docking-guided identification of protein hosts for gfp ... · docking-guided identification of...
TRANSCRIPT
1
Supplementary information
Docking-guided identification of protein hosts for GFP chromophore-like
ligands
Natalia V. Povarovaa, Nina G. Bozhanovaa, Karen S. Sarkisyana, Roman Gritcenkoa, Mikhail
S. Baranova,b, Ilia V. Yampolskya,b, Konstantin A. Lukyanova, Alexander S. Mishina
aShemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Miklukho-Maklaya 16/10, 117997
Moscow, Russia bPirogov Russian National Research Medical University, Ostrovitianov 1, Moscow 117997,
Russia
Supplementary file. Zip-archive with optimized geometries of Kaede chromophores.
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry C.This journal is © The Royal Society of Chemistry 2016
2
Supplementary data and figures.
Table S1. Top-50 of candidate proteins assessed by molecular docking with GFP
chromophore.
Kaede docking
GFP docking
PDB ID Score PDB ID Score
1DOS -12.5 2GFX -9.75
1GVH -11 2QRY -9.6
1PVS -10.8 1DOS -9.6
3FBR -10.8 3HNZ -9.55
1VB6 -10.7 1XDQ -9.45
3ASV -10.4 2GFY -9.45
1TJ1 -10.2 3DNT -9.2
1V9Z -10.2 3FBR -9.15
3NR0 -10.2 3HO2 -9.15
1TLZ -10.2 3G11 -9.1
1TLY -10.2 1GVH -9.05
1TLW -10.2 1B3N -9.05
3IP0 -10.2 3I8P -9.05
2R46 -10.2 2GFV -9
1TJ2 -10.2 3EPS -9
3OW7 -10.1 1HO5 -9
1RP7 -10.1 1KFY -9
2FQ1 -10.1 2CGL -9
3DNT -10.1 3HZI -8.95
1I8T -10.1 1XDY -8.95
2FZM -10.1 2FDK -8.95
1FFT -10.1 2PUA -8.9
2ANB -10.1 3HO9 -8.9
2UDP -10 3MR8 -8.9
2QCU -10 3ASV -8.85
1TIW -10 2PUE -8.85
2FZN -10 2CGJ -8.85
1TJ0 -10 1IL2 -8.8
1MPG -10 1TJ2 -8.75
2CGL -9.9 2WDR -8.75
2R45 -9.9 1MWJ -8.75
1L8A -9.9 1FDI -8.7
1MWJ -9.9 3O7Q -8.7
1TLC -9.9 1PNS -8.7
1W7K -9.9 1K0G -8.7
3DMQ -9.9 3NQ8 -8.7
3Q2D -9.8 2WS3 -8.7
3D4V -9.8 2R4E -8.65
3
3SEX -9.8 2ANB -8.65
3ITG -9.8 1K87 -8.65
2OWO -9.8 1NEN -8.65
1NAI -9.8 2WDV -8.6
3CW7 -9.8 2FZN -8.6
2R4J -9.8 2HGP -8.6
1LQA -9.8 1HPU -8.6
1W78 -9.8 2Q29 -8.6
2G28 -9.8 2QOW -8.6
2VET -9.8 1TLC -8.6
1K87 -9.8 3OAS -8.6
3CVS -9.8 1SPA -8.6
4
Fig. S1 Spectral changes upon binding of the chromophore to proteins (1PVS, 3HO2, BSA).
5
Table S2. Spectral properties of the tested chromophores in water solution (PBS pH 7.4).
Compound
λexc (nm) free/
+1PVS/ +3HO2
λem (nm) free/
+1PVS/ +3HO2
ε (M*cm
-1)
Solubility, µM
𝜙 (%)
λAbs (nm)
λAbs anion (nm)
PBS PBS +1% EtOH
PBS +5% EtOH
A05 478 475 480
568 563 565
31000 29.6 ND ND 0.40 468 525
A12 520 503 520
608 601 599
39500 1.1 10.5 13.8 0.05 481 ND*
A12H 480 481 485
572 577 576
35000 5.9 29.9 ND 0.03 465 ND*
A24 440 438 433
535 512 506
34500 8.4 13.5 31.0 0.15 436 511
*- multiple anion forms are possible.
6
Fig. S2 Comparison of docking poses of the chromophores within the protein host 3HO2.
Chromophores A12 (A), A12H (B), A5 (C), A24 (D). Top-scoring mode is thicker, top 50
chromophore binding modes are shown as overlaid magenta sticks. Grey surface
corresponds to the binding pocket.
7
Table S3 Residues with maximum impact on the ligand binding according to Rosetta ΔΔG
score. HI - hydrophobic interaction, 𝜋-𝜋 - stacking, ⋅⋅⋅H - hydrogen bond.
3HO2 1PVS
residue role ΔΔG residue role ΔΔG
A5 F399 𝜋-𝜋 -2.30 Y239 𝜋-𝜋 -1.48
F397 𝜋-𝜋 -1.42 T219 ⋅⋅⋅H -1.05
P271 ⋅⋅⋅H -1.08 W218 𝜋-𝜋 -2.93
L125 HI -1.64
A12 F399 𝜋-𝜋 -2.15 Y239 𝜋-𝜋 -2.10
D264 ⋅⋅⋅H -1.12 W218 𝜋-𝜋 -2.40
L125 HI -1.14
A12H F399 𝜋-𝜋 -2.19 Y239 -1.57
D264 ⋅⋅⋅H -1.12 W218 𝜋-𝜋 -2.61
L125 HI -1.10
A24 F399 𝜋-𝜋 -2.33 Y239 -1.88
T304 ⋅⋅⋅H -1.55 T219 ⋅⋅⋅H -1.11
P271 ⋅⋅⋅H -1.18 W218 𝜋-𝜋 -2.46
L125 HI -1.41
8
Fig. S3 TDDFT studies on anionic and neutral species of A12H chromophore. (A)
experimental absorption spectrum; (B) Computed transitions for possible species of a12h in
solution, obtained at ZORA–PBE0/def2-TZVP (COSMO: H2O) level of theory, dashed lines
shows correspondence between theoretically predicted S0→S1 transitions and experimental
spectrum; (C) proposed equilibrium for a12h; (D) molecular orbitals (HOMO and LUMO) of
a12h_1_anion_2 and their contribution to S0→S1 transition.
9
Fig. S4 TDDFT studies on anionic and neutral species of A12 chromophore.
10
Fig. S5 TDDFT studies on anionic and neutral species of A5 chromophore.
11
Fig. S6 TDDFT studies on anionic and neutral species of A24 chromophore.
12
Supplementary Methods.
Table S4. List of primers used for self-assembly cloning
13.1 1DOS external forward
GGCCCGACGATACAGGACAAGAGACATGTCTAAGATTTT
TGATTTCGTAAAACCTGGCG
13.2 1DOS external reverse
AGACCCGCAGAGCGGGCCTTGAGATAAGCAGAAAGGAA
TATCTTACAGAACG
13.3 1DOS internal FL
CCGAGCTCGAGATCTATGTCTAAGATTTTTGATTTCGTAA
AACCTGGCGTAATCACTGGTGATGACGTACAG
13.4 1DOS internal FS
ATGTCTAAGATTTTTGATTTCGTAAAACCTGGCGTAATCA
CTGGTGATGACGTACAG
13.5 1DOS internal RL
CAGCCAAGCTTTTACAGAACGTCGATCGCGTTCAGTTCC
TGGAATGCTTTCTCCAGACGAGCG
13.6 1DOS internal RS
TTACAGAACGTCGATCGCGTTCAGTTCCTGGAATGCTTT
CTCCAGACGAGCG
13.39 2QRY FL
AGCTCGAGATCTATGTCTGCCCCTGCTGTTGCTGTGACA
GCGCCCG
13.40 2QRY FS ATGTCTGCCCCTGCTGTTGCTGTGACAGCGCCCG
13.41 2QRY RL
ACAGCCAAGCTTTTAACGGCTGACGGCGCGTTGCCATTC
GC
13.42 2QRY RS TTAACGGCTGACGGCGCGTTGCCATTCGC
13.38 1PVS RS TCATGCTTCGTCTGGTTGCCAGCCTTCCGTATACCAG
13.37 1PVS RL
ACAGCCAAGCTTTCATGCTTCGTCTGGTTGCCAGCCTTC
CGTATACCAG
13.36 1PVS FS
ATGTATACCCTGAACTGGCAGCCGCCGTATGACTGGTC
GTGG
13.35 1PVS FL
AGCTCGAGATCTATGTATACCCTGAACTGGCAGCCGCC
GTATGACTGGTCGTGG
13.13 3HO2 external forward
GTCCCACTAGAATCATTTTTTCCCTCCCTGGAGGACAAA
CGTGTCTAAGCGTCGTG
13.14 3HO2 external reverse
GGCCCGCAAGCGGACCTTTTATAAGGGTGGAAAATGAC
AACTTAGATCTTTTTAAAG
13.15 3HO2 internal FL
CCGAGCTCGAGATCTGTGTCTAAGCGTCGTGTAGTTGTG
ACCGGACTGGGCATGTTGTC
13.16 3HO2 internal FS
GTGTCTAAGCGTCGTGTAGTTGTGACCGGACTGGGCAT
GTTGTC
13.17 3HO2 internal RL
CAGCCAAGCTTTTAGATCTTTTTAAAGATCAAAGAACCAT
TAGTGCCACCGAAGCCG
13.18 3HO2 internal RS
TTAGATCTTTTTAAAGATCAAAGAACCATTAGTGCCACCG
AAGCCG
13
Materials
Commercially available reagents were used without additional purification. For column
chromatography, E. Merck Kieselgel 60 was used. NMR spectra were recorded on a 700-
MHz Bruker Avance III NMR at 293 K. Chemical shifts are reported relative to residue peaks
of DMSO-d6 (2.51 ppm for 1H and 39.5 ppm for 13C). Melting points were measured on a
SMP 30 apparatus. High-resolution mass spectra were obtained on a Thermo Scientific LTQ
Orbitrap.
.
Geometry optimization
Geometry optimization of chromosphere models was performed in ORCA 3.0.3
software 1 in the framework of DFT theory. RKS B3LYP hybrid DFT functional has already
been shown sufficient for geometry optimization of related compounds 2–4. TurboMole
program system defined B3LYP version was used in the present studies. def2-SVP and ma-
Def2-SVP basis set were tested and no significant difference was obtained, so def2-SVP
basis set was chosen to perform geometry optimization in order to save a computational
time compared to its analog with diffuse functions5,6. Split-RI-J method in conjugation with
“chain of spheres” COSX approximation (RIJCOSX) was successfully applied in order to
speed up calculations 7. COSX grid was tightened up to GRIDX4 to prevent numerical noise
appearing issues. For RIJCOSX approximation corresponding auxiliary def2-SVP/J basis set
was used 8. Multigrid option was turned on 8, so for SCF iterations GRID4 was used and
gradients and final energies were obtained at FINALGRID5. Optimization was performed in
internal coordinates in vacuum with tightened TIGHTOPT criteria (Energy Change 1.0000e-
06 Eh, Max. Gradient 1.0000e-04 Eh/bohr, RMS Gradient 3.0000e-05 Eh/bohr, Max.
Displacement 1.0000e-03 bohr, RMS Displacement 6.0000e-04 bohr).
Time-dependent density functional theory calculations
TD–DFT studies were performed on geometries used for docking studies and
obtained at B3LYP/def2–SVP level of theory in gas phase. Tamm-Dancoff approximation as
well as RIJCOSX were successfully applied in order to speed up calculations. Only 10 first
excitations were computed, the size of the expansion space was set to 100. SCF and GRID
settings were kept the same as for geometry optimization, except otherwise noticed (ma–
def2–TZVP and aug–SVP calculations, where GRIDX5, GRID5, and FINALGRID6 grid
settings were used, and auxiliary basis set was decontracted, SCF convergence criteria
were tightened with VERYTIGHTSCF option). Basis set optimization using B3LYP hybrid–
GGA functional was performed. def2–SVP and def2–TZVP basis sets give almost no
differences for the first transition, addition of polarization functions (def2–TZVPP), led to no
observable changes (Fig S7,A). Relativistic effects were found to play minor role, only small
changes of computed excitations were observed below ~ 400 nm when ZORA model was
applied, for def2–TZVP basis set changes were smaller than for smaller def2–SVP (Fig
S7,B), this almost didn’t lead to increasing of computational time. Effect of diffuse functions
also was studied (Minimally augmented for def2-XVP and bigger augmented one for SVP),
similar to latter comparison, for bigger def2–TZVP basis set influence of diffuse functions is
smaller than for def2–SVP, but in both cases changes are minor, especially for the first
S0→S1 transitions, where the difference is no more than few nm (Fig S7, C), in the case of
ma–def2–TZVP basis set some issues, rising from nonsufficient grid size, were noticed (Fig
S7, D).
14
Fig. S7 TDDFT basis set optimization on a12h_2_anion_2.
Basis set optimization revealed def2–TZVP to be sufficient for our studies. Further
DFT functional optimization showed, that transitions, obtained with hybrid-GGA functionals (Fig. S8,A), are red–shifted in comparison to range separated ones (Fig. S8,B), except BHANDHLYP (Fig. S8,C), which has quite big amount of HF exchange. The main disadvantage of range–separated functionals is their computational cost, because they can be used only in conjugation with RIJONX approximation, which is significantly slower than RIJCOSX. All methods predict transitions of anionic forms to be closer to the maximum in the experimental excitation spectrum, in comparison to neutral ones for a12h_2 set of molecules (Fig. S8,C), but to select exactly which one is very difficult, because of DFT functional choice dependence. So, PBE0 hybrid–GGA functional was used in present studies.
15
Fig. S8 Comparison of different DFT functionals. (A) Screening of hybrid-GGA functionals
on a12_2_anion_2; (B) Screening of range separated functionals on a12_2_anion_2; (C)
Comparison of different functionals on a12h_2 set of molecules, anionic as well neutral
ones.
16
Synthesis
((Z)-4-(4-hydroxybenzylidene)-2-methyl-1H-imidazol-5(4H)-ones (1)
((Z)-4-(4-hydroxybenzylidene)-2-methyl-1H-imidazol-5(4H)-ones (1) was synthesized as
reported previously 9 .
(Z)-4-(4-hydroxybenzylidene)-1-methyl-2-((E)-styryl)-1H-imidazol-5(4H)-ones (A) 10
To the solution of compound 1 (1 mmol) and corresponding aldehyde (1.2 mmol) in THF
(5 mL) anhydrous zinc chloride (30 mg, 0.22 mmol) was added. The mixture was refluxed for
1 h and the solvent was removed in vacuum. The mixture was dissolved in EtOAc (50 mL)
and washed by EDTA solution (0.5%, 10 mL), water (3x10 mL) and brine (1x10 mL). The
mixture was dried over anhydrous Na2SO4. The solvent was evaporated and the product
was purified by column chromatography (EtOH:CHCl3).
Examples of A
Red solid, 220 mg (64%); mp = over 250°С with decomposition; 1H NMR (700 MHz,
DMSO) δ 11.96 (bs, 1H), 10.16 (bs, 1H), 8.53 (s, 1H), 8.01 (d, J = 15.6 Hz, 1H), 7.99 (d, J =
8.6 Hz, 2H), 7.97 (d, J = 7.8 Hz, 1H), 7.47 (d, J = 7.8 Hz, 1H), 7.18 (t, J = 7.8 Hz, 1H), 7.16
(t, J = 7.8 Hz, 1H), 6.75 (d, J = 15.6 Hz, 1H), 6.70 (s, 1H), 6.24 (d, J = 8.6 Hz, 2H), 3.25 (s,
3H); 13C NMR (176 MHz, DMSO) δ 170.1, 157.8, 157.6, 137.5, 134.1, 131.9, 124.9, 123.7,
122.6, 120.9, 120.3, 118.1, 116.6, 116.3, 116.2, 113.4, 112.4, 106.9, 26.2; HRMS (ESI) m/z:
344,1406 found (calcd. for C21H18N3O2, [M+H]+ 344.1399) 11.
Orange solid, 370 mg (77%); mp = 203-205°С; 1H NMR (700 MHz, DMSO) δ 10.44 (bs,
1H), 10.17 (bs, 1H), 8.19 (d, J = 8.6 Hz, 2H), 8.15 (s, 2H), 7.83 (d, J = 15.7 Hz, 1H), 7.19 (d,
J = 15.7 Hz, 1H), 6.95 (s, 1H), 6.87 (d, J = 8.6 Hz, 2H), 3.26 (s, 3H); 13C NMR (176 MHz,
DMSO) δ 169.9, 159.7, 158.6, 152.0, 136.9, 136.7, 134.5, 132.1, 130.0, 125.8, 125.7, 115.8,
17
113.8, 112.2, 26.4; HRMS (ESI) m/z: 478.9424 found (calcd. for C19H15Br2N2O3, [M+H]+
478.9429).
Orange solid, 340 mg (73%); mp = over 250°С with decomposition; 1H NMR (700 MHz,
DMSO) δ 11.58 (bs, 1H), 10.44 (bs, 1H), 10.14 (bs, 1H), 8.10 (d, J = 8.7 Hz, 2H), 7.87 (s,
2H), 7.43 (d, J = 16.4 Hz, 1H), 7.01 (d, J = 16.4 Hz, 1H), 6.88 (s, 1H), 6.84 (d, J = 8.7 Hz,
2H);13C NMR (176 MHz, DMSO) δ 171.2, 159.6, 158.7, 151.9, 138.3, 136.5, 134.2, 131.4,
129.8, 125.7, 125.4, 117.3, 115.8, 112.3; HRMS (ESI) m/z: 464.9261 found (calcd. for
C18H13Br2N2O3, [M+H]+ 464.9272).
Orange solid, 280 mg (88%); mp = 196-199°С; 1H NMR (700 MHz, DMSO) δ 10.15 (bs,
1H), 8.19 (d, J = 8.6 Hz, 2H), 7.95 (d, J = 15.9 Hz, 1H), 7.76 (d, J = 8.0 Hz, 2H), 7.28 (d, J =
8.0 Hz, 2H), 7.19 (d, J = 15.9 Hz, 1H), 6.95 (s, 1H), 6.89 (d, J = 8.6 Hz, 2H), 3.27 (s, 3H),
2.36 (s, 3H); 13C NMR (176 MHz, DMSO) δ 170.0, 159.6, 158.9, 139.9, 139.5, 136.9, 134.4,
132.5, 129.5, 128.2, 125.8, 125.6, 115.8, 112.9, 26.3, 21.0; HRMS (ESI) m/z: 319.1440
found (calcd. for C20H19N2O2, [M+H]+ 319.1447).
Orange solid, 180 mg (56%); mp = 186-190°С; 1H NMR (700 MHz, DMSO) δ 10.16 (bs,
1H), 8.22-8.15 (m, 3H), 7.95-7.90 (m, 1H), 7.36-7.26 (m, 3H), 7.11 (d, J = 15.8 Hz, 1H), 6.98
(s, 1H), 6.87 (d, J = 8.7 Hz, 2H), 3.28 (s, 3H), 2.54 (s, 3H); 13C NMR (176 MHz, DMSO) δ
169.9, 159.7, 158.8, 137.2, 136.8, 136.6, 134.4, 133.9, 130.7, 129.7, 126.5, 126.3, 126.0,
125.8, 115.9, 115.1, 26.4, 19.3; HRMS (ESI) m/z: 319.1438 found (calcd. for C20H19N2O2,
[M+H]+ 319.1447).
18
Orange solid, 285 g (86%); mp = 223-227°С; 1H NMR (700 MHz, DMSO) δ 10.15 (bs,
1H), 8.18 (d, J = 8.6 Hz, 2H), 7.93 (d, J = 15.8 Hz, 1H), 7.65 (bs, 1H), 7.58 (bd, J = 7.5 Hz,
1H), 7.23 (d, J = 7.5 Hz, 1H), 7.15 (d, J = 15.8 Hz, 1H), 6.95 (s, 1H), 6.87 (d, J = 8.6 Hz, 2H),
3.27 (s, 3H), 2.29 (s, 3H), 2.27 (s, 3H); 13C NMR (176 MHz, DMSO) δ 169.9, 159.6, 158.9,
139.7, 138.8, 136.9, 136.8, 134.4, 132.8, 130.0, 129.2, 125.9, 125.8, 125.4, 115.8, 112.7,
26.3, 19.4, 19.2; HRMS (ESI) m/z: 333.1696 found (calcd. for C21H21N2O2, [M+H]+
333.1603).
Orange solid, 230 mg (68%); mp = 234-238°С; 1H NMR (700 MHz, DMSO) δ 10.14 (bs,
1H), 8.19 (d, J = 8.6 Hz, 2H), 7.97 (d, J = 15.9 Hz, 1H), 7.89 (d, J = 8.4 Hz, 2H), 7.53 (d, J =
8.4 Hz, 2H), 7.25 (d, J = 15.9 Hz, 1H), 6.98 (s, 1H), 6.87 (d, J = 8.6 Hz, 2H), 3.27 (s, 3H); 13C
NMR (176 MHz, DMSO) δ 169.9, 159.8, 158.5, 137.9, 136.9, 134.5, 134.4, 134.2, 129.9,
128.9, 126.2, 125.8, 115.9, 114.9, 26.4; HRMS (ESI) m/z: 339.0894 found (calcd. for
C19H16ClN2O2, [M+H]+ 339.0900).
References
1 M. Wanko, P. García-Risueño and A. Rubio, Phys. Status Solidi , 2012, 249, 392–400. 2 A. K. Das, J.-Y. Hasegawa, T. Miyahara, M. Ehara and H. Nakatsuji, J. Comput. Chem.,
2003, 24, 1421–1431. 3 Y. Ma, Q. Sun, Z. Li, J.-G. Yu and S. C. Smith, J. Phys. Chem. B, 2012, 116, 1426–
1436. 4 F. Weigend and R. Ahlrichs, Phys. Chem. Chem. Phys., 2005, 7, 3297–3305. 5 E. Papajak, H. R. Leverentz, J. Zheng and D. G. Truhlar, J. Chem. Theory Comput.,
2009, 5, 3330–3330. 6 F. Neese, F. Wennmohs, A. Hansen and U. Becker, Chem. Phys., 2009, 356, 98–109. 7 F. Weigend, Phys. Chem. Chem. Phys., 2006, 8, 1057–1065. 8 R. Ahlrichs, M. Bär, H. P. Baron, R. Bauernschmitt, S. Böcker, M. Ehrig, K. Eichkorn, S.
Elliott, F. Furche, F. Haase and Others, J. Chem. Phys., 1995, 102, 346. 9 A. Baldridge, J. Kowalik and L. M. Tolbert, Synthesis , 2010, 2010, 2424–2436. 10 W.-T. Chuang, B.-S. Chen, K.-Y. Chen, C.-C. Hsieh and P.-T. Chou, Chem. Commun. ,
2009, 6982–6984. 11 I. V. Yampolsky, A. A. Kislukhin, T. T. Amatov, D. Shcherbo, V. K. Potapov, S.
Lukyanov and K. A. Lukyanov, Bioorg. Chem., 2008, 36, 96–104.