actin-independent exclusion of cd95 by pi3k/akt signalling: implications for apoptosis

Actin-independent exclusion of CD95 by PI3K/AKTsignalling: Implications for apoptosis

Mathieu Pizon�1,2, Hariniaina Rampanarivo�3, Sebastien Tauzin3,

Benjamin Chaigne-Delalande1,2, Sophie Daburon1,2,

Michel Castroviejo2,4, Patrick Moreau2,5, Jean-Franc-ois Moreau1,2,6

and Patrick Legembre3

1 CNRS UMR 5164, Bordeaux, France2 Universite de Bordeaux-2, Bordeaux, France3 Universite de Rennes-1, IRSET (Institut de Recherche en Sante, Environnement et Travail)/EA-

4427 SERAIC, Rennes, France4 CNRS UMR-5234, Laboratoire de Microbiologie Cellulaire et Moleculaire et Pathogenicite,

Bordeaux, France5 CNRS-UMR 5200, Bordeaux, France6 CHU Bordeaux, Bordeaux, France

The immune system eliminates infected or transformed cells through the activation of the

death receptor CD95. CD95 engagement drives the recruitment of the adaptor protein Fas-

associated death domain protein (FADD), which in turn aggregates and activates initiator

caspases-8 and -10. The CD95-mediated apoptotic signal relies on the capacity to form the

CD95/FADD/caspases complex termed the death-inducing signalling complex (DISC). Cells

are classified according to the magnitude of DISC formation as either type I (efficient DISC

formation) or type II (inefficient). CD95 localised to lipid rafts in type I cells, whereas the

death receptor was excluded from these domains in type II cells. Here, we show that

inhibition of both PI3K class IA and serine–threonine kinase Akt in type II cells promoted

the redistribution of CD95 into lipid rafts, DISC formation and the initiation of the apop-

totic signal. Strikingly, these molecular events took place independently of CD95L and the

actin cytoskeleton. Overall, these findings highlight that the oncogenic PI3K/Akt signalling

pathway participates in maintaining cells in a type II phenotype by excluding CD95 from

lipid rafts.

Key words: Akt . Apoptosis . CD95 . Lipid rafts . PI3K

Supporting Information available online

�These authors have contributed equally to this study.Correspondence: Dr. Patrick Legembree-mail: [email protected]

& 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.eji-journal.eu

DOI 10.1002/eji.201041078 Eur. J. Immunol. 2011. 41: 2368–2378Mathieu Pizon et al.2368

Introduction

The death receptor CD95 (Fas/APO1) belongs to the tumour

necrosis factor (TNF) receptor family. Although CD95 is

ubiquitously expressed, its cognate ligand, CD95L, displays a

more restricted expression pattern. This apoptotic ligand is

found at the plasma membrane of immune cells [1] and

participates in the elimination of transformed and infected cells.

A common feature of the death receptors is the presence

of an intracellular domain termed the death domain (DD).

Binding of CD95L to CD95 triggers the recruitment at the DD

level of the adaptor protein Fas-associated death domain protein

(FADD), which in turn aggregates proteases called caspase-8

and -10. The close vicinity of these caspases facilitates their

activation and the induction of the caspase cascade,

culminating in the death of the cell. The CD95/FADD/caspase-8

complex is called the death-inducing signalling complex (DISC)

[2]. Investigations of the molecular mechanisms modulating

the initial steps of CD95 signalling showed that the redistribution

of CD95 into nanometer to micrometer-sized domains

of the plasma membrane, termed lipid rafts, enhanced the

formation of the DISC and the transmission of the apoptotic

signal [3–6]. In addition, some anti-tumoral drugs eliminate

malignant cells through the redistribution of CD95 into lipid

rafts and the induction of a CD95L-independent apoptotic signal

(e.g. rituximab [7], resveratrol [8, 9], edelfosin [3, 10] and

cisplatin [11]).

According to the signalling pathway triggered upon

CD95 engagement, cells are classified, both in vivo and in vitro,

as type I or type II cells [12]. In this regard, the DISC is

efficiently formed in type I cells and the large amount of

activated caspase-8 directly activates the executioner caspases-3,

-6 and -7, which in turn process various intracellular

substrates. On the contrary, type II cells display impaired

DISC formation and release a weak amount of caspase-8

sufficient to activate the mitochondrion-driven apoptotic

pathway [13].

The PI3K signal participates in various cellular processes

such as cell proliferation, migration, survival and cell

growth. The class I PI3K phosphorylates plasma membrane

phospholipids and generates a second messenger termed

phosphatidylinositol-(3,4,5)-trisphosphate (PIP3). In turn, phos-

phatidylinositol-(3,4,5)-trisphosphate serves as a docking

site for various signalling factors such as the serine–threonine

kinase Akt. The re-localisation of cytosolic Akt to the

plasma membrane leads to its activation via phosphorylation

by the PI3K-dependent kinase-1 (PDK1) at Thr308 and by

mammalian target of rapamycin (mTOR) complex-2 (TORC2)

at Ser473.

Herein, inhibition of the PI3K-Akt axis is shown to orchestrate

the partition of CD95 into lipid rafts through an actin- and

CD95L-independent mechanism. In addition, the redistribution of

CD95 into lipid rafts promotes the conversion of cells from a type

II to a type I phenotype.

Results

PI3K activity controls the plasma membrane distribu-tion of CD95

To address the effect of PI3K activity on the plasma membrane

distribution of CD95, the effect of PI3K inhibitors (wortmannin

and LY294002) was analysed on the leukemic T-cell line Jurkat,

which displays strong constitutive PI3K activation [3]. Using gel

filtration chromatography, PI3K inhibition was observed to

induce the formation of CD95-containing heavy macromolecular

complexes (Fig. 1A). Indeed, while fractions 1 and 2, encom-

passing molecular complexes heavier than 1 megadalton,

contained only 2% of the total amount of CD95 in untreated

Jurkat T cells, this amount increased up to 37% after PI3K

inhibition (Fig. 1A). Similarly, PI3K inhibition increased the

amount of caspase-8 eluted in fractions 1 and 2 (data not shown).

Since these heavy complexes included both the death receptor

CD95 and its downstream effector caspase-8, PI3K inhibition

was thought to induce DISC formation. To prove this assumption,

Jurkat cells were incubated for 4 h with wortmannin or LY294002

(data not shown) and CD95 was subsequently immunoprecipi-

tated (Fig. 1B). Inhibition of PI3K activity resulted in the

association of FADD with CD95 and the subsequent recruitment

of the initiator caspase-8 (Fig. 1B). Next, we wondered

whether PI3K inhibition caused the re-distribution of CD95 into

lipid rafts due to de novo expression of CD95L. To address this

question, the presence of CD95L in treated and untreated

cells was assessed using flow cytometry (plasma

membrane CD95L) and immunoblotting (total CD95L), and

no trace of CD95L was detected (Supporting Information Fig.

S1A and B). These findings indicated that the PI3K-inhibition-

induced formation or ‘PI3Kinh-DISC’ formation occurred inde-

pendently of CD95L.

We next explored whether the DISC formation and the

apoptotic signal observed upon PI3K inhibition relied on the

redistribution of CD95 into lipid rafts. Methyl-b-cyclodextrin

(MbCD) treatment chelates cholesterol and dismantles lipid rafts

[14]. While MbCD pretreatment did not alter the expression level

of CD95 (Supporting Information Fig. S1C), it abrogated the

DISC formation observed upon PI3K inhibition (Fig. 1C) and

significantly crippled the subsequent apoptotic signal (Fig. 1D).

Overall, these results suggested that abrogation of PI3K signalling

in type II cells induced DISC formation through a lipid raft-

dependent and CD95L-independent pathway.

Pharmacologic inhibition of Akt triggers the redistri-bution of CD95 into lipid rafts

Since the serine–threonine kinase Akt (also known as protein

kinase B) mediates many of the downstream events regulated by

PI3K, we next wondered whether this kinase was instrumental in

maintaining CD95 outside of the lipid rafts. Phosphorylation of Akt

Eur. J. Immunol. 2011. 41: 2368–2378 Leukocyte signaling 2369


on serine473 is a hallmark of Akt activation. Using cell lines of

haematological origin, phosphorylated Akt could not be detected

in the type I cell lines H9 and SKW6.4, whereas Akt was

constitutively activated in type II cells (see inset in Fig. 2A). More

intriguingly, analysis of the lipid raft distribution of CD95 revealed

that the death receptor was excluded from lipid rafts in type II cells

(high PI3K activity), whereas it was enriched in type I cells (low

PI3K activity) (Supporting Information Fig. S2A and B). The

inverse correlation observed between the magnitude of Akt

phosphorylation and the distribution of CD95 into lipid rafts

raised the question of whether this kinase participated in excluding

CD95 from the lipid rafts.

Akt inh-VIII (Akt inhibitor VIII) is a selective inhibitor of

isoforms 1 and 2 of Akt [15], whereas Akt inh-X is a pan-Akt

inhibitor [16]. Both pharmacological inhibitors triggered apop-

totic signalling in type II cells, whereas they were ineffective in

type I cells (Fig. 2A). Next, the role of CD95 in the apoptotic

signal induced by Akt inhibitors was investigated. For this

purpose, the previously described CD95-deficient type II cell line

CEM-IRC [3] was reconstituted with WT CD95 or a death

domain-truncated mutant (CD95(1–210)) unable to transmit the

apoptotic signal [17]. Stable clones exhibiting comparable

amounts of CD95 to the parental CEM were selected (Supporting

Information Fig. S3A). As expected, the CEM-IRC cell line and its

CD95(1–210)-reconstituted counterpart failed to transmit any

CD95-mediated apoptotic signal, whereas the signal was restored

in CEM-IRCCD95 (Supporting Information Fig. S3B). Similarly, the

apoptotic signals induced by PI3K and Akt inhibitors were

hindered in CEM-IRC and CEM-IRCCD95(1–210) cells compared

with the parental CEM or CD95-reconstituted CEM-IRC (Fig. 2B

and Supporting Information Fig. S3B). These findings supported

the notion that CD95 and its downstream signalling pathway

participated in the transmission of the apoptotic signal.

Confirming these latter observations, FADD-deficient Jurkat cells

were less sensitive than their FADD-reconstituted counterparts to

the apoptotic signal induced by Akt and PI3K inhibitors

(Supporting Information Fig. S3C). It was next analysed whether

Akt inhibition led to the activation of the death receptor-induced

initiator caspase-8. As with the PI3K inhibitor wortmannin,

exposure to Akt inh-VIII caused the cleavage and activation of

caspase-8 both in Jurkat and in CEM T cells (Fig. 2C). As did PI3K

inhibitors, Akt inh-VIII and -X induced no change in cell-surface

CD95 expression, nor did they induce any CD95L expression

(Supporting Information Fig. S1D). Overall, these findings

suggested that Akt inhibition promoted the aggregation of CD95

and its redistribution into lipid rafts, which in turn elicited the

induction of a CD95L-independent and CD95-dependent apop-

totic signal.

We next wondered whether Akt inhibition, like PI3K inhibi-

tion, induced the partition of CD95 into lipid rafts. Lipid rafts can

be followed using the fluorochrome-coupled B-subunit of the

cholera toxin, a protein exhibiting a strong affinity for the

Figure 1. PI3K inhibition promotes DISC formation through a lipid raft-dependent mechanism. (A) Top: Jurkat cells were incubated for 4 h with5 mM wortmannin, washed and lysed. Proteins were resolved using gel filtration chromatography in native conditions. Fifty microliters of eachfraction was loaded onto a 12% SDS-PAGE. Immunoblots were performed using anti-CD95 mAb. Estimated molecular sizes are indicated below theimmunoblots. Bottom: For each immunoblot, the bands were scanned and quantified by densitometry using Image J software. The percentage ofCD95 present in each fraction is indicated. Data are representative of three independent experiments. (B) Jurkat cells were exposed to 5 mMwortmannin for 4 h and then lysed. CD95 was immunoprecipitated and the immune complex was resolved using SDS-PAGE. Immunoblots wereperformed with the indicated Abs. The p41/43 fragments correspond to the auto-processed caspase-8 and represent the initial step of caspaseactivation. The � indicates an irrelevant band, which corresponds to the heavy chain of APO1-3 IgG3. Total lysates were loaded as control. Data arerepresentative of three independent experiments. (C) Jurkat T cells were incubated for 20 min in the presence or absence of 2 mM MbCD and thenexposed to 5 mM wortmannin for 4 h. CD95 was immunoprecipitated and the immune complex was resolved using SDS-PAGE as described in (B).The � indicates an irrelevant band, which corresponds to the heavy chain of APO1-3 IgG3. Data are representative of three independentexperiments. (D) Jurkat cells was pre-incubated with 2 mM MbCD for 20 min and then exposed to the PI3K inhibitors wortmannin and LY294002 for6 h. The drop in mitochondrial potential (DCm) was assessed. Data show the mean and SD of three independent experiments.

Eur. J. Immunol. 2011. 41: 2368–2378Mathieu Pizon et al.2370


monosialoganglioside GM1, which is enriched in these domains.

Exposure of the T-cells Jurkat and CEM to Akt inh-VIII (Fig. 2D)

and -X (data not shown) promoted the clustering of CD95 and its

localisation to lipid rafts. In addition, the dismantling of lipid

rafts using MbCD prevented the apoptotic signal induced by Akt

inhibition (Fig. 2E). Overall, these findings suggested that in type

II cells, the kinase activity of Akt hampered CD95 clustering, its

partition into lipid rafts and apoptotic signal initiation.

Genetic disruption of Akt activity compartmentalisesCD95 into lipid rafts

To confirm the role of the kinase Akt in the plasma membrane

compartmentalisation of CD95, we generated a dominant negative

mutant of Akt (DN-Akt) by the substitution of threonine378 and

serine473 for alanine. The type II cell line Jurkat, which displayed

strong PI3K/Akt signalling (Fig. 2A), was transfected with DN-Akt

and stably expressing clones were selected (Fig. 3A). As expected,

the expression of DN-Akt in leukemic T cells decreased endogen-

ous Akt phosphorylation (Fig. 3A). It is thought that while cancers

arise through the acquisition of numerous genetic alterations,

some malignancies are addicted to the activity of a single

oncogene. Consequently, disruption of the respective oncogene

leads to apoptosis of malignant cells. This phenomenon is called

‘oncogene addiction’ [18]. According to this notion, type II

leukemic cells are considered addicted to oncogenic PI3K/Akt

signalling. Nonetheless, viable leukemic cell clones expressing DN-

Akt were isolated. Viability in the presence of DN-Akt may be due

to sufficient residual Akt activity or to another oncogenic signalling

pathway compensating for the loss of PI3K/Akt signalling. To

ascertain that DN-Akt Jurkat cells remained addicted to PI3K/Akt

signalling, sensitivity to selective inhibitors of PI3K and Akt was

assessed. When compared with the parental cell line, each stable

DN-Akt clone displayed a significant increase in sensitivity to PI3K

(wortmannin, LY294002) or Akt (Akt-inhVIII) inhibitors (Fig. 3B).

Figure 2. Akt activity maintains CD95 outside of lipid rafts. (A) Type II (Jurkat and CEM) and type I cells (SKW 6.4 and H9) were exposed to Aktinhibitors for 16 h. Cell death was assessed using the MTT assay. Inset shows immunoblots performed with Abs recognising phosphorylated Akt(activated form) or the whole protein. Data represent mean and SD of three independent experiments. (B) The low CD95-expressing CEM-IRC andits parental counterpart (CEM) were incubated for 16 h with selective Akt inhibitors. The percentage of cell death was assessed by measuring thedrop in mitochondrial potential (DCm). Data represent mean and SD of three independent experiments. (C) Type II cells Jurkat and CEM wereexposed to 5mM wortmannin or Akt inh-VIII. Cells were then lysed and subjected to SDS-PAGE and anti-caspase-8 immunoblotting. Data arerepresentative of three independent experiments. (D) Jurkat and CEM cells were incubated for 4 h with or without 5 mM Akt inh-VIII. Cells werethen fixed and stained for lipid rafts and CD95. Images were acquired with a confocal microscope using an ApoPLAN 63� objective. Bars 5 5mm.(E) Cells were pre-incubated for 20 min with or without 2 mM MbCD and then exposed to Akt inh-VIII for 6 h. The drop in DCm was assessed. Datarepresent mean and SD of three independent experiments.



These findings indicated that the small amount of phosphorylated

Akt observed in the DN-Akt leukemic cells (Fig. 3A) played a

pivotal role in their survival and that no additional signal overrode

their Akt addiction.

Next, we determined whether the genetic disruption of Akt

activity affected the CD95-mediated apoptotic threshold in

leukemic cells by redistributing CD95 into lipid rafts. The plasma

membrane distribution of CD95 was analysed using sucrose

gradient fractionation. The reduction in Akt activity was observed

to promote the compartmentalisation of CD95 into lipid rafts

(Fig. 3C). Indeed, while in parental cells 9% of the total amount

of CD95 was detected in lipid rafts, the distribution of CD95 in

the low-buoyancy fractions reached 32 and 38% of total CD95 in

DN-Akt clones 5 and 8 respectively (Fig. 3C). Importantly,

expression of DN-Akt enhanced the localisation of CD95 into lipid

rafts through a CD95L-independent process since the cytokine

was not detected in DN-Akt-expressing Jurkat cells (data not

shown). Redistribution of CD95 into lipid rafts enhances DISC

Figure 3. Akt inhibition promotes CD95-mediated apoptotic signalling through a lipid raft-dependent mechanism. (A) DN-Akt was transfected inJurkat cells and two independent clones were isolated. Left and middle: intracellular staining and flow cytometry analysis of total Akt in the DN-Akt-expressing cells and control cells (empty vector). Right: anti-whole Akt and phosphorylated Akt (Serine473) immunoblots were carried out.b-Actin serves as a loading control. Data are representative of three independent experiments. (B) Indicated cells were incubated for 8 h with PI3K(wortmannin and LY294002), and Akt (Akt Inh-VIII) inhibitors and cell death was assessed by measuring the drop in DCm. Data represent meanand SD of three independent experiments. (C) Left: Empty vector and DN-Akt-expressing Jurkat T cells were lysed. Total lysate was subjects toultracentrifugation in a sucrose gradient to separate lipid raft fractions from soluble membranes. The src kinase Lck delineates lipid raft fractions.Right: For CD95 immunoblots, the bands were scanned and quantified by densitometry using Image J software. The percentage of CD95 present ineach fraction is indicated. Data are representative of three independent experiments. (D) Indicated cells were incubated with 1mg/mL of theagonistic Ab APO1-3 for 15 min at 41C (0) or at 371C (15 min). Cells were lysed and CD95 was immunoprecipitated. The DISC was resolved bySDS-PAGE and immunoblots were performed. Total lysates were loaded as controls. Immunoblots are representative of three independentexperiments. (E) Empty vector- and DN-Akt-expressing Jurkat cells were exposed to CD95L for 16 h and cell death was assessed using the MTTassay. Data represent mean and SD of three independent experiments. (F) Control and DN-Akt-expressing Jurkat ]5 (Left) or ]8 (right) cell lines werepre-incubated with or without 2 mM MbCD for 20 min and then exposed to CD95L or the anti-CD95 agonistic mAb APO1-1 for 6 h. The drop inmitochondrial potential (DCm) was assessed. Data represent mean and SD of three independent experiments.



formation and the transmission of the apoptotic signal [4, 5, 19].

In accordance with this notion, the expression of DN-Akt

enhanced the recruitment of FADD to CD95 and the subsequent

aggregation of caspase-8 at the DISC level in the presence of

CD95L (Fig. 3D and Supporting Information Fig. S4). Further-

more, Akt inhibition not only promoted the initial steps of CD95

signalling (i.e. DISC formation) but also significantly enhanced

CD95-mediated apoptosis (Fig. 3E).

Next, the role of lipid rafts in CD95 signalling was investi-

gated. Consistent with the small amount of CD95 present in the

lipid rafts of type II cells (Fig. 3C), cholesterol depletion by MbCD

did not affect the CD95 signalling induced by the agonist mAb

APO1-1 or by CD95L in the parental cells (Fig. 3F). On the

contrary, the same pre-treatment reduced the sensitivity of the

DN-Akt clones to the level of the parental cell line (Fig. 3F).

Importantly, the weak agonistic mAb APO1-1 has been previously

used to discriminate between type I and type II cells [20]. In this

regard, although type I cells of leukemic origin were efficiently

eliminated by APO1-1, type II leukemic cells were resistant to

APO1-1. Our observation that the type I cells SKW6.4 (Support-

ing Information Fig. S5) and H9 (data not shown) were killed

more efficiently than the type II cells Jurkat (Supporting Infor-

mation Fig. S5) or CEM (data not shown) confirms these findings.

Interestingly, Jurkat cells in which Akt activity was crippled

exhibited a dramatic increase in APO1-1 sensitivity and therefore

behaved as type I-like cells (Supporting Information Fig. S5).

Another key feature distinguishing type I cells from type II

cells is the addiction of type II cells to the mitochondrial apoptotic

pathway as a mediator of CD95-induced apoptosis [13]. As

shown in Fig. 4, over-expression of GFP-tagged Bcl2 impaired

CD95-mediated apoptotic signalling in the type II cell Jurkat.

Similarly, GFP-Bcl2 protected cells from the mitochondrion-

dependent apoptotic pathway induced by staurosporine (Fig.

4A), confirming that the mitochondrion-driven apoptotic signal

was efficiently inhibited in these cells. On the contrary, the

apoptotic signal induced by PI3K and Akt inhibitors remained

unaffected by the over-expression of Bcl2 (Fig. 4A), suggesting

that in this context the CD95-mediated apoptotic signal occurred

independently of mitochondria. In line with this observation,

expression of DN-Akt in Jurkat cells significantly decreased the

influence of mitochondria in CD95-mediated apoptotic signalling

compared with parental cells (Fig. 4B). Overall, these findings

established that, in type II cells, inhibition of Akt enhanced the

CD95 signalling pathway in part by localising CD95 into lipid

rafts and consequently by shifting the apoptotic signal from a

type-II to a type I-like response.

PI3K and Akt inhibition elicit an actin andezrin-independent apoptotic signal

Ezrin, radixin and moesin (ERM proteins) are three closely related

proteins in the band 4.1 superfamily, members of which are known

to serve as membrane–cytoskeleton linkers. Despite controversy

[21], the adaptor protein ezrin was shown to connect CD95 to the

actin meshwork and thereby to play a pivotal role in CD95-

mediated apoptosis, at least in T cells [22]. First, to address the

role of ezrin in the apoptotic signal triggered by PI3K inhibition

and Akt inhibition, ezrin phosphorylation was analysed. In its

inactive state, ezrin exhibits a closed NH2 terminal-to-COOH

terminal (N-C) binding conformation. Disruption of the N-C

binding conformation through the phosphorylation of threonine567

leads to ezrin activation and promotes interaction with F-actin

[23]. Strikingly, incubation of the type II cell-line Jurkat with PI3K

or Akt inhibitors led to the dephosphorylation of threonine567

(Fig. 5A). On the grounds that PI3K/Akt inhibition inactivates

ezrin, we hypothesised that this adaptor molecule did not

participate in connecting CD95 with F-actin upon inhibition of

the oncogenic signal. In agreement with this observation, ezrin

was not detected in the DISC formed in activated peripheral blood

lymphocytes (PBLs) or Jurkat cells exposed to wortmannin (data

not shown). Second, to confirm that ezrin did not contribute to the

signalling induced upon inhibition of the PI3K-Akt axis, two GFP-

fused ezrin dominant negative constructs were engineered. One of

the constructs consisted of the amino-terminal region (amino acids

1–310) encompassing the CD95-binding domain [24] and the

other consisted of the carboxy-terminal fragment including the

consensus sequence motif for actin binding [25] (Supporting

Information Fig. S6A). These constructs were designated ezrin-

NBD for N-terminal binding domain and ezrin-ABD for actin-

binding domain (Supporting Information Fig. S6A). As expected,

although ezrin-NBD was mostly detectable at the cortex of the

epithelial cell-line HEK, the ezrin-ABD fragment exhibited a more

diffused pattern inside the cytoplasm and partially co-localised

with the actin meshwork (F-actin) (Supporting Information Fig.

S6B). The over-expression of these domains competes with

endogenous ezrin for binding to CD95 and F-actin and thereby

prevents the connection of CD95 with the actin cytoskeleton [24].

Type II cells were transiently transfected with the dominant

negative mutants of ezrin and the sensitivity of the GFP-positive

cells to PI3K and Akt inhibition was assessed. Strikingly, while both

constructs efficiently hindered the actin-dependent apoptotic

signal triggered by the agonist anti-CD95 mAb APO1.3 in the type

I cell-line SKW6.4 (Supporting Information Fig. S6D) [26], they

failed to alter the apoptotic signal induced by PI3K or Akt

inhibition (Fig. 5B). In agreement with the latter observation,

transient expression of ezrin dominant negative mutants in DN-

Akt-expressing Jurkat cells did not affect CD95-mediated apoptosis

(Fig. 5C). Similarly, although non-cytotoxic concentrations of two

inhibitors of actin remodeling, cytochalasin D and latrunculin A,

prevented actin polymerisation (Supporting Information Fig. S6C

and [26]), they did not alter the apoptotic signal induced by PI3K

and Akt inhibitors in the type II cells CEM and Jurkat (Fig. 5D and

data not shown). Similarly, disruption of the actin network in DN-

Akt-expressing Jurkat cells did not affect the enhanced CD95-

mediated apoptotic signal (Fig. 5E). Altogether, these findings

established that, although the PI3K/Akt signalling pathway

contributed to ezrin phosphorylation, which unmasked the F-actin

and membrane-binding sites, this adaptor and the actin cytoske-

leton network did not orchestrate the compartmentalisation of



CD95 into lipid rafts and the induction of the downstream

signalling pathway upon inhibition of the PI3K/Akt axis.

Discussion

PI3K/Akt signalling plays a crucial role in cell survival, prolifera-

tion, migration and differentiation. This study demonstrates that

this oncogenic signal contributes to the tight control of CD95

plasma membrane distribution. Disruption of PI3K and Akt

activity leads to the aggregation of CD95 and its compartmenta-

lisation into lipid rafts, which in turn promotes DISC formation

and the initiation of apoptotic signalling independently of CD95L

de novo expression. Lipid rafts are enriched in certain lipids such

as sphingolipids and cholesterol, and the aggregation of these

lipids appears to be sites of protein oligomerisation for the

purpose of transmembrane signalling [27]. In this regard, the

increase in CD95 density within these small areas of the cell

membrane seems to be a prerequisite for signal transmission,

facilitating downstream recruitment of molecules that initiate the

apoptotic signal. However, the mechanism that mediates prefer-

ential partitioning or exclusion of proteins into the lipid raft

platform remains to be deciphered. It is worth noting that the

actin cytoskeleton is not instrumental in CD95 clustering (data

not shown) or in the apoptotic signal observed in type II leukemic

cells exposed to PI3K/Akt inhibitors. Confirming these observa-

tions, the adaptor protein ezrin, which links CD95 to the actin

meshwork [22], does not contribute to this apoptotic signal. In

addition, when CD95 is redistributed into lipid rafts, DN-

Akt-expressing type II T cells show that the disruption of the

actin network does not alter the enhanced CD95-mediated

signalling, indicating that both CD95 aggregation and the

subsequent transmission of the apoptotic signal occur indepen-

dently of actin re-organisation. Yet, the molecular process

responsible for the lateral motion of CD95 and the induction of

the apoptotic signal remain to be deciphered.

Strikingly, in type II cells, inhibition of PI3K/Akt or expression

of DN-Akt promotes transduction of a CD95-mediated apoptotic

signal that is independent of mitochondria. These findings high-

light that PI3K/Akt signalling maintains cells in a type II pheno-

type by preventing the localisation of CD95 into lipid rafts.

Overall, this study reveals that constitutive activation of the PI3K/

Akt cue, which is frequently observed in malignant cells, excludes

CD95 from lipid rafts and thereby abrogates the proximal step of

CD95 signalling and prevents CD95L-independent DISC forma-

tion. These findings raise the question of whether the so-called

‘PI3Kinh-DISC’ and the classical ‘CD95L-DISC’ encompass

the same elements or whether the ‘PI3Kinh-DISC’ consists of

Figure 4. PI3K and Akt inhibition elicits a mitochondrion-independent apoptotic signal. (A) Jurkat cells were transfected with GFP alone orGFP-Bcl2 and stable clones were isolated. Cells were lysed and the expression of the chimeric protein was assessed by immunoblot using anti-Bcl2or anti-GFP mAbs. White arrowheads indicate protein positions. The sensitivity of the cells to CD95L, staurosporine, wortmannin and LY294002was assessed using the MTT assay. (B) DN-Akt-expressing Jurkat cells and their parental counterparts were transfected with GFP alone or GFP-Bcl2.Viable cells were isolated 24 h after transfection and incubated for 20 h with Akt or PI3K inhibitors. Plasma membrane integrity was assessed usingthe non-cell permeant dye PI and the percentage of dead cells (PI-positive) among the GFP-positive cells was assessed by flow cytometry. The datarepresent mean and SD of three independent experiments.



additional molecules essential to bypass the presence of the

cognate ligand of CD95. A recent study revealed that an increase

in membrane fluidity promotes CD95 activation in the presence

of cisplatin [28]. This chemotherapeutic agent increases plasma

membrane fluidity through the activation of acid sphingomyeli-

nase and the subsequent production of ceramide, which in turn

favours the aggregation of lipid rafts [29]. Given the cross-talk

between PI3K/Akt signalling and ceramide metabolism [30], one

may argue that ceramide could be instrumental in the induction

of CD95-mediated apoptosis in leukemic type II cells exposed to

PI3K inhibitors.

Nonetheless, it is important to keep in mind that the anti-

apoptotic role of Akt is multifaceted. For instance, Akt abrogates

the function of the pro-apoptotic caspase-9, Bad and Forkhead

family of transcription factor-1 (FKHR1) via phosphorylation

[31–33]. In addition, by phosphorylating the anti-apoptotic

factor PED/PEA-15, Akt dramatically augments its half-life and

protects cells from TRAIL and CD95L-induced apoptosis [34, 35].

The PI3K/Akt signalling pathway also promotes the up-regulation

of anti-apoptotic genes such as c-FLIP, which alters DISC

formation and caspase-8 activation [36]. In summary, we have

established that PI3K/Akt signalling blocks CD95-mediated

apoptosis by acting upstream of DISC formation, and even

upstream of the CD95-CD95L interaction, through the exclusion

of CD95 from a favourable pro-apoptotic plasma membrane

environment.

Figure 5. PI3K and Akt inhibition elicits ezrin and actin-independent apoptotic signalling. (A) Jurkat cells were exposed to 50 mM LY294002 or 10 mMAkt inh-VIII and -X for 2 h. Cells were lysed, protein (100 mg) was resolved by SDS-PAGE and immunoblots were performed. (B) Jurkat and CEMT cells were transfected with GFP alone or the GFP-tagged constructs ezrin-ABD and ezrin-NBD. In total, 24 h after transfection, viable cells wereisolated and incubated for 20 h with 10mM wortmannin or 5 mM Akt Inh-VIII. The percentage of dead cells (PI-positive) among the GFP-positive cellswas assessed by flow cytometry. Data are representative of three independent experiments. (C) Indicated cells were transfected with GFP alone orthe GFP-tagged constructs ezrin-ABD and ezrin-NBD. Twenty-four hours after transfection, viable cells were isolated and incubated for 20 h with1 ng/mL CD95L. Cell death was assessed as described in (B). Data represent mean and SD of three independent experiments. (D) Jurkat and CEMcells were pre-incubated for 30 min with 5 mM cytochalasin D or DMSO (control) and then incubated for 20 h with wortmannin or Akt Inh-VIII. Celldeath was assessed using the MTT assay. Data represent mean and SD of three independent experiments. (E) DN-Akt-expressing Jurkat cells andtheir parental counterparts were pre-incubated for 30 min with 5mM cytochalasin D (CytD) or DMSO (control) and then incubated for 20 h withCD95L. Cell death was assessed using the MTT assay. Data represent mean and SD of three independent experiments.



Materials and methods

Cell lines

All cells were cultured in RPMI1640 supplemented with 8% heat-

inactivated FCS and 2 mM L-glutamine in a 5% CO2 incubator at

371C. The CEM-IRC (Ig-CD95L-Resistant Cell) cell line was

obtained as described previously [3].

DNA constructs and transfection

The pcDNA3.1-human HA-tagged Akt1 was kindly provided by

Dr B. Hemmings (Friedrich Miescher Institute, Basel, Switzerland).

We generated the DN-Akt (T308A, S473A) construct by site-

directed mutagenesis using Quickchange II XL Kit (Stratagene,

Massy, France) with the following primers 50gtgccaccatgaaggcctt-

ttgcggc30 (T308A) and 50ttcccccagttcgcctactcggccag30 (S473A).

The pEGFP-Bcl-2 plasmid was kindly provided by Dr R. Youle

(NIH, Bethesda, MD). The pEGFP-N1 and -C2 empty vectors were

purchased from Clontech (Mountain View, CA). Ezrin-NBD was

amplified by PCR from wild type Ezrin (kind gift from Dr M. Arpin,

Institut Curie, CNRS UMR144, Paris) using the following set of

primers (CGGAATTCATCCACAACGAGAACATG and CGGGATCC-

TCACAGGGCCTCGAACTCGTC). The amplicon was digested by

EcoRI/BamHI and inserted in the EcoRI/BamHI-digested pEGFP-

C2 vector. Ezrin-ABD was amplified by PCR from wild type Ezrin

using the following primer set (CCGCTCGAGATGCCGAAACCAA-

TCAAT and CGGAATTCGGGCCTGGGCCTTCAT). The amplicon

was digested by XhoI/EcoRI and inserted in the XhoI/EcoRI-

digested pEGFP-N1 vector (clontech, Mountain View, CA). The

leukemic T-cell line Jurkat (5� 106) was electroporated with 10 mg

of plasmid at 300V with one pulse of 10 msec using the BTM 830

electroporation generator (BTX Instrument Division, Holliston,

MA). Twenty-four hours later, 800 mg/ml of hygromycin (Clontech,

Saint-Germain-en-Laye, France) was added. GFP, GFP-Bcl-2 or

DN-Akt-expressing clones were isolated by limiting dilution.

Abs and reagents

Cytochalasin D, MbCD, DAPI, Alexa555-conjugated cholera toxin

subunit B (CTB) and the anti-b-Actin mAb were purchased from

Sigma-Aldrich (Lyon, France). Anti-human CD95 (DX2), anti-

FADD (clone1) and anti-p56Lck mAbs were purchased from BD

Biosciences (Le Pont de Claix, France). The homemade soluble

CD95L was generated by fusing the Ig-domain of the leukemia

inhibitory factor (LIF) receptor gp190 to the extracellular region

of CD95L (a.a. 105 to 281). The anti-CD95L mAb 14C2 and its

isotype-matched negative control mAb 1F10 (anti-LIF) were

generated in the laboratory. Anti-Caspase-8 (C15) and the

agonistic anti-CD95 mAb APO1-1 were purchased from Axxora

(Coger S.A., Paris, France). The anti-CD95 mAb (C-20) was from

Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-Akt and

anti-phospho-Akt antisera were from Cell Signaling Technology,

Inc (Boston, MA, USA). LY294002, Wortmannin, Akt inh-VIII and

Akt inh-X were purchased from Merck Biosciences (Nottingham,

UK).

Detergent lysis experiments and Western blot analysis

Cell lysis and Western blot analyses were performed exactly as

described previously [3].

Measurement of cell death

Cell death was assessed using the MTT viability assay or by

measuring the loss of mitochondrial potential (Dcm) as described

previously [26]. To quantify the impact of GFP-Bcl2 and

GFP-ezrin mutants on the apoptotic signal, cells were electro-

porated using the electro square porator ECM830 (BTX, San

Diego, CA). Viable cells were isolated using a Ficoll gradient 24 h

after transfection. Cells were then exposed to CD95L or Akt and

PI3K inhibitors for 20 h and then incubated for 60 min with

20 mg/mL of propidium iodide (PI). PI stains cells exhibiting loss

of plasma membrane integrity, a late event in apoptosis.

The percentage of dead cells (PI-positive cells) among the

GFP-positive and -negative cell populations was assessed by flow

cytometry as described previously [37]. The efficiency of

transfection varied between 30 and 50% of the T cells depending

on the vector.

Flow cytometry analysis

For Akt staining, cells were incubated for 10 min in PBS/1% BSA,

washed in PBS and fixed with PBS/2% PFA for 30 min at 41C.

Cells were permeabilised using methanol for 20 min at 41C. After

washing, Akt was quantified by incubating cells for 30 min with

anti-Akt mAb followed by Alexa488-conjugated goat anti-rabbit

Ab (Invitrogen, Cergy Pontoise, France). Stained cells were

analysed using a BD FACSCantoTM II cytometer.

Immunofluorescence staining

Cell staining was performed as described previously [26].

DISC analysis

Cells (5� 107 per condition) were treated with control medium

(DMSO) or 5 mM wortmannin for 4 h at 371C. Cells were then

immediately placed at 41C and incubated with 1mg/mL APO1-3

for 15 min at 41C. Cells were washed and lysed. CD95 was

immunoprecipitated using protein A-sepharose beads (Sigma) for

2 h at 41C. Beads were extensively washed in lysis buffer and the



CD95-associated immunocomplex was revealed by Western

blotting. In DN-Akt-expressing Jurkat, DISC analysis was carried

out as described previously [26].

Sucrose gradient fractionation

Cells (1� 108 per condition) were harvested, washed twice with

PBS and lysed. Lipid rafts were isolated from the rest of the

membranes as described previously [38].

Gel filtration

Cells (5�107 cells) were lysed with 200mL of lysis buffer. Lysate

was resolved using a wide range fractionation Superose 6 10/30

column (GE Healthcare) equilibrated with lysis buffer. Using an

AKTA purifier apparatus (GE Healthcare), proteins were eluted

with a flow rate of 0.2 mL/min. Fifty fractions were harvested and

pooled to obtain nine samples.

Acknowledgements: This work was supported by grants from

ANR (JC07_183182), INCa (projets libres recherche

biomedicale), Canceropole GO, Region Bretagne, Rennes

Metropole and Ligue Contre le Cancer (Comites d’Ille-

et-Vilaine/Morbihan/Cotes d’Armor/Maine et Loire). H. R. is

supported by the University of Rennes-1. S. T. is funded by La

Ligue Contre Le Cancer (postdoctoral fellowship).

Conflict of interest: The authors declare no financial or

commercial conflict of interest.

References

1 Berke, G., The CTL’s kiss of death. Cell 1995. 81: 9–12.

2 Kischkel, F. C., Hellbardt, S., Behrmann, I., Germer, M., Pawlita, M.,

Krammer, P. H. and Peter, M. E., Cytotoxicity-dependent APO-1 (Fas/

CD95)-associated proteins form a death-inducing signaling complex

(DISC) with the receptor. EMBO J. 1995. 14: 5579–5588.

3 Beneteau, M., Pizon, M., Chaigne-Delalande, B., Daburon, S., Moreau, P.,

De Giorgi, F., Ichas, F. et al., Localization of Fas/CD95 into the lipid rafts on

down-modulation of the phosphatidylinositol 3-kinase signaling path-

way. Mol. Cancer Res. 2008. 6: 604–613.

4 Hueber, A. O., Bernard, A. M., Herincs, Z., Couzinet, A. and He, H. T., An

essential role for membrane rafts in the initiation of Fas/CD95-triggered

cell death in mouse thymocytes. EMBO Rep. 2002. 3: 190–196.

5 Legembre, P., Daburon, S., Moreau, P., Ichas, F., de Giorgi, F., Moreau, J. F.

and Taupin, J. L., Amplification of Fas-mediated apoptosis in

type II cells via microdomain recruitment. Mol. Cell. Biol. 2005. 25:

6811–6820.

6 Legembre, P., Daburon, S., Moreau, P., Moreau, J. F. and Taupin, J. L.,

Cutting edge: modulation of fas-mediated apoptosis by lipid rafts in T

lymphocytes. J. Immunol. 2006. 176: 716–720.

7 Stel, A. J., Ten Cate, B., Jacobs, S., Kok, J. W., Spierings, D. C., Dondorff, M.,

Helfrich, W. et al., Fas receptor clustering and involvement of the death

receptor pathway in rituximab-mediated apoptosis with concomitant

sensitization of lymphoma B cells to fas-induced apoptosis. J. Immunol.

2007. 178: 2287–2295.

8 Delmas, D., Rebe, C., Lacour, S., Filomenko, R., Athias, A., Gambert, P.,

Cherkaoui-Malki, M. et al., Resveratrol-induced apoptosis is associated

with Fas redistribution in the rafts and the formation of a death-inducing

signaling complex in colon cancer cells. J. Biol. Chem. 2003. 278:

41482–41490.

9 Delmas, D., Rebe, C., Micheau, O., Athias, A., Gambert, P., Grazide, S.,

Laurent, G. et al., Redistribution of CD95, DR4 and DR5 in rafts accounts

for the synergistic toxicity of resveratrol and death receptor ligands in

colon carcinoma cells. Oncogene 2004. 23: 8979–8986.

10 Gajate, C. and Mollinedo, F., The antitumor ether lipid ET-18-OCH(3)

induces apoptosis through translocation and capping of Fas/CD95

into membrane rafts in human leukemic cells. Blood 2001. 98:

3860–3863.

11 Lacour, S., Hammann, A., Grazide, S., Lagadic-Gossmann, D., Athias, A.,

Sergent, O., Laurent, G. et al., Cisplatin-induced CD95 redistribution into

membrane lipid rafts of HT29 human colon cancer cells. Cancer Res. 2004.

64: 3593–3598.

12 Barnhart, B. C., Alappat, E. C. and Peter, M. E., The CD95 type I/type II

model. Semin. Immunol. 2003. 15: 185–193.

13 Scaffidi, C., Fulda, S., Srinivasan, A., Friesen, C., Li, F., Tomaselli, K. J.,

Debatin, K. M. et al., Two CD95 (APO-1/Fas) signaling pathways. EMBO

J. 1998. 17: 1675–1687.

14 Xavier, R., Brennan, T., Li, Q., McCormack, C. and Seed, B., Membrane

compartmentation is required for efficient T cell activation. Immunity

1998. 8: 723–732.

15 Calleja, V., Laguerre, M., Parker, P. J. and Larijani, B., Role of a novel

PH-kinase domain interface in PKB/Akt regulation: structural mechanism

for allosteric inhibition. PLoS Biol. 2009. 7: e17.

16 Thimmaiah, K. N., Easton, J. B., Germain, G. S., Morton, C. L., Kamath, S.,

Buolamwini, J. K. and Houghton, P. J., Identification of N10-substituted

phenoxazines as potent and specific inhibitors of Akt signaling. J. Biol.

Chem. 2005. 280: 31924–31935.

17 Siegel, R. M., Frederiksen, J. K., Zacharias, D. A., Chan, F. K., Johnson, M.,

Lynch, D., Tsien, R. Y. et al., Fas preassociation required for apoptosis

signaling and dominant inhibition by pathogenic mutations. Science 2000.

288: 2354–2357.

18 Weinstein, I. B., Cancer. Additiona to oncogenes – the Achilles heal of

cancer. Science 2002. 297: 63–64.

19 Gajate, C., Del Canto-Janez, E., Acuna, A. U., Amat-Guerri, F., Geijo, E.,

Santos-Beneit, A. M., Veldman, R. J. et al., Intracellular triggering

of Fas aggregation and recruitment of apoptotic molecules into Fas-

enriched rafts in selective tumor cell apoptosis. J. Exp. Med. 2004. 200:

353–365.

20 Muppidi, J. R. and Siegel, R. M., Ligand-independent redistribution of Fas

(CD95) into lipid rafts mediates clonotypic T cell death. Nat. Immunol.

2004. 5: 182–189.

21 Chaigne-Delalande, B., Moreau, J. F. and Legembre, P., Rewinding the

DISC. Arch. Immunol. Ther. Exp. (Warsz). 2008. 56: 9–14.

22 Parlato, S., Giammarioli, A. M., Logozzi, M., Lozupone, F., Matarrese, P.,

Luciani, F., Falchi, M. et al., CD95 (APO-1/Fas) linkage to the actin



cytoskeleton through ezrin in human T lymphocytes: a novel

regulatory mechanism of the CD95 apoptotic pathway. EMBO J. 2000. 19:

5123–5134.

23 Zhu, L., Zhou, R., Mettler, S., Wu, T., Abbas, A., Delaney, J. and Forte, J. G.,

High turnover of ezrin T567 phosphorylation: conformation, activity, and

cellular function. Am. J. Physiol. Cell. Physiol. 2007. 293: C874–C884.

24 Lozupone, F., Lugini, L., Matarrese, P., Luciani, F., Federici, C., Iessi, E.,

Margutti, P. et al., Identification and relevance of the CD95-binding

domain in the N-terminal region of ezrin. J. Biol. Chem. 2004. 279:

9199–9207.

25 Turunen, O., Wahlstrom, T. and Vaheri, A., Ezrin has a COOH-terminal

actin-binding site that is conserved in the ezrin protein family. J. Cell. Biol.

1994. 126: 1445–1453.

26 Chaigne-Delalande, B., Mahfouf, W., Daburon, S., Moreau, J. F. and

Legembre, P., CD95 engagement mediates actin-independent and -

dependent apoptotic signals. Cell Death Differ. 2009. 16: 1654–1664.

27 Stancevic, B. and Kolesnick, R., Ceramide-rich platforms in transmem-

brane signaling. FEBS Lett. 2010. 584: 1728–1740.

28 Rebillard, A., Tekpli, X., Meurette, O., Sergent, O., LeMoigne-Muller, G.,

Vernhet, L., Gorria, M. et al., Cisplatin-induced apoptosis involves

membrane fluidification via inhibition of NHE1 in human colon cancer

cells. Cancer Res. 2007. 67: 7865–7874.

29 Cremesti, A., Paris, F., Grassme, H., Holler, N., Tschopp, J., Fuks, Z.,

Gulbins, E. et al., Ceramide enables fas to cap and kill. J. Biol. Chem. 2001.

276: 23954–23961.

30 Burow, M. E., Weldon, C. B., Collins-Burow, B. M., Ramsey, N., McKee, A.,

Klippel, A., McLachlan, J. A. et al., Cross-talk between phosphatidylino-

sitol 3-kinase and sphingomyelinase pathways as a mechanism for cell

survival/death decisions. J. Biol. Chem. 2000. 275: 9628–9635.

31 Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S.,

Anderson, M. J. et al., Akt promotes cell survival by phosphorylating and

inhibiting a Forkhead transcription factor. Cell 1999. 96: 857–868.

32 Cardone, M. H., Roy, N., Stennicke, H. R., Salvesen, G. S., Franke, T. F.,

Stanbridge, E., Frisch, S. et al., Regulation of cell death protease caspase-9

by phosphorylation. Science 1998. 282: 1318–1321.

33 Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y. and

Greenberg, M. E., Akt phosphorylation of BAD couples survival signals to

the cell-intrinsic death machinery. Cell 1997. 91: 231–241.

34 Peacock, J. W., Palmer, J., Fink, D., Ip, S., Pietras, E. M., Mui, A. L., Chung,

S. W. et al., PTEN loss promotes mitochondrially dependent type II Fas-

induced apoptosis via PEA-15. Mol. Cell. Biol. 2009. 29: 1222–1234.

35 Trencia, A., Perfetti, A., Cassese, A., Vigliotta, G., Miele, C., Oriente, F.,

Santopietro, S. et al., Protein kinase B/Akt binds and phosphorylates PED/

PEA-15, stabilizing its antiapoptotic action. Mol. Cell. Biol. 2003. 23:

4511–4521.

36 Panka, D. J., Mano, T., Suhara, T., Walsh, K. and Mier, J. W.,

Phosphatidylinositol 3-kinase/Akt activity regulates c-FLIP expression in

tumor cells. J. Biol. Chem. 2001. 276: 6893–6896.

37 Guidicelli, G., Chaigne-Delalande, B., Dilhuydy, M. S., Pinson, B.,

Mahfouf, W., Pasquet, J. M., Mahon, F. X. et al., The necrotic signal

induced by mycophenolic acid overcomes apoptosis-resistance in tumor

cells. PLoS One 2009. 4: e5493.

38 Legembre, P., Moreau, P., Daburon, S., Moreau, J. F. and Taupin, J. L.,

Potentiation of Fas-mediated apoptosis by an engineered glycosylpho-

sphatidylinositol-linked Fas. Cell. Death Differ. 2002. 9: 329–339.

Abbreviations: Akt inh-VIII: Akt inhibitor VIII � DISC: death-inducing

signalling complex � DN-Akt: dominant negative mutant of Akt �ezrin-ABD: ezrin actin-binding domain � ezrin-NBD: ezrin N-terminal

binding domain � FADD: Fas-associated death domain protein � MbCD:

methyl-b-cyclodextrin � PI3Kinh-DISC: PI3K inhibition induced-DISC

Full correspondence: Dr. Patrick Legembre, Universite de Rennes-1,

IRSET / EA-4427 SERAIC, 2 av Prof Leon Bernard, 35043 Rennes cedex,

France

Fax: 33-2-2323-4794

e-mail: [email protected]

Received: 20/9/2010

Revised: 13/4/2011

Accepted: 3/5/2011

Accepted article online: 10/5/2011



actin-independent exclusion of cd95 by pi3k/akt signalling: implications for apoptosis

Documents