a regulatory subunit of the camp-dependent protein kinase down-regulated in aplysia sensory neurons...

Neuron, Vol. 8, 387-397, February, 1992, Copyright 0 1992 by Cell Press

A Regulatory Subunit of the CAMP-Dependent Protein Kinase Down-Regulated in Aplysia Sensory Neurons during Long-Term Sensitization Peter J. Bergold,*+ Sven A. Beushausen,**§ Todd C. Sacktor,*+ Stephen Cheley,* Hagan Bayley,** and James H. Schwartz* *Howard Hughes Medical Institute Center for Neurobiology and Behavior Columbia University New York, New York 10032 *Worcester Foundation for Experimental Biology Shrewsbury, Massachusetts 01545

Summary

Binding of CAMP by the five neuronal isoforms (Nl-5) of the regulatory (R) subunit of the Aplysia CAMP- dependent protein kinase is diminished in sensory neurons stimulated to produce long-term presynaptic facilitation. To determine how the CAMP-binding activity of the R subunits is lost, we isolated cDNAs encoding N4, which is a homolog of mammalian RI. lmmunoblots with antisera raised against the R protein overexpressed in E. coli show that the diminished binding activity, which occurs in long-term facilitation, results from coordinate loss of R protein isoforms. No change was detected in the amount of transcripts for R subunits, suggesting that the down-regulation results from enhanced proteolytic turnover.

Introduction

In Aplysia, presynaptic facilitation of sensory-to-mo- tor synapses is thought to underlie behavioral sensitization, a modification of defensive reflexes that is con- sidered a simple form of memory (for review, see Byrne, 1987; Dudai, 1989). Activation of CAMP-dependent protein kinase (PKA) plays an important role in producing facilitation in the sensory neurons that me- diate these reflexes (Kandel and Schwartz, 1982). The PKA holoenzyme (R&) is activated when CAMP binds to the inhibitory regulatory(R) subunits, which disso- ciate as a dimer to release active, monomeric catalytic (C) subunits. After brief sensitizing stimuli, the kinase in sensory neurons remains active as long as CAMP is elevated (Bernier et al., 1982). Persistent activation of PKA is seen 24 hr after administering prolonged sensitizing stimuli, even though CAMP returns to basal concentrations rapidly (Bernier et al., 1982; Sweatt and Kandel, 1989). In long-term facilitated sensory cells, binding of CAMP diminishes with no change in the amounts of the C subunits, suggesting that the ratio of the two kinase subunits is altered (Greenberg et al.,

*Present address: Department of Pharmacology, SUNY Health Sciences Center, Brooklyn, New York 11203.

SPresent address: NINDS, Laboratory of Neurobiology, Bethesda, Maryland 20892.

1987; Bergold et al., 1990). A stable change in this ratio could account for the persistent activation of the en- zyme seen in long-term facilitated neurons (Green- berg et al., 1987), implying the existence of an important mechanism for regulating the ratio of PKA subunits that is not yet explained (Schwartz and Greenberg, 1987, 1989).

Aplysia neurons contain four isoforms of the C subunit and five isoforms of the R subunit. The multiple C subunits are produced by alternative RNA splicing (Beushausen et al., 1988; S. A. Beushausen and H. Bayley, submitted). Five distinct isoforms of the neuronal R subunit (Nl-5) can be detected in extracts of ganglia by photoaffinity labeling with the CAMP analog [32P]8-azido-cAMP (Eppler et al., 1982; Palazzolo et al., 1990). These five were tentatively grouped into two families on the basis of the peptides produced by limit cleavage with trypsin and cyanogen bromide (Eppler et al., 1986).

We report here the cDNA cloning of the N4 isoform of the Aplysia R subunit and show that it is expressed in sensory cells. Antisera raised against recombinant N4 protein, obtained byoverexpression in Escherichia coli, recognize several R subunits in Aplysia neurons. These antisera were used to assay R subunit protein in long-term facilitated sensory cell clusters. In parallel experiments, we also assayed R and C subunit transcripts.

Results

Isolation of cDNA Clones Encoding an Aplysia R Subunit of PKA A genomic R subunit clone was obtained from an Aplysia library by screening at low stringency with a cDNA probe encoding the bovine R subunit Rla. An oligonucleotide corresponding to a sequence in an Aplysia exon homologous to the bovine probe was then synthesized. We used this oligonucleotide to screen Aplysia neuronal cDNA libraries. From these screenings and by polymerase chain reaction (PCR) amplification of Aplysia neuronal cDNA, we isolated three cDNAs containing 4.2 kb of overlapping sequence (Figure IA). Of the 4.2 kb isolated, we sequenced 1217 bp. The sequence contained an open reading frame of 1134 bp, which included the sequence similar to bovine Rla. The predicted amino acid sequence of the open reading frame (Figure IB) can be readily aligned with RI isoforms of other animals (Figure 2; Clegg and McKnight, 1987; Kalderon and Rubin, 1988). The methionine codon for the proposed initiator is within a sequence that matches the consensus proposed by Kozak (1987).

R subunits can be divided into distinct domains: the extreme amino terminus is required for dimerization; adjacent is the pseudo-substrate sequence, a region that inhibits the C subunit; the remaining two-thirds

Neuron 388

Proteins with PEST domains turn over rapidly (Rogers et al., 1986; Rechsteiner, 1987,199l). This suggests that the amino acid composition of the PEST region might regulate proteolytic turnover of R subunits through- out phylogeny.

Figure 1. Sequence Analysis of Aplysia R Subunit cDNAs

(A)ThreecDNAclonesdefining4.2kbofcDNAarealignedabove a diagram of the N4 message. The coding region is indicated by a solid box. The heavy bar below the N4 message shows the extent of sequence analyzed on both strands. (B) The sequence of the sense strand of the cDNAs and the predicted amino acid sequence of its open reading frame. The first nucleotide of the predicted initiator methionine codon is designated nucleotide 1.

of the molecule consists of two homologous CAMP- binding domains (Takio et al., 1984;Taylor et al., 1990). The primary structures of these domains are conserved in the cloned Aplysia R subunit (Figure 2). The CAMP-binding domains of the Aplysia subunit have 79% amino acid identity with murine Rla, 76% with RIB, and 75% with the Drosophila R subunit.

The aligned R proteins are dissimilar in the region of amino acid residues 57-86, with only 16% identity OftheAplysiaRsubunitwith murineRlaandl3%with the Drosophila R subunit (Figure 2). This region in Aplysia isgreatlyenriched (50%) in proline, glutamate, serine, and threonine (PEST) residues. Other RI subunits have a corresponding domain close to their amino termini: for example, murine Rla, with 39% PEST residues, and Drosophila, with 37% (Figure 2).

The cDNA Clones Encode R Subunit N4 Five R subunit isoforms were previously identified in two-dimensional gels of Aplysia neurons labeled with [32P]8-azido-cAMP: values for the relative molecular weight (M,) and isoelectirc point (pl) for these isoforms are as follows: Nl, 105,000/5.0; N2, 47,000/5.1; N3,52,000/5.3; N4,52,000/5.6; N5,47,000/5.7(Palazzolo et al., 1990). These polypeptides were characterized by photoaffinity labeling and peptide mapping(Eppler et al., 1986), which indicated that four of the five polypeptides (Nl, N3, N4, and N5 [the N4 family]) have closely related binding sites for CAMP. The other polypeptide, N2, gave divergent peptide maps and must therefore differ in amino acid sequence in the vicinity of the carboxy-terminal domain that binds 8-azido- CAMP.

In the present work, protein chemistry was again used to determine which, if any, of the previously identified neuronal isoforms we had cloned. The cloned Aplysia R subunit was expressed in E. coli from a cDNA encoding the complete polypeptide that was generated by PCR amplification. In SDS-polyacrylamide gels, the recombinant polypeptide (RAPL) migrates with an M, of 52,000, as seen by staining with Coomassie blue (data not shown) or by labeling with [32P]8-azido-cAMP. The in vitro translation product of an RNA transcript encompassing the entire coding region has the same M, (Figu re 3). The mass calculated from theopen reading frame (Figure IB) is only42,675 daltons, but anomalous electrophoretic mobility is a characteristic of R subunits in other animals (Titani et al., 1984; Takio et al., 1984; Clegg and McKnight, 1988). Given these results, it can be inferred that the cDNAs described here encode one of the two previously characterized M, 52,000 polypeptides (N3 or N4) or an unrelated polypeptide of similar electrophoretic mobility. To distinguish between these possibilities, the [32P]8-azido-cAMP-labeled, recombinant polypeptide was extracted from an SDS-polyacrylamide gel and cleaved with cyanogen bromide. This produced the major M, 18,000 fragment, derived from both N3 and N4, but not the M, 12,000 and 9,500 fragments characteristic of N2 (Figure 4; Eppler et al., 1986). These results indicate that the cDNA that we isolated en- codes either N3 or N4, but not an unrelated species.

N4 can be distinguished from N3 by two-dimensional electrophoresis (Eppler et al., 1982,1986; Palaz- zolo et al., 1990). To determine which of these two subunits was cloned, we subjected a sample of [32P]8- azido-CAMP-labeled proteins from a homogenate of Aplysia neural tissue to electrophoresis in parallel with a sample containing an equal number of counts of labeled neural tissue and of the labeled recombinant R subunit (Figure 5). In the two-dimensional

Down-Regulation of R Subunits in Aplysia Neurons 389

gel of the mixture (Figure 5, left panel), the closely spaced series of spots migrating with N4 is greatly augmented compared with the spots in this region of the gel with the sample containing neural proteins alone (Figure 5, right panel). This indicates that N4 has been cloned. The observed isoelectric variants of N4 most likely arise by posttranslational modifications in both Aplysia (Eppler et al., 1982, 1986) and E. coli (Johnson et al., 1987; Hire1 et al., 1989).

Other experiments strengthen the conclusion that

A B Mr + -

93K-

69 -

30 -

Figure 2. Comparison of the Amino Acid Sequences of the Aplysia R Subunits with Rla and the Drosophila R Subunit

The predicted amino acid sequences of Aplysia N4(Apl), mouse Rla (Mur),and Dro- sophila R (Dro) are aligned. Only the amino acid residues that differ from the Aplysia sequence are shown. The PEST region (amino acids 56-89) is bracketed. Tyr-370 and Trp-259, which bind [SZP]&azido-cAMP (Taylor et al., 1990), are circled.

A R APL NS

Mr

29.8K-

22.2 - 18.1 -

11.7 - N2

9.6 -

B IIII I I 1.:. ”

. N4

I *I*

I4 -

Figure 3. The Recombinant R Subunit Protein Is Labeled by [“P]&Azido-CAMP

(A) An RNA transcribed from linearized pN4 (+, left lane) or no RNA (-, right lane) was translated in vitro in the presence of [3rS]methionine. (B) RAPL in a crude E. coli protein extract labeled with [JLP]8-azido- CAMP. The products were separated by SDS-PAGE and autoradiographed. The resulting M, 52,000 product is indicated by an arrowhead. Molecular weights of standard proteins are shown on the left.

. . N2

Figure 4. Cyanogen Bromide Peptide Maps of RApI

(A) The recombinant protein (RAPL) and total Aplysia nervous system protein (NS) were labeled with [32P]8-azido-cAMP and reacted with cyanogen bromide. Fragments were separated by SDS-PAGE. The peptides generated from the R subunit, N2, are indicated. In Eppler et al. (1986), all three fragments were obtained from the N2 polypeptide isolated from central ganglia, the M, 12,000 and 9,500 peptides predominating. We have since shown that an N2-like polypeptide from the Aplysia eye contains only the M, 12,000 and 9,500 fragments, suggesting that the N2 polypeptide analyzed previously was contaminated with N3 or an unidentified polypeptide (H. Bayley, unpublished data). Mo- lecular weight markers are shown on the left. (B) Maps of N4 and N2 showing the positions of methionine residues inferred from the cyanogen bromide cleavages. The asterisks indicate the positions of the vertebrate amino acid residues that bind [3ZP]8-azido-cAMP (Taylor et al., 1990).

NCXIVJ” 390

NS + RAPL

Mr 66K-

N4+b,

i 43 -

NS

N4 N3 --

+PH

Figure 5. Rnvi Recombinant Protein Migrates with N4 on Two- Dimensional Gel Electrophoresis

[“PI8-azido-CAMP-labeled Aplysia nervous tissue protein was electrophoresed with (NS + RAPL) or without (NS) an equal number of counts of [‘*PI&azido-CAMP-labeled RAPL on two-dimensional SDS-PAGE. The positions of N2, N3, N4, and RkPL are indicated. At this exposure, Nl and N5, which are minor neuronal R subunits, are not seen (Eppler et al., 1986; Palazzolo et al., 1990). Molecular weight markers are shown on the left, and the direction of the pH gradient is indicated by the arrow below.

N4 was cloned. Cyanogen bromide maps were made from labeled neuronal R subunits electrophoresed in the same SDS one-dimensional polyacrylamide gel as R*PL. The polypeptides in the M, 52,000 region of the gel (N3 and N4), which migrate with the recombinant

polypeptide, RAPL, do not produce the peptides characteristic of N2, while the polypeptides from the M, 47,000 region do yield them. Furthermore, N4 migrates slightly more slowly than N3 (M, difference of 500) in SDS gels containing low concentrations of polyacrylamide (data not shown). In these gels, both the photoaffinity-labeled RApL and the in vitro translation product labeled with [35S]methionine migrate with the upper band (N4) of the N3lN4 doublet (data not shown). Thus we find that Rapt has the distinctive characteristics of N4: it is a CAMP-binding protein with an M, of 52,000 and a pl of 5.6. Moreover, cleavage with cyanogen bromide yields peptides characteristic of the N4 family that distinguish it from N2.

The Distribution of N4 Transcripts in Sensory Neurons As seen in Figure 6, which shows Northern blots of poly(A)’ RNA from various tissues, a single size class of RNA hybridizes with an oligonucleotide probe corresponding to nucleotides 493-545 of N4 (Figure IB). Hybridization is prominent in both muscle and nervous tissue and is absent in the ovotestis.

In situ hybridization provides evidence that at least one member of the N4 family is transcribed in cell bodies of all neurons in the pleural ganglion, including cells in the sensory cluster (Figure 7). No specific hybridization is seen in dendrites, axons, or connec-

A+

MO N

Kb

2,4-

1.4-

Figure 6. Blot Analysis of N4 Transcripts

A-

N

Poly(A)+ RNA (IO pg) (A+) from buccal muscle (MI, ovotestis 0, or nervous tissue (NJ, or poly(A)- RNA (IO ug) (A-) from nervous tissue (N) was electrophoresed, blotted, and hybridized with a ‘Wabeled oligonucleotide fnucleotides 493-545 of the N4 cDNA; see Figure IB). The migration of RNA size markers (GIBCO BRL) is shown on the left.

tive tissue sheath. We saw a similar pattern of hybridization in each of the other central ganglia (data not shown). On the whole, expression of the N4 family matches that of the C subunit; an unexplained difference is that C subunit transcripts are present in axonal processes of bag cell neurons (Beushausen et al., 1988).

PKA Messages Do Not Change in Long-Term Facilitated Sensory Cells Since steady-state amounts of message for both PKA subunits, R and C, are quite low, we needed pairs of sensory cell clusters dissected from 50 animals to compare the amounts of the transcripts reliably. To avoid any differences that might be due to laterality, we dissected the right and then the left pleural-pedal ganglion from each animal, alternately placing first one and then the next into experimental and control groups. The experimental ganglia were exposed to 50 PM serotonin for 2 hr, a protocol that produces long-term facilitation of sensory neurons (Sweatt and Kandel, 1989). We then maintained the ganglia in culture for 24 hr, removed the sensory cell clusters, and extracted total RNA. Amounts of RNA were standard- ized by dotting one-sixth of the samples onto nitrocellulose paper and hybridizing with a j2P-labeled oligonucleotide specific for Aplysia calmodulin (Swanson et al., 1991). The amount of hybridization was then compared with a standard curve determined with total RNA extracted from Aplysia ganglia (Figure 8A). In five independent experiments, we obtained 4.6 + 0.6 pg of RNA from each group of clusters. Treatment with serotonin did not change the amount of RNA

Figure 7. In Situ Hybridization of R Subunit Transcripts in Pleural-Pedal Ganglia

Bright-field (A) and dark-field (B) micrographs of a section of the pleural and pedal (P) ganglia treated with a iiS-labeled N4 antisc in vitro transcript. Silver grains are present over the cytoplasm of all cell bodies, including pleural sensory neurons whose posi IS indicated by the arrow. Little or no label appears over the nuclei, neuropil, pleural-pedal connective, and connective tissue she The location of the sensory cell cluster was determined by reconstructing the ganglion from serial sections. No label is seen in dark-field micrograph of an adjacent section (C) treated with ‘Wabeled N4 sense RNA. Bar, 100 em.

tion ath.

the

NeUrOll 392

A Calmodulin Slot Blot Total Sensory

NS RNA Cluster RNA

lYsJ-.

0.5 -

0.2 -1

B R and C Nuclease Protection

Probe R C R C R C RC RC NS$N$- - - - + + + + -------w-+

Nuclease - - + + + + + + 12345676

bp

716- 666 653=

366-

recovered (no treatment, 4.5 + 0.4 vg; serotonin treatment, 5.0 + 0.6 pg). The amounts of R and C subunit transcripts in each RNA sample were then assayed for their ability to protect R and C subunit antisense cRNA probes from digestion by Sl nuclease. In each experiment, equal amounts of RNA from control or serotonin-treated sensory cells were individually hybridized to a mixture of R and C subunit probes, which were both present in excess in the solution. We assayed the hybridization to each probe by measuring the radioactivity in the protected fragments. The ra- tios of the amounts of protected Rand C subunit transcripts were not altered by the treatment with serotonin (Table 1) and are independent of the amounts of RNAanalyzed. Furthermore, sincetheamount of RNA in the samples was normalized by calmodulin hybridization prior to the Sl digestion in each experiment, these data also suggest that the absolute amounts of RandCsubunittranscriptsareunaffected bythetreat- ment (Table 1).

Anti-N4 Antiserum Recognizes Other Members of the N4 Family Threeanti-N\lrlantisera(Rapl I-3)were raised in rabbits

Figure 8. Nuclease Protection Analysis of Nervous Tissue RNA Hybridized with R or C Subunit Probes

(A) Quantitation of RNA from Aplysia pleural sensory clusters. Total NS RNA: 0.2,0.5, or 1.0 pg of total nervous tissue RNA was spotted onto nitrocellulosefilters and hybridized with a L’P-labeled oligonucleotide probe specific for Aplysia calmodulin (Swanson et al., 1990). Sensory cell cluster RNA: one-sixth of the RNA prepared from a control sensory cell cluster group or from a group treated with 50 FM serotonin for 2 hr and maintained in culture for an additional 24 hr (S-HT) was hybridized with the “P-labeled oligonucleotide probe specific for calmodulin. (B) Measurement of N4 or C subunit transcripts in pleural sensory cell clusters. A l”P-labeled antisense RNA probe specific for N4 was made by in vitro transcription (lane 1) and hybridized with yeast tRNA (lanes 3) or Aplysia total nervous tissue RNA (lane 5). A “P-labeled antisense RNA probe specific for the C isoform CAri Al (Beus- hausen et al., 1988) was transcribed in vitro (lane 2) and hybridized with yeast tRNA (lane 4), or Aplysia total nervous tissue RNA (lanes 6). Both N4 and CW.~~ probes were hybridized to RNA from pleural sensory cell clusters (lane 7), or pleural sensory cell clusters treated with serotonin (lane 8). The hybridization reaction mixtures were treated with nuclease Sl and electrophoresed on a 4% acrylamide gel. The gel was dried and autoradiographed. Fragment size was determined by reference to a sequence ladder of Ml3 bacteriophage DNA. The amounts of radioactivity in the bands specific for N4 (590 nucleotides) and CArl A, (366 nucleotides) were measured.

immunized with the recombinant N4 protein purified by SDS-polyacrylamide gel electrophoresis (SDS- PAGE). Protein extracts from Aplysiaganglia or buccal muscle, which had been photolabeled with [32P]8- azido-CAMP, were separated by SDS-PAGE and transferred to nitrocellulose (Figure 9A). The filters were autoradiographed (Figure 9A, lanes 1) and then reacted with Rapl 2. The proteins that reacted with the anti-N4 antiserum were visualized using alkaline phosphatase complexed to anti-rabbit IgG (Figure 9A, lanes 2). Both the antisera and the labeled photoaffinity reagent react with neuronal proteins of M, 105,000, 52,000, and 47,000 and muscle proteins of M, 55,000 and 52,000, as well as with two proteolytic fragments present in the extracts in small amounts (Eppler et al., 1982). Similar resultswereobtained with theother two anti-N4 antisera (Rap1 1 and 3).

R Subunit Protein Is Diminished in Long-Term Facilitated Sensory Neurons In earlierexperiments, lossof CAMP binding had been assayed by photoaffinity labeling with [32P]8-azido- CAMP (Greenberg et al., 1987; Bergold et al., 1990). Although we concluded that R subunit protein is

Down-Regulation of R Subunits in Aplysia Neurons 393

Table 1. Quantitation of PKA Transcripts and R Subunit Protein in Pleural Sensory Cell Clusters

Treatment Change

Control 5-HT (% of Control)

Transcripts R 2404~489 2157 f 254 93.0 f 7.1 C 5749 + 734 5524 +_ 904 93.4 +_ 8.5

Calmodulin 3154 f 619 3160 f 627 100 (set) R/C transcript ratio 0.42 f 0.07 0.39 f 0.08 92.9

R Subunit Proteins M, 52,000 1470 f 111 1118 + 136 76.8 + 8.8a M, 47,000 367 f 64 230 f 52 67.7 f 8.5”

Sensory cell clusters were grouped and either mock-treated (Control) or treated with 50 uM serotonin for 2 hr, washed, and maintained in culture for an additional 24 hr (5-HD. RNA or protein was extracted and analyzed as described in Experimental Procedures. Values are presented as the average number of total counts rt SEM. PKA Subunit Transcripts: Slot blots containing sensory cell cluster RNA were hybridized to a S*P-labeled probe for calmodulin. The amount of calmodulin hybridization was assayed by scanning the radioactivity of the dried filters for 6 hr. RNA from both the control and the serotonin-treated group was normalized to the number of counts obtained with the calmodulin transcript and assayed by Sl nuclease protection analysis using probes for both R and C subunits. The amounts of radioactivity in the 590 nucleotide (R subunit, N4) and 366 nucleotide (C subunit, CAnA,) fragments that had been protected in solution were directly assayed by scanning the dried gels for 4.8 hr (n = 5). R Subunit Proteins: R proteins were measured by immunoblot assay using ‘Wabeled protein A. lmmunoblots containing protein extracts from sensory cell clusters were reacted with anti-N4 antiserum (Rap1 2). The amount of antibody binding to the M, 52,000 and the M, 47,000 regions of the filter was determined by scanning the immunoblot for 18 hr (n = 7). The percent loss of R protein found with the immunoblot assay is similar to values obtained using [3ZP]8-azido-cAMP binding (Bergold et al., 1990). d Values significantly different from control (p > 0.05, Student’s t test).

A N

1 2

lOOK- 92.5 -

xr

69 -

B N

C 5-HT

4

4

30-

Figure 9. Characterization of Anti-N4 Antisera and Measure- ment of R Subunits in Long-Term Facilitated Sensory Cells

(A) Comparison of anti-N4-reactive proteins and CAMP-binding proteins in Aplysia. Protein extracts from Aplysia nervous system (N) or buccal muscle (M) were labeled with [32P]8-azido-cAMP, separated by SDS-PAGE, and transferred to nitrocellulosefilters. The filters were autoradiographed (lanes 1) and then reacted with anti-N4antiserum Rap12 followed by alkaline phosphatase- conjugated anti-rabbit IgG (lanes 2). Arrowheads point to compo- nents identified as proteolytic breakdown productsof Rsubunits (Palazzolo et al., 1990). (B) Quantitative immunoblot. Equal amounts of protein extracted from control (C) or serotonin-treated (5-HT) pleural sensory cell clusters were electrophoresed and transferred to nitrocellulose. The filters were treated with Rap12 antiserum followed by ‘Wlabeled protein A, dried, and autoradiographed. The migration of protein standards is shown at the left.

down-regulated, these experiments did not distinguish definitively between the loss of R subunit protein and a change in affinity for CAMP, for example, by a posttranslational modification. We therefore used

anti-N4 antisera to measure R subunit protein in pleural sensory cell clusters that had been treated under conditions producing long-term facilitation. In each experiment, paired pleural-pedal ganglia from 10 animals were isolated; one ganglion from each pair was placed in the control group and the other in the experimental group. Experimental ganglia were exposed to 50 PM serotonin for 2 hr, washed, and then maintained in culture for 24 hr, which produces loss of CAMP binding and persistent activation of PKA in sensory neurons (Sweatt and Kandel, 1989; Bergold et al., 1990). Proteins extracted from these clusters were immunoblotted using the anti-N4 antiserum, Rapl 2. We found that less R subunit protein was present in the treated ganglia than in the paired controls (Figure 9B; Table 1). This decrease in R subunits is similar to that seen in the earlier experiments in which the subunits were assayed with [32P]8-azido-CAMP (Ber- gold et al., 1990). We conclude that the diminished binding of CAMP, previously detected by affinity labeling, results from loss of R subunit protein.

Discussion

Two Families of R Subunit in Aplysia Neurons Two R subunit families, RI and RII, that differ in amino acid sequence and in the number of sites binding 8-azido-CAMP covalently have been identified in ver- tebrates (Taylor et al., 1990). Sequence analysis of the N4 transcript and peptide mapping of R subunits labeled with [32P]8-azido-cAMP suggest that all mem-

Neuron 394

bers of the N4 family (Nl, N3, N4, and N5) are Aplysia homologs of vertebrate RI isoforms (Figure 2). Defini- tive evidence for this idea awaits sequencing of the other R subunits. Cleavage of N2 photolabeled with [32P]8-azido-cAMP with cyanogen bromide suggests that the N2 isoform has a different primary amino acid sequence from that of the N4 family (Figure 4B; Eppler et al., 1986). N2 may be the Aplysia homolog of RII. It is curious that to date no PKA R subunit similar to vertebrate RII has been cloned from an invertebrate.

Down-Regulation of R Subunits in Long-Term Facilitated Sensory Neurons We previously obtained evidence for diminished CAMP binding activity in long-term facilitated sensory neurons (Greenberg et al., 1987; Schwartz and Green- berg, 1987). By using the anti-R antisera, we show here that this change results from loss of R subunit protein. Although thechange is modest, it is likely to be signifi- cant physiologically, resulting in the increased protein phosphorylation responsible for many of the changes in membraneconductance(Daleand Kandel, 1990; Sweatt and Kandel, 1989), gene expression (Dash et al., 1990), and synaptic growth (Glanzman et al., 1990; Buonomano and Byrne, 1990) seen in long-term facilitated sensory cells. Changes in Rsubunitsof PKA also affect learning in Drosophila (Muller and Spatz, 1989;Dudai,1989;Aszodietal.,1991;Drainetal.,1991).

Barzilai et al. (1989) reported rapid changes in the synthesis of several proteins in long-term facilitated sensory neurons. A day after the training, when R subunit protein is lowered, we could detect no change in the amounts of transcripts for either R or C subunits, consistent with the idea that the mechanism by which R subunits are diminished is posttranscriptional. But the observed decrease in the amount of R subunit protein is never more than 40%. To rule out a corresponding change in mRNA levels or RNA processing definitively, we would need to make measurements at several time intervals between application of sensitizing stimuli and a day later, when the presynaptic facilitation has become stabilized.

Selective proteolysis is a plausible mechanism for the loss of R subunits during long-term facilitation (Schwartz and Greenberg, 1987; Bergold et al., 1990). We can now measure protein turnover directly using anti-N4 antisera. There are several proteolytic mechanisms that could result in turnover of the regulatory subunits (Rechsteiner, 1987, 1991; Finley and Chau, 1991). The evolutionary conservation of PEST amino acid residues in the amino terminus of N4 suggests that this region participates in its altered stability. Preliminary experiments indicate that ubiquitin- mediated proteolysis degrades R subunits in Aplysia neurons (Hegde and Schwartz, 1991, Sot. Neurosci., abstract).

In contrast to the N4 R subunit isoforms, muscle R subunits are unaltered bytreatments that cause much larger increases in intracellular CAMP than those seen in sensory neurons (Bergold et al., 1990). Ml, the major

muscle R subunit, belongs to the N4 family, as evi- denced by the following: peptide maps of the CAMP- binding regions in Ml are identical to those of Nl, N3, N4, and N5 (Eppler et al., 1986); a muscle transcript is recognized by the N4 cDNA (Figure 6); and two extensive amino acid sequences from the affinity- purified muscle R subunit are identical to N4 (F. Croom, W. S. Sossin, P. J. Bergold, and J. H. Schwartz, unpublished data). We are presently cloning the Ml subunit in order to compare it with the neuronal forms. In particular, we wish to determine whether the muscle R subunits contain a divergent PEST region. The stability of muscle R subunits might also be compared with recombinant N4 in extracts from naive and long-term facilitated sensory neurons.

Posttranscriptional regulation of other multifunc- tional protein kinases includes phosphorylation, trans- location between subcellular compartments, and li- gand activation. PKA is unusual because it is regulated physiologically by association and dissociation of a multi-subunit holoenzymewith subsequent proteolysis. Therefore, regulated proteolysis of R subunits can lead to persistent activation of PKA. Neurophysiologi- cal and biochemical studies indicate that this small change in kinase activity produces the enduring presynaptic facilitation underlying long-term behavioral sensitization in Aplysia (Greenberg et al., 1987; Sweatt and Kandel, 1989; Bergold et al., 1990). Specific proteolysis may be a general mechanism for generating persistent protein phosphorylation common to other forms of long-term synaptic plasticity. Selective prote-

olysis is also responsible for the rapid degradation of an isoform of cyclin (Glotzer et al., 1991) and of several regulatory transcription factors (nuclear oncogenes [Scheffner et al., 1990; Ciechanover et al., 19911 and homeotic proteins in Drosophila [Rechsteiner, 1987]), strengthening the prevalent notion that long-term memory and development share common molecular mechanisms.

Experimental Procedures

Purification of DNA and RNA Aplysiatissues were isolated as described by Schwartz and Swan- son (1987). Genomic DNA was prepared by adding an equal vol- ume of 20 mM Tris-HCI (pH 8.0,) 200 mM NaCI, 20 mM EDTA, 1% SDS, 400 @ml proteinase K (GIBCO BRL, Gaithersberg, MD) to Aplysia sperm. The sperm were incubated at 37OC for 16 hr and extracted twice with phenol and twice with chloroform:isoamyl alcohol at 241. DNAwas precipitated by adding 2 vol of isopropa- nol, collected on a glass rod, and resuspended in 10 mM Tris- HCI (pH 8.0), 1 mM EDTA. RNA was isolated as described by Beushausen et al. (1988). Oligonucleotides were synthesized on an Applied Biosystems Model 380 DNA synthesizer at the Howard Hughes Protein Chemistry Core Facility, Columbia University, or at the Worcester Foundation for Experimental Biology Cancer Center and purified on OPC columns (Applied Biosystems) according to the manufacturer’s instructions.

Analysis of RNA and DNA Northern blots, in situ hybridizations, slot blot hybridizations, and 12P labeling of probes were done as described by Beus- hausen et al. (1988). A ‘*P-labeled probe (HB8), corresponding to nucleotides 493-545 (Figure IB), was synthesized from two

Down-Kegulation of R Subunits in Aplysta Neurons 39s

overlapping sense (CGTCATGAGCGTCACAACTTCTACGTC) and antisense (TACACGTCCACllCCCClTGATCGATGACGTAG) oligonucleotides by the method of Lauffer et al. (1985) and hybridized to Northern blots as described in Beushausen et al. (1988). Slot blot filterswere prepared (Sambrook et al., 1989) and hybridized with ‘ZP-labeled oligonucleotide probes synthesized from nucleotides 298-352 of the Aplysia calmodulin sequence (Swan- son et al., 1991) as described by Beushausen et al. (1988). Nuclease protection experiments were performed as described in Beushausen et al. (1988), but with 1200 U of nuclease Sl (Boehringer Mannheim). The amounts of radioactivity in the protected fragments were determined by scanning the dried gels for 24 hr with a model II radioisotope scanning system (Ambis, San Diego, CA).

Isolation and Sequence Analysis of Cenomic and cDNA Clones A genomic library (provided by Richard Scheller, Stanford Uni- versity, and made by ligating Aplysia DNA partially digested with Mbol into the vector XII) was screened with a JLP-labeled bovine Rla probe (762 bp Pstl fragmentof pBR322-62C12 from C. Stanley McKnight, University of Washington, Seattle). The hybridization was done at 42OC overnight at reduced stringency: 5x SSC, 25% formamide, 1 x Denhardt’s solution (100 vg/ml carrier salmon sperm DNA [Sigma Chemical Co., St. Louis, MO], 10% dextran sulfate [Pharmacia, Piscataway, NJ], 1.8 mgiml bovine serum albumin, 5 mM EDTA, 50 mM sodium phosphate [pH 6.81). A final wash was done at 55°C with 2x SSC. One clone, XIII, was Isolated and sequenced as described in Beushausen et al. (1988). All sequencing was done on both strands.

The sequence of an Aplysia exon homologous to vertebrate RI was used to synthesize the HB8 oligonucleotide (see above), in order to screen randomly primed Aplysia nervous tissue cDNA libraries made from poly(A)+ RNA (Beushausen et al., 1988). We Isolated 12 positive clones, a frequency of 1 clone in 300,000 recombinant phage. This frequency is similar to that found for the C subunit of PKA (1 clone in 600,000 phage), but much lower than that for calmodulin (1 clone in 3000). Phage inserts were restriction mapped and partially sequenced. The largest insert of all the clones was ARI, which contained 703 bp of open reading frame as well as 2.4 kb of putative 3’ untranslated region.

Oligonucleotides encoding a conserved sequence close to the 5’end of vertebrate and Drosophila RI (DSiClVQ) (Figure 2) were used to amplify cDNAs encoding the Send of the N4 transcript. A 384-fold degenerate mixtureof 15.meroligonucleotides encoding DSiClVQwas synthesized in fourequallysized batches. Each batch and the oligonucleotide CCTTGCTGACAAAGTCC (corresponding to nucleotides 732-749 in Figure IB) were used in PCR amplification of randomly primed Aplysia nervous tissue cDNA.

cDNA was prepared from 5 pg of total Aplysia nervous tissue RNA primed with 1 Ggof random 6.mers (Pharmacia) and reverse transcribed with 15 U of Moloney’s murine leukemia virus reverse transcriptase (Pharmacia). A tenth of the reverse transcrip- tlon product was added directly to 1.5 mM MgCl>, 50 mM KCI, 0.2 mgiml gelatin, 100 PM dNTPs, IO mM Tris-HCI (pH 8.4), 1 U of Taq polymerase (Perkin-Elmer, Norwalk, CT) and amplified for 40 cycles with the following program: 95’C, 1.5 min; 38OC, 2 mtn; 72OC. 2 min. The amplified product was electrophoresed in agarose gels, blotted onto nylon filters (Zeta-probe, Bio-Rad, Richmond, CA), and hybridized at high stringency (Beushausen et al., 1988) with a probe from AR1 corresponding to nucleotides 431-990 (Figure 16). We obtained a positive hybridizing DNA of approximately 700 bp. PCR amplifications were repeated with similar oligonucleotides containing restriction sites for cloning. The amplification product was purified by electrophoresis in an agarose gel and cloned into the EcoRl site of hgtl0. Approxi- mately 1% of the recombinant phage hybridized to the probe, and 12 phage clones were analyzed and sequenced for inclusion in Figure 16.

The extreme 5’ sequence of Aplysia N4 was isolated by G-tailing randomly primed total nervous tissue cDNA with terminal deoxynucleotidyl transferase (GIBCO BRL) and amplified using a 15mer of oligo(dC) and the antisense oligonucleotide GCC- CACTTGCTCClTCTCCAGTCC, corresponding to nucleotides

154-178 of the sequence in Figure 16 (Frohman et al., 1988). The amplified product was analyzed and cloned as described as above; 0.025% of the clones obtained contained the Send of the N4 coding region. The insert of one clone (XAR59) was sequenced. A complete coding region of N4 was then amplified from cDNA prepared from 1 pg of Aplysia nervous tissue poly(A)+ RNA primed with the200 pmol of theoligonucleotide CCTACAC- CGACACGGATACAAAGCTATTAT, which overlaps the stop codon of N4. The cDNA was amplified by adding 200 pmol of the primer AACAACACATATGGCGGCCAACACCGACGA, which spans the initiation codon and contains two mismatches intro- ducing an Ndel site, CAITATG at the start of the coding region. The reverse transcription mixture was diluted into 0.1 ml of PCR buffer with 2.5 mM MgCI, and 2.5 U of Taq polymerase and amplified for 40 cycles with the following program: 95OC, 1.5 min; 45OC, 2 min; 72OC, 2 min. The desired full-length cDNA was the predominant PCR product and was purified by agarose gel electrophoresis. After further purification on an Elutipd column (Schleicher and Schuell, Keene, NH), the cDNA was phosphory- lated using T4 polynucleotide kinase (New England Biolabs, Bev- erly, MA) and ligated into the Smal site of pKS- (Stratagene, La Jolla, CA). A recombinant plasmid with N4 inserted in thedesired orientation (pN4; sense RNA from the T7 promoter) was identified by restriction mapping of miniprep plasmid DNA.

In Vitro Transcription-Translation of pN4 Plasmid DNA The pN4 plasmid was linearized with Hindlll, and a sense strand RNA was synthesized with T7 RNA polymerase in the presence of m7G(5’)pppG. This RNA was translated in a nuclease-treated reticulocyte lysate (Promega, Madison, WI) at final concentrations of 100 mM potassium acetate and 0.7 mM magnesium acetate, with [3iS]methionine (New England Nuclear, Boston, MA) for 1 hr at 30°C. All translation products were analyzed on 12% SDS-PAGE (Laemmli, 1970).

Expression of N4 in E. coli The DNA insert of pN4 was removed by complete digestion with Hindlll followed by partial digestion with Ndel. The DNA fragment containing a complete N4 coding region was purified by polyacrylamide gel electrophoresis. The plasmid vector pT7flA (provided by Mark Zoller, Genentech, South San Francisco, CA) was prepared by digesting pT7/BCY/flA with Ndel and Hindlll to remove the BCYI insert (Kuret et al., 1988). The N4 insert was ligated into pT7fIA and transformed into E. coli strain JM109 (DE3). This directional cloning allowed translation to be initiated at the ATG codon used by the N4 protein. Strains containing pT7-N4 were difficult to maintain. Fresh colonies were innocu- lated into LB broth (Difco Laboratories, Detroit, MI) containing 0.2 mglml ampicillin (LB-amp) and grown to 0.5 Asso in small cultures (10 ml). These cultures were added to a liter of LB-amp and grown to0.5A550. Isopropyl P-D-thiogalactoside(0.5 mmol; Sigma Chemical Co.) was then added, and growth was continued for 2.5 hr. The cultures were chilled, sedimented, and dispersed in 5 ml of a buffer containing 8 M deionized urea, 2 mM EDTA, 2 mM EGTA, 5 mM 2-mercaptoethanol, 10 mM benzamidine-HCI, 0.1 mM phenylmethylsulfonyl fluoride, 10 PM N-tosyl+-leucyl chloromethyl ketone, 10 PM N-tosyl-L-phenylalamne chloromethyl ketone, 10 PM leupeptin, 5 mM 2-(N-morpholino) ethane- sulfonic acid (pH 6.5). The suspension was dispersed by 10 pas- sages each through 18 and 21 gauge needles and centrifuged at 3000 x g for 1 hr at 4OC. The supernatant contained recombinant N4 protein at approximately0.5 mg/ml. Large scaleculturesyielded as much as 6 mg/liter recombinant N4 protein.

Analysis of RApJRecombinant N4 Protein Before being photoaffinity labeled, crude recombinant N4 protein was diluted 50-fold into 0.15 M NaCI, 3 mM EDTA, 3 mM EGTA, 10 mM benzamidine-HCI, 0.1 mM phenylmethylsulfonyl fluoride, 50 mM Tris-HCI, (pH 7.5) to permit renaturation. A por- tion of the solution (IO ~1) was mixed with 10 PI of water containing 3 PM [‘LP]8-azido-cAMP (ICN, Costa Mesa, CA) and irradi- ated with ultraviolet light (Eppler et al., 1982). Labeled proteins were separated on 8% SDS-polyacrylamide gels, the gels were

NWMXl 396

dried, and the proteins were located by autoradiography. Gel slices containing either recombinant N4 or labeled M, 52,000 and 47,000 proteins from Aplysia nervous system extracts were rehydrated in 0.5 ml of 70% aqueous formic acid and 0.1 ml of 10% (wlv)cyanogen bromidein70% formicacid wasadded.After 24 hr at room temperature, the supernatant was removed from the gel fragments, and 1 ~rl of 20% SDS was added to each supernatant. The samples were dried, and 50 PI of water was added. After the samples were dried again, they were electrophoresed as described by Swank and Munkres (1971) in a gel containing 15% polyacrylamide,6Murea,and0.2% SDSin buffercontaining 0.1 M sodium phosphate(pH 7.2) and 0.2% SDS. Thegel was dried and autoradiographed. Labeled proteins were also separated by two-dimensional gel analysis as described by O’FarrelJ (1975) using the Mini-Protean I I system (Bio-Rad). Isoelectric focusing was carried out for 18 hr at 300 V in 1.6% Biolyte 5/7 and 0.4% Biolyte 3110. The second dimension was a 12% SDS-polyacrylamide gel with a 3.5% stacking gel.

Preparation of Anti-N4 Antisera and lmmunoblot Analysis Gel slices containing purified recombinant N4 protein (0.2 mg) from one-dimensional SDS-PAGEwere minced, mixed with RIBI adjuvant (Ribi Adjuvant Systems, Hamilton, MT), and injected into three New Zealand White rabbits. The rabbits were immunized again every 3 weeks with 0.2 mg of the protein, and the sera were tested by immunoblotting.

Aplysia nervous system or muscle homogenates were labeled with [32P]&azido-cAMP according to Eppler et al. (1986). Labeled proteins (10 Jrg) were electrophoresed on 8% SDS-polyacrylamide gels and transferred to nitrocellulose (BA85, Schleicher and Schuell). The filters were blocked with 5% bovine serum albumin in Tris-buffered saline (TBS; 10 mM Tris-HCI [pH 7.41 0.9% NaCI) for 2 hr and autoradiographed. The filters were then treated for 2 hr with a I:2000 dilution of an anti-N4 antiserum or with the same dilution of normal rabbit serum, washed 4 times for 8 min with TBS containing 0.2% Nonidet-40, and then treated with a I:5000 dilution of alkaline phosphatase complex anti- rabbit IgC (Promega). Immune complexes were visualized according to the manufacturer’s instructions.

Proteins were extracted from pleural sensory cells or buccal muscle by grinding dissected clusters (Sweatt and Kandel, 1989) in 50 PI of 62.5 mM Tris-HCI (pH 6.8), 2% SDS, 10% glycerol that had been heated to 100°C, and the extract was incubated at 85°C for 5 min. The concentration of protein in the sample was measured with the bicinchoninic acid assay (Pierce, Rockford, IL). Equal amounts of protein were electrophoresed on 8% polyacrylamide gels, transferred to nitrocellulose filters, and reacted with anti-N4 antiserum as described above, except the immuno- complexes were reacted with 1251-labeled protein A (0.1 pCi/ml, 70-100 RCi/pg, New England Nuclear). The filters were washed as before and exposed to XAR-5 film at -7OOC with Cronex inten- sifying screens for varying amounts of time. The amount of antibody binding was determined by scanning several different exposuresonaModel380laserdensitometer(MolecularDynam- its, Sunnyvale, CA].

Acknowledgments

We thank members of the Center for Neurobiology and Behavior for help and discussions during this study and Steven Sturner and Alice Elste for technical assistance. Mark Zoller provided help with the pT7 vector, and Ken Mueller assisted with preliminary experiments on N4 expression in E. coli. We also thank Robin Tewes, Jill Lindahl, Christianne Figueroa, and Lorraine Beck for help in preparing the manuscript. Parts of this work were supported by National Institutes of Health grant NS26760 (H. B.).

The costs of publication of this article were defrayed in part by the payment of page charge. This article must therefore be hereby marked “advertisment” in accordance with 18 USC Sec- tion 1734 solely to indicate this fact.

Received February 28, 1991; revised October 8, 1991

References

Aszodi,A., Muller, U., Friedrich, P., and Spatz, H.-C. (1991). Signal convergence on protein kinase A as a molecular correlate of learning. Proc. Natl. Acad. Sci. USA. 88, 5832-5836.

Barzilai, A., Kennedy, T. E., Sweatt, J. D., and Kandel, E. R. (1989). 5-HT modulates protein synthesis and the expression of specific proteins during the long-term facilitation of Aplysia sensory neurons. Neuron 2, 1577-1586.

Bergold, P. J., Sweatt, J. D., Winicov, I., Weiss, K. R., Kandel, E. R., and Schwartz, J. H. (1990). Protein synthesis during acquisi- tion of long-term facilitation is needed for the persistent loss of regulatory subunits of the Aplysia CAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 87, 3788-3791.

Bernier, L., Castellucci, V. F., Kandel, E. R., and Schwartz, J. H. (1982). Facilitatory transmitter causes a selective and prolonged increase in adenosine 3’:5’- monophosphate in sensory neurons mediating the gill and siphon withdrawal reflex in Aplysia. J. Neurosci. 2, 1682-1691.

Beushausen, S., Bergold, P., Sturner, S., Elste,A., Roytenberg,V., Schwartz, J. H., and Bayley, H. (1988). Two catalytic subunits of CAMP-dependent protein kinase generated by alternative RNA splicing are expressed in Aplysia neurons. Neuron 1, 853-864.

Buonomano, D. V., and Byrne, J. H. (1990). Long-term synaptic changes produced by a cellular analog of classic conditioning in Aplysia. Science 249, 420-423.

Byrne, J. H. (1987). Cellular analysis of associative learnrng. Phys- iol. Rev. 67, 329-439.

Ciechanover, A., DiGuiseppe, J. A., Berkovic, B., Orian, A., Rich- ter, J. D., Schwartz, A. L., and Brodeur, J. M. (1991). Degradation of nuclear oncoproteins by ubiquitin in vitro. Proc. Natl. Acad. SC;. USA 88, 139-143.

Clegg, C. H., and McKnight, G. S. (1988). Genetic characterization of a brain-specific form of the type I regulatory subunit of CAMP- dependent protein kinase. Proc. Natl. Acad. Sci. USA 85, 3703- 3707.

Dale, N., and Kandel, E. R. (1990). Facilitatoryand inhibitorytrans- mitters modulate spontaneous transmitter release at cultured Aplysia sensorimotor synapses. J. Physiol. 421, 203-222.

Dash, P. K., Hochner, B., and Kandel, E. R. (1990). Injection of the CAMP-responsive element into the nucleus of Aplysia sensory neurons blocks long-term facilitation, Nature 345, 718-721.

Drain, P., Folkers, E., and Quinn, W. G. (1991). CAMP-dependent protein kinase and the disruption of learning in transgenic flies. Neuron 6, 71-82.

Dudai, Y. (1989). The Neurobiology of Memory (New York: Ox- ford University Press).

Eppler, C. M., Palazzolo,M., and Schwartz, J. H. (1982). Character- ization and location of adenosine 3’5’ monophosphate-binding proteins in the nervous system of Aplysia. J. Neurosci. 2, 1692- 1704.

Eppler, C. M., Bayley, H., Greenberg, 5. M., and Schwartz, I. H. (1986). Structural studies on a family of CAMP-binding proteins in the nervous system of Aplysia. J. Cell Biol. 702, 320-331.

Finley, D., and Chau, V. (1991). Ubiquitination. Annu. Rev. Cell Biol. 7, 25-69.

Frohman, M. A., Dush, M. K., and Martin, C. R. (1988). Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998-9002.

Clanzman, D. L., Kandel, E. R., and Schacher, S. (1990). Target- dependent changes accompany long-term synaptic facilitation in Aplysia neurons. Science 249, 799-802.

Glotzer, M., Murray, A. W., and Kirchner, M. W. (1991). Cyclin IS degraded by the ubiquitin pathway. Nature 349, 132-138.

Greenberg, S. M., Castellucci, V. F., Bayley, H., and Schwartz, J. H. (1987). A molecular mechanism for long-term sensitization in Aplysia. Nature 329, 62-65.

Hirel, P.-H., Schmitter, J.-M., Dessen, P., Favat, G., and Blanquet,

Down-Regulation 397

of R in Aplysia Neurons

S. (1989). Extent of N-terminal methionine excision from Esche- richia co/i proteins is governed by the side-chain length of the penultimate amino acid. Proc. Natl. Acad. Sci. USA 86, 8247- 8251.

Johnson, K. E., Cameron, S., Toda, T., Wigler, M., and Zoller, M. J. (1987). Expression in Escherichia coliof BCYI, the regulatory subunit of cyclic AMP-dependent protein kinase. I. Biol. Chem. 262,8636-8642. Kalderon, D., and Rubin, G. (1988). Isolation and characterization of Drosophila CAMP-dependent protein kinase genes. Genes Dev.2,1539-1556. Kandel, E. R., and Schwartz, J. H. (1982). Molecular biology of learning: modulation of transmitter release. Science 218, 433- 443. Kozak, M. (1987). An analysis of the 5’noncoding sequences from 699 vertebrate messenger RNAs. Nucl. Acids Res. 75,8125-8143.

Kuret, J., Johnson, K. E., and Zoller, M. J. (1988). Mutagenesis of the regulatory subunit of yeast CAMP-dependent protein kinase. Isolation of site-directed mutant with altered affinity for catalytic subunit. J. Biol. Chem. 263, 9149-9154.

Laemmli, U. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680~685.

Lauffer, L., Garcia, P. D., Hawkins, R. N., Coussens, L., Ullrich, A., and Walter, P. (1985). Topology of signal recognition particle receptor in the endoplasmic reticulum membrane. Nature 378, 334-338. Muller, U., and Spatz, H.-C. (1989). Ca+‘-dependent proteolytic modification of the CAMP-dependent kinase in wild-type Dro- sophila and dunce memory mutants. J. Neurogenet. 6, 95-114.

O’Farrell, P. (1975). High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250, 4007-4021.

Palazzolo, M., Katz, F., Kennedy, T. E., and Schwartz, J. H. (1990). MultiplecAMP-binding proteins in Aplysia tissues. J. Neurobiol. 20, 746-761.

Rechsteiner, M. (1987). Ubiquitin-mediated pathways for intracellular proteolysis. Annu. Rev. Cell Biol. 3, I-30.

Rechsteiner, M. (1991). Natural substrates of the ubiquitin proteolytic pathway. Cell 66, 615-618.

Rogers, S., Wells, R., and Rechsteiner, M. (1986). Amino acid sequences common to rapidly degraded proteins: the PEST hy- pothesis. Science 234, 364-368.

Sambrook, j., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Second edition (Cold Spring Har- bor, New York: Cold Spring Harbor Laboratory).

Scheffner, M., Werness, B.A., Huibregtse, J. M., Levine, A. J., and Howley, P. M. (1990). The E6 oncoprotein encoded by human papilloma virus types 10 and 18 promotes thedegradation of ~53. Cell 63, 129-136.

Schwartz, J. H., and Greenberg, S. M. (1987). Molecular mechanisms for memory: second-messenger induced modifications of protein kinases in nerve cells. Annu. Rev. Neurosci. 70,459-476.

Schwartz, J. H., and Greenberg, S. M. (1989). Turtles all the way down: some molecular mechanisms underlying long-term synaptic plasticity. In Neural Models of Plasticity, J. H. Byrne and W. 0. Berry, eds. (New York: Academic Press, Inc.), pp. 47-57.

Schwartz, J. H., and Swanson, M. E. (1987). Dissection of tissues for characterizing nucleic acids from Aplysia: isolation of the structural gene encoding calmodulin. Meth. Enzymol. 739,277- 290. Siman, R.,and Noszek, J. C. (1988). Excitatoryaminoacidsactivate calpain I and induce structural protein breakdown in viva. Neu- ron 1, 279-287.

Swank, R. T., and Munkres, K. D. (1971). Molecular weight analysis of oligopeptides by electrophoresis in polyacrylamide gel with sodium dodecyl sulfate. Anal. Biochem. 39, 462-477.

Swanson, M., Sturner, S. F., and Schwartz, J. H. (1991). Structure and expression of the Aplysia californica calmodulin gene. J. Mol. Biol. 216. 545-553.

Sweatt, J. D., and Kandel, E. R. (1989). Persistent and trans- criptionally-dependent increase in protein phosphorylation upon long-term facilitation in Aplysia sensory neurones. Nature 339, 51-54.

Takio, K., Smith, S. B., Krebs, E. G., Walsh, K. A., and Titani, K. (1984). Amino acid sequence of the regulatory subunit of bovine type II adenosine cyclic 3’,5’-phosphate dependent protein kinase. Biochemistry 23, 4200-4206.

Taylor, S. S., Buechler, J. A., and Yonomoto, W. (1990). CAMP- dependent protein kinase: framework for a diverse family of regulatory enzymes. Annu. Rev. Biochem. 59, 971-1005.

Titani, K., Sasagawa, T., Ericsson, L. H., Kumar, S., Smith, S. B., Krebs, E. G., and Walsh, K. A. (1984). Amino acid sequence of the regulatory subunit of bovine type I adenosine cyclic 3’5. phosphate dependent protein kinase. Biochemistry 23, 4193- 4199.

CenBank Accession Number

The GenBank accession number for the sequence reported in this paper is X62382.

Note Added in Proof

The work cited as S. A. Beushausen and H. Bayley, submitted, is now in press: Beushausen, S., Lee, E., Walker, B., and Bayley, H. (1992). Catalytic subunits of Aplysia neuronal CAMP-dependent protein kinasewith twodifferent N termini. Proc. Natl. Acad. Sci. USA.

a regulatory subunit of the camp-dependent protein kinase down-regulated in aplysia sensory neurons...

Documents