dna fingerprinting a method of developing a person’s dna “profile,” similar to a fingerprint....

22
DNA Fingerprinting • A method of developing a person’s DNA “profile,” similar to a fingerprint. • Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec Jeffreys

Upload: melanie-claribel-turner

Post on 18-Dec-2015

228 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

DNA Fingerprinting

• A method of developing a person’s DNA “profile,” similar to a fingerprint.

• Pioneered in England in 1984 by Dr. Alec Jeffreys

Dr. Alec Jeffreys

Page 2: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

First Forensic Use

• First used by law enforcement in England in the mid-1980’s.

• DNA evidence exonerated one man, and convicted another.

• Described in The Blooding, by Joseph Wambaugh

Page 3: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

How does it work?

• 99.9% of your DNA is the same as everyone else’s.

• The 0.1% that differs are a combination of:– Gene differences (Differences in the genes

themselves)– Differences in “polymorphic regions” between the

genes on the DNA.

Page 4: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

How does it work?

• Certain points between the genes on the DNA have repeating base sequences.– For example:

ATTACGCGCGCGCGCGCGCTAGC– These are called short tandem repeats (STRs for

short)

Page 5: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

How does it work?

• Everyone has STRs at the same place in their DNA, but they are different lengths for different people.– For example:

Person 1: ATTACGCGCGCGCGCGCGTAGC(7 repeats)

Person 2: ATTACGCGCGCGCGTAGC(5 repeats)

Page 6: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

To Make a DNA Fingerprint…

• First, we use restriction enzymes to chop the DNA up into millions of fragments of various lengths.– Some of the fragments contain STRs; some do

not. The ones that do are different lengths for different people.

Page 7: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Restriction Fragment Length Polymorphisms (RFLPs)

• Polymorphisms are slight differences in DNA sequences as seen in individuals of the same species

Page 8: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

To Make a DNA Fingerprint…

• Next, we use gel electrophoresis to sort the DNA fragments by size.

Page 9: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Gel Electrophoresis

• Method for sorting proteins or nucleic acids on the basis of their electric charge and size

Page 10: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Gel Electrophoresis• Electrical current carries

negatively-charged DNA through gel towards positive electrode

• Agarose gel sieves DNA fragments according to size– Small fragments move

farther than large fragments

Page 11: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Gel Electrophoresis

Page 12: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

To Make a DNA Fingerprint…

• Finally, a radioactive probe attaches to our STRs. Only the fragments with our STRs will show up on the gel.

Figure 12.11C

Restriction fragmentpreparation

1

Restrictionfragments

Gel electrophoresis2

Blotting3

Probe

Radioactive probe4

Detection of radioactivity(autoradiography)

5

Film

Page 13: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

To Make a DNA Fingerprint…

• Since STRS are different lengths in different people, this creates a DNA Fingerprint.

Page 14: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Two uses for DNA Fingerprints...

• ForensicsDNA taken from crime scenes (blood, semen, hair, etc.) can be compared to the DNA of suspects.

Real-life CSI!

Page 15: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Two uses for DNA Fingerprints...

• ForensicsThis is an example of a gel that might be used to convict a rape suspect. Compare the “Sperm DNA” to the “Suspect DNA.” Which suspect committed the rape?

Page 16: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Two uses for DNA Fingerprints...

• Paternity TestingSince all of our DNA markers came from either mommy or daddy, we can use DNA fingerprints to determine whether a child and alleged father are related…just like on Maury Povich!

Page 17: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Two uses for DNA Fingerprints...

• Look at the two “Child” markers on this gel. Can they both be matched up to either the mother or the “alleged father?”

• Yes. This is a “positive” test for paternity.

Page 18: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Two uses for DNA Fingerprints...

• How about this gel? Do both of the child’s markers match either the mother or the “alleged father.”

• No! The “alleged father” is not this child’s biological parent.

Page 19: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Interpreting DNA Fingerprints

• Which child is not related to the mother?

• Son 2

• Which children are not related to the father?

• Daughter 2 and Son 2

Page 20: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Interpreting DNA Fingerprints

• A blood stain was found at a murder scene. The blood belongs to which of the seven possible suspects?

Suspect 3

Page 21: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

Interpreting DNA Fingerprints

• These DNA fingerprints are from a mother, a child, and two possible biological fathers. Which one is the daddy?

2nd alleged father

Page 22: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec

The Polymerase Chain Reaction (PCR)

• The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA

• A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules

Genomic DNA

Targetsequence

5

3

3

5

5

3

3

5

Primers

Denaturation:Heat brieflyto separate DNAstrands

Annealing:Cool to allowprimers to formhydrogen bondswith ends oftarget sequence

Extension:DNA polymeraseadds nucleotides tothe 3 end of eachprimer

Cycle 1yields

2molecules

Newnucleo-

tides

Cycle 2yields

4molecules

Cycle 3yields 8

molecules;2 molecules

(in white boxes)match target

sequence

Genomic DNA

Targetsequence

5

3

3

5

5

3

3

5

Primers

Denaturation:Heat brieflyto separate DNAstrands

Annealing:Cool to allowprimers to formhydrogen bondswith ends oftarget sequence

Extension:DNA polymeraseadds nucleotides tothe 3 end of eachprimer

Cycle 1yields

2molecules

Newnucleo-

tides

Cycle 2yields

4molecules

Cycle 3yields 8

molecules;2 molecules

(in white boxes)match target

sequence