. 36 S. Peiris, and K. Y. Yuen. 2005. Characterization and complete genome 37
sequence of a novel coronavirus, coronavirus HKU1, from patients with 38
pneumonia. J Virol 79:884-895. 39
36. Ye, Z., K. Cheng, R. V. Guntaka, and R. I. Mahato. 2005. Targeted delivery of 40
a triplex-forming oligonucleotide to hepatic stellate cells. Biochemistry 44:4466-41
76. 42
37. Youngblood, D. S., S. A. Hatlevig, J. N. Hassinger, P. L. Iversen, and H. M. 43
Moulton. 2007. Stability of cell-penetrating Peptide-morpholino oligomer 44
conjugates in human serum and in cells. Bioconjug Chem 18:50-60. 45
ACCEPTED
25
38. Yuan, J., D. A. Stein, T. Lim, D. Qiu, S. Coughlin, Z. Liu, Y. Wang, R. 1
Bouch, H. M. Moulton, P. L. Iversen, and D. Yang. 2006. Inhibition of 2
Coxsackievirus B3 in Cell-cultures and in Mice by Peptide-Conjugated 3
Morpholino Oligomers Targeting the IRES. J Virol. 4
39. Zhang, Y. J., D. A. Stein, S. M. Fan, K. Y. Wang, A. D. Kroeker, X. J. Meng, 5
P. L. Iversen, and D. O. Matson. 2006. Suppression of porcine reproductive and 6
respiratory syndrome virus replication by morpholino antisense oligomers. Vet 7
Microbiol. 8
40. Zorzitto, J., C. L. Galligan, J. J. Ueng, and E. N. Fish. 2006. Characterization 9
of the antiviral effects of interferon-alpha against a SARS-like coronavirus 10
infection in vitro. Cell Res 16:220-229. 11
12
ACCEPTED
26
Figure 1. P-PMO target sites and efficacy evaluation in a reporter assay. A) 1
Locations targeted by each PMO compound on the genomic (+) and antigenomic (-) viral 2
RNA (top panel), and on the subgenomic RNAs (lower right panel, example given is 3
RNA6) are indicated. B) Comparison of translation inhibitory activity by P-PMO against 4
in vitro transcribed RNA consisting of MHV 5’-untranslated region sequence fused to 5
luciferase in rabbit reticulocyte lysate in vitro translation reactions. . Activities of P-6
PMO complementary to the genomic MHV 5’-untranslated region (left) and other regions 7
of viral RNA (right) from the same experiment are depicted at right. Error bars indicate 8
standard error of the mean. 9
10
Figure 2. Evaluation of PMO sequences and various peptide conjugates in MHV 11
infected cells. A) Dose-dependent inhibition of MHV plaque expansion. DBT cell 12
cultures were inoculated with fixed doses of MHV-A59, and R9F2-PMO was added with 13
each agarose overlay. Plaque diameter was then measured 72 h after the overlay was 14
applied. B) R9F2-PMO treatment reduces syncytium formation by MHV-1 and MHV-4. 15
Qualitative changes in cell morphology and density were compared against untreated 16
infected (leftmost panel) and untreated uninfected (right panel, column marked untreated) 17
controls. Representative images show cells pretreated for 3 h with 10 µM R9F2-PMO and 18
fixed 24 h after inoculation. C) Effects of delivery peptide conjugation on PMO activity. 19
DBT cells were treated with 20 µM P-PMO for 3 h, before inoculation at a multiplicity of 20
0.1 PFU/cell with MHV-A59. Virus yield was quantified 24 h after inoculation. 5’-21
terminal peptide conjugates follow standard single-letter amino acid naming except as 22
follows: 6-amino-hexanoic acid (X), beta-alanine (B), mannose (Man). Asterisks 23
indicate significant differences (p < 0.05 by Student’s t-test) with respect to mock-treated 24
controls. D) Dose-response experiment comparing the effects of R9F2 and (RXR)4-25
conjugated 5TERM, TRS1 and RND P-PMO on viral titer. Cells were treated with 26
various P-PMO at 10 µM for 3 h, infected with MHV-A59 for 1 h, then incubated again 27
in the presence of PPMO for 24 h. Error bars throughout indicate standard error of the 28
mean. 29
ACCEPTED
27
Figure 3. Single-dose and long-term inhibition of coronavirus multiplication. A) 1
Inhibition of the replication of various MHV strains (inoculated at multiplicities of 0.01 2
to 1 PFU/cell) in DBT cells after 3 h pre-inoculation treatment with 10 µM P-PMO. 3
Virus yield was quantified 24 h after inoculation. B) Dose-activity comparison of the 4
effects of SARS-5TERM and SARS-TRS1 P-PMO on SARS-CoV (1 PFU/cell) in Vero-5
E6 cells. Cells were treated with P-PMO 6 h prior to inoculation, and viral titer was 6
analyzed 48 h after. C) Effects of long-term P-PMO treatment on MHV replication. 7
DBT cells were treated for 6 h with P-PMO, then inoculated with plaque-purified MHV-8
A59 (0.1 PFU/cell). Culture medium was used to inoculate fresh cultures of P-PMO-9
treated cells every 24 h for a total of 10 viral passages. Virus yield was quantified as in 10
panel A. Error bars throughout indicate standard error of the mean. 11
12
Figure 4: 5TERM-PMO and -P-PMO reduce viral titers in the livers of MHV-13
infected mice. Mice were inoculated i.p. with MHV-A59 (A and B) or various other 14
MHV strains (C). Starting at 5 h before infection and on each of the next two days, each 15
animal received one dose of saline (black bars), RND PMO or (RXR)4-PMO (hatched 16
bars) or 5TERM PMO or (RXR)4-PMO (white bars), as indicated in the Materials and 17
Methods. Livers were collected on day 4 (A and C), or at the indicated time points (B), 18
and viral titers were determined by plaque assay. Error bars indicate standard error of the 19
mean. Asterisks indicate significant difference from mock-treated controls (p<0.05, 20
Student’s t test). 21
22
Figure 5: 5TERM-(RXR)4-PMO attenuate viral hepatitis. A) Livers were obtained 23
from mice infected with the indicated MHV strain at 4 (MHV-2, MHV-3 and MHV -24
Alb139) or 6 (MHV -A59) days p.i. The number of necrotic lesions per unit area was 25
compared between P-PMO-treated and mock-treated groups, as described in Materials 26
and Methods. Data points represent individual mice, and bars indicate the mean severity 27
for the combined mock- and RND P-PMO-treated groups, and the 5TERM P-PMO-28
treated group respectively. The number of lesions was significantly lower in A59-infected 29
mice treated with 5TERM P-PMO relative to mock-treated (p<0.05) or RND P-PMO-30
treated (p<0.005) controls. B-G) Representative areas of hematoxylin and eosin-stained 31
livers from uninfected (B and C), MHV-A59 (D and E, 6 days p.i.), and MHV-3 (F and 32
ACCEPTED
28
G, 4 days p.i.) infected animals. Mice received (RXR)4-5TERM P-PMO treatment 1
(panels C, E and G) or mock treatment (panels B, D and F). Necrotic lesions and 2
inflammation characteristic of lymphocytes are indicated with arrowheads. Note the 3
regions of bright pink staining that mark necrotic areas in panel E. At a higher 4
magnification, the liver sections show ballooning necrosis (large black arrowheads), 5
lymphocytic infiltration with more moderate necrosis (large white arrowheads), 6
widespread coagulation necrosis with karyorrhectic debris (small black arrowheads) and 7
eosinophilic staining reminiscent of Councilman bodies (small white arrowheads). Scale 8
bars represent 0.1 mm. 9
10
Figure 6: Dual effects of (RXR)4-5TERM on weight loss and survival. Mice were 11
infected by 10 PFU MHV-3 (A) or 100 (B), 10,000 (C) or 50,000 (D) PFU MHV-12
Alb139. Depending on the experiment, some animals received (RXR)4-5TERM either 13
following a prophylactic (empty circles) or therapeutic (empty squares and empty 14
triangles) regimen. Controls received either saline (black circles) or (RXR)4-RND (black 15
triangles) daily, with the first injection starting 5 h before inoculation. Relative weight is 16
shown for each treatment group (n=3 to 7). Error bars indicate standard error of the 17
mean. Each death is represented with the group’s corresponding symbol positioned on 18
the time axis at the time of the event. Asterisks indicate significant differences relative to 19
the mock-treated control group. *, p<0.05. **, p<0.01. Student’s t test (weight) or log-20
rank survival test (mortality). 21
22
Figure 7: P-PMO in the lungs of MHV-1-infected mice 23
A) Comparison of viral titers from lung homogenates collected 4 days after inoculation. 24
As indicated, the treated groups received three doses of 5TERM (RXR)4-PMO i.n. or i.p. 25
starting 5 hours before or 24 hours after i.n. inoculation with 100 PFU MHV-1. The 26
designation “a” marks a non-significant trend of difference from mock-treated controls 27
(p=0.057, Student’s t test). B) Clinical disease in A/J mice infected with 50 PFU MHV-1 28
and treated i.n. as indicated. Daily weight values are expressed as a percentage of the 29
initial weight of each animal. Error bars indicate standard error of the mean for each 30
ACCEPTED
29
group (n=4/group, except RND P-PMO n=1). Asterisks indicate significant differences 1
relative to the mock-treated control group. *, p<0.05. **, p<0.01. Student’s t test. 2
3
ACCEPTED
1
Table 1. P-PMO sequences and target sites. 1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18 aMHV nucleotide positions based on AY700211. 19
bPositions of the complementary genomic nucleotide positions are specified.
20 cSARS-CoV positions based on AY274119. 21
22
SARS-CoV genomic 5’-terminus (1-20) GGTAGGTAAAAACCTAATAT SARS-5TERM
SARS-CoV genomic leader TRS region (53-72)c GTTCGTTTAGAGAACAGATC SARS-TRS1
Randomized control sequence AGTCTCGACTTGCTACCTCA RND
Antigenomic leader stem-loop 1 (18-39)b TCCGTACGTACCCTCTCAACTC (-)19-40
Antigenomic 3’-terminus (2-22)b TATAAGAGTGATTGGCGTCCG (-)3TERM
Genomic sgRNA 6 TRS region (28958-28979) GTACTACTCATAATGTTTAGAT MBTRS
Genomic pp1ab ribosomal frameshift signal (13612-13632) GACGGGCATTTACACTTGTAC 1ABFS
Genomic pp1ab AUG region (200-220) TCTTTGCCATTATGCAACCTA AUG
Genomic between leader and pp1ab AUG (104-123) TGACAAGACCAGGCCCGCGG 5UTR
Genomic TRS region (60-82) CGTTTATAAAGTTTATATTAGAT TRS2
Genomic and subgenomic TRS region (51-72) GTTTAGATTAGATTTAAACTAC TRS1
Genomic leader stem-loop 1 (19-40) GAGTTGAGAGGGTACGTACGGA (+)19-40
Genomic 5’-terminus (2-22)a CGGACGCCAATCACTCTTATA 5TERM
P-PMO target site (nucleotide positions) P-PMO sequence (5’-3’) P-PMO name
ACCEPTED
1
Table 2. Summary of P-PMO effectiveness. 1
2
3
4
P-PMO EC50a IC50
b Strain Log titer decrease
c
R9F2-5TERM 16 nM 1.46 µM
MHV-1 MHV-2 MHV-3 MHV-4
MHV-A59
2.05 1.19 2.45 2.35 3.63
R9F2-(+)18-39 51 nM 1.42 µM n.t.d n.t.
R9F2-TRS1 >1000 nM 2.08 µM
MHV-1 MHV-2 MHV-3 MHV-4
MHV-A59
0.55 0.05 0.11 0.63 0.87
R9F2-AUG 335 nM 2.73 µM n.t. n.t.
R9F2-RND >1000 nM >20 µM
MHV-1 MHV-2 MHV-3 MHV-4
MHV-A59
-0.15 -0.25 -0.21 -0.40 0.16
a50% reduction of luciferase expression in cell-free translation assays relative to untreated controls. 5
b50% reduction of MHV-A59 titer 24 h.p.i. following 6h P-PMO pretreatment. 6
cAverage log10 decrease in titer at 24 h.p.i. following 6h pretreatment with 10 µM P-PMO, relative to 7
untreated control. Negative values describe elevated titers. 8 dNot tested. 9
10 ACCEPTED
ACCEPTED
ACCEPTED
ACCEPTED
ACCEPTED
ACCEPTED
ACCEPTED
ACCEPTED