DIVERSITY OF RICE BLAST PATHOGEN FROM

DIFFERENT GEOGRAPHICAL LOCATION OF

CHHATTISGARH AND ITS MANAGEMENT

Ph.D. Thesis

by

Jahaar Singh

DEPARTMENT OF PLANT PATHOLOGY

COLLEGE OF AGRICULTURE, RAIPUR

FACULTY OF AGRICULTURE

INDIRA GANDHI KRISHI VISHWAVIDYALAYA

RAIPUR (Chhattisgarh)

2018

DIVERSITY OF RICE BLAST PATHOGEN FROM

DIFFERENT GEOGRAPHICAL LOCATION OF

CHHATTISGARH AND ITS MANAGEMENT

Thesis

Submitted to the

Indira Gandhi Krishi Vishwavidyalaya, Raipur

by

Jahaar Singh

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR

THE DEGREE OF

Doctor of Philosophy

in

Agriculture

(Plant Pathology)

Roll No. 20151622757 ID No. 130115050

JULY, 2018

ACKNOWLEDGEMENTS

It gives me immense pleasure to express my gratitude to Dr. R. K. Dantre,

Professor, Department of Plant Pathology, College of Agriculture, Raipur (C.G.)

and Chairman of the Advisory Committee for his valuable guidance,

inextinguishable encouragement, unflagging help and constructive criticism during

the course of investigation.

I deem it privilege to extol my profound and sincere feelings to Dr. M.

Srinivas Prasad, Principal Scientist, Head and Co-Chairman of the Advisory

Committee, Department of Plant Pathology, ICAR-IIRR Hyderabad (Telangana)

for insightful guidance, constant encouragement, constructive criticism in planning

of the investigation, moral support during my most of the trying times and

unflagging help in bringing out the best of my ability, in this dissertation.

I am highly thankful to Dr. P. K. Tiwari, Principal Scientist, Department of

Plant Pathology, College of Agriculture, Raipur (C.G.) and Member of my

Advisory Committee for his keen interest, help and co-operation during the course

of my investigation. I express my sincere thanks to member of my Advisory

Committee Dr. R. R. Saxena, Professor, Department of Statistics, College of

Agriculture, Raipur (C.G.) for his kind co-operation, valuable advises during my

research work. I take this opportunity to express my gratitude to Dr. A. S.

Kotasthane, Professor and Head, Department of Plant Pathology, College of

Agriculture, Raipur (C.G.) for his generous help and co-operation during my

entire Ph.D programme. I am highly thankful to Dr. Sunil Nag, Scientist,

Department of Plant Breeding and Genetics, College of Agriculture, Raipur (C.G.)

and Member of my Advisory Committee for his keen interest, help and co-

operation during the course of my investigation.

I wish to record my grateful thanks to Dr. S. K. Patil, Hon’ble Vice

Chancellor, Dr. S. S. Rao, Director Research Services, Dr. M. P. Thakur,

Director of Instructions, Dr. G. K. Shrivastav, Dean of Student Welfare and Dr. O.

P. Kashayap, Dean, College of Agriculture, IGKV, Raipur for providing necessary

facilities, technical and administrative supports for conductance of my research

work.

I express my wholehearted gratitude to Dr. N. Khare, Principal Scientist,

Dr. C. S. Shukla, Professor, Dr. K. P. Verma, Principal Scientist, Dr. C. P.

Khare, Principal Scientist Dr. N. Lakpale, Assistant Professor and Shri H. K.

Singh, Scientist, Department of Plant Pathology, College of Agriculture, Raipur

TABLE OF CONTENTS

Chapter Title Page

ACKNOWLEDGEMENT i

TABLE OF CONTENTS iii

LIST OF TABLES v

LIST OF FIGURES vi

LIST OF PLATES vii

LIST OF SYMBOLS AND ABBREVIATIONS viii

ABSTRACT x

I INTRODUCTION 1-4

II REVIEW OF LITERATURE 5-27

2.1 The causal agent 5

2.2 Distribution 6

2.3 Symptoms of rice leaf blast 6

2.4 Economic importance 7

2.5 Survey for disease incidence of rice blast 8

2.6 Pathogenicity test of P. oryzae 10

2.7 Pathogenic diversity of P. oryzae 11

2.8 Isolation, identification and maintenance of P. oryzae 13

2.9 Cultural and morphological diversity of P. oryzae 15

2.10 Molecular diversity of rice blast isolates 19

2.11 Multilocation trial for blast resistant lines 22

2.12 Evaluation of Ocimum leaf decoction for management of rice blast

disease 24

III MATERIALS AND METHODS 28-57

3.1 The Pathogen: P. oryzae Cavara (Survey, Collection and Diversity

Studies) 28

3.1.1 Cleaning and Sterilization of glassware 28

3.1.2 Media and its composition 28

3.1.3 Survey and Collection of blast infected samples 30

3.1.4 Isolation by mono-conidial method of P. oryzae isolates 35

3.1.5 Pathogenicity test 35

3.1.6 Pathogenic diversity of P. oryzae isolates using host

differentials 38

3.1.6.1 Inoculum preparation and Inoculation 38

3.1.7 Storage of fungal isolates 40

3.1.8 Cultural and morphological variability among

P. oryzae isolates 40

3.1.9 Sporulation 40

3.1.10 Molecular variability in P. oryzae using SSR markers 41

3.2 Multilocation evaluation of near isogenic lines (NIL’S) carrying

different blast resistant genes 48

3.3 To Evaluate the Efficacy of Ocimum Leaf Decoctions for

Management of Rice Blast 51

3.3.1 Evaluation of different ocimum species against P. oryzae in- 51

Chapter Title Page

vitro to assess inhibition of mycelium growth

3.3.2 Collection of plant material 51

3.3.3 Extraction of plant material 51

3.3.4 Extraction with Methanol 51

3.3.5 Extraction with Water 52

3.3.6 In Vivo evaluation of different Ocimum species against P.

oryzae on HR-12 variety 55

IV RESULTS AND DISCUSSION 58-111

4.1 The Pathogen: P. oryzae Cavara (Survey, Collection and Diversity

Studies) 58

4.1.1 Symptomatology 58

4.1.2 Survey and Collection of P. oryzae isolates 58

4.1.3 Isolation and Purification 61

4.1.4 Pathogenicity test 68

4.1.5 Virulence analysis and race identification 73

4.1.6 Cultural diversity studies 76

4.1.7 Morphological diversity studies 88

4.1.8 Genetic diversity analysis using SSR markers 93

4.1.8.1 Allelic polymorphism and diversity analysis of

P. oryzae 93

4.1.8.2 Cluster analysis 94

4.2 Multilocation Evaluation of Near Isogenic Lines (NIL’S) Carrying

Different Blast Resistance Genes 99

4.3 Evaluation of the Bio-efficacy of Ocimum Leaf Decoctions For

Management of Rice Blast 102

4.3.1 In-vitro efficacy of Ocimum spp. against P. oryzae 102

4.3.2 In vivo Efficacy of Ocimum Leaf Decoction in the

Management of Rice Blast Disease 103

V SUMMARY AND CONCLUSIONS 112-116

REFERENCES 117-134

RESUME 135

LIST OF TABLES

Table Title Page

3.1 Survey and collection of blast from Chhattisgarh 32

3.2 Disease rating (0-9) scale (SES IRRI, 1996) for leaf blast nursery 36

3.3 Sporulation Index 36

3.4 Host differentials in pathogenic variability 38

3.5 List of SSR markers and their sequences 47

3.6 Blast resistant introgressed lines 49

3.7 Ocimum species and their chemical compounds 52

3.8.a Water and methanolic extract of Ocimum leaf decoction used for

the management of rice blast in in vitro condition

56

3.8.a Water and methanolic extract of Ocimum leaf decoction used for

the management of rice blast in in vitro condition

56

4.1 Leaf blast disease severity and per cent disease index (PDI) on

different rice varieties cultivated in major rice growing areas of

Chhattisgarh

63

4.2 Pathogenicity of rice blast isolates collected from different agro-

climatic zones of Chhattisgarh

69

4.3 Pathogenicity test of rice blast isolates collected from different

agro- climatic zones of Chhattisgarh

71

4.4 Disease reaction of P. oryzae races on host differentials 75

4.5 Races of P. oryzae in different agro climatic zones of Chhattisgarh 76

4.6 Cultural characteristics of P. oryzae isolates from different rice

growing areas of Chhattisgarh

80

4.7 Frequency distribution of P. oryzae isolates from Chhattisgarh

based on colony color and texture under in-vitro conditions

83

4.8 Conidial size and sporulation of different P. oryzae isolates

collected from different rice growing areas of Chhattisgarh

91

4.9 Sporulation Index of different isolates of P. oryzae 93

4.10 Polymorphic SSR markers and their PIC values 95

4.11 Performance of rice cultivars BPT5204, ISM, Swarna and IR-64

introgressed lines with blast resistance genes under different

agro- climatic regions

101

4.12 The efficacy of Ocimum leaf decoctions on P. oryzae in in-

vitro conditions

104

4.13.a Efficacy of Ocimum leaf extract in water for the control of rice

blast under UBN condition during Kharif 2016-17

109

4.13.b Efficacy of Ocimum leaf extract in methanol for the control of

rice blast under UBN condition during Kharif 2016-17

110

LIST OF FIGURES

Figure Title Page

3.1 Sites of P. oryzae isolates in Chhattisgarh 34

4.1.a Per cent Disease Index of rice blast in Bastar Plateau Zone 66

4.1.b Per cent Disease Index of rice blast in Chhattisgarh Plains Zone 66

4.1.c Per cent Disease Index of rice blast in North Hills Zone 67

4.1.d Mean Per cent Disease Index of rice blast in three different Zones 67

4.2 Pathogenicity of rice blast isolates collected from different agro

climatic zones of Chhattisgarh 72

4.3 Radial growth of P. oryzae isolates 82

4.4 Amplification pattern of the marker MGM-1 96

4.5 Amplification pattern of the marker MGM-21 97

4.6 Dendrogram depiciting the genetic relationship of 63 isolates of P.

oryzae collected from different regions of Chhattisgarh on

similarity coefficients calculated from SSR data

98

4.7 In vitro evaluation of water and methanolic extract of Ocimum leaf

decoction against P. oryzae 105

4.8 Management of rice blast under UBN condition with Ocimum

extracts 110

LIST OF PLATES

Plate Title Page

3.1 Leaf blast severity based on disease rating scale (0-9) 37

3.2 Variability studies of P. oryzae isolates on host differentials 39

3.3 Multilocation evaluation of near isogenic lines (NIL’S) carrying

different blast resistant genes

50

3.4 Three Ocimum species 53

3.5 Water extracts of different Ocimum spp. 53

3.6 Methanolic extracts of different Ocimum spp. dried in Petri

plates

54

3.7 Methanolic extraction by Soxhlet apparatus 54

3.8 In vivo evaluation of three species of Ocimum leaf extracts

(Water and Methanol) against rice blast disease at Uniform

Blast Nursery (UBN) IIRR, Hyderabad

57

4.1 Symptoms of rice blast disease 62

4.2 Variation in cultural morphology of sixty three (63) P. oryzae

isolates on oat meal agar medium

84-87

4.3 Pure culture, conidia and mycelium of P. oryzae after 14 days of

incubation at 280C temperature

90

4.4.a Efficacy of Ocimum leaf decoctions against P. oryzae in in-vitro

conditions with water extract

106

4.4.b Efficacy of Ocimum leaf decoctions against P. oryzae in in-

vitro conditions with methanolic extract

107

LIST OF SYMBOLS AND ABBREVIATIONS

% : per cent

C : Celsius

µm : micrometer

cm : centimeter

g : gram

h : hours

ha : hectare

i.e., : that is

l : liter

µl : microliter

°C : degree celcius

mg : milligram

ml : milliliter

mm : millimeter

MT : Million Tonns

OMA : Oat Meal Agar

ANOVA : Analysis of Variance

CRD : Completely Randomized Design

RBD : Randomized Block Design

DR : Disease Reaction

DS : Disease severity

et al. : and others

No. : Number

RH : Relative Humidity

SE (m) : Standard Error of mean

Viz., : Namely

SSR : Simple Sequence Repeat

PDI : Per cent Disease Index

PDS : Per cent Disease severity

rpm : Revolutions per minute

PCR : Polymerase chain reaction

PIC : Polymorphic Information Content

DA1S : Days After First Spraying

DA2S : Days After Second Spraying

DA3S : Days After Third Spraying

kg ha-1

: Kilogram per hectare

M : Molar

MAS : Marker-Assisted Selection

bp : base pair

CV : Coefficient of Variation

CD : Critical difference

SE (m) : Standard error of the mean

SE (d) Standard error of the differences/standard

deviation

DMRT : Doncon multiple range test

cultivated rice verities. The PDI was observed from 20.00 to 87.78 per cent

in different agro-climatic regions of Chhattisgarh. The highest PDI of 87.78 per

cent recorded in Swarna variety (Jagdalpur) and lowest PDI of 20.00 per cent was

recorded in Safari (Bastar) and Maheshwari (Surajpur) varities. The mean blast

PDI recorded in Chhattisgarh plain zone was 35.49 per cent, in North hills zone

was 47.16 per cent, and in Bastar Plateau was 47.25 per cent. These results

indicated variation in PDI which was influenced by weather, rainfall, geographical

area under different cultivation practices.

A total of 63 blast isolates were collected from different locations of

Chhattisgarh. The highly significant differences were observed among the blast

isolates in pathogenicity test. The highest PDI 96.30 per cent was recorded in four

isolates and the lowest PDI 51.85 per cent were found in sixteen isolates.

The relativity of P. oryzae isolates were examined that represent the wide

collection of races from Chhattisgarh. A total of 14 races were detected among 15

isolates. The most frequently occurred isolate was IA (10 isolates) followed by IB

(2 isolates) and IC, ID, IG (1 isolate).

Variation in mycelium color, colony diameter and texture were observed

among the isolates. The smooth surface showed more sporulation compared with

rough surface isolates. P. oryzae grouped in 12 different color and most of isolates

showed grey (15 isolates), whitish grey (12 isolates) and greyish white (10

isolates) with smooth surface appearance. Significant differences in colony

diameter were observed among the isolates from different locations ranged

between 77 mm to 90 mm after 14 days of incubation at 28 0C.

In 63 isolates, observations were recorded on the conidial size (L×W). The

size of the conidia ranged between 28.0µm to 39.6 µm. The length of the conidia

ranged from 8 µm to 11 µm and width were ranged from 3.5 µm to 3.6 µm.

Studies on genetic variability indicated that, the polymorphic SSR markers

in the present study detected a total of 4 alleles among the 63 P. oryzae isolates

assayed. 2 alleles were detected in MGM-1 and MGM-21. The PIC values

obtained for MGM 1 was 0.35 and MGM 21 was 0.29. Overall topology of the

dendrogram indicated the presence of two major groups among 63 isolates. Out of

63 isolates, fifty seven isolates were clustered together in one group and remaining

six isolates were clustered in another group.

The sixteen introgressed lines were evaluated along with donor parents,

recurrent parents, resistant and susceptible checks. These lines were gene

pyramided with board spectrum of blast resistant genes i.e., Pi1, Pi2 and Pi54.

Verification of introgressed lines for blast resistance that, MSP-1 and MSP-7

(Pi1), MSP-3, MSP-9, MSP-14 and MSP-16 (Pi54), MSP-6 and MSP-12 (Pi1, Pi2

and Pi54), MSP-8 and MSP-13 (Pi2) and MSP-11 (Pi1 and Pi54) lines showed

complete resistant reaction to blast disease at four locations. While MSP-4 (Pi1

and Pi2), MSP-10 (Pi1 and Pi2), MSP-15 with (Pi2) genes were moderately

resistant at KVK Dhamtari. Similarly MSP-2 with (Pi2) at SGCARS Jagdalpur

and MSP-5 (Pi2 and Pi54) at RMDCARS Ambikapur and ICAR-IIRR, Hyderabad

showed moderately resistant reaction respectively.

In vitro evaluation of Ocimum leaf decoction, P. oryzae was tested against

three Ocimum species (O. sanctum, O. basilicum and O. gratissimum) by poisoned

food technique. Among the three different species of Ocimum, O. sanctum

inhibited maximum fungal growth i.e., 92.59 per cent (6.67 mm) and 96.67 per

cent (3.00 mm) in water and methanolic extract at 100 and 10% concentrations,

respectively.

Leaf extract of three Ocimum species were tested in UBN nursery method

against P. oryzae by foliar spray under in-vivo conditions. Of three Ocimum

species, O. sanctum reduced the blast disease under in-vivo conditions. The lowest

PDI was observed in O. sanctum @ 10% methanolic extract (29.26%) and it

showed non- significant difference with the tricyclazole which was recorded 28.52

per cent PDI of seven days after third spray.

NRrhlx<+ ds fofHkUu LFkkuksa ls dqy rhjlB ¼63½ iz/oal jksx ds uewus ,d= fd;s x, Fks

vkSj chekjh xaHkhjrk ntZ dh xbZ FkhA Lo.kkZ fdLe ¼txnyiqj½ ij 87-78 izfr”kr dh

mPpre ih-Mh-vkbZ ntZ dh xbZ vkSj lQjh ¼cLrj½ vkSj egs”ojh ¼lwjtiqj½ fdLe ij 20-

00 izfr”kr dh lcls de ih-Mh-vkbZ- ntZ dh xbZA bu ifj.kkeksa us ih-Mh-vkbZ- esa fHkUurk

dk ladsr fn;k] tks fofHkUu [ksrh izFkkvksa ds rgr ekSle] o’kkZ] HkkSxksfyd {ks= ls izHkkfor

FkkA

jksxtud v/;;u esa vyxko ¼vkblksysV½ ds chp cgqr fHkUurk feyhA urhts

crkrs gSa fd mPpre ih-Mh-vkbZ- 96-30 izfr”kr pkj vyx&vyx esa ntZ fd, x, Fks vkSj

de ih-Mh-vkbZ- 51-85 izfr”kr lksyg vyxko esa ik, x, FksA

iSFkksykftdy fHkUurk v/;;u esa] vyx&vyx tkWap ,p vkj&12 ds lkFk vkB

¼8½ estcku varjks ij vyx&vyx ewY;kadu fd;s x;s FksA iz/oal varjks ij vyxko ds

mxzrk esa cgqr fHkUurk ik;h x;hA iRrh iz/oal¼~>ksadk½ xaHkhjrk ds vk/kkj ij ih- vksjkbth

vyxko dks pkSng ¼14½ jksx tud jsl esa lewghd`r fd;k x;k FkkA vkbZ ,¼10 vyxko½

ds ckn] vkbZ ch¼2 vyxko½ vkSj vkbZ lh] vkbZ Mh] vkbZ th ¼1 vyxko½ vDlj lcls

vyx gqvkA

dYpjy fo”ks’krk esa fofo/krk] tSls dh ekblsfy;e ¼dodtky½ jax vkSj cukoV

dks vyxko ds chp ns[kk x;k FkkA fpduh lrg ds lkFk i`Fkd lrg dh rqyuk esa

vf/kd chtk.kq mRiknu fd;kA dksfufM;k vkSj Liks+++#ys”ku ds vkdkj esa fHkUurk ns[kh xbZ

ysfdu dksbZ Li’V dV lewg ugha ns[kk x;kA dksfufM;k DyLVj esa yEcs lsIVk] iryk

dksfufM;ksQksj mRikfnr gksrs gSA dodtky dh jsfM;y o`f/n dks 77 feeh ls 90 feeh

rd ds 14 fnuksa ds ckn Hkkik x;k FkkA

ekjQksykftdy v/;;u esa] vo/kkj.kkvksa dk dfu’B vkdkj ¼,y × MCY;w½ ij

ntZ fd;k x;k FkkA dksfufM;k dk vkdkj ik;jhQkeZ FkkA dksfufM;k dk vkdkj 28-0

ekbdzksu ls 11 ekbdzku rd Fkh vkSj pkSM+kbZ 3-5 ekbdzku ls 3-6 ekbdzksu rd FkhA

vkuqokaf”kd fofo/krk esa] cgq#irk dk irk yxk;k x;k Fkk fd rhjlB ¼63½ ih-

vksjkbth ds chp dqy pkj ¼4½ ,yhy dk vuqeku yxk;k x;k gSA ,eth,e&1 vkSj

,eth,e&21 esa nks&nks ,yhy ik, x,A ,eth,e&1 ds fy, ihvkbZlh ewY; 0-35 Fks vkSj

,eth,e&21 ds fy, 0-29 FkkA vyxko dks ,eth,e MsVk ds DyLVj fo”ys’k.k ds vk/kkj

ij nks DyLVj esa cakVk x;k FkkA iz/oal vyxko ds DyLVj fo”ys’k.k ls irk pyk gS fd

0-00 ls 1-0 dh lhek esa vkSlr tksMh+ leku lekurk,Wa] bl izdkj vyxko ds chp cMh+

fHkUurkvksa dk lq>ko nsrh gSA

iz/oal izfrjks/k v/;;uksa ds fy, izxfr”khy ykbuksa ds lR;kiu ls irk pyk fd]

,e,lih&1 vkSj ,e,lih&7 ¼ihvkbZ&1½] ,e,lih&3 vkSj ,e,lih&9] ,e,lih&14 vkSj

,e,lih&16 ¼ihvkbZ&54½] ,e,lih&6 vkSj ,e,lih&12 ¼ihvkbZ&1] ihvkbZ&2 vkSj

ihvkbZ&54½] ,e,lih&8 vkSj ,e,lih&13 ¼ihvkbZ&2½ vkSj ,e,lih&11 ¼ihvkbZ&1 vkSj

ihvkbZ&54½ ykbukas dk pkj LFkkuksa ij iz/oal jksx ds fy, iw.kZ izfrjks/kh izfrfdz;k fn[kkbZ

xbZ FkhA ,e,lih&4 ¼ihvkbZ 1 vkSj ihvkbZ 2½] ,e,lih&10 ¼ihvkbZ 1 vkSj ihvkbZ 2½]

,e,lih&15 ¼ihvkbZ 2½ thu d`f’k foKku dsUnz] /kerjh esa ekewyh izfrjks/kh FksA blh rjg

,e,lih&2 ¼ihvkbZ 2½] ,l-th-lh-,-vkj-,l- txnyiqj vkSj ,e,lih&5 ¼ihvkbZ 2 vkSj

ihvkbZ 54½ vkj,eMhlh,vkj,l vafcdkiqj esa vkSj vkbZlh,vkj& Hkk-pk-vuqla gSnjkckn esa

dze”k% ekewyh izfrjks/kh izfrfdz;k fn[kkrk gSA

rqylh iRrs ds vdZ ds bu&foVªks ewY;kadu esa] ih- vksjkbth dk tgj [kkn~;

rduhd }kjk rhu rqylh iztkfr;ksa ¼vks-lsUdVe] vks- csflfyde vkSj vks- xzsfVflee½ ds

lkFk ijh{k.k fd;k x;k FkkA rqylh dh rhu vyx&vyx iztkfr;ks esa ls] vks- lsUdVe us

dze”k% 100 izfr”kr vkSj 10 izfr”kr lkUnzrk ikuh vkSj esFksukWy nksuksa esa dod fodkl

vf/kdre 92-9 izfr”kr ¼6-67½ vkSj 96-67 izfr”kr ¼3-00 feeh½ dks izfrjks/k fd;kA

;w-ch-,u- ulZjh fof/k esa ih- vksjkbth ds f[kykQ rqylh iRrh vdZ ¼ikuh vkSj

esFksukfyd½ dk ewY;kadu rhu rqylh iztkfr;ksa ds lkFk bu&fooks fLFkfr;ksa ds rgr

Qksfy;j Lizs }kjk ijh{k.k fd;k x;k FkkA rhu rqylh iztkfr;ksa eas ls] vks- lsUdVe us

ih- vksjkbth ds fodkl dks bu&fooks fLFkfr;ksa ds rgr de dj fn;kA vks- lsaVe @ 10

izfr”kr esFksukfyd ¼29-26 izfr”kr½ esa lcls de ih-Mh-vkbZ ik;k x;k FkkA vkSj ;g rhljs

Lizs ds lkr fnu ckn 28-52 izfr”kr ih-Mh-vkbZ ntZ fd;k x;k Fkk] ftlesa

Vªkblk;Dyktksy ds lkFk xSj egRoiw.kZ varj fn[kkbZ fn;k FkkA

CHAPTER - I

INTRODUCTION

Rice (Oryza sativa L.) is one of the most important cereals of the world

and is consumed by 50% of the world population (Luo et al., 1998). In the world,

rice is cultivated in an area of 160.74 million hectares with annual production of

486.57 million metric tons and productivity 4.51 metric tons (USDA, 2017). It is

widely cultivated in India, China, Indonesia, Bangladesh, Vietnam, Thailand,

Myanmar, Japan, Philippines and Brazil. China is the leading rice producer

followed by India, Indonesia and Bangladesh in 2016-17. India was the largest

exporter of rice in 2016-17 followed by Thailand, Vietnam and USA. Developing

countries account for 95% of the total production, with China and India alone

responsible for nearly half of the world output. Rice provides 20% of the world’s

dietary energy supply followed by wheat and maize accounts 19% and 5%

respectively.

In India, Rice is cultivated in an area of 433.88 lakh hectares with a total

production of 104.32 Mt and productivity of 2404 kg/ha during 2016-2017

(Anonymous, 2016-17). Chhattisgarh, the central eastern state is also called as the

“Rice bowl of India”. The total area of rice in Chhattisgarh is 3.75 million ha with

production of 7.71 Mt and productivity is 2050 kg/ha during 2016-17

(Anonymous, 2017).

Rice crop suffers with many diseases caused by fungi, bacteria, viruses,

phytoplasma, nematodes and other non-parasitic disorders. Among the fungal

diseases, blast disease caused by Pyricularia oryzae Cavara is considered as a

major threat to rice production because of its wide spread distribution and its

destructiveness under favorable conditions. This disease was recorded from 85

countries (Hawksworth, 1990) and it is estimated to cause 14-18% grain yield

losses worldwide (Mew and Gonzales, 2002). The yield losses in rice due to pests

and diseases are estimated to be around 37% of which blast disease accounts to 14-

18 per cent.

Rice blast is caused by P. oryzae C. [synonym P. grisea (Sacc.) the

anamorph of Magnaporthe grisea (Hebert) Yaegashi and Udagawa], a filamentous

ascomycetes fungus infecting more than 50 hosts and it is one of the most

destructive and wide spread disease (Jia et al., 2000). Rice blast was first recorded

in China (Soong ying-shin, 1637) later from Japan (Tsuchiya, 1704). In India, the

disease gained importance when a devastating epidemic occurred in Thanjavur

(Tanjore) delta of Tamil Nadu during 1919 (Padmanabhan, 1965). The disease

results in yield loss as high as 70-80% (Ou, 1985).

Different breeding strategies are being adopted to increase the durability of

resistance in different rice-growing areas and these require knowledge on the

population structure of the pathogen. The population structure is considered to be

the amount of phenotypic and genotypic variation and can vary through time and

space as these populations evolve or adapt in response to environmental conditions

(McDonald & Linde, 2002).

Pathogenic variability in the target production area is a prerequisite for

identifying genotypes with a stable resistance to the variable pathogen populations.

It is important from an ecological, epidemiological and breeding perspective to

know how genetic diversity is maintained and how new, well-adapted complex

races arise in the pathogen population. In case of rice blast, there are several site-

specific differential sets and an international differential set have been developed

(Atkins et al., 1967; Ling and Ou, 1969; Ou, 1972 and Bonman et al., 1986).

The use of molecular markers have received much attention in the recent

past. The major advantage of the molecular markers over the conventional markers

lies in their ability to cover large portion of the crop genome and being able to

distinguish even more closely related varieties (Helentjaris et al., 1985). Resistance

to the pathogen is a classic gene-for-gene system, where a major resistance gene is

effective against P. oryzae strains containing the corresponding avirulance gene

(Silue et al., 1992). Twenty resistant genes have been identified by extensive

genetic studies (Chao et al., 1999., Mackill and Bonman, 1992., Yu et al., 1996).

Pi-b and Pi-ta, two major resistance genes, introgressed from indica cultivars, have

recently been molecularly characterized (Bryan et al., 2000., Inukai et al., 1994.,

Wang et al., 1999). Both Pi-b and Pi-ta encode predicted nucleotide binding site

type proteins that are characteristic of products of major resistance genes (Wang et

al., 1999, Bryan et al., 2000, Wise, 2000).

The fungus P. oryzae is considered highly variable and is composed of a

large number of physiological races or pathotypes. Breeding for blast resistance is

mostly based on observations on leaf blast, while the infection of greatest

economic importance occurs on the panicle (Bonman, 1992).

Several management strategies have been proposed and evaluated to

minimize the blast disease incidence. Cultural practices, host plant resistance and

the use of synthetic fungicides are the three strategies adopted to control rice blast

(Ghazanfar et al., 2009 and IRRI, 2010). Although the use of resistant cultivars are

known to be the most effective control strategy, it also carries certain issues

relating to development of pathogenic races. Thus the use of resistant cultivars is

limited to a certain place and time. Though, synthetic pesticides are an essential

input for preventing crop losses caused by phytopathogenic microorganisms

(Wheeler, 2002); and disease control depends primarily on the application of

synthetic chemicals, their extensive use is currently felt posing serious problem to

the life supporting systems due to their undesirable attributes such as phytotoxicity,

residual toxicity and environmental pollution including non-targeted organisms

(Satish et al. 2010). Further, contamination of soils that may lead to development

of crop pest population that are resistant to treatment with agrochemicals

(Wattanpayakul et al., 2011). Concern over the excessive use of pesticides led

researchers to select alternative methods that are environment-friendly and also

relatively inexpensive compared with chemical pesticides (Choi et al., 2004;

Tewari and Patra, 2006; Netam et al., 2011). Therefore, non-chemical pest control

method as an alternative for management of diseases, which are ecofriendly and

effective (Tewari and Patra 2006; Satish et al. 2010). Biologically active plant-

derived pesticides are expected to play an increasingly significant role in crop

protection strategies (Park et al., 2008a).

Ocimum sanctum L., commonly known as holy basil or tulasi and other

Ocimum species are aromatic plants in the family Lamiaceae which are widespread

as a cultivated plant throughout the Southeast Asia. Various Ocimum species are

cultivated for religious and medicinal purposes and for their essential oils. Tulasi

plants are known to have pathogen repellent properties, leaf powders were used

for management of plant pathogens and centuries in storage of grains (Olufolaji,

2015, Upadhyaya et al., 2012, Rout and Tewari, 2012 and Netam et al., 2011).

Chhattisgarh is mostly dominated by tribal community so they don’t follow

the high input intensive cultivation. Owing to small land holdings costly pesticides

cannot be used by them for controlling the crop pests. The alternate pest

management methods adopted mainly include use of indigenous technologies like

use of plant extracts and cultural methods for control of crop diseases.

In view of the importance of the crop and economic importance and

unsatisfactory control of the disease, considerable attention was given on the

detailed studies of development of resistant sources and evaluation of different

Ocimum species for the management of rice blast. Hence the present investigation

was planned with the following objectives.

1. To survey, collection and characterization of blast pathogen population from

different location of Chhattisgarh.

2. To multilocation evaluation of introgressed lines carrying blast resistance gene.

3. To evaluate the efficacy of Ocimum leaf decoctions for management of rice

blast.

CHAPTER - II

REVIEW OF LITERATURE

The literature available on blast disease of rice and various aspects related

to the present study on diversity of P. oryzae existing in different agro-climatic

regions of Chhattisgarh and sustainable management with different Ocimum spp.

have been reviewed in this chapter. The review of literature pertaining to this

study is presented in foregoing pages.

2.1The causal agent

The fungus P. oryzae Cavara (Anamorph: M. grisea (Cooke) Sacc. is the

causal agent of rice blast disease. The perfect stage M. grisea was earlier named

as Ceratosphaeria grisea (Hebert, 1971). Later Yaegashi and Nishihara (1976)

suggested the genus Magnaporthe.Yaegashi and Udagawa (1978) finally

proposed M. grisea as a perfect stage of P. oryzae Cavara instead of

Ceratosphaeria grisea.

Description of the culture according to Commonwealth Mycological

Institute (Hawksworth, 1990): Cultures greyish, conidiophores single or in

fascicles, simple, rarely branched, showing sympodial growth. Conidia formed

singly at the tip of the conidiophore at points arising sympodially and in

succession, pyriform to obclavate, narrowed toward tip, rounded at the base, three

septate rarely one or two septate, hyaline to pale olive, 19-23 x 7-9 µm, with a

distinct protruding basal hilum. Chlamydospores often produced in culture, thick-

walled, 5-12 µm diameter.

Nicholas (2003) reported production of fungal sexual fruiting bodies

called perithecia within 21 days. Perithecia are flask-shaped that carry asci

containing ascospores, the products of meiosis. Ascospores are arranged as

unordered octads or as larger populations of randomly selected ascospores.

2.2 Distribution

At present rice blast is distributed approximately in 85 rice growing

countries throughout the world. It was first reported as rice fever disease in China

by Soon Ying-Shin in 1637 (Ou, 1985), in Japan it was reported as Imochi-Byo

by Tsuchiya in 1704 (Ou, 1985). In Italy it was reported as Brusone by Astolifi

(1828) and in India it was first reported in Thanjavur delta of Tamil Nadu in 1919

(Padmanabhan, 1965). The disease is also a major problem in major rice growing

area of Chhattisgarh. The blast fungus can attack more than fifty other species of

grasses. It causes disease at seedling and adult stage on the leaves, nodes and

panicles.

2.3 Symptoms of rice leaf blast

The lesions or spots first appear as minute brown specks, then grow to

become spindle shaped pointed at both ends, several cm long and about 0.5 – 1.0

cm wide. The centre is greenish grey often showing a brownish margin. The size,

colour and shape of the lesions, however, vary with different climatic conditions

and also varietal response. Under favourable conditions on a susceptible cultivar

several greyish spots may appear, become larger and broader and coalesce,

leading to withering of the whole leaf (Padmanabhan, 1974).

During early growth stages symptoms are mainly found on leaves and

referred to as leaf blast (Ou et al., 1970). Leaf blast severity usually peaks around

maximum tilleting stage, followed by a gradual decline of the disease. This

gradual decline has been attributed to adult plant resistance (Torres, 1986; Yeh

and Bonman, 1986; Koh et al., 1987).

Hajimo, (2001) revealed about the symptoms of P. grisea purple spots on

young leaves, and changing into spindle shape which has a grey centre and purple

to brown border. Brown spots appeared only on older leaves or leaves of resistant

cultivars. In young or susceptible leaves, lesions coalesce and cause withering of

the leaves, especially at seedling and tillering stages. Infection to the neck results

formation of triangular purplish lesions followed by elongation on both sides of

neck. When young necks are infected, the panicles become white in colour and

later it caused incomplete grain filling and poor grain quality.

Ram et al. (2007) indicated that the Leaf blast fungus can attack the rice

plant at any growth stage and can cause severe leaf necrosis and impede grain

filling, resulting in decreased grain number and weight. When the last node is

attacked, it causes partial to complete sterility.

Castilla et al.( 2009) reported that the rice blast pathogen infect all the

above ground parts of rice plants at different growth stages, i.e., leaf, collar,

nodes, internodes, base or neck and other parts like panicle and leaf sheath. They

stated that a typical blast lesion on rice leaf is grey at the center with a dark

border and is spindle shaped.

Koutroubas et al. (2009) observed lesions as typically spindle-shaped on

leaves, wide at the center and pointed towards either ends. Large lesions usually

develop a diamond shape with greyish center and brown margin. Under

favourable conditions, lesions on the leaves expand rapidly and tend to coalesce,

leading to complete necrosis of infected leaves giving a burnt appearance from a

distance. On susceptible cultivars, lesions may initially appear greyish green and

water soaked with a darker green boarder and they expand rapidly to several

centimeters in length.

Prasad et al., (2011) reported that the neck blast infects the panicle that

causes failure of the seeds to fill or causing the entire panicle to fall over as it is

rotted. Infection of the necks can be very destructive and directly reduces the

economic value of the produce. The lesions are often greyish brown discoloration

of the branches of the panicle and over time, the branches may break at the lesion.

2.4 Economic importance

In India, Padmanabhan (1965) studied the relationship of yield with blast

incidence and found significant yield reduction. He showed 4% loss due to 4%

disease incidence. He made an attempt to estimate the yield loss during 1960-61

to be about 2, 65,000 tons. Rangaswamy and Subramanian (1957) reported 70%

yield loss in Tamil Nadu and similar yield loss was reported by Mathur et al.

(1964) in Uttar Pradesh. Losses of nearly 80% have been reported in certain years

in West Africa (Delassus, 1973). In India for the first time due to blast disease

yield loss estimate over 50% was observed by Mc Rae (1922). Cent per cent yield

reduction was recorded at Rampur, Nepal (Batsa and Tamang, 1983). Reddy and

Bonman (1987) estimated 1,40,000 tons yield loss from Andhra Pradesh, Tamil

Nadu and Karnataka states. Rice blast caused by P. oryzae is one of the

devastating disease of rice resulting in yield losses up to 65% in susceptible rice

cultivars. Ramappa et al. (2002) observed 76% reduction in grain yield when

infection occurred immediately after flowering. Mahesh et al. (2012) reported that

under traditional system of rice cultivation and in System of Rice Intensification

(SRI) methods, the damage of blast in terms of grain yield was recorded as 8.2

and 7.5% respectively.In 1952, Seventy five acre crop was completely destroyed

by blast in Deras Farm, Orissa, India. About 5-70% grain yield losses were

reported in Kashmir depending upon the stage of the crop infected and severity of

the disease (Bhat et al., 2013). In Rajasthan grain yield losses of 25.21 to 45.52 %

were recorded (Maheshwari and Sharma, 2013).

In abroad, several studies have reported that leaf, panicle and neck blast

disease incidences caused similar yield losses. The disease often results in a

significant yield loss, as high as 70-80% during an epidemic (Ou, 1985). Hai et

al., 2007 reported grain yield losses of 38.21 to 64.57 % due to neck blast in

Vietnam on susceptible rice varieties. Koutroubas et al. (2009) in Italy reported

reduced grain yield due to blast was from 22 to 26 %.In Brazil, yield losses as

high as 100 % (Prabhu et al., 2009) have been reported in upland rice varieties. In

Korea 8 % yield losses and 14 % losses in China and 50 to 85 % in the

Philippines have been reported (Saifulla et al., 2011).In Japan the yield losses of

20 to 100 % were reported by (Khush and Jena, 2009) and (Pinheiro et al., 2012).

In Iran, Pasha et al. (2013) reported yield reduction of 10-20 % in susceptible rice

varieties, but in severe cases the yield loss caused by rice blast may reach up to 80

%.Hence the yield losses due to blast disease have a direct impact on the welfare

of farm households as well as on the national economy.

2.5 Survey for disease incidence of rice blast

According to Verma and Sengupta (1985) survey for diseases of rice, the

principal cereal crop of Tripura, had led to the identification of as many as 17

diseases caused by fungi, bacteria, viruses and nematodes. The major diseases

were blast, brown spot and bacterial leaf blight.

Reddy and Bonman (1987) stated that, severe epidemics of blast caused by

P. oryzae have occurred recently on rice in India and Egypt. During the wet and

dry seasons of 1984 and 1985, Directorate of Rice Research survey teams

recorded severe blast in the states of Andhra Pradesh, Karnataka and Tamil Nadu.

Cultivars affected were IR 50 and improved locally developed NLR 9672,

Tellahamsa and TKM 9.

A simple rapid roving disease survey was carried out in three districts of

Karnataka viz., Bangalore rural. Sixty one per cent (61%) of rice blast incidence

was recorded in the surveyed villages of Hassan, Alur and Sakleshpur (Pawar et

al., 2000).

Hossain and Kulakarni (2001) conducted survey on blast of rice during

Kharif 1999 in different villages of Dharwad, Belgaum and Uttara Kannada

districts and reported maximum disease incidence in Haliyal (61.66%) and

Mundagod (54.00%) talukas of North Karnataka.

Puri et al. (2006) stated that, the higher blast PDI at dough stage (30.45%)

followed by booting stage (29.77%) and tillering stage (15.4%) in low land rice

growing areas.

Mukundvariar et al. (2006) reported in Andhra Pradesh BPT- 5204 suffers

with moderate blast severity because of use of nitrogen fertilizers above the

recommended doses.

Anwar et al. (2009) conducted survey in temperate districts of Kashmir

revealed that leaf blast severity ranged from 3.7 to 41.3%. Highest node blast was

found in Kulgam (7.3%) followed by Khudwani (5.4%) and Larnoo (3.8%) zones

of Anantanag district. The most destructive phase of neck blast severity was found

in every district with an average range of 0.3-4.9%.

Shahijahandar et al. (2010) recorded prevalence and distribution of blast in

Kupwara district of Jammu and Kashmir and reported 25% disease incidence and

15% severity and the incidence was more from transplanting to panicle initiation

stage.

In Andhra Pradesh and Telangana states during 2013-14 the mean blast

PDI was recorded as Krishna Zone with 55.33%, in Godavari Zone 53.13%, in

North Coastal Zone 46.17%, in Southern Zone 55.97%, in Scarce Rain fall Zone

61.48%, in Northern Telangana Zone 54.80%, in Central Telangana Zone 52.39%

and in Southern Telangana Zone 51.81% (Ramesh et al., 2017).

Incidence and severity of blast disease of rice was recorded by Hossain et

al. (2017) in ten agro-ecological zones (AEZs) of Bangladesh during Boro

(November to May; irrigated ecosystem) and Transplanted Aman (July to

December; rain fed ecosystem) seasons. Disease incidence and severity was

higher in irrigated ecosystem (Boro season) (21.19%) than in rain fed ecosystem

(Transplanted Aman season) (11.98%) regardless of locations (AEZs). It was as

high as 68.7% in Jhalak hybrid rice variety followed by high yielding rice cultivar

BRRI dhan47 (58.2%), BRRI dhan29 (39.8%), BRRI dhan28 (20.3%) during

Boro and in BRRI dhan34 (59.8%) during T. Aman season.

2.6 Pathogenicity test of P. oryzae

Boza et al. (2006) studied the race pattern of nine isolates of P. grisea.

The seedlings of thirty three rice varieties were spray inoculated with conidia

(2.0×105) of rice blast pathogen at 3-4 leaf stage. Two per cent Tween- 20 was

added to 50-100 ml of inoculum as a sticking agent. After inoculation the plants

were placed in a dew chamber at 100% relative humidity at 21-220C for 24 h.

Plants were then transferred to green house at 28-300C for 6-7 days and scored for

disease reaction using a qualitative and quantitative rating scale of 0-9.

Saifulla et al. (2011) was proved the pathogenicity of P. oryzae on

Basmati C-622 rice variety. Two to three seeds were sown in pots. Spore

suspension was made in sterile distilled water and spore concentration was

adjusted to 106spores ml

-1 with the help of haemocytometer. Three weeks old

plants in plastic bags were inoculated with P. oryzae using a hand sprayer and

kept at 300C for one week. Diseased leaves were collected and the pathogen was

re-isolated, purified and stored at 50C on potato dextrose agar plates.

Ghatak et al. (2013) measured the components of aggressiveness of

isolates originating from leaves and necks. Infection efficiency, latent period,

sporulation intensity and lesion size were measured on both leaves and necks.

Univariate and multivariate analyses indicated that isolates originating from

leaves were less aggressive than isolates originating from necks, when

aggressiveness componentswere measured on leaves as well as on necks,

indicating that there is no specialization within the pathogen population with

respect to the type of organ infected.

2.7 Pathogenic diversity of P. oryzae

Pathogenic diversity in the target production area is a prerequisite for

identifying genotypes with a stable resistance to the variable pathogen

populations.It is important from an ecological, epidemiological and breeding

perspective to know how genetic diversity is maintained and how new, well-

adapted complex races arise in the pathogen population. Information on the

pathogen population structure, such as the type of variants present in a location,

the amount and distribution of variation assist plant breeders in developing for

resistance breeding and deployment of resistant cultivars (Atkins et al., 1967.,

Ling and Ou, 1969., Ou, 1972 and Bonman et al., 1986), Extensive work has been

done with rice blast and detailed pathogenic variation has been reported from

single spores originating from single lesions and monoconidal subcultures (Ou

and Ayad, 1968., Ou et al., 1970).

Rice blast fungus, Pyricularia grisea from two weed hosts Digitaria

ciliaris and D. marginata and pathogenicity was confirmed on cross inoculation

to rice plants. By inoculating on the international blast differentials the race of

weed hosts was found to be identical to the race (IC – 12) which infects rice plant

(Srinivasprasad et al., 1998).

Chen et al., (2001) tested the pathogenicity reactions of 792 M. grisea

isolates of rice using 13 host differentials consisting of six indica and seven

japonica near-isogenic lines (NILs) and identified that 48 pathotypes with the

indica NILs, 82 pathotypes with the japonica NILs, and a total of 344 pathotypes

with both indica and japonica NILs and concluded that large differences in

distribution of the pathotypes occur among the different rice growing areas of the

world.

119 isolates of M. grisea from north-western Himalayan region were

grouped into 52 pathotypes on the basis of disease reaction on international

differential rice lines and proved the set was inadequate to characterize the

pathogen population (Sharma et al., 2002). Singha and Maibangsa (2003)

reported the dominant race groups of M. grisea in India race were group ID-1 and

IC-7.

Muralidharan et al. (2004) studied the performance of BL 245 with two

resistance genes (Pi-2 and Pi-4) and C101LAC (Pi-1) comparable to A57. The

performance of these NILs was marginally superior to the resistant checks are

Tadukan, Rasi, Tetep and IR 64 and the international blast differential Raminad

Strain 3. Alleles for the genes identified as effective and durable.

Padmavathi et al. (2005) studied the identification of blast resistance

genes in rice, mode of inheritance and allelic relationship of genes for blast

resistance against the Directorate of Rice Research (DRR) isolate. The donors

with unknown genes, i.e. Carreon and CNM4140 were crossed with the donors of

known genes, i.e. Dular, Tetep, Zenith and Tadukan and with susceptible check,

CO 39. Crosses were also made among the donors with known genes to confirm

the allelic relationship. The inheritance pattern of resistance genes in donors when

crossed with CO 39 indicated the presence of monogenic dominant gene. CNM

4140 when crossed with Dular, Tetep, Zenith and Tadukan segregated in 15:1

(resistant:susceptible) in F2 generation, indicating the involvement of different

genes governing resistance against the DRR isolate. The allelic test revealed that

Carreon, Dular and Tetep possessed the same gene (Pi-k), while Zenith, CNM

4140 and Tadukan have different genes.

Silva et al. (2011) used additional differentials (BRS Jaburu, BRS Taim,

BRS Biguá, BR IRGA-417, Epagri 109, Javaé, Metica-1 and Supremo) in

addition to the international set to determine the pathogenic diversity of 193 P.

oryzae isolates collected during 1994-2002 from irrigated rice cultivars in Brazil.

From 193 P. oryzae isolates 38 pathotypes were identified based on leaf blast

reactions of international set and 29 pathotypes based on these additional

differentials. The predominant pathotypes (TI-1, TG-2, TD-15 and TF-2) were

represented by 53% of the tested isolates. The major international pathotypes (IB-

45, IB-41, II-1 and ID-13) were represented by 43% of the isolates tested. The

virulence pattern of 28 isolates belonging to the pathotype IB-45 was further

differentiated into nine local pathotypes using additional set of differentials.

Karthikeyan et al. (2013) carried out virulence characteristic analysis and

identification of new pathotypes of rice blast fungus (M. grisea) from India during

2001-03. During the pathotyping analysis in 2001, 15 new pathotypes were

identified among the 49 Kerala strains. During 2002, 14 pathotypes were

identified among 26 Tamil Nadu strains and 9 pathotypes were identified among

22 Karnataka strains and in the year 2003, 100 M. grisea strains collected from

other states of India, from that 17 pathotypes were identified.

Tanaka et al., 2016 collected 310 rice blast (P. oryzae Cavara) isolates

from Japan showed wide variation in virulence. Virulence on rice differential

varieties (DV) harboring resistance genes Pish, Pia, Pii, Pi3, Pi5(t), Pik-s and

Pi19(t) ranged from 82.9 to 100.0%. In contrast, virulence on DV possessing Pib,

Pit, Pik-m, Pi1, Pik-h, Pik, Pik-p, Pi7(t), Pi9(t), Piz, Piz-5, Piz-t, Pita-2, Pita,

Pi12(t) and Pi20(t) ranged from 0 to 21.6%. Cluster analysis using the reaction

patterns of the DV classified isolates into three groups: I, virulent to Pik, Pik-h,

Pik-p, Pik-m, Pi1and Pi7(t); IIa, avirulent to the preceding 6 genes and virulent to

Pia, Pii, Pi3, and Pi5(t) and IIb, avirulent to all 10 genes. Group I was limited to

northern Japan and group IIb to central Japan, while group IIa was distributed

throughout Japan and estimated that group IIa represents the original population

and that groups I and IIb arise from it through minor changes in pathogenicity.

2.8 Isolation, Identification and Maintenance of P. oryzae

Padmanabhan et al., 1970 collected the P. grisea isolates from diseased

leaves, necks, and nodes of the infected rice plant on oat meal agar (OMA) with

traces of biotin and thiamine (B and T). Cultures were purified by dilution method

and single spore isolates were grown and multiplied on OMA + B and T at 250C

Bonman et al. (1987) collected and isolated blast pathogen from Infected

rice leaves by placing each lesion in a moist petri dish and incubated at 25ºC until

sporulation. Conidia from the lesion surface were spread on to water agar and the

germinating conidium was isolated and transferred to agar slants.

Correa et al. (1993) collected leaves and panicles infected with rice blast

from rice cultivars obtained from germ plasm bank at the Centro Internacional de

Agricultura Tropical (CIAT) and the International Rice Research Institute (IRRI).

They derived cultures from either mass or single conidial isolates obtained from

single lesions. Cultures were maintained on V8 juice agar and multiplied for

inoculations on rice-polish agar at 28ºC under continuous light. They stated that

M. grisea expressed its virulence spectrum irrespective of geographical location.

The panicles with the symptoms of neck blast, washed once with sterile

distilled water and placed on moist filter paper in petri dishes at room temperature

to induce sporulation. Conidia from the lesion surface were spread onto 3% water

agar with a sterile loop and incubated overnight. Single germinating conidium

was isolated and transferred to potato dextrose agar (Xia et al., 1993).

Silva et al.(2009) reported that the eight samples of rice leaves infected

with blast were collected from commercial fields of upland rice cultivars in the

state of Goias, Brazil. Mono-conidial isolates were obtained by directly

transferring one conidium per lesion on 5% water agar from two to three lesions

per leaf. The majority of the cases isolates from panicles were obtained from one

conidium per panicle. The collected isolates were conserved on sterilized filter

paper discs in a freezer at -20 ± 1ºC.

In Guilan province of Iran, blast affected leaves of rice cultivars were

collected from rice fields. Leaf pieces with lesions were surface sterilized with

0.5% sodium hypochlorite solution, washed with sterile distilled water and placed

on potato dextrose agar in petri dishes at 25ºC for 2–3 days. Later, petri dishes

were incubated at 25ºC in the dark or artificial fluorescent light on a 12 h

light/dark photoperiod for 15–25 days. Mono-conidial isolates of the recovered

fungi were maintained on half-strength potato dextrose agar slants in test tubes as

stock cultures (Motlagh and Javadzadeh, 2010).

Blast disease samples were collected and surface sterilized with 0.1%

mercuric chloride for 1 min and placed over clean glass slides kept in sterile petri

dishes padded with moist cotton. The petri dishes were incubated for 48 h at room

temperature (28±2°C). The causal organism was identified as P. oryae based on

the spore morphology (Vanraj et al., 2013).

Akator et al., 2014 isolated P. oryzae isolates by incubating the 1-1.5 cm

lesions on water agar at 28 0C for 24 hrs. Single colony of spores observed on

white agar were transferred to a medium composed of 20 g agar, 10 g starch, 2 g

yeast extract and 1000 ml of water for pureculture.

Onega et al., 2015 collected a total number of 88 isolates from East

African countries Rwanda, Uganda and Tanzania on V8 juice agar. For long term

storage, each culture was overlaid with several sterilized filter paper sections and

incubated at 250

C. After 10-15 days filter paper discs were dried on sterilized

petriplates and stored at -200C.

2.9 Cultural and morphological diversity of P. oryzae

Nishikado (1917) studied the morphology of P. grisea spores which

measured 16–33 x 5–9 μm. Usually 22–27 x 7–8 μm with a small basal

appendage, other dimensions were basal appendage 1.2–1.8 (1.6) μm in width,

basal cell 4.8–11.5 (7.8 μm), middle cell 1.8–11.5 (6.6 μm), apical cell 6–14 (7)

μm in length.

Tochinai and Shimamura (1932) classified 39 isolates into nine forms on

the basis of cultural characteristics. On steamed rice straw, the conidia of the

isolates belonging to four forms were short, the mean value ranged from 19.3 to

22.8 μm. The conidia of other five forms were long, the mean value ranged from

26.8 to 29.9 μm. All isolates from the affected spikes or glumes of rice plants

were of the long conidium type, while most isolates from the nodes were of the

short conidium type. This suggests that considerable difference in the length of

conidia among the isolates of Pyricularia on rice.

Ramakrishnan (1948) studied the linear growth of the colonies of the

Pyricularia isolated from rice was measured on standard medium agar, oat meal

agar, french bean agar and decoction agar made out of the leaf material of rice.

Lilly and Barnett (1951) reported that the growth in fungi follows a

definite pattern and they observed the onset of autolysis after the maximum

growth during which cellular enzymes going to digest the various cell

constituents.

Aoki (1935) observed the growth of 16 isolates of P. grisea which was

measured on potato dextrose agar with the average length of the isolate ranging

from 21.2 to 28.4 µm and the average width ranging from 7.3 to 9.0 µm.

The dimensions of conidia produced by P. oryzae ranged from 17.6 to

24.0 µm in length and 8.0 to 9.6 µm in width (Veeraraghavan and Padmanabhan,

1965). The pathogen from rice grows luxuriantly on oat-meal, potato dextrose,

ragi-meal agar medium at pH of 6.9 and temperature 30°C (Kulkarni and

Govindu, 1976).

Most of the works on sporulation and conidial release from blast lesions

on rice have been conducted during the leaf blast stage (Kato and Kozaka, 1974)

and this was probably due to the importance of primary inoculum potential of leaf

blast lesions to neck blast development. Perezsendin et al. (1982) recorded 30°C

as the optimum temperature for sporulation of M. grisea from rice. Sporulation of

M. oryzae and disease progress was favored by high relative humidity (>89%),

optimal temperature (25-28°C) and a minimum of 4 h of leaf wetness (Teng,

1994).

The effect of 17 media on 41 isolates of P. oryzae was studied by Sun et al.

(1989).They found that corn meal and rice straw agar media were most conducive

for sporulation. Awoderu et al.(1991) revealed that the greatest linear growth of

P. oryzae on potato dextrose agar, while conidial production was greatest on 1 per

cent soluble starch yeast extract agar.

Kumar and Singh (1995) studied about the P. grisea isolated from rice on

different solid culture media and found that maximum colony diameter of rice

isolate occurred on malt extract agar and Leonin agar.

Kim (1994) reported that conidiophores and first conidia were produced 4

to 6 h after dew formation and released shortly thereafter under optimal

conditions. Sporulation of P. grisea from rice is favored by relative humidity

≥89%, optimal temperature of 25-28°C and a minimum of 4 h leaf wetness.

Studies by Kim and Yoshino (2000) on the sporulation pattern of rice blast

fungus by detaching lesion bearing leaves revealed that more conidia were

produced on the ad axial than on the ab axial leaf surfaces and sporulation

intensity was higher on the intact lesions than on those from which conidia and

conidiophores were removed previously.

In mycelium, culture was first hyaline in colour then changed to

olivaceous, 1–5.2 μm in width, septate and branched. The spore measurements

were 15–22 μm x 4–7 μm (Average, 17.4 μm x 5.2 μm). Among the non synthetic

media, potato dextrose agar supported maximum radial growth (85.00 mm), next

was host extract + 2 per cent sucrose agar medium (80.33 mm) followed by oat

meal agar (75.00 mm) (Hossain, 2000).

Colony colour of all the rice blast (P. grisea) isolates was usually buff

with good growth on oat meal agar, greyish black with medium growth on host

seed extract + 2% sucrose agar, the raised mycelial growth with smooth colony

margin on potato dextrose agar and raised mycelium with concentric ring pattern

on Richard’s agar medium. On host seed extract + 2% sucrose agar all the blast

pathogenic isolates showed black to greyish black colour with smooth colony

margin and good growth (Meena, 2005).

Bussaban (2005) worked on molecular and morphological characterization

of Pyricularia and allied genera that in most of the Pyricularia species, two

species of Dactylaria that have obpyriform conidia with high bootstrap support.

Pyricularia variability was more related to Dactylaria, Tumularia or Ochroconis

species than to the Magnaporthaceae. Dactylaria and species of Nakataea,

Ochroconis, Pyriculariopsis and Tumularia were distinct from the

Magnaporthaceae, and the genus Dactylaria is polyphyletic. The characters, spore

morphology and ITS ribosomal DNA sequences data suggested that conidial

shape a primary character to distinguish Pyricularia from allied genera.

Ram et al. (2012) found isolates of the fungus from different hosts

differed in their response in media for mycelial growth and sporulation. Radial

mycelial growth and days of sporulation of P. grisea were studied by culturing

three fungal isolates from rice, finger millet and Panicum sp. on six different

media: prune agar (PA), oat meal agar (OMA), potato dextrose agar (PDA),

finger millet leaf decoction agar, finger millet polish agar (FPA) and finger millet

meal agar.

Moghaddam and Soltani (2013) evaluated the three fungal culture media,

i.e. PDA, PCA and WA, based on which P. oryzae sporulation inducers like rice

polish, rice extract or rice leaf segments could be added and evaluated both for

vegetative growth and sporulation. Mycelial growth was measured after 11 days,

but sporulation was tracked on the 10th, 20th and 30th day after incubation at

26ºC. The findings indicate that PDA culture medium could provide the best

medium for P. oryzae vegetative growth, regardless of light condition.

Vanaraj et al. (2013) studied culturing of different isolates of P. oryzae

and reported that colonies of P. oryzae appeared as white on oat meal, ricepolish

and malt extract agar, grey on potato dextrose agar and whitish grey on rice agar.

Blast fungal isolates produced ring like, circular, irregular colonies with

rough and smooth margins on oat meal agar media having buff colour, greyish

black to black colour (Srivastava et al., 2014).

Gashaw et al.(2014) reported the colony diameters of different groups

ranging from 67.40 to 82.50 mm and the conidial shape of the different groups

was pyriform (pear-shaped) with rounded base and narrowed towards the tip

which is pointed or blunt. On oat meal agar, colony colour of all the isolates was

usually grey with good growth. All the isolates showed raised mycelial growth

with smooth colony margin.

Asfaha et al. (2015) observed optimum growth and good sporulation of P.

oryzae isolates on oat meal agar when compared with other media i.e. rice flour

agar, malt extract agar and potato dextrose agar.

Twenty isolates of M. oryzae and categorized based on the variation in

morphological characteristics viz., colony colour, surface appearance and type of

growth. The isolates produced little surface, downy, flat with little mycelium and

submerged growth with smooth and rough margins on OMA media. The colony

colour varied from grey, greyish white, dark black, blackish white and greyish

black. The colony diameters of different isolates varied from 27.0 mm to 48.0

mm. Similarly, most of the isolates were smooth and few were rough in colony

appearance. Among twenty isolates, maximum isolates have shown flat with little

mycelium growth followed by little surface and downy growth. Only three

isolates were found to display submerged type of growth (Panda et al., 2017).

2.10 Molecular diversity of rice blast isolates

The breakdown of blast resistance of the two selections 11348 and 10998

reported was first time by Thomas (1941). The existence of races of P. oryzae

differing in pathogenicity was first noticed by Sasaki (1923) who ascertained that

rice cultivars resistant to strain A were severely infected by strain B. By about

1960, 12 cultivars were selected as differentials, two tropical, four Chinese and

six Japanese in origin. Goto (1960 and 1965), thirteen pathogenic races were

identified and classified into these groups called T, C and N.

The standardization of the international race numbers of P. oryzae was

proposed by Ling and Ou (1969). The system consists of a dichotomous

arrangement of susceptible and resistant reactions of the differential varieties and

therefore race numbers can be determined without referring to a race chart.

Hamer et al. (1989) reported a family of dispersed repetitive DNA

sequences known as M. grisea repeat (MGR) elements and this has been used

foranalyzing the population structure of rice-infecting M. grisea in various

countries (Levy et al., 1991., Han et al., 1993., Levy et al., 1993., Shull and

Hamer, 1994., Chen et al., 1995., Zeigler et al., 1995., Kumar et al., 1999.,

Correll et al., 2000 and Xia et al., 2000).

George et al. (1998) developed a pair of primers amplify Pot (P. oryzae)

transposable elements (Kachroo et al., 1994) present in the genome of M. grisea

facilitated the characterization of population into clonal lineages.

Brondani et al. (2000) isolated seventy two DNA clones containing

microsatellite repeats and sequenced in order to develop a series of new PCR-

based molecular markers to be used in genetic studies of the fungus. Twenty-four

of these clones were selected to design primer pairs for the PCR amplification of

microsatellite alleles. Single spore cultures of M. grisea isolated from rice and

wheat in Brazil, Colombia and China were genotyped at three microsatellite loci.

Isolates from southern Brazil were predominantly monomorphic at the tested SSR

loci, indicating a low level of genetic variability in these samples. However,

seven alleles were observed at the MGM-1 locus in isolates from Central Brazil

and at least nine alleles were detected at the same locus in a sample of Colombian

isolates. Polymorphism analysis at SSR loci is a simple and direct approach for

estimating the genetic diversity of M. grisea isolates and a powerful tool for

studying M. grisea genetics.

Gupta and Varshney (2000) studied that the microsatellites or SSR

markers are tandemly repeat DNA sequences occur throughout the eukaryotic

genome on the other hand represent the locus specific, highly polymorphic, multi-

allelic and co-dominant marker systems which have been proved the markers of

choice in plant genetics and breeding applications. Generation of SSR markers is

a time consuming, labour intensive and expensive task. Several SSR (Brondani et

al., 2000., Kim et al., 2000., Kaye et al., 2003 and Suzuki et al., 2009) and

minisatellite markers (Li et al., 2007) have already been developed for M.grisea.

Chadha and Gopalkrishna (2005) reported that the genetic relatedness and

probable mechanisms of genetic variation among the Indian isolates of rice blast

pathogen by using 171 polymorphic markers were scored using 33 selected

random decamer primers. They concluded that isolates exhibited polymorphism

of about 64% and similarity degree value ranged from 0.76 to 0.92.

Zheng et al. (2008) investigated 446 simple sequence repeat (SSR) loci

and developed 313 SSR markers which showed polymorphism among nine

isolates from rice (including a laboratory strain 2539). The number of alleles of

each marker ranged 2–9 with an average of 3.3. The polymorphic information

content (PIC) of each marker ranged 0.20–0.89 with an average of 0.53. Using a

population derived from a cross between isolates Guy11 and 2539, a genetic map

of M. grisea was constructed consisting of 176 SSR markers. The map covers a

total length of 1247 cM, equivalent to a physical length of about 35.0 Mb or 93%

of the genome with an average distance of 7.1 cM between adjacent markers. A

web-based database of the SSR markers and the genetic map was established.

Suzuki et al. (2009) evaluated several SSR markers reported by Kaye et

al. (2003) among contemporary M. grisea isolates from Japan, but polymorphisms

were rarely observed except for a few markers and the main reason is probably

that field isolates collected from Japan in recent years have a genetically similar

relationship and belongs to a limited number of lineages.

The molecular characterization of isolates was done by employing the rep-

PCR analysis with two primer sequences from Pot2. The genetic analysis of 538

isolates showed a high genotypic diversity in both leaf and panicle pathogen

populations with 103 haplotypes in Bonança and 49 in Primavera. The migration

of pathotypes from leaves to panicles in each field was 70.8% and 36.6% for

Primavera and BRS Bonança, respectively. The diversity of M. oryzae population

was influenced by cultivar of origin (Silva et al., 2009).

Population dynamics of 226 isolates of M. oryzae was studied by Le et al.

(2010) in the Mekong Delta in Vietnam based on the transposable elements Pot2

and MGR586 in the genomes supported that the pathogenic races were critically

variable in comparison with the genomic diversity.

Eleven polymorphic SSR markers with good fit of 1:2:1 ratio for single

gene model in F2 population derived from the cross of Pongsuseribu 2 (Resistant)

and Mahsuri (Susceptible). Rice cultivars were analyzed in 296 F3 families

derived from individual F2 plants to investigate association with Pi gene

conferring resistance to M. oryzae pathotype. They concluded that SSR markers

(RM413, RM5961, RM1233 and RM8225) were significantly associated with

blast resistance to pathotype 7.2 of M. oryzae in rice (Ashkani et al., 2012).

Genetic diversity of M. grisea isolates was evaluated by Mohan et al.

(2012) using 12 microsatellite primers and the PIC values were estimated for all

the markers, a high PIC value of 0.60 was observed with MGM - 21 and a low

PIC value of 0.24 was observed with MGM - 24, while the Pot2 primer displayed

a PIC value of 0.26.

Karthikeyan et al. (2013) assembled 600 leaf and neck-blast infected rice

samples from several states of India. One hundred and ninety-eight (198) rice

strains of M. grisea were pathotyped with 9 rice near-isogenic rice lines (NILs) in

field plots of a blast nursery using standard inoculation and disease scoring

methods. Several patterns of virulence were observed among the rice strains.

During the pathotyping analyses carried out in the year 2001 and 15 new

pathotypes were identified among the 49 Kerala strains pathotyped. During 2002,

14 pathotypes was identified among 26 Tamil Nadu strains and 9 pathotypes were

identified among 22 Karnataka strains and in the year 2003, 100 M. grisea strains

collected from other states of India, from that 17 pathotypes were identified.

Motlagh et al. (2015) evaluated the genetic diversity of P. grisea by using

14 microsatellite primers. Primer SSR43, 44 had the most polymorphic

information content (PIC = 0.85), observed number of alleles (na = 8), effective

number of alleles (ne = 3.76), Nei’s expected heterozygosity (Ne = 0.861) and

Shannon’s information index (I = 1.38). This marker was the best primer between

14 used primers for evaluating the genetic diversity of P. grisea. Cluster analysis

was carried out with simple matching similarity matrix and UPGMA method. The

results showed that these isolates were classified into 3 lineages by cutting off the

dendrogram at 0.76 similar linkage levels.

Genetic diversities studies for major rice blast resistance genes were made

in 192 rice germplasm accessions using simple sequence repeat (SSR) markers.

The genetic frequencies of the 10 major rice blast resistance genes varied from

19.79% to 54.69%. Seven accessions IC337593, IC346002, IC346004, IC346813,

IC356117, IC356422 and IC383441 had maximum eight blast resistance genes,

while FR13B, Hourakani, Kala Rata 1-24, Lemont, Brown Gora, IR87756-20-2-

2-3, IC282418, IC356419, PKSLGR-1 and PKSLGR-39 had seven blast

resistance genes (Singh et al., 2015).

2.11Multilocation Trial for Blast Resistant Lines

The significant effect of genotype and environment interaction might

suggest that genotypes possess different resistant genes and structures of the

population, in terms of virulence genes varied across different locations

(Kulakarni and Chopra, 1982).

Dissanayake (1994) studied on frequent appearance of M. grisea races

leading to development of heterogeneous blast populations. These studies showed

differential reaction of rice varieties for blast at different locations indicating the

presence of blast races with varying levels of virulence at different locations.

Establishment and maintenance of multilocation blast screening nurseries to

represent different agro climatic regions provide a practical means of selecting

elite lines with broad spectrum resistance leading to improving the durability of

blast resistance in cultivated varieties.

The effects and multiplicative interaction models which are widely used

for analyzing main effects and genotype by environment (G×E) interactions in

multilocation variety trials. They gained insight interaction into G×E in rice blast

and identified genotypes with high and stable resistance to the disease (Abamu et

al., 1998).

Rice genotypes carrying resistance genes to blast disease were evaluated

by Muralidharan et al. (2004) in multi-environment tests (METs). Tadukan

carrying resistance gene Pi-ta showed small lesions infecting < 2% leaf area

indicating a very high level of durable resistance to blast disease. The METs

clearly demonstrated the expression of a high degree of resistance in A57 carrying

three resistance genes (Pi-1, Pi-2 and Pi-4). A57 was identified as the best line

that exhibited resistance to blast across the country in all rice growing

environments, irrespective of ecosystems. The performance of BL 245 with two

resistance genes (Pi-2 and Pi-4) and C101LAC (Pi-1) was comparable to A57.

The performance of these NILs was marginally superior to the resistant checks

(Tadukan, Rasi, Tetep and IR 64) and the international blast differential Raminad

Strain 3.

The screening revealed that none of the test lines was immune or highly

resistant. One line IR-70181-1-1-1 of course type was found to be resistant. Nine

lines of the course type displayed moderately resistant response, while none of the

fine type lines showed this response. Seventy seven lines of thirty five of the

course and forty two of the fine displayed susceptible response toward the disease

were found to be moderately susceptible. Twenty four lines of fine rice showed

susceptible to highly susceptible response (Ghazanfar et al., 2009).

Near Isogenic Lines (NILs) harboring different blast resistant Pi genes

were surveyed for blast resistance along with resistant and susceptible

varieties.These genotypes were randomly crossed to transfer disease resistance to

agronomically superior varieties ADT 43,Improved White Ponni and BPT5204.

Disease reaction was recorded in both artificial as well as natural epiphytotic

conditions. The minimum blast incidence was observed in F1s of ADT

43/CT13432-3R, ADT 43/C101A51 and ADT 43/C101LAC across the

environments. Advanced back crossinbred lines developed from the cross

combination of ADT 43/CT13432-3R were also screened against blast disease.

Genepyramided back cross lines exhibited higher resistance thansusceptible

genotypes. Among the genotypes tested underepiphytotic conditions at different

environments, lines withgene combinations Pi1+Pi2+Pi33+Pi54 and

Pi1+Pi2+Pi33 were highly resistant to blast disease than those withsingle genes

indicating that these non-allelic genes have a complementary effect (Divya et al.,

2014).

Ramesh B. S. et al. (2015) verified introgressed lines for blast resistance

and revealed that, the introgressed lines (ILM-16 and ILM-29) with gene

pyramiding of three genes (Pi1, Pi2 and Pi54) showed complete resistant reaction

at all different locations. The introgressed lines (ILM-10, ILM-11, ILM-15 and

ILM-30-4) with two resistance genes (Pi1 and Pi2) showed moderately resistant

reaction. The introgressed line (ILM-30) with two resistance genes (Pi2 and Pi54)

showed moderately resistant reaction at three different locations.

2.12 Evaluation of Ocimum Leaf Decoction for Management of

Rice Blast

Amadioha (2000) tested the oil, ethanol and cold water extracts of neem

compared favourably with carbendazim at 0.1% a.i. in controlling the pathogen in

vitro and in vivo. Neem appears to have the potential to be used for managing rice

blast in the field.

Netam et al. (2011) observed the efficacy of plant extracts for the control of

(Pyricularia grisea) blast of rice under field condition of Bastar, Chhattisgarh that

the five plant part extracts viz., mahua leaf extract (Madhuca indica), Kurchi leaf

extract (Holarrhena antidysenterica), Garlic bulb extract (Allium sativam), van

tulsa leaf extract (Hiptis suaveolens) and neem leaf extract (Azadirachta

indica) were evaluated their efficacy against leaf and neck blast of rice (variety,

swarna). Ediphenphas50EC was used for standard check fungicide for

comparison. The results concluded that the garlic bulb extract @20ml was found

significantly more effective as an alternative to conventional chemical fungicide.

Rout and Tewari (2012) observed the amalab-e, a formulated botanical

product potential against rice blast incitant P. grisea that the bioassay test

conducted through standard conidial germination exhibited MIC of A. marmelos

extract at 0.1% and mycelial growth at 1%, whereas, the combined formulated

product registered MIC at 0.01% and at 1% respectively.

Upadhyaya et al. (2012) studied on the integrated management of foliar

blast through ecofriendly formulated product, Oscext-e developed from Ocimum

sanctum ethanolic extract combined with a formulating agent (coded Bþ) that the

formulated product retained its fungitoxicity until 24 months storage period in all

treatments. In a separate test of the product in greenhouse and field conditions, it

was not only found to effectively reduce the foliar blast of rice crop but also found

comparable with a standard fungicide carbendazim.

Gurjar et al. (2012) stated about volatile oils, which often contain the

principal aromatic and flavouring components of herbs and spices, have been

recommended as plant based antimicrobials to retard microbial contamination and

reduction in spoilage of food commodities

Upadhyaya and Tewari (2013) worked on the Oscilene-e, an ethanolic

extract producted from O. sanctum L. leaves as biofungitoxicant in the

management strategy of rice blast disease that the mycelial growth was

completely inhibited at 0.1 percent concentration of the product, Oscilene-e. This

formulated product retained its fungitoxicity in conidial germination distortion

even after storage period of 24 months. In a separate test conducted under in vivo

i.e. both in green house and under field conditions, it was found to be effective in

reducing the foliar blast of rice crop and also in the reduction of the disease as

observed comparable with the standard fungicide carbendazim.

Enyiukwu et al. (2014) studied the significance of characterization of

secondary metabolites from extracts of higher plants in plant disease management,

these plants extracts have been found to contain broad spectra of phytochemicals

(secondary metabolites) such as alkaloids, flavonoids, tannins, saponins, phenols,

glycosides, terpenoids, phlobatannins, polyphenols and steroids. Secondary

metabolites constitute plants weaponry against pests and pathogens invasion.

These groups of phytochemicals possess wide ranging chemical functional groups

by which they establish contact with and bind to sites on target pathogens to

ineffectuate them.

Upadhyaya and Tewari (2014) studied on the fungitoxic potential of O.

sanctum essential oil based formulated product in management of collar rot

disease of a rice based crop, groundnutfor the formulating agent (coded A+),

Complete mycelial growth inhibition (0.2 cm2 ± 2.60) was exhibited by EOA+

and EO alone at 0.1% concentration in A. niger. EOA+ displayed significantly

reduced mycelial growth (31.37 cm2 ± 2.60) at 0.001% when compared with

either EO or A+ (63.60 cm2 ± 2.60) tested alone. EOA+ significantly reduced the

disease [25.4% ± 3.4] compared to EO and A+ at 0.01% concentration and found

to be at par with carbendazim [6.2% ± 3.4] at 0.1% concentration.

Gohel and Chauhan (2015) worked on integrated management of leaf and

neck blast disease of rice caused by P. oryzae and find out that the tricyclazole

(beam) was found significantly superior than the rest of treatments and recorded

minimum (9.56%) leaf blast intensity. The next effective treatment was

Pseudomonas fluorescens (15.12%) which was statistically at par with iprobenfos

(kitazin) (16.17%), followed by mancozeb (dithane M-45) (21.11%), neem leaf

extract (27.16%) and tulsi leaf extract (59.99%). The similar trend was observed

in case of controlling neck blast. The tricyclazole recorded significantly lowest

(24.25%) neck blast intensity than the rest of treatments. The next best treatment

was P. fluorescens (37.46%) which was statistically at par with iprobenfos

(39.44%), followed by mancozeb (44.56%), neem leaf extract (47.15%) and tulsi

leaf extract (59.99%) in location pooled analysis.

Olufolaji et al. (2015) worked on in vitro evaluation of antifungal activity of

some plant extracts against P. oryzae and the antifungal activity was tested at

concentrations of 10, 20, 30, 40, 50 and 100 % of plant extracts using the

poisoned food technique. All plant extracts reduced the growth of Pyricularia

oryzae at all tested concentrations. Highest growth inhibition was achieved at 100

% concentration with E. aromatica, 100 %; P. guineense 98 % and G. kola, 97.3

% mycelial growth inhibition. Extracts from E. aromatica, G. kola and P.

guineense at 100 % concentration promoted significant (P≤0.05) inhibition on

mycelial growth and sporulation of P. oryzae than the control, O. gratissimum, C.

odorata and C. citratus.

Pandey (2015) studied on the efficacy of leaf extracts in controlling leaf

blast and brown spot in rice and reveals that A. indica leaf extract @ 0.5% was

found most effective in minimizing the mycelial growth of both the pathogens

28.35 mm and 27.12 mm, closely followed by P. glabra leaf extract 29.57 and

30.10 mm in the same concentration, 96 hrs after incubation.

Shafaullah and Khan (2016) studied on the management of P. grisea, the

rice blast pathogen through botanical pesticides that the ginger and garlic extracts

after 21 days, exhibited promising result of eliminating leaf blast severity to

9.82% and 9.89% respectively, whereas a significant reduction of 14.18% and

13.97% was observed in neck blast by applying these plant extracts as compared

to control.

CHAPTER - III

MATERIALS AND METHODS

The present study entitled “Diversity of rice blast pathogen from different

geographical location of Chhattisgarh and its management.” was carried out at

Department of Plant Pathology, ICAR-Indian Institute of Rice Research,

Hyderabad. The multi-location trials were conducted at ICAR-IIRR Hyderabad

(T.S.), Krishi Vigyan Kendra Dhamatari (C.G.), RMD College of Agriculture and

Research Station Ambikapur (C.G.) and SG College of Agriculture and Research

Station, Jagdalpur (C.G.). The details of materials used and procedures adopted in

experimentation are described under the following headings.

3.1 The Pathogen: P. oryzae C. (Survey, Collection and Diversity

Studies)

3.1.1 Cleaning and Sterilization of glassware

The glassware used in the present study (Petri dishes, conical flasks,

measuring cylinders and test tubes) were first cleaned with a detergent, followed

by thorough cleaning with tap water. The cleaned glassware were placed in

potassium dichromate solution for 24 hours and finally rinsed with distilled water

for 3-4 times. Later they were air dried prior to use. Glassware were placed in tins

and sterilized in a hot air oven at 1800C for one hour. Media and water used in the

study were sterilized at 15 lb psi (121.60C) for 20 minutes in an autoclave. Work

benches were sterilized by ethyl alcohol. Cork borer, scalpel and inoculation loop

were also sterilized by flame method.

3.1.2 Media and its composition

Oat meal agar medium was used for isolation and purification of isolates

(Padmanabhan et al., 1970).

Oat meal agar medium (OMA)

Oat-meal : 20 g

Agar : 20 g

Dextrose : 20 g

Distilled water : 1000 ml

Potato dextrose agar (PDA) and potato dextrose broth (PDB) medium

Name of medium Composition Quantities

Potato Dextrose Agar

(PDA)

Potato (peeled and sliced)

Dextrose

Agar-agar

Distilled water

200 g

20 g

20 g

1000 ml

Potato Dextrose

Broth (PDB)

Peeled and sliced potato

Dextrose

Distilled water

200g

20 g

1000 ml

Preparation of culture media

Oat Meal Agar (OMA)

Oat meal agar media used for culturing of the fungus. Twenty (20) g of oat

meal, 20 g of glucose were dissolved in 1000 ml of distilled water. The pH of the

medium was measured with pH meter and adjusted to 6.8 with either 1 N NaOH or

1 N HCL. The medium was distributed to conical flasks and then sterilized in an

autoclave at 15 psi (121.6°C) for 15 minutes.

Potato Dextrose agar (PDA)

Required amount of peeled potato was cut into fine pieces. It was boiled in

500 ml of distilled water for 30 minutes and filtered through muslin cloth.

Thereafter, 20 g of dextrose and 20 g of Agar-agar were dissolved in 500 ml

boiling water. Potato extract was added in boiling mixture and mixed thoroughly

by stirring with glass rod. After few minutes of boiling it was transferred to, about

200 ml in each, 500 ml capacity flasks and plugged with non- absorbent cotton.

The pH of the medium was adjusted to 6.8 in the same way as mentioned above

and autoclaved at 15 lbs p.s.i. at 121.6°C for 15 minute.

Potato Dextrose broth (PDB)

Required amount of peeled potato was cut into fine pieces. It was boiled in

500 ml of distilled water for 30 minutes and filtered through muslin cloth.

Thereafter, 20 g of dextrose was dissolved in 500 ml boiling water. Potato extract

was added in boiling mixture and mixed thoroughly by stirring with glass rod.

After few minutes of boiling it was transferred to, about 200 ml in each, 500 ml

capacity flasks and plugged with non- absorbent cotton. The pH of the medium

was adjusted to 7.0 ± 0.2 in the same way as mentioned above and autoclaved at 15

lbs p.s.i. at 121.6°C for 15 minute.

3.1.3 Survey and collection of blast infected samples

A roving survey was conducted for collection of rice blast infected leaf

samples and to assess the disease incidence from different locations of

Chhattisgarh during Kharif 2016 and Kharif 2017. Sampling sites also included

hot spots where blast occurs regularly in severe form. All collections were made

from tissues infected in field with naturally occurring inoculum. From

Chhattisgarh state a total of 63 isolates were collected. Seventeen samples were

collected from Jagdalpur (Madhya Bastar), fifteen samples were collected from

Surguja, seven were collected from Surajpur, five were collected from Kanker and

Balrampur, six were collected from Dhamtari, two were collected from Bemetara,

one isolate from each district of Dantewada, Narayanpur, Janjgir-Champa,

Bilaspur, Raipur and Gariyabandh. The samples were separately bagged air dried

and stored in a refrigerator at 4 0C for further studies (Table 3.1 and Figure 3.1).

Ten plots in each field having an area of one square meter were selected at

random. For assessing the Percent disease index (PDI), Sum of all rating hills, total

number of observed plants and maximum disease grade in each field were

recorded. The PDI was calculated using the formula.

PDI = Sum of all rating hills

Total No.of observed plants×Maximum disease grade(1−9)× 100

From each district ten to twenty rice growing villages were identified based

on production oriented survey reported from ICAR-IIRR and randomly 5-8 rice

field are selected.

Symptoms on leaf portions the disease isolate at each observation during

the survey are recorded. Besides, information like plant characters and

geographical information (longitude/latitude) were collected. The fungus was

isolated by tissue segmentation method (Bonman et al., 1987). Blast infected leaf

tissues stored in refrigerator were cut into small bits. These bits were washed in

sterilized distilled water twice, surface sterilized in 0.1% mercuric chloride for 30

seconds, rinsed three times in sterilized water and allowed for sporulation on

sterilized glass slides by incubating in a moist chamber at 25 0C for 48 h. Well

sporulated lesions were placed in double distilled water in the test tubes and

vortexed for 1 min. About 1 ml of spore suspension was added to sterilized plates

and 2% agar was added. Single spores were located and picked up microscopically

and transferred to fresh sterilized Petri plates containing OMA medium. The Petri

plates were incubated at 280C for 7 days and the fungus was identified following

mycological description given by Ou (1985). All the sixty three isolates proved

Koch’s postulates at glasshouse conditions on susceptible cultivar HR-12 Kharif-

2017 and Kharif-2018 at ICAR-IIRR Rajendranagar, Hyderabad.

The isolates were named tentatively with 3-part code such as PO-CG-1,

PO-CG-2 and PO-CG-3 and so on. The first part of the two letters represented the

causal organisms of crop disease (e.g. PO: Pyricularia oryzae). The next two

alphabet letters represented the location name of state (CG: Chhattisgarh) and final

numeral number indicated isolate serial number. The identity was assigned to each

isolate based on place from which samples collected.

Table 3.1. Survey and collection of blast from Chhattisgarh

S. No. Village District Isolate identity No.

1 Kumrawan Jagdalpur PO-CG-1

2 Kumrawan Jagdalpur PO-CG-2

3 Kumrawan Jagdalpur PO-CG-3

4 Kumrawan Jagdalpur PO-CG-4

5 Kumrawan Jagdalpur PO-CG-5

6 Ghatkawali Jagdalpur PO-CG-6

7 Ghatkawali Jagdalpur PO-CG-7

8 Ghatkawali Jagdalpur PO-CG-8

9 Kudkanar Jagdalpur PO-CG-9

10 Kudkanar Jagdalpur PO-CG-10

11 Kudkanar Jagdalpur PO-CG-11

12 Murenga Jagdalpur PO-CG-12

13 Murenga Jagdalpur PO-CG-13

14 Palwa Jagdalpur PO-CG-14

15 Palwa Jagdalpur PO-CG-15

16 Birinpal Jagdalpur PO-CG-16

17 Birinpal Jagdalpur PO-CG-17

18 Pathari Kanker PO-CG-18

19 Pathari Kanker PO-CG-19

20 Aturgarh Kanker PO-CG-20

21 Aturgarh Kanker PO-CG-21

22 Makadi Kanker PO-CG-22

23 Seharadabri Dhamtari PO-CG-23

24 Seharadabri Dhamtari PO-CG-24

25 Siyadehi Dhamtari PO-CG-25

26 Alekhunta Dhamtari PO-CG-26

27 Belarbahra Dhamtari PO-CG-27

28 Bhadsena Dhamtari PO-CG-28

29 Krishak Nagar Zora Raipur PO-CG-29

30 Kathia Bemetara PO-CG-30

31 Kaesara Bemetara PO-CG-31

32 Chitalanka Dantewada PO-CG-32

33 Brahbeda Narayanpur PO-CG-33

34 Munund Janjgir-Champa PO-CG-34

35 Sarkanda Bilaspur PO-CG-35

36 Kokdi Gariyabandh PO-CG-36

37 Barion Balrampur PO-CG-37

38 Barion Balrampur PO-CG-38

39 Charpara Balrampur PO-CG-39

40 Charpara Balrampur PO-CG-40

41 Bhagima Balrampur PO-CG-41

42 Bhagwanpur Surguja PO-CG-42

43 Bhagwanpur Surguja PO-CG-43

44 Bhagwanpur Surguja PO-CG-44

45 Bhagwanpur Surguja PO-CG-45

46 Bhagwanpur Surguja PO-CG-46

47 Bhagwanpur Surguja PO-CG-47

48 Mahavirpur Surajpur PO-CG-48

49 Mahavirpur Surajpur PO-CG-49

50 Mahavirpur Surajpur PO-CG-50

51 Amapara Surajpur PO-CG-51

52 Amapara Surajpur PO-CG-52

53 Sanjay Nagar Surajpur PO-CG-53

54 Sanjay Nagar Surajpur PO-CG-54

55 Bafali Surguja PO-CG-55

56 Bafali Surguja PO-CG-56

57 Bafali Surguja PO-CG-57

58 Bafali Surguja PO-CG-58

59 Bafali Surguja PO-CG-59

60 Ajirma Surguja PO-CG-60

61 Ajirma Surguja PO-CG-61

62 Ajirma Surguja PO-CG-62

63 Ajirma Surguja PO-CG-63

PO- Pyricularia oryzae, CG- Chhattisgarh

Figure 3.1. Sites of P. oryzae isolates in Chhattisgarh

3.1.4 Isolation by mono-conidial method of P. oryzae isolates

The fungus was isolated by tissue segmentation method (Bonman et al.,

1987). Blast infected leaf tissues stored in refrigerator were cut into small bits.

These bits were washed in sterilized distilled water twice, surface sterilized in

0.1% mercuric chloride for 30 seconds, rinsed three times in sterilized water and

allowed for sporulation on sterilized glass slides by incubating in a moist chamber

at 25 0C for 48 h. Well sporulated lesions were placed in double distilled water in

the test tubes and vortexed for 1 min. About 1 ml of spore suspension was added to

sterilized plates and 2% agar was added. Single spores were located and picked up

microscopically and transferred to fresh sterilized Petri plates containing OMA

medium. The Petri plates were incubated at 280C for 7 days and the fungus was

identified following mycological description given by Ou (1985). The fungus was

subsequently transferred to test tubes after the sufficient growth, containing OMA

for culture establishment.

3.1.5 Pathogenicity test

Disinfected viable seeds of the susceptible variety HR-12 were sown in the

plastic cups. When the seedlings were three-weeks-old, they were inoculated with

spore suspension obtained from the culture grown on oat meal agar. Seedlings

sprayed with each isolate were covered with a polythene bag. Inoculated plants

were kept for incubation in moist chamber at 280C with >95% RH. After

incubation the plants were kept in glasshouse and observations were made for

development of blast symptoms on the leaves. Re-isolations were made for each

isolate to compare with original isolates and stored in refrigerator for future use.

Leaf blast severity of each isolate was recorded on individual plant basis using

progressive 0-9 scale (IRRI, 1996) (Prasad et al., 2011 and Saifulla et al., 2011).

(Plate 3.1 and Table 3.2).

Table 3.2 Disease rating (0-9) scale (SES IRRI, 1996) for leaf blast nursery

Score Disease Host

Response

0 No lesions observed Highly

Resistant

1 Small brown specks of pin-point size or larger brown

specks without sporulating center Resistant

2 Small roundish to slightly elongated, necrotic gray spots,

about 1-2 mm in diameter, with a distinct brown margin

Moderately

Resistant

3 Lesion type is the same as in scale 2, but a significant

number of lesions are on the upper leaves

Moderately

Resistant

4 Typical susceptible blast lesions 3 mm or longer,

infecting less than 4% of the leaf area

Moderately

Susceptible

5 Typical blast lesions infecting 4-10% of the leaf area Moderately

Susceptible

6 Typical blast lesions infection 11-25% of the leaf area Susceptible

7 Typical blast lesions infection 26-50% of the leaf area Susceptible

8 Typical blast lesions infection 51-75% of the leaf area

and many leaves are dead

Highly

Susceptible

9 More than 75% leaf area affected Highly

Susceptible

Table 3.3 Sporulation Index

Sporulation No of spores / microscopic

field (10x) Index

Excellent >36 4

Good 25-36 3

Fair 13-24 2

Poor <12 1

Plate 3.1 Leaf blast severity based on disease rating scale (0-9)

3.1.6 Pathogenic diversity of P. oryzae isolates using host differentials

Fifteen monosporic cultures of P. oryzae representing different agro-

climatic zones of Chhattisgarh were used to study their virulence pattern on eight

rice differential hosts and one susceptible (HR-12) as check (Karthikeyan et al.,

2013) (Table 3.4 and Plate 3.2).

3.1.6.1 Inoculum preparation and Inoculation

Stored cultures of P. oryzae were revived and multiplied by sub-culturing

on OMA medium for sporulation. After 14 days of incubation at 28°C, 63 Petri

plates (90 mm) of each P. oryzae isolate were washed each with 20 ml of sterile

distilled water to produce spore suspension. Mycelium was filtered out with a

double-layered muslin cloth. The concentration of the conidial suspension was

adjusted to 1 × 105 conidia ml

-1 using a haemocytometer. Spore suspension was

sprayed on 14 days-old-seedlings using a hand operated atomizer. All the

inoculated seedlings were incubated at 25°C with >95% RH. Leaf blast reaction

of each isolate was recorded 15 DAI using a progressive 0-9 disease scoring scale

(IRRI, 1996). Blast differential lines exhibiting reaction types R were considered

as resistant, while those showing reaction types S were considered as susceptible.

Isolates were classified into different pathogenic groups using resistance factors.

Table 3.4. Host differentials in pathogenic variability

S. No. International host Differentials

1 Raminad str. 3

2 Zenith

3 NP – 125

4 Usen

5 Dular

6 Kanto 51

7 Shia – tiao – tsao

8 Caloro

Susceptible Check HR-12

Plate 3.2. Variability studies of P. oryzae isolates on host differentials

Moist chamber Disease reaction

Host differentials Hand atomizer

3.1.7 Storage of fungal isolates

The fungus was allowed to grow on OMA medium slants for 7 days at

280C in an incubator. These test tubes were filled up at active mycelia growth of

fungus with mineral oil, sealed in plastic zippy bags and stored at 40C for further

studies as short term preservation. Established cultures were also subsequently

maintained according to the method of Valent et al. (1986), which involves

growing the cultures in sterilized filter paper (Whatmann No.3 discs (0.5 cm2)

overlaying OMA medium. The plates were incubated at 280C for 7 days by the

time filter papers were fully colonized by the fungus. After colonization, the filter

paper discs were dried at 300C and subsequently stored in sterilized glass vials at

40C.

3.1.8 Cultural and morphological variability among P. oryzae isolates

Cultural and morphological characters of all mono-conidial isolates of P.

oryzae were recorded by growing them on OMA medium for 14 days at 280C.

Cultural characters include colour and radial growth (mm) of the fungal mycelium.

Morphological characteristics viz. size of conidia, septa formation and sporulation.

Spores of P. oryzae of different isolates were collected from the culture plate

mounted in lactophenol on a clean slide. Spores were measured under high power

objective (40x) using precalibrated ocular micrometer. The average size of spore

was then determined and shape of the spores were recorded. Microphotographs

were taken to show the typical spore morphology of the pathogen (Srivastava et

al., 2014).

3.1.9 Sporulation

Sporulation capacity of each isolate was assessed by microscopic

observations. For this purpose, spore suspension from each isolate was prepared by

harvesting spores into 20 ml of sterile distilled water from a 14-day-old culture

plate using camel hair brush. A loopful of spore suspension was then placed on a

clean slide and a cover slip was placed on it. The rate of sporulation was recorded

in five different microscopic fields.

3.1.10 Molecular variability in P. oryzae using SSR markers

Molecular variability among the isolates of P. oryzae collected from

different locations was studied using the SSR (simple sequence repeat) markers.

A set of 13 SSR markers were selected based on the P. oryzae linkage map

reported by Mohan et al. (2012) (Table 3.5).

Genomic DNA isolation: DNA was extracted from the single spore

cultures of P. oryzae isolates from rice by using DNA extraction method (Viji et

al., 2000).

Stock solutions

Extraction buffer (10 mM Tris HCl,; 1.4 M NaCl’ and 20 mM EDTA).

1 M Tris – HCl, pH 8.0

0.2 M EDTA, pH 8.0

5M NaCl

10% sodium do-decyl sulfate (SDS)

10% CTAB in 0.7 M NaCl solution.

Chloroform: Iso-amyl alcohol (24:1) mixture.

2-isopropanol

RNase-A (10 mg ml-1

) dissolved in solution containing 10 mM Tris (pH

7.5)

15 mM NaCl stored at -20°C; working stocks were stored at 4°C

Phenol-chloroform-iso-amyl alcohol mixture (25:24:1)

3 M sodium acetate (pH 5.2)

70% Ethyl alcohol.

T10E1 buffer: Tris 10 mM containing 1mM EDTA.

Culturing of the fungus

P. oryzae isolates were grown in aliquots of 100 ml of potato dextrose

broth (PDB) were dispensed in 250 ml Erlenmeyer flasks under

continuous shaking for 7-10 days.

The mycelial mat was harvested by filtering through a sterilized

Whatmann No. 3 filter paper.

The mycelial mats were transferred to sterilized blotter papers for

drying and stored at -200C.

Grinding and extraction

The dried frozen mycelium of 200 mg was ground in a mortar with a pestle

in liquid nitrogen to a fine powder.

CTAB buffer was pre-heated in 65°C water bath before start of

DNA extraction.

Pulverized mycelium of each isolate then transferred to a 2-ml

Eppendorf tube containing a volume of 750 μl of pre-heated

CTAB buffer and the contents were thoroughly vortexed until

evenly suspended.

Samples were incubated at 650C in a water bath for 30 min with

occasional shaking and then allowed to cool at room temperature

Solvent extraction

A volume of 750 μl of chloroform-isoamyl alcohol mixture (24:1)

was added to each tube and the samples were centrifuged at 8000

rpm for 10 min.

After centrifugation, the aqueous, viscous supernatant

(approximately 400 μl) was transferred to a fresh Eppendorf tube.

Initial DNA precipitation

To the tube containing aqueous layer, 0.7 volumes (approximately

280 μl) of cold isopropanol (kept at -200C) was added to

precipitate the nucleic acid. The solutions were carefully mixed

and the tubes were kept at -200C for one hour.

The samples were centrifuged at 8000 rpm for 15 min.

The supernatant was decanted under a fume-hood and pellets were

vacuum dried for 10 min.

RNase treatment

In order to remove co-isolated RNA, 200 μl of low salt TE buffer

(T1E0.1) and 3 μl of RNase (stock 10 mg/μl) were added to each

tube containing dry pellet and mixed properly.

The solution was incubated at room temperature overnight.

Solvent extraction

After incubation, 200 μl of phenol-chloroform-isoamyl alcohol

mixture (25:24:1) was added to each tube, carefully mixed and

centrifuged at 8000 rpm for 10 min.

The aqueous layer was transferred to fresh tubes and chloroform

isoamylalcohol (24:1) mixture was added to each tube, carefully

mixed and centrifuged at 8000 rpm for 10 min. The aqueous layer

was transferred to fresh tubes.

DNA precipitation

To the tubes containing aqueous layer, 15 μl (approximately 1/10th

volume) of 3M sodium acetate (pH 5.2) and 300 μl (2 volume) of

absolute ethanol (kept at -200C) were added and the tubes were

subsequently placed in a freezer (-200C) for 30 min.

Following incubation, the tubes were centrifuged at 8000 rpm for

15 min.

Ethanol wash

After centrifugation, supernatant was carefully decanted

from each tube having ensured that the pellets remained

inside the tubes and 200 μl of 70% ethanol was added to the

tubes followed by centrifugation at 8000 rpm for 5 min.

Final re-suspension

Pellets were obtained by carefully decanting the supernatant from each tube

and then dried in vacuum for 10 min.

Completely dried pellets were re-suspended in 100 μl of T10E1 buffer and

incubated overnight at room temperature to allow them to dissolve

completely.

Dissolved DNA samples were stored at 40C.

DNA quality / quantity check: Qualitative analysis of DNA was performed by

agarose gel electrophoresis as described below.

Reagents required

TBE buffer: 109 g of Tris and 55 g of boric acid were dissolved

one by one in 800 ml distilled water; then 40 ml of 0.5M EDTA

(pH 8.0) was added for 10X TBE buffer. The volume was made

up to one liter with distilled water and sterilized by autoclaving.

This was stored at 4°C. To prepare working solution (1X), the

stock solution was diluted 10 times.

Ethidium bromide (10 mg ml-1

): A quantity of 100 mg ethidium

bromide was dissolved in 10 ml of distilled water. The vessel

containing this solution was wrapped in aluminium foil and stored

at 4°C.

Agarose

Orange loading dye

0.5 M EDTA (pH 8.0): 10 ml

5 M NaCl : 1 ml

Glycerol : 50 ml

Distilled water : 39 ml

Orange dye powder (Orange G, Gurr CertistainR) was added till the color became

sufficiently dark.

Procedure:

Agarose (0.8 g) was added to 100 ml of 1X TBE buffer and heated using

microwave oven until the agarose was completely dissolved. After cooling the

solution to about 60°C, 5 μl of ethidium bromide solution was added and the

resulting mixture was poured into the gel-casting tray for solidification. Before the

gel solidified, an acrylic comb of desired well number was placed on the agarose

solution to form wells for loading the samples. Each well was loaded with 5 μl of

sample aliquot having 3 μl distilled water, 1 μl orange dye and 1 μl of DNA

sample. The DNA samples in known concentration (lambda DNA of 50 ng μl-1

,

100 ng μl-1

and 200 ng μl-1

) were also loaded on to the gel to estimate the DNA

concentration of the experimental samples. The gel was run at 70 V for 20 min.

After completing the electrophoresis run, DNA on the gel was visualized under UV

light and photographed. If the DNA was observed as a clear and intact band, the

quality was considered good, whereas a smear of DNA indicating poor quality was

discarded and re-isolated. Relative concentration of DNA present in the samples

approximately derived by visual comparison with lambda DNA.

SSR genotyping:

A set of MGM and Pot2 primers were used for studying the genetic

diversity of P. oryzae isolates. These primer sequences were synthesized at MWG-

biotech (Bangalore). All the 13 primer pairs were initially tried on four

representative isolates. Genomic DNA of all the isolates were diluted to 5 ng ml-1

and used as template for amplification of SSR loci. The PCR reactions were

performed in 5 ml volume consisting of 2 ml of 5 ng DNA template, 1 ml of 2 mM

dNTPs, 0.4 ml of 50 mM MgCl2, 0.7 ml of primer containing 1:5:1 ratio of 100

pmole/ml forward primer, 100 pmole/ml reverse primer, 1.0 ml of 10X PCR buffer

and 0.04 U of Taq DNA polymerase (SibEnzymes Ltd, Russia). The reaction

mixture was vortexed and briefly centrifuged. PCR amplification was performed in

a ABI thermal cycler with the following temperature profiles: 94oC for 5 min of

initial denaturation cycle, followed by 35 cycles of denaturation at 94oC for 30

seconds, with constant annealing temperature (45°C) for 30 sec and extension at

72°C for 30 sec, followed by a final extension at 72°C for 20 min. The PCR

products were tested for amplification on 1.2% agarose.

Capillary electrophoresis:

Three grams of Agarose was weighed and added to a conical flask

containing 250 ml of 1 x TAE buffer.

The agarose was melted by heating the solution in oven and the solution

was stirred to ensure even mixing and complete dissolution of agarose.

The solution was then cooled to about 40-450C.

Two to three drops of ethidium bromide (0.5 μg ml-1

) was added.

The solution was mixed and poured into the gel casting platform after

inserting the comb in the gel. While pouring sufficient care was taken for

not allowing the air bubbles to trap in the gel.

The gel was allowed to solidify and the comb was removed after placing

the solidified gel into the electrophoretic apparatus containing sufficient

buffer (1 X TAE) so as to cover the wells completely.

The amplified products (20 ml) to be analyzed were carefully loaded into

the sample wells, after adding bromophenol blue with the help of

micropipette.

Electrophoresis was carried out at 100 volts, until the tracking dye migrated

to the end of the gel.

The gel was taken out from electrophoretic apparatus and stained by

placing it in distilled water containing ethidium bromide (0.5 μm/ml) for 10

min.

Ethidium bromide stained DNA bands were viewed under UV-

transilluminator and photographed for documentation.

Molecular data analysis

The profiles generated by different MGM and Pot2 primers were compiled

to determine the genetic relatedness among the different P. oryzae isolates. The

presence or absence of each band in all isolates were scored manually by binary

data matrix with ‘1’ indicating the presence of the band and ‘0’ indicating the

absence of band. Data were generated separately for each primer. A similarity

matrix was generated from the binary data using Jaccard’s similarity coefficient in

the SIMQUAL program of the NTSYS-pc package. Cluster analysis was

performed with the unweighted pair group arithmetic mean method (UPGMA) in

the SHAN program of the NTSYS-pc package (Rohlf, 1993).

Marker polymorphism:

The polymorphic information content (PIC) values measure the

informativeness of a given DNA marker. The PIC value for each SSR loci was

measured as given by Anderson et al. (1993).

where k is the total number of alleles detected for a given marker locus and Pi is

the frequency of the i th

allele in the set of genotypes investigated.

Table 3.5. List of SSR markers and their sequences

S.No. Sequence

name Forward primers (5¹ to 3¹) Reverse primers (3¹ to 5¹)

1 MGM-1 TTTCGTACAATCCCGATG GCGACAATGTCTTTTTTTTT

2 MGM-2 GATGGGGAGATATTCCAT ACTCACCCTATCAACACTTCA

3 MGM-3 GTGACATTAGAGGAAATAAGGT AATCCCAAAACTCAAAACC

4 MGM-4 TCTAGAACTCAAAACTCAAA ATCACCATTCCTGCTG

5 MGM-5 TCTCCCTATATTTCTCCC AAATGATATGTTTGCTGC

6 MGM-6 AGGCAGGAAGACATATGC ACAGCTCATTACCATGCC

7 MGM-7 GACATATTATCTTGTACTGTG TTTCTTAGATTTTTCCAT

8 MGM-8 CCAAAACAACGGATGGAT ACTGGTTCAGTTCGCCTC

9 MGM-9 GACTCAAGGTGGAGATGG GCCTCCACTATCTCTCGT

10 MGM-10 ACAGCCGACAGGTCAAGA GCCAGACCTTCAAGGACA

11 MGM-21 GCAGGTGAGCAAACAGCAAGA ATATCTCGTGCAGGCCGGT

12 MGM-24 GTCTTGAGTCCACCCTCTTTG CCGTCCCTTGTTTTCATCC

13 Pot2 CGGAAGCCCTAAAGCTGTTT CCCTCATTCGTCACACGTTC

3.2 Multilocation Evaluation of Near Isogenic Lines (NIL’S)

Carrying Different Blast Resistant Genes

Multilocation evaluation of resistant lines were conducted on sixteen

near isogenic lines (NIL’s) viz., MSP-1, MSP-2, MSP-3, MSP-4, MSP-5,

MSP-6, MSP-7, MSP-8, MSP-9, MSP-10, MSP-11, MSP-12, MSP-13, MSP-

14, MSP-15 and MSP-16 possessing different blast resistance genes in the

background of BPT5204, Improved Samba masuri, Swarna and IR-64 along

with donar parents (C101LAC, C101A51 and Tetep), susceptible checks (Co-

39 and HR-12) and resistant check (Rasi). These lines were evaluated against

blast disease in different agro climatic regions of Chhattisgarh and

Telangana during Kharif 2016 and Kharif 2017. The details of sixteen near

isogenic lines and blast resistance genes are presented in Table 3.6. These

lines were evaluated in Uniform blast nurseries at four different locations

viz., IIRR Hyderabad, KVK Dhamatari (C.G.), RMDCARS Ambikapur

(C.G.) and SGCARS Jagdalpur (C.G.).

The fungus was isolated by tissue segmentation method (Bonman et

al., 1987). Single spores were located and picked up microscopically and

transferred to fresh sterilized petri plates containing OMA medium. The

Petri plates were incubated at 280C for 7 days and the fungus was identified

following mycological description given by Ou (1985). After 14 days of

incubation at 28°C, Petri plates (90 mm) of P. oryzae isolate was washed

with 20 ml of sterile distilled water to produce spore suspension. The

concentration of the conidial suspension was adjusted to 1 × 105 conidia ml

-

1 using a haemocytometer. Each row in the nursery bed representing one

isogenic line. Susceptible variety (HR-12) were sown around the nursery

beds to keep the blast disease. After 25 days these nursery beds were

sprayed with sporulation of local blast isolate using a hand operated

atomizer. Data was collected from nursery beds by using 0-9 scale after 15

days of spraying (IRRI, 1996), (Table 3.6 and Plate 3.3).

Table 3.6. Blast resistant introgressed lines

S.No Designation Cross Combination Resistance

Gene/Genes

1 MSP-1 BPT5204 X C101LAC Pi1

2 MSP-2 BPT5204 X C101A51 Pi2

3 MSP-3 BPT5204 X Tetep Pi54

4 MSP-4 BPT5204 X C101LAC X C101A51 Pi1 and Pi2

5 MSP-5 BPT5204 X C101LAC X Tetep Pi1 and Pi54

6 MSP-6 BPT5204 X C101LAC X C101A5 X Tetep Pi1, Pi2 and Pi54

7 MSP-7 Swarna X C101LAC Pi1

8 MSP-8 Swarna X C101A51 Pi2

9 MSP-9 Swarna X Tetep Pi54

10 MSP-10 Swarna X C101LAC X C101A51 Pi1 and Pi2

11 MSP-11 Swarna X C101LAC X Tetep Pi1 and Pi54

12 MSP-12 Swarna X C101LAC X C101A5 X Tetep Pi1, Pi2 and Pi54

13 MSP-13 IR64 X C101A51 Pi2

14 MSP-14 IR64 X Tetep Pi54

15 MSP-15 Improved Samba mahsuri X C101A51 Pi2

16 MSP-16 Improved Samba mahsuri X Tetep Pi54

Plate 3.3. Multilocation evaluation of near isogenic lines (NIL’S) carrying

different blast resistant genes

IIRR

, Hy

dera

ba

d R

MD

CA

RS

, Am

bik

ap

ur

SG

CA

RS

, Ja

gd

alp

ur

KV

K, D

ha

mta

ri

3.3 To Evaluate the Efficacy of Ocimum Leaf Decoctions for

Management of Rice Blast

3.3.1 Evaluation of different ocimum species against Pyricularia oryzae in-vitro

to assess inhibition of mycelium growth

3.3.2 Collection of plant material

The leaves of Holy basil- Ocimum sanctum, Sweet basil- Ocimum

basilicum and Clove basil- Ocimum gratissimum were collected from the garden

near glasshouse of Entomology Department of Indian Institute of Rice Research,

Hyderabad (Plate 3.4).

3.3.3 Extraction of plant material

The young leaves were collected from different Ocimum species, washed

and dried under shade at ambient temperature. Dried leaf material was ground to

fine powder by using electric grinder. Powders were then stored in air-tight

containers in a cool place away from sunlight.

3.3.4 Extraction with Methanol

The powder of each plant O. sanctum, O. basilicum and O. gratissimum

(50 gm) was separately extracted with methanol by using Soxhlet apparatus (Plate

3.7) which consists of three components- basal flask, Soxhlet and condenser.

Different Ocimum spp. leaf powder was taken into thimble and put it seperately

into Soxhlet, 600 ml of respective solvent taken into round bottom flask, then

Soxhlet apparatus was properly arranged and started the distillation process. When

the solvent in round bottom flask was heated to boiling, the vapour passes through

tube in the reflex condenser, gets condensed and drips in to the thimble containing

the plant material. The condensed liquid gradually trickles down and falls on plant

material in thumbs. The extract (liquid) accumulates in chamber enters into the

siphon tube and gradually rises up to the point of return and falls back into round

bottom flask. The cycle of the solvent evaporation and siphoning back can be

continued as many time as possible without changing the solvent, so as to get

efficient extraction up to time period of 6 hrs. Finally after evaporation of solvent,

the remaining plant extract was taken into Petri plate and concentrated under

reduced pressure at a temperature not exceeding 40°C. The concentrated extract

was then dried in an oven at 40°C for about 48 hrs until it formed like a gummy

material (Plate 3.6). Petri plates with extracts were labeled and stored in

refrigerator at 40°C.

3.3.5 Extraction with Water

Water extracts (100%) prepared by dissolving 100 gm of the three Ocimum

species fine leaf powder in 100 ml of distilled water mixed were thoroughly and

soaked for overnight. Soaked after 10 hours the extract was filtered first with

muslin cloth then with filter paper. Filtrate volume is made up to 100 ml by adding

distilled water (Plate 3.5).

Table 3.7. Ocimum species and their chemical compounds

S.

No.

Common

name

Scientific

name Family

Used

part

Major chemical

compounds

1 Holy basil O. sanctum Lamiaceae Leaf eugenol, methyl

eugenol

2 Sweet basil O. basilicum Lamiaceae Leaf eugenol, methyl

cinnamate

3 Clove basil O. gratissimum Lamiaceae Leaf

eugenol,

methylchavicol,

thymol, camphor

The required quantities of water and methanolic extract of Ocimum leaf

decoctions were measured and mixed in the potato dextrose agar medium by

thorough shaking for uniform mixing of the Ocimum extracts (water and

methanolic) before pouring into Petri dishes so as to get the desired concentration

of active ingredients of each species of Ocimum leaf decoction separately (Table

3.8.a). Twenty (20) ml of amended medium was poured in 90 mm sterilized Petri

dishes and allowed to solidify. Mycelial discs of 5 mm diameter from 10 day-old

culture was placed at the center of the Petri plate and then incubated at 280C for 15

days. Control was maintained without Ocimum leaf decoction.

Three replications were maintained for each treatment. Per cent inhibition of

mycelial growth was calculated using the formula.

I = (C-T/C) X 100

Where,

I = Per cent inhibition of mycelial growth

C = Colony diameter in control (cm)

T = Colony diameter in treatment (cm)

Plate 3.4 Three Ocimum species

Plate 3.5 Water extracts of different Ocimum spp.

O. sanctum O. basilicum O. gratissimum

Plate 3.6 Methanolic extracts of different Ocimum spp. dried in Petri plates

Plate 3.7 Methanolic extraction by Soxhlet apparatus

O. sanctum O. basilicum O. gratissimum

3.3.6 In Vivo evaluation of different Ocimum species against P. oryzae on HR-

12 variety

The effect of water and methanolic extract three species of Ocimum leaf

extracts on blast susceptible rice variety HR-12 was evaluated in UBN trial

conducted at IIRR, Hyderabad during Kharif 2016 and Kharif 2017 with nursury

size of 10x1(LxW) meter by following standard agronomic practices. Susceptible

variety HR-12 seeds were sown in UBN nursery bed after 21 days.The experiment

was conducted with five treatments viz., Ocimum sanctum, Ocimum basilicum,

Ocimum gratissimum leaf extracts (50%, 75%, 100% of water extract and 0.5%,

1% and 10% of methanol extract), tricyclazole and water were used as a check.

Each treatment had three replications. First spray of Ocimum leaf decoction was

given seven days after the appearance of symptoms in the UBN and subsequent

spray was applied seven days after the first spray (i.e. 14 days after the appearance

of the symptoms). A total of three sprays were given. Observations were recorded

before spraying and seven days after the first sprays, second and last. The

experiment was laid out in randomized block design (Table 3.8.b and Plate 3.8).

Disease severity was recorded as per cent leaf area affected (Per cent Disease

Severity –PDS) and compared with the check.

Table 3.8.a Water and methanolic extract of Ocimum leaf decoction used for

the management of rice blast in in vitro condition

S. No. Ocimum spp.

Extract with water Extract with methanol

Extract:Media

(60ml)

Doses

(%/ppm)

Extract:Media

(60ml)

Doses

(%/ppm)

T-1 O. sanctum 15.0:45.0 50 0.5:59.5 0.5

T-2 O. sanctum 22.5:37.5 75 1.0:59.0 1.0

T-3 O. sanctum 30.0:30.0 100 6.0:54.0 10

T-4 O. basilicum 15.0:45.0 50 0.5:59.5 0.5

T-5 O. basilicum 22.5:37.5 75 1.0:59.0 1.0

T-6 O. basilicum 30.0:30.0 100 6.0:54.0 10

T-7 O. gratissimum 15.0:45.0 50 0.5:59.5 0.5

T-8 O. gratissimum 22.5:37.5 75 1.0:59.0 1.0

T-9 O. gratissimum 30.0:30.0 100 6.0:54.0 10

T-10 Check

(Tricyclazole) 0.03:60.0 600 ppm 0.03:60 600 ppm

T-11 Control - - - -

Table 3.8.b Water and methanolic extract of Ocimum leaf decoction used for

the management of rice blast in in vivo condition

S. No. Ocimum spp.

Extract with water Extract with methanol

Extract:Water

(100ml)

Doses

(%/ppm)

Extract:Water

(100ml)

Doses

(%/ppm)

T-1 O. sanctum 25.0:75.0 50 0.5:99.5 0.5

T-2 O. sanctum 37.5:62.5 75 1.0:99.0 1.0

T-3 O. sanctum 50.0:50.0 100 10.0:90.0 10

T-4 O. basilicum 25.0:75.0 50 0.5:99.5 0.5

T-5 O. basilicum 37.5:62.5 75 1.0:99.0 1.0

T-6 O. basilicum 50.0:50.0 100 10.0:90.0 10

T-7 O. gratissimum 25.0:75.0 50 0.5:99.5 0.5

T-8 O. gratissimum 37.5:62.5 75 1.0:99.0 1.0

T-9 O. gratissimum 50.0:50.0 100 10.0:90.0 10

T-10 Check

(Tricyclazole) 0.06:100 600 ppm 0.06:100 600 ppm

T-11 Control (Water) 100 100 100 100

Kharif 2016

Kharif 2017

Plate 3.8 In vivo evaluation of three species of Ocimum leaf extracts (Water

and Methanol) against rice blast disease at Uniform Blast Nursery

(UBN) IIRR, Hyderabad

CHAPTER - IV

RESULTS AND DISCUSSION

The present investigation was conducted to study the “Diversity of rice

blast pathogen from different geographical location of Chhattisgarh and its

management” under laboratory and field conditions and the results are presented

and discussed in this chapter.

4.1 The Pathogen: P. oryzae Cavara (Survey, Collection and

Diversity Studies)

4.1.1 Symptomatology

Rice blast disease develops symptoms during August to October, especially

when there is light showers with cloudy weather. The disease occurs during

seedling and adult stages on the leaves, nodes and panicles. In leaf blasts, lesions

are typically spindle-shaped on leaves, wider at the center and pointed towards

either ends. Large lesions usually develop into a diamond shape with grayish

center and brown margin. Under favorable conditions, small spots may merge

leading to complete necrosis of infected leaves giving a burning appearance from

distance (Plate 4.1).

These symptoms have close resemblance with the symptoms described by

several workers (Ou, 1985; Koutroubas et al., 2009; Prasad et al., 2011 and

Pinheiro et al., 2012).

4.1.2 Survey and collection of P. oryzae isolates

A roving survey was conducted from thirteen districts of Chhattisgarh to

assess the incidence of rice blast disease and also the blast infected leaf samples

were collected during Kharif 2016 and Kharif 2017 for isolation of P. oryzae

isolates (Table 4.1 and Fig. 4.1a, b, c & d). The collection sites were recognized as

the hot spots for blast disease where farmers usually grow traditional rice varieties.

A total of 63 leaf blast diseased samples were collected from different

geographical locations of Chhattisgarh during the Kharif 2016 (32 samples) and

Kharif 2017 (31 samples). A survey on disease incidence indicated that Percent

Disease Index (PDI) varied in different agro climatic regions ranging from 20.00

per cent on Safari and Maheshwari varieties in Bastar and Surajpur districts,

respectively to 87.78 per cent on Swarna in Bastar (Jagdalpur) district. The

maximum disease incidence was noticed in Jagdalpur (87.78 %) followed by

Surguja (85.56 %) and Balrampur (84.44 %). The PDI of leaf blast among different

cultivars and locations were found to be varied from each other (Table 4.1)

The perusal of the data given in the Table 4.1 revealed that the mean blast

PDI was recorded in Chhattisgarh Plain Zone was 35.49 per cent, in North Hills

Zone 47.16 per cent, and in Bastar Plateau was 47.25 per cent.

Among the cultivars studied, the highest PDI of 87.78 per cent was

recorded on Swarna variety (Jagdalpur) and lowest PDI of 20.00 per cent was

recorded on Safari (Bastar) and Maheshwari (Surajpur). These results indicated

that variation in PDI which was influenced by the geographical area under

different cultivation practices.

In Swarna cultivar, the lowest PDI was recorded i.e., 31.11 per cent in

Chhattisgarh Plains Zone while the highest PDI was recorded in Bastar Plateau

Zone (87.78 per cent). Whereas, In Mahamaya cultivar, the lowest PDI of 26.67

per cent was recorded in Chhattisgarh plains zone while, the highest PDI recorded

in North Hills Zone was 65.56 per cent.

In Bamleshwari and Indira Sona cultivars, the lowest PDI was 33.33 per

cent and 42.22 per cent respectively in North Hills Zone while, the highest PDI

was 65.56 per cent and 56.67 per cent respectively was recorded in Bastar plateau

zone. Whereas, In Safari, the lowest and highest PDI was 20.00 and 30.00 per cent

respectively in Bastar Plateau Zone. Similarly, In Maheswhwari the lowest PDI

was 20.00 per cent and highest PDI was 65.56 per cent in North Hills Zone, In US-

312 the lowest PDI was recorded i.e., 23.33 per cent and highest PDI was 45.56

percent in North hills zone and in Karma Mahsuri, 31.11 per cent and 33.33 per

cent PDI were recorded in Bastar Plateau and Chhattisgarh Plains Zones. Similarly,

Indira Sugandhit Dhan 32.22 per cent and 28.89 per cent PDI were recorded in

Bastar Plateau and Chhattisgarh Plains Zones, respectively. In Badshah the 24.44

per cent and 25.56 per cent PDI were recorded in North Hills Zone.

The PDI of MTU 1001, MTU1010, Pusa Sugandhit, Dubraj, US 350,

Jirafal, IR 36, Gomati, Indira Barani Dhan-1, PAC- 507, Dayal and Danteshwari

were 26.67, 23.33, 38.89, 74.44, 44.44, 21.11, 33.33, 32.22, 44.44, 42.22, 36.67

and 33.33 per cent respectively (Table 4.1). These variation in PDI might have

been influenced by weather, rainfall and geographical area under cultivation or the

pathogen race prevailing in the region or interaction of the variety and the weather

condition in these areas.

The results of the present investigations are in accordance with the findings

of Hossain et al., 2017, Ramesh et al., 2017, Shahijahandar et al., 2010.,

Jagadeeshwar et al., 2014., Hossain and Kulakarni, 2001., Anwar et al., 2009 and

Mukund variar et al., 2006.

Hossain et al., (2017) surveyed, in Bangladesh, found that the disease

incidence and severity were higher in irrigated ecosystem (Boro season) (21.19%)

than in rain fed ecosystem (Transplanted, aman season) (11.98%) regardless of

locations (AEZs). It was as high as 68.7% in Jhalak hybrid rice variety followed

by high yielding rice cultivar BRRI dhan47 (58.2%), BRRI dhan29 (39.8%), BRRI

dhan28 (20.3%) during boro season and in BRRI dhan34 (59.8%) during

Tranplanted, aman season.

Ramesh et al. (2017) conducted survey in Andhra Pradesh and Telangana

found that the most severity of blast diseases. The mean PDI in BPT-5204 was

53.48, in MTU-1010 was 43.33, NLR-145 was 55.97, HR-12 was 78.88, RGL-

2624 was 55.41, MTU-1001 was 49.86 and WGL-44645 was 51.78.

Shahijahandar et al. (2010) recorded the prevalence and distribution of

blast in Kupwara district of Jammu and Kashmir and reported 25% disease

incidence and 15% diseases severity.

Anwar et al. (2009) surveyed temperate districts of Kashmir for the

severity of rice blast and reported that the leaf blast severity ranged from 3.7 to

41.3% whereas highest nodal blast was found in Kulgam (7.3%) followed by

Khudwani (5.4%) and Larnoo (3.8%) zones of Anantanag district. The most

destructive phase of neck blast severity was found in every district with an average

range of 0.3-4.9%.

Similarly, Mukundvariar et al. (2006) conducted survey in Andhra Pradesh

and found that BPT-5204 suffer with moderate blast severity because of use of

high nitrogen fertilizers. While, Hossain and Kulakarni (2001) conducted survey

for rice blast during Kharif 1999 in different villages of Dharwad, Belgaum and

Uttara Kannada districts of Karnataka and reported the maximum disease

incidence in Haliyal (61.66%) and Mundagod (54.00%) talukas of North

Karnataka.

4.1.3 Isolation and Purification

The isolated pathogen culture was similar with Hawksworth (1990)

description i.e., Mycelium was greyish, conidiophores single or in fascicles,

simple, rarely branched, showing sympodial growth. Conidia formed singly at the

tip of the conidiophore at points arising sympodially and in succession, pyriform to

obclavate, narrowed towards tip, rounded at the base. Similar method was adopted

for the isolation and purification of the fungi (Silva et al., 2009, Vanraj et al.,

2013, Akator et al., 2014, Onega et al., 2015 and Prasad et al., 2011).

Plate 4.1. Symptoms of rice blast disease;

a. Severe form of blast disease in paddy field,

b. Collection of disease samples from blast infected field,

c. Blast disease infected leaves

a

c b

Table 4.1. Leaf blast disease severity and per cent disease index (PDI) on different rice varieties cultivated in major rice growing

areas of Chhattisgarh

S.

No. Cultivars Block District

Agro-

climatic

Zone

Isolates Latitude Longitude Altitude PDI(%) Score

(Mean±Stdev)

1 Swarna Jagdalpur Bastar

Bastar

Plateau

PO-CG-1 19.088 81.961 1785 64.44 5.80±0.79

2 Bamleshwari Jagdalpur Bastar PO-CG-2 19.087 81.964 1821 65.56 5.90±0.74

3 Indira Sona Jagdalpur Bastar PO-CG-3 19.087 81.964 1821 56.67 5.10±0.57

4 Mahamaya Jagdalpur Bastar PO-CG-4 19.088 81.961 1785 61.11 5.50±0.71

5 MTU 1001 Jagdalpur Bastar PO-CG-5 19.088 81.961 1785 26.67 2.67±0.50

6 Mahamaya Bastar Bastar PO-CG-6 19.120 81.944 1811 32.22 2.90±0.57

7 Swarna Bastar Bastar PO-CG-7 19.120 81.944 1811 58.89 5.30±0.67

8 Safari Bastar Bastar PO-CG-8 19.120 81.944 1811 30.00 2.70±0.67

9 Swarna Bastar Bastar PO-CG-9 19.117 81.964 1772 67.78 6.10±0.88

10 Mahamaya Bastar Bastar PO-CG-10 19.117 81.964 1772 32.22 2.90±0.74

11 MTU 1010 Bastar Bastar PO-CG-11 19.117 81.964 1772 23.33 2.10±0.74

12 Swarna Jagdalpur Bastar PO-CG-12 19.043 81.939 1814 65.56 5.90±0.88

13 Mahamaya Jagdalpur Bastar PO-CG-13 19.043 81.939 1814 62.22 5.60±0.84

14 Safari Tokapar Bastar PO-CG-14 19.046 81.914 1808 20.00 1.80±0.79

15 Swarna Tokapar Bastar PO-CG-15 19.046 81.914 1808 42.22 3.80±0.79

16 Swarna Jagdalpur Bastar PO-CG-16 19.002 81.046 1798 87.78 7.90±0.74

17 Indira Sugandhit Jagdalpur Bastar PO-CG-17 19.002 81.046 1798 32.22 2.90±0.57

18 Karma mahsuri Dantewada Dantewada PO-CG-18 18.416 81.334 1148 31.11 2.80±0.63

19 Mahamaya Narayanpur Narayanpur PO-CG-19 19.714 81.209 1745 37.78 3.40±0.84

Mean 47.25

20 Swarna Kanker Kanker

Chhattisgarh

Plains

PO-CG-20 20.226 81.516 1329 36.67 3.30±0.48

21 Mahamaya Kanker Kanker PO-CG-21 20.226 81.516 1329 26.67 2.40±0.70

22 Swarna Kanker Kanker PO-CG-22 20.209 81.506 1307 40.00 3.60±0.70

23 Karma mahsuri Kanker Kanker PO-CG-23 20.209 81.506 1307 33.33 3.00±0.67

24 Swarna Kanker Kanker PO-CG-24 20.569 81.606 1311 37.78 3.40±0.52

25 Mahamaya Dhamtari Dhamtari PO-CG-25 20.709 81.55 1063 34.44 3.10±0.74

S.

No. Cultivars Block District

Agro-

climatic

Zone

Isolates Latitude Longitude Altitude PDI(%) Score

(Mean±Stdev)

26 Swarna Dhamtari Dhamtari PO-CG-26 20.709 81.55 1063 35.56 3.20±0.79

27 Pusa Sugandhit Dhamtari Dhamtari PO-CG-27 20.709 81.55 1063 38.89 3.50±0.53

28 Mahamaya Kurud Dhamtari PO-CG-28 20.709 81.55 1063 36.67 3.30±0.67

29 Swarna Nagri Dhamtari PO-CG-29 20.709 81.55 1063 33.33 3.00±0.82

30 Mahamaya Nagri Dhamtari PO-CG-30 20.709 81.55 1063 35.56 3.20±0.79

31 Swarna Raipur Raipur PO-CG-31 21.236 81.703 735 48.89 4.40±0.70

32 Swarna Berla Bemetara PO-CG-32 21.948 82.549 856 31.11 2.80±0.63

33 Mahamaya Khamharia Bemetara PO-CG-33 21.948 82.549 856 27.78 2.50±0.53

34 Swarna Nawagarh Janjgir-Champa PO-CG-34 21.949 82.582 901 38.89 3.50±0.53

35 Indira Sugandhit Dhan Bilaspur Bilaspur PO-CG-35 22.103 82.140 883 28.89 2.60±0.52

36 Swarna Gariyabandh Gariyabandh PO-CG-36 20.645 82.074 1250 38.89 3.50±0.53

Mean 35.49

37 Dubraj Rajpur Balrampur

North Hills

PO-CG-37 23.056 83.319 1867 74.44 6.70±0.95

38 Poineer-575 Rajpur Balrampur PO-CG-38 23.056 83.319 1867 42.22 3.80±0.79

39 Bamleshwari Rajpur Balrampur PO-CG-39 23.116 82.962 1896 48.89 4.40±0.52

40 Swarna Rajpur Balrampur PO-CG-40 23.116 82.962 1896 84.44 7.60±0.70

41 Mahamaya Rajpur Balrampur PO-CG-41 23.257 83.210 1909 48.89 4.40±0.97

42 US-312 Surguja Surguja PO-CG-42 23.157 83.153 1949 45.56 4.10±0.88

43 US-350 Surguja Surguja PO-CG-43 23.157 83.153 1949 44.44 4.00±0.82

44 Maheshwari Surguja Surguja PO-CG-44 23.157 83.153 1949 65.56 5.90±0.88

45 Swarna Surguja Surguja PO-CG-45 23.157 83.153 1949 66.67 6.00±0.82

46 Jirafal Surguja Surguja PO-CG-46 23.157 83.153 1949 21.11 1.90±0.57

47 IR-36 Surguja Surguja PO-CG-47 23.157 83.153 1949 33.33 3.00±0.67

48 US-312 Surajpur Surajpur PO-CG-48 23.176 83.127 1884 23.33 2.10±0.88

49 Swarna Surajpur Surajpur PO-CG-49 23.176 83.127 1884 62.22 5.60±0.97

50 Mahamaya Surajpur Surajpur PO-CG-50 23.176 83.127 1884 62.22 5.60±1.17

51 Badshah Surajpur Surajpur PO-CG-51 23.176 83.127 1884 24.44 2.20±0.79

52 Maheshwari Surajpur Surajpur PO-CG-52 23.176 83.127 1884 20.00 1.80±0.63

53 Indira Sona Surajpur Surajpur PO-CG-53 23.218 81.277 1886 42.22 3.80±0.97

S.

No. Cultivars Block District

Agro-

climatic

Zone

Isolates Latitude Longitude Altitude PDI(%) Score

(Mean±Stdev)

54 Gomati Surajpur Surajpur PO-CG-54 23.218 81.277 1886 32.22 2.90±0.32

55 Swarna Ambikapur Surguja PO-CG-55 23.696 82.216 1878 85.56 7.70±0.82

56 Maheshwari Ambikapur Surguja PO-CG-56 23.696 82.216 1878 64.44 5.80±1.03

57 Mahamaya Ambikapur Surguja PO-CG-57 23.696 82.216 1878 65.56 5.90±0.88

58 Indira Barani Dhan-1 Ambikapur Surguja PO-CG-58 23.696 82.216 1878 44.44 4.00±0.82

59 PAC-507 Ambikapur Surguja PO-CG-59 23.696 82.216 1878 42.22 3.80±0.79

60 Badshah Ambikapur Surguja PO-CG-60 23.218 81.277 1886 25.56 2.30±0.95

61 Dayal Ambikapur Surguja PO-CG-61 23.218 81.277 1886 36.67 3.30±0.95

62 Bamleshwari Ambikapur Surguja PO-CG-62 23.218 81.277 1886 33.33 3.00±0.67

63 Danteshwari Ambikapur Surguja PO-CG-63 23.218 81.277 1886 33.33 3.00±0.82

Mean 47.16

Figure 4.1.a Per cent Disease Index of rice blast in Bastar Plateau Zone

Figure 4.1.b Per cent Disease Index of rice blast in Chhattisgarh Plains Zone

64.44 65.56

56.67 61.11

26.67 32.22

58.89

30.00

67.78

32.22

23.33

65.56 62.22

20.00

42.22

87.78

32.22 31.11

37.78

0.00

10.00

20.00

30.00

40.00

50.00

60.00

70.00

80.00

90.00

100.00P

er c

ent

Dis

ease

In

dex

Cultivars

36.67

26.67

40.00 33.33

37.78 34.44 35.56 38.89

36.67 33.33

35.56

48.89

31.11 27.78

38.89

28.89

38.89

0.00

10.00

20.00

30.00

40.00

50.00

60.00

Per

cen

t D

isea

se I

nd

ex

Cultivars

Figure 4.1.c Per cent Disease Index of rice blast in North Hills Zone

Figure 4.1.d Mean Per cent Disease Index in three different agro climatic

Zones of Chhattisgarh

74.44

42.22 48.89

84.44

48.89 45.56

44.44

65.56 66.67

21.11

33.33

23.33

62.22 62.22

24.44 20.00

42.22

32.22

85.56

64.44 65.56

44.44 42.22

25.56

36.67 33.33

33.33

0.00

10.00

20.00

30.00

40.00

50.00

60.00

70.00

80.00

90.00

Du

bra

j (B

alra

mpu

r)

Poin

eer-

575

…

Bam

lesh

war

i…

Sw

arn

a (B

alra

mp

ur)

Mah

amay

a…

US

-31

2 (

Surg

uja

)

US

-35

0 (

Surg

uja

)

Mah

eshw

ari

(Su

rgu

ja)

Sw

arn

a (S

urg

uja

)

Jira

fal

(Surg

uja

)

IR-3

6 (

Su

rgu

ja)

US

-31

2 (

Sura

jpur)

Sw

arn

a (S

ura

jpu

r)

Mah

amay

a (S

ura

jpur)

Bad

shah

(S

ura

jpur)

Mah

eshw

ari…

Ind

ira

Son

a (S

ura

jpu

r)

Go

mat

i (S

ura

jpu

r)

Sw

arn

a (S

urg

uja

)

Mah

eshw

ari

(Su

rgu

ja)

Mah

amay

a (S

urg

uja

)

Ind

ira

Bar

ani

Dhan

-…

PA

C-5

07 (

Surg

uja

)

Bad

shah

(S

urg

uja

)

Day

al (

Surg

uja

)

Bam

lesh

war

i…

Dan

tesh

war

i (S

urg

uja

)

Per

cen

t D

isea

se I

nd

ex

Cultivars

47.25

35.49

47.16

Per cent Disease Index (PDI)

Bastar Plateau

Chhattisgarh Plains

North Hills

4.1.4 Pathogenicity test

The pathogenicity test of sixty three P. oryzae isolates from different agro-

climatic zones of Chhattisgarh were tested on susceptible rice cultivar, HR-12

under glasshouse conditions. The inoculated plants showed visible symptoms after

6-7 days of inoculation under congenial environment maintained by providing high

humidity under plastic cover. The artificially inoculated plants showed the similar

symptoms as the infected plants in the field. The fungus re-isolated from the

inoculated leaves gave the similar morphological and cultural characters as the

original one as described earlier.

Highly significant differences were observed among the isolates of leaf

blast disease using IRRI scale, 1996. The results were summarized in Table 4.2,

4.3 and Figure 4.2 shows that the highest PDI i.e., 96.30 per cent and lowest PDI

i.e., 51.85 per cent was recorded in sixty three isolates.

The maximum PDI i.e., 96.30 per cent was recorded by four different

isolates (PO-CG-16, PO-CG-37, PO-CG-40 and PO-CG-55) followed by 92.59 per

cent PDI was observed by two isolates (PO-CG-1 and PO-CG-4), 88.89 per cent

PDI by two isolates (PO-CG-2 and PO-CG-57). Similarly, 85.19 per cent PDI was

recorded by eight isolates (PO-CG-9, PO-CG-12, PO-CG-13, PO-CG-44, PO-CG-

45, PO-CG-49, PO-CG-50 and PO-CG-56), 81.48 and 74.07 per cent PDI was

recorded by PO-CG-3 and PO-CG-7 isolates, 70.37 per cent PDI was recorded by

six isolates (PO-CG-15, PO-CG-35, PO-CG-39, PO-CG-48, PO-CG-59 and PO-

CG-60), 66.67 per cent PDI by two isolates (PO-CG-38 and PO-CG-51), 62.96

per cent PDI by seven isolates (PO-CG-14, PO-CG-21, PO-CG-31, PO-CG-41,

PO-CG-43, PO-CG-58 and PO-CG-63), 59.26 per cent PDI by twelve isolates

(PO-CG-5, PO-CG-8, PO-CG-11, PO-CG-18, PO-CG-23, PO-CG-26, PO-CG-29,

PO-CG-32, PO-CG-46, PO-CG-54, PO-CG-61 and PO-CG-62) and 55.56 per cent

PDI by two isolates (PO-CG-27 and PO-CG-52), were found respectively. The

lowest PDI 51.85 per cent was found by sixteen isolates i.e., PO-CG-6, PO-CG-10,

PO-CG-17, PO-CG-19, PO-CG-20, PO-CG-22, PO-CG-24, PO-CG-25, PO-CG-

28, PO-CG-30, PO-CG-33, PO-CG-34, PO-CG-36, PO-CG-42, PO-CG-47 and

PO-CG-53.

These results are in close proximity with the findings of Saifulla et al.,

2011, Prasad et al., 2011, Ghatak et al., 2013 and Ramesh et al., 2017.

Thus the fungus causing the leaf blast disease in rice crop under different

regions of Chhattishgarh was established as P. oryzae Cavara.

Table 4.2 Pathogenicity of rice blast isolates collected from different agro

climatic zones of Chhattisgarh

S. No. Isolates Score (IRRI, 1996) PDI*

1 PO-CG-1 8.3 92.59

2 PO-CG-2 8.0 88.89

3 PO-CG-3 7.3 81.48

4 PO-CG-4 8.3 92.59

5 PO-CG-5 5.3 59.26

6 PO-CG-6 4.7 51.85

7 PO-CG-7 6.7 74.07

8 PO-CG-8 5.3 59.26

9 PO-CG-9 7.7 85.19

10 PO-CG-10 4.7 51.85

11 PO-CG-11 5.3 59.26

12 PO-CG-12 7.7 85.19

13 PO-CG-13 7.7 85.19

14 PO-CG-14 5.7 62.96

15 PO-CG-15 6.3 70.37

16 PO-CG-16 8.7 96.30

17 PO-CG-17 4.7 51.85

18 PO-CG-18 5.3 59.26

19 PO-CG-19 4.7 51.85

20 PO-CG-20 4.7 51.85

21 PO-CG-21 5.7 62.96

22 PO-CG-22 4.7 51.85

23 PO-CG-23 5.3 59.26

24 PO-CG-24 4.7 51.85

25 PO-CG-25 4.7 51.85

26 PO-CG-26 5.3 59.26

27 PO-CG-27 5.0 55.56

S. No. Isolates Score (IRRI, 1996) PDI*

28 PO-CG-28 4.7 51.85

29 PO-CG-29 5.3 59.26

30 PO-CG-30 4.7 51.85

31 PO-CG-31 5.7 62.96

32 PO-CG-32 5.3 59.26

33 PO-CG-33 4.7 51.85

34 PO-CG-34 4.7 51.85

35 PO-CG-35 6.3 70.37

36 PO-CG-36 4.7 51.85

37 PO-CG-37 8.7 96.30

38 PO-CG-38 6.0 66.67

39 PO-CG-39 6.3 70.37

40 PO-CG-40 8.7 96.30

41 PO-CG-41 5.7 62.96

42 PO-CG-42 4.7 51.85

43 PO-CG-43 5.7 62.96

44 PO-CG-44 7.7 85.19

45 PO-CG-45 7.7 85.19

46 PO-CG-46 5.3 59.26

47 PO-CG-47 4.7 51.85

48 PO-CG-48 6.3 70.37

49 PO-CG-49 7.7 85.19

50 PO-CG-50 7.7 85.19

51 PO-CG-51 6.0 66.67

52 PO-CG-52 5.0 55.56

53 PO-CG-53 4.7 51.85

54 PO-CG-54 5.3 59.26

55 PO-CG-55 8.7 96.30

56 PO-CG-56 7.7 85.19

57 PO-CG-57 8.0 88.89

58 PO-CG-58 5.7 62.96

59 PO-CG-59 6.3 70.37

60 PO-CG-60 6.3 70.37

61 PO-CG-61 5.3 59.26

62 PO-CG-62 5.3 59.26

63 PO-CG-63 5.7 62.96

Table 4.3 Pathogenicity test of rice blast isolates collected from different agro-

climatic zones of Chhattisgarh

S. No. PDI No. of

isolates Name of Isolates

1 96.30 4 PO-CG-16, PO-CG-37, PO-CG-40 and PO-CG-55

2 92.59 2 PO-CG-1 and PO-CG-4

3 88.89 2 PO-CG-2 and PO-CG-57

4 85.19 8 PO-CG-9, PO-CG-12, PO-CG-13, PO-CG-44, PO-

CG-45, PO-CG-49, PO-CG-50 and PO-CG-56

5 81.48 1 PO-CG-3

6 74.07 1 PO-CG-7

7 70.37 6 PO-CG-15, PO-CG-35, PO-CG-39, PO-CG-48,

PO-CG-59 and PO-CG-60

8 66.67 2 PO-CG-38 and PO-CG-51

9 62.96 7 PO-CG-14, PO-CG-21, PO-CG-31, PO-CG-41,

PO-CG-43, PO-CG-58 and PO-CG-63

10 59.26 12

PO-CG-5, PO-CG-8, PO-CG-11, PO-CG-18, PO-

CG-23, PO-CG-26, PO-CG-29, PO-CG-32, PO-

CG-46, PO-CG-54, PO-CG-61 and PO-CG-62

11 55.56 2 PO-CG-27 and PO-CG-52

12 51.85 16

PO-CG-6, PO-CG-10, PO-CG-17, PO-CG-19, PO-

CG-20, PO-CG-22, PO-CG-24, PO-CG-25, PO-

CG-28, PO-CG-30, PO-CG-33, PO-CG-34, PO-

CG-36, PO-CG-42, PO-CG-47 and PO-CG-53

Figure 4.2 Pathogenicity of rice blast isolates collected from different agro climatic zones of Chhattisgarh

0.00

20.00

40.00

60.00

80.00

100.00

120.00

PO

-CG

-1

PO

-CG

-2

PO

-CG

-3

PO

-CG

-4

PO

-CG

-5

PO

-CG

-6

PO

-CG

-7

PO

-CG

-8

PO

-CG

-9

PO

-CG

-10

PO

-CG

-11

PO

-CG

-12

PO

-CG

-13

PO

-CG

-14

PO

-CG

-15

PO

-CG

-16

PO

-CG

-17

PO

-CG

-18

PO

-CG

-19

PO

-CG

-20

PO

-CG

-21

PO

-CG

-22

PO

-CG

-23

PO

-CG

-24

PO

-CG

-25

PO

-CG

-26

PO

-CG

-27

PO

-CG

-28

PO

-CG

-29

PO

-CG

-30

PO

-CG

-31

PO

-CG

-32

PO

-CG

-33

PO

-CG

-34

PO

-CG

-35

PO

-CG

-36

PO

-CG

-37

PO

-CG

-38

PO

-CG

-39

PO

-CG

-40

PO

-CG

-41

PO

-CG

-42

PO

-CG

-43

PO

-CG

-44

PO

-CG

-45

PO

-CG

-46

PO

-CG

-47

PO

-CG

-48

PO

-CG

-49

PO

-CG

-50

PO

-CG

-51

PO

-CG

-52

PO

-CG

-53

PO

-CG

-54

PO

-CG

-55

PO

-CG

-56

PO

-CG

-57

PO

-CG

-58

PO

-CG

-59

PO

-CG

-60

PO

-CG

-61

PO

-CG

-62

PO

-CG

-63

Per

cen

t D

isea

se I

nd

ex

P. oryzae isolates

4.1.5 Virulence analysis and race identification

The eight (8) international host differentials were screened against 15

isolates of P. oryzae collected from different agro climatic regions of Chhattisgarh

under glasshouse conditions at ICAR-IIRR, Hyderabad to monitor and identify the

virulence and races of the pathogens. The host differentials produced a varying

degree of reactions ranging from resistant to susceptible for fifteen (15) isolates of

the pathogen. Typical blast symptoms were developed on all the susceptible

differentials whereas un-inoculated control plants were free from infection. The

differentials showed different reactions to the isolates of the pathogen in the 0-9

point scale as shown in the Table 3.4 and Plate 3.2 (Materials and Methods)

designated by IRRI (1996).

The primary aim of this study was to examine the relativity of a collection

of P. oryzae isolates that represent the large collection of races from Chhattisgarh

states. Among the fifteen isolates, 15 races (IA-48, IA-30, IA-14, ID-16, IA-8, IB-

55, IA-46, IC-16, IA-40, IA-64, IG-2, IA-46, IB-32, IA-124 and IA-93) were

detected (Table 4.4 and 4.5). Most frequently occurred race was IA (10 isolates)

followed by IB (2 isolates) and IC, ID, IG (1 isolate) (Table 4.4).

The races i.e., IA-48, IA-30 and IA-14 were found in Bastar region, ID-16,

IA-8, IB-55, IA-46, IC-16, IA-40, IA-64, IG-2 and IA-124 were found in

Dantewada, Narayanpur, Kanker, Dhamtari, Janjgir-Champa, Bilaspur,

Gariyabandh, Balrampur and Surajpur, IB-32, IA-93 and IA-46 were found in

Surguja district. IA-48, IA-30, IA-14, ID-16 and IA-8 races were found at Bastar

Plateau Zone, IB-55, IA-46, IC-16, IA-40 and IA-64 races were found in

Chhattisgarh Plains Zone and IG-2, IA-46, IB-32, IA-124 and IA-93 races were

found in North Hills Zone. (Table 4.5).

It may be concluded that the races of P. oryzae identified in the present

investigation may be virulent, irrespective of their distribution in different

geographical locations as evidenced by the occurrence of blast in moderate to

severe form in all the selected villages in the Chhattisgarh. Further, frequency of

distribution of the race(s) prevalent in particular area was also influenced by the

rice variety. Similar observations were made by Correa et al. (1993) who stated

that M. grisea expressed its virulence spectrum irrespective of geographical

location.

The fifteen isolates were highly aggressive on Raminad Strain-3 and Zenith

followed by Usen, Sha-Tiao-Tsao and NP-125. Least aggressive on Kanto

followed by Caloro and Dular (Table 4.4).

There was significant variation observed among the races for disease

severity. The transition zone comprised of variable races groups IA and IB which

may be due to wide host genetic base observed in Bastar Plateau, Chhattisgarh

Plains and North Hills Zones.

These results are coincided with the finding of many of the workers

(Srinivasprasad et al., 1998; Singha and Maibangsa, 2003; Muralidharan et al.,

2004; Karthikeyan et al., 2013 and Tanaka et al., 2016).

Srinivasprasad et al. (1998) isolated the rice blast fungus, P. grisea from

two weed hosts Digitaria ciliaris and D. marginata and pathogenicity was

confirmed by cross inoculation to rice plants. By inoculating on the international

blast differentials the race of weed hosts was found to be identical to the race (IC-

12) which infects rice plant.

Muralidharan et al. (2004) showed the performance of NILs were

marginally superior to the resistant checks (Tadukan, Rasi, Tetep and IR 64) and

the international blast differential Raminad Strain 3. In the present study, fifteen

(15) isolates were showing highly aggressiveness on Raminad Strain 3.

Karthikeyan et al. (2013) carried out virulence characteristic analysis and

identification of new races of rice blast fungus (M. grisea) from India. In the

present study, new races of P. oryzae were found from different regions of

Chhattisgarh.

Tanaka et al., 2016 collected 310 rice blast (P. oryzae C.) isolates from

Japan which showed wide variation in race. Similarly in the present study, fifteen

isolates were collected from different rice growing regions of Chhattisgarh which

showed variations in race.

Table 4.4 Disease reaction of P. oryzae races on host differentials

S.No. Isolates BL-12

Raminad strain-3

BL-13

Zenith

BL-14

NP-125

BL-15

Usen BL-16 Dular

BL-17

Kanto

BL-18

Sha-tiao-tsao BL-19 Caloro

Check

HR-12 Ratio (R/S) Race

1 PO-CG-02 S S R S R R R R S 5R:4S IA-48

2 PO-CG-10 S S S R R R S R S 4R:5S IA-30

3 PO-CG-12 S S S S R R S R S 3R:6S IA-14

4 PO-CG-18 R R R S R R R R S 7R:2S ID-16

5 PO-CG-19 S S S S S R R R S 3R:6S IA-8

6 PO-CG-20 R S R R S R R S S 5R:4S IB-55

7 PO-CG-25 S S R S R R S R S 4R:5S IA-46

8 PO-CG-34 R R S S R R R R S 6R:3S IC-16

9 PO-CG-35 S S R S S R R R S 4R:5S IA-40

10 PO-CG-36 S S R R R R R R S 6R:3S IA-64

11 PO-CG-37 R R R R R R S R S 7R:2S IG-2

12 PO-CG-42 S S R S R R S R S 4R:5S IA-46

13 PO-CG-43 R S S R R R R R S 6R:3S IB-32

14 PO-CG-48 S R R R R S R R S 6R:3S IA-124

15 PO-CG-56 S R S R R R S S S 4R:5S IA-93

R- Resistance, S- Suseptible

Table 4.5 Races of P. oryzae in different agro climatic zones of Chhattisgarh

Agroclimatic Zone Districts Isolates Ratio (R/S) Race

ZONE-I

Bastar

PO-CG-02 5R:4S IA-48

PO-CG-10 4R:5S IA-30

PO-CG-12 3R:6S IA-14

Dantewada PO-CG-18 7R:2S ID-16

Narayanpur PO-CG-19 3R:6S IA-8

ZONE-II

Kanker PO-CG-20 5R:4S IB-55

Dhamtari PO-CG-25 4R:5S IA-46

Janjgir-Champa PO-CG-34 6R:3S IC-16

Bilaspur PO-CG-35 4R:5S IA-40

Gariyabandh PO-CG-36 6R:3S IA-64

ZONE-III

Balrampur PO-CG-37 7R:2S IG-2

Surguja

PO-CG-42 4R:5S IA-46

PO-CG-43 6R:3S IB-32

PO-CG-48 6R:3S IA-124

PO-CG-56 4R:5S IA-93

4.1.6 Cultural diversity studies

Diversity in cultural characteristics of P. oryzae isolates was studied on oat

meal agar medium by following standard procedures as mentioned in previous

chapter. Variation was observed in colony characteristics viz., growth, colour of the

vegetative mycelium, colony diameter and surface appearance. The perusal of the

data given in the Table 4.6 and Figure 4.3 shows that the colony growth of P.

oryzae isolates on oat meal agar differed significantly with each other. The colony

diameter ranged from 77 mm (PO-CG-14 and PO-CG-52) to 90 mm (PO-CG-10,

PO-CG-11, PO-CG-22, PO-CG-34, PO-CG-36, PO-CG-42, PO-CG-43, PO-CG-

48, PO-CG-49 and PO-CG-50). The results of the sixty three isolates were grouped

into twelve categories. First group has ten isolates with greyish white mycelium

and smooth surface appearance. This group includes PO-CG-1, PO-CG-3, PO-CG-

8, PO-CG-13, PO-CG-14, PO-CG-18, PO-CG-28, PO-CG-32, PO-CG-37 and PO-

CG-47 with range of mycelial growth in diameter from 77 mm to 88 mm. Second

group has three isolates (PO-CG-19, PO-CG-23 and PO-CG-25) with range of

mycelial growth in diameter 85 mm to 86 mm showed greyish white color

mycelium with rough surface appearance. Third group has only one isolate PO-

CG-60 with 80 mm colony diameter was recorded which showed greyish black

color mycelium with smooth surface appearance. Fourth group had fifteen isolates

with grey color mycelium with smooth surface appearance, which includes PO-

CG-5, PO-CG-6, PO-CG-27, PO-CG-38, PO-CG-39, PO-CG-40, PO-CG-41, PO-

CG-46, PO-CG-49, PO-CG-53, PO-CG-55, PO-CG-56, PO-CG-57, PO-CG-58

and PO-CG-62 with range of mycelial growth in diameter from 78 mm to 90 mm.

Whereas, Fifth group has six isolates (PO-CG-7, PO-CG-15, PO-CG-26, PO-CG-

42, PO-CG-43 and PO-CG-48) with 82 mm to 90 mm mycelial colony showed

white mycelium with smooth surface appearance. Sixth group has five isolates

showing white mycelium with rough surface appearance that includes PO-CG-2,

PO-CG-4, PO-CG-11, PO-CG-17 and PO-CG-24 with 82 mm to 90 mm diameter

mycelial growth.

Seventh group has twelve isolates i.e., PO-CG-9, PO-CG-16, PO-CG-21,

PO-CG-29, PO-CG-30, PO-CG-36, PO-CG-44, PO-CG-45, PO-CG-50, PO-CG-

51, PO-CG-61 and PO-CG-63 from 77 mm to 88 mm diameter mycelial growth

showing whitish grey mycelium with smooth surface appearance. Eighth group has

whitish grey mycelium from 79 mm to 90 mm diameter mycelial growth with

rough surface appearance (PO-CG-54). Ninth group has blackish white mycelium

with smooth surface (PO-CG-10 and PO-CG-12) from 80 mm to 90 mm mycelial

growth. Tenth group has blackish grey color mycelium with smooth surface (PO-

CG-35, PO-CG-52 and PO-CG-59) from 77 mm to 90 mm diameter mycelial

growth. Eleventh group has one isolate (PO-CG-31) showing blackish grey

mycelium with rough surface appearance with 86 mm diameter mycelium colony.

Twelfth group has four isolates (PO-CG-20, PO-CG-22, PO-CG-33 and PO-CG-

34) showing whitish black colony with smooth texture from 81 mm to 90 mm

diameter mycelial growth (Table 4.7 & Plate 4.2).

Isolates collected from the cultivar Swarna in Bastar Plateau Zone showing

greyish white mycelium with smooth surface (PO-CG-1) and whitish grey with

smooth surface (PO-CG-16), isolates (PO-CG-40, PO-CG-49 and PO-CG-55)

from North Hills Zone showing grey mycelium with smooth surface and whitish

grey mycelium with smooth surface (PO-CG-45) on oat meal agar medium and

showing excellence sporulation (Index-4). PO-CG-9 isolate collected in the

cultivar Swarna from Bastar Plateau Zone showing greyish white mycelium with

smooth surface, PO-CG-22 and PO-CG-26 isolates collected in the cultivar

Swarna from Chhattisgarh Plains Zone showing whitish black mycelium with

smooth surface and white mycelium with smooth surface, respectively with poor

sporulation (Index-1). PO-CG-39 and PO-CG-62 isolates collected in the cultivar

Bamleshwari from North Hills Zone showing grey mycelium and smooth surface

with fair sporulation (Index-2) and PO-CG-2 isolate also collected in the cultivar

Bamleshwari from Bastar Plateau Zone showing white mycelium and rough

surface with good sporulation (Index-3). PO-CG-3 isolate collected in the cultivar

Indira Sona from Bastar Plateau Zone showing greyish white mycelium and

smooth surface, whereas, PO-CG-53 collected in same cultivar from North Hills

Zone showing grey mycelium and smooth surface with good sporulation (Index-3).

Isolates collected from cultivar Mahamaya in Bastar Plateau Zone showing

white mycelium with rough surface (PO-CG-4) and greyish white with rough

surface (PO-CG-19), while, in Chhattisgarh Plains Zone showing whitish grey and

whitish black mycelium with smooth surface (PO-CG-30 and PO-CG-33), in

North Hills Zone showing (PO-CG-50, PO-CG-41 and PO-CG-57) whitish grey

mycelium with smooth surface with good sporulation (Index-3), whereas, PO-CG-

28 isolate collected from same cultivar from Chhattishgarh Plains Zones showing

greyish white mycelium with smooth surface with poor sporulation (Index-1).

PO-CG-5 isolate collected from the cultivar MTU1001 in Bastar Plateau

Zone showing grey mycelium with smooth surface with good sporulation (Index-

3). PO-CG-8 and PO-CG-14 isolates were collected from the cultivar Safari in

Bastar Plateau Zone showing greyish white mycelium with smooth surface with

poor and fair sporulation, respectively (Index-1 & 2). PO-CG-11 isolate collected

from the cultivar MTU1010 in Bastar Plateau Zone showing white mycelium with

rough surface with poor sporulation (Index-1). PO-CG-17 Isolate collected from

the cultivar Indira Sugandhit in Bastar Plateau Zone showing white mycelium with

rough surface and PO-CG-35 isolate from Chhattisgarh Plains Zone showing

blackish grey mycelium with smooth surface with fair sporulation (Index-2).

PO-CG-18 Isolate collected in the cultivar Karma Mahsuri from Bastar

Plateau Zone showing greyish white mycelium and smooth surface with poor

sporulation (Index-2) and PO-CG-23 isolate from Chhattisgarh Plains Zone

showing greyish white mycelium and rough surface with fair sporulation (Index-

2). PO-CG-27 isolate collected in the cultivar Pusa Sugandghit from Chhattishgarh

Plains Zones showing grey mycelium and smooth surface with poor sporulation

(Index-1). PO-CG-59 isolate collected in the cultivar PAC 507 from North Hills

Zones showing blackish grey mycelium and smooth surface with excellent

sporulation (Index-4). PO-CG-38 isolate collected in the cultivar Poineer 575 from

North Hills Zones showing grey mycelium and smooth surface with good

sporulation (Index-3). PO-CG-42 and PO-CG-48 isolates were collected in the

cultivar US 312 from North Hills Zone showing white mycelium and smooth

surface with good sporulation (Index-3). PO-CG-43 isolate collected in the cultivar

US 350 from North Hills Zone showing white mycelium and smooth surface with

good sporulation (Index-3). PO-CG-52 isolate collected in the cultivar Maheshwari

from North Hills Zone showing blackish grey mycelium and smooth surface with

poor sporulation (Index-1). PO-CG-44 isolate showing whitish grey mycelium and

smooth surface with fair sporulation (Index-2) and PO-CG-56 isolate showing

grey mycelium and smooth surface with good sporulation (Index-3). PO-CG-46

isolate collected in the cultivar Jirafal from North Hills Zone showing grey

mycelium and smooth surface with good sporulation (Index-3). PO-CG-47 isolate

collected in the cultivar IR-36 from North Hills Zone showing greyish white

mycelium and smooth surface with excellent sporulation (Index-4). PO-CG-54

isolate collected in the cultivar Gomati from North Hills Zone showing whitish

grey mycelium and rough surface with fair sporulation (Index-2). PO-CG-51 and

PO-CG-60 isolates collected from the cultivar Badshah in North Hills Zone

showed whitish grey color mycelium with smooth surface and fair sporulation

(Index-2) and greyish black color mycelium with smooth surface and good

sporulation (Index-3). PO-CG-58 isolate collected from the cultivar Indira Barani

Dhan-1 in North Hills Zone showed grey color mycelium with smooth surface and

fair sporulation (Index-2). PO-CG-61 isolate collected from the cultivar Dayal in

North Hills Zone showed whitish grey color with smooth surface and excellent

sporulation (Index-4). PO-CG-63 isolate collected from the cultivar Danteshwari

in North Hills Zone showed whitish grey color mycelium with smooth surface and

poor sporulation (Index-1), (Table 4.6).

Table 4.6 Cultural characteristics of P. oryzae isolates from different rice

growing areas of Chhattisgarh

S.

No.

Isolates Colony dia.

(mm)

Colour of

mycelium

Surface

appearance

1 PO-CG-1 82 Greyish white Smooth

2 PO-CG-2 85 White Rough

3 PO-CG-3 85 Greyish white Smooth

4 PO-CG-4 82 White Rough

5 PO-CG-5 85 Grey Smooth

6 PO-CG-6 78 Grey Smooth

7 PO-CG-7 82 White Smooth

8 PO-CG-8 80 Greyish white Smooth

9 PO-CG-9 83 Whitish grey Smooth

10 PO-CG-10 90 Blackish white Smooth

11 PO-CG-11 90 White Rough

12 PO-CG-12 80 Blackish white Smooth

13 PO-CG-13 83 Greyish white Smooth

14 PO-CG-14 77 Greyish white Smooth

15 PO-CG-15 84 White Smooth

16 PO-CG-16 83 Whitish grey Smooth

17 PO-CG-17 85 White Rough

18 PO-CG-18 88 Greyish white Smooth

19 PO-CG-19 85 Greyish white Rough

20 PO-CG-20 84 Whitish black Smooth

21 PO-CG-21 85 Whitish grey Smooth

22 PO-CG-22 90 Whitish black Smooth

23 PO-CG-23 86 Greyish white Rough

24 PO-CG-24 88 White Rough

25 PO-CG-25 85 Greyish white Rough

26 PO-CG-26 83 White Smooth

27 PO-CG-27 82 Grey Smooth

28 PO-CG-28 81 Greyish white Smooth

29 PO-CG-29 85 Whitish grey Smooth

30 PO-CG-30 79 Whitish grey Smooth

31 PO-CG-31 86 Blackish grey Rough

32 PO-CG-32 82 Greyish white Smooth

S.

No.

Isolates Colony dia.

(mm)

Colour of

mycelium

Surface

appearance

33 PO-CG-33 81 Whitish black Smooth

34 PO-CG-34 90 Whitish black Smooth

35 PO-CG-35 88 Blackish grey Smooth

36 PO-CG-36 90 Whitish grey Smooth

37 PO-CG-37 82 Greyish white Smooth

38 PO-CG-38 82 Grey Smooth

39 PO-CG-39 78 Grey Smooth

40 PO-CG-40 82 Grey Smooth

41 PO-CG-41 80 Grey Smooth

42 PO-CG-42 90 White Smooth

43 PO-CG-43 90 White Smooth

44 PO-CG-44 79 Whitish grey Smooth

45 PO-CG-45 86 Whitish grey Smooth

46 PO-CG-46 88 Grey Smooth

47 PO-CG-47 80 Greyish white Smooth

48 PO-CG-48 90 White Smooth

49 PO-CG-49 90 Grey Smooth

50 PO-CG-50 90 Whitish grey Smooth

51 PO-CG-51 84 Whitish grey Smooth

52 PO-CG-52 77 Blackish grey Smooth

53 PO-CG-53 88 Grey Smooth

54 PO-CG-54 85 Whitish grey Rough

55 PO-CG-55 84 Grey Smooth

56 PO-CG-56 78 Grey Smooth

57 PO-CG-57 82 Grey Smooth

58 PO-CG-58 80 Grey Smooth

59 PO-CG-59 85 Blackish grey Smooth

60 PO-CG-60 80 Grayish black Smooth

61 PO-CG-61 82 Whitish grey Smooth

62 PO-CG-62 80 Grey Smooth

63 PO-CG-63 84 Whitish grey Smooth

C.D. 0.691

C.V. 0.509

*Colony diameter recorded after 14 days of mycelial growth

Figure 4.3 Radial growth of P. oryzae isolates

82

85 85

82

85

78

82

80

83

90 90

80

83

77

84 83

85

88

85 84

85

90

86

88

85

83 82

81

85

79

86

82 81

90

88

90

82 82

78

82

80

90 90

79

86

88

80

90 90 90

84

77

88

85 84

78

82

80

85

80

82

80

84

70

72

74

76

78

80

82

84

86

88

90

92

PO

-CG

-1

PO

-CG

-2

PO

-CG

-3

PO

-CG

-4

PO

-CG

-5

PO

-CG

-6

PO

-CG

-7

PO

-CG

-8

PO

-CG

-9

PO

-CG

-10

PO

-CG

-11

PO

-CG

-12

PO

-CG

-13

PO

-CG

-14

PO

-CG

-15

PO

-CG

-16

PO

-CG

-17

PO

-CG

-18

PO

-CG

-19

PO

-CG

-20

PO

-CG

-21

PO

-CG

-22

PO

-CG

-23

PO

-CG

-24

PO

-CG

-25

PO

-CG

-26

PO

-CG

-27

PO

-CG

-28

PO

-CG

-29

PO

-CG

-30

PO

-CG

-31

PO

-CG

-32

PO

-CG

-33

PO

-CG

-34

PO

-CG

-35

PO

-CG

-36

PO

-CG

-37

PO

-CG

-38

PO

-CG

-39

PO

-CG

-40

PO

-CG

-41

PO

-CG

-42

PO

-CG

-43

PO

-CG

-44

PO

-CG

-45

PO

-CG

-46

PO

-CG

-47

PO

-CG

-48

PO

-CG

-49

PO

-CG

-50

PO

-CG

-51

PO

-CG

-52

PO

-CG

-53

PO

-CG

-54

PO

-CG

-55

PO

-CG

-56

PO

-CG

-57

PO

-CG

-58

PO

-CG

-59

PO

-CG

-60

PO

-CG

-61

PO

-CG

-62

PO

-CG

-63

Rad

ial

gro

wth

(m

m)

P. oryzae isolates

Colony diameter (mm)

Table 4.7 Frequency distribution of P. oryzae isolates from Chhattisgarh

based on colony color and texture under in-vitro conditions

S.

No.

Colony

colour and

texture of P.

oryzae

No. of

isolates

Colony dia.

(mm) range Name of the isolates

1

Greyish white

with smooth

surface

10 77-88

PO-CG-1, PO-CG-3, PO-CG-8, PO-

CG-13, PO-CG-14, PO-CG-18, PO-

CG-28, PO-CG-32, PO-CG-37, PO-

CG-47

2

Greyish white

with rough

surface

3 85-86 PO-CG-19, PO-CG-23, PO-CG-25

3

Greyish black

with smooth

surface

1 80 PO-CG-60

4

Grey with

smooth

surface

15 78-90

PO-CG-5, PO-CG-6, PO-CG-27, PO-

CG-38, PO-CG-39, PO-CG-40, PO-

CG-41, PO-CG-46, PO-CG-49,PO-

CG-53, PO-CG-55, PO-CG-56, PO-

CG-57, PO-CG-58, PO-CG-62

5

White with

smooth

surface 6 82-90

PO-CG-7, PO-CG-15, PO-CG-26,

PO-CG-42, PO-CG-43, PO-CG-48

6 White with

rough surface 5 82-90

PO-CG-2, PO-CG-4, PO-CG-11, PO-

CG-17, PO-CG-24

7

Whitish grey

with smooth

surface 12 79-90

PO-CG-9, PO-CG-16, PO-CG-21,

PO-CG-29, PO-CG-30, PO-CG-36,

PO-CG-44, PO-CG-45, PO-CG-50,

PO-CG-51, PO-CG-61, PO-CG-63

8

Whitish grey

with rough

surface

1 85 PO-CG-54

9

Blackish white

with smooth

surface

2 80-90 PO-CG-10, PO-CG-12

10

Blackish grey

with smooth

surface

3 77-88 PO-CG-35, PO-CG-52, PO-CG-59

11

Blackish grey

with rough

surface

1 86 PO-CG-31

12

Whitish black

with smooth

surface 4 81-90

PO-CG-20, PO-CG-22, PO-CG-33,

PO-CG-34

Plate 4.2 Variation in cultural morphology of sixteen (16) P. oryzae isolates on

oat meal agar medium

1. PO-CG-1, 2.PO-CG-2, 3.PO-CG-3, 4.PO-CG-4, 5.PO-CG-5, 6.PO-CG-6,

7.PO-CG-7, 8.PO-CG-8, 9.PO-CG-9, 10.PO-CG-10, 11.PO-CG-11, 12.PO-CG-

12, 13.PO-CG-13, 14.PO-CG-14, 15.PO-CG-15, 16. PO-CG-16

1 2 3 4

5 6 7 8

9 10 11 12

13 14 15 16

Plate 4.2 Variation in cultural morphology of sixteen (16) P. oryzae isolates on

oat meal agar medium

17. PO-CG-17, 18. PO-CG-18, 19.PO-CG-19, 20.PO-CG-20, 21.PO-CG-21,

22.PO-CG-22, 23.PO-CG-23, 24.PO-CG-24, 25.PO-CG-25, 26.PO-CG-26,

27.PO-CG-27, 28.PO-CG-28, 29.PO-CG-29, 30.PO-CG-30, 31.PO-CG-31,

32.PO-CG-32

17 18 19 20

21 22 23 24

25 26 27 28

29 30 31 32

Plate 4.2 Variation in cultural morphology of sixteen (16) P. oryzae isolates on

oat meal agar medium

33. PO-CG-33, 34. PO-CG-34, 35.PO-CG-35, 36.PO-CG-36, 37.PO-CG-37,

38.PO-CG-38, 39.PO-CG-39, 40.PO-CG-40, 41.PO-CG-41, 42.PO-CG-42,

43.PO-CG-43, 44.PO-CG-44, 45.PO-CG-45, 46.PO-CG-46, 47.PO-CG-47,

48.PO-CG-48

33 34 35 36

37 38 39 40

41 42 43 44

45 46 47 48

Plate 4.2 Variation in cultural morphology of fifteen (15) P. oryzae isolates on

oat meal agar medium

49. PO-CG-49, 50. PO-CG-50, 51.PO-CG-51, 52.PO-CG-52, 53.PO-CG-53,

54.PO-CG-54, 55.PO-CG-55, 56.PO-CG-56, 57.PO-CG-57, 58.PO-CG-58,

59.PO-CG-59, 60.PO-CG-60, 61.PO-CG-61, 62.PO-CG-62, 63.PO-CG-63

49 50 51 52

53 54 55 56

57 58 59 60

61 62 63

The results are in close proximity with the findings of Ou, 1985; Meena,

2005; Ram et al. 2012; Srivastava et al., 2014, Gashaw et al., 2014, Asfaha et al.,

2015 and Panda et al., 2017.

Ou, 1985, observed the variation in cultural characteristics among the 12

isolates of P. grisea with respect to colony characters like type of growth, colony

color and margin. Similarly Meena (2005) reported the variability in aerial

mycelial growth of M. grisea isolates.

Ram et al. (2012) found isolates of the fungus from host differed in their

response in media for mycelial growth and sporulation.

Blast fungal isolates produced ring like, circular, irregular colonies with

rough and smooth margins on Oat meal agar medium having buff color, greyish

black to black color (Srivastava et al., 2014).

In the present study greyish white, blackish and whitish color with smooth

and rough surface observed. Similarly, Gashaw et al., 2014, recorded that the

colony color of blast isolates was usually grey with good growth.

Asfaha et al. (2015) observed optimum growth and good sporulation of

P.oryzae isolates on oat meal agar when compared with other media i.e. rice flour

agar, malt extract agar and potato dextrose agar.

Panda et al., 2017 observed that the colony color varied from grey,

greyish white, dark black, blackish white and greyish black. The colony diameters

of different isolates varied from each other likewise in the present study colony

color and colony diameter.

The variation among the radial growth may be due to several reasons like

autolysis of the mycelium and exhaustion of nutrients in the medium. Diversity in

cultural characters such as color of vegetative growth and texture, were noticed

among the isolates, but there was no clear-cut grouping between isolates from

different cultivars.

4.1.7 Morphological diversity studies

Sixty three isolates were collected from the different rice growing areas of

Chhattisgarh and study for various morphological characters. The results were

depicted in Table 4.8 reveal that the isolates differ significantly from each other

with respect to spore morphology i.e., conidial shape, size and sporulation index.

The fungus produced a single bottle-shaped conidiogenous cell bearing 3-5 conidia

arranged in a cluster at the active apical tip or they were formed successively and

sympodially in a characteristic pattern, i.e. the active apical tip moves to the side to

produce next conidium, resulting 3-5 conidia borne sympodially on mature

conidiophore. The successive and sympodial bearing of spores was commonly

observed with the isolates. Mature conidia of P. oryzae were pyriform, almost

hyaline to pale olive, 2-septate, 3-celled, the middle cell being wider and darker,

and exhibit a basal appendage at the point of attachment to the conidiophore. End

cells and middle cells germinate and produce a germ tubes (Plate 4.3).

In all isolates, observations were recorded on the conidial size (L×W) and

results are presented in the Table 4.8. The shape of the conidia was pyriform and

the size of the conidia ranged between 28.0 µm (PO-CG-63) to 39.6 µm (PO-CG-

1, PO-CG-25 and PO-CG-48). The length of the conidia ranged from 8 µm (PO-

CG-12, PO-CG-43 and PO-CG-63) to 11 µm (PO-CG-1, PO-CG-17, PO-CG-25,

PO-CG-32, PO-CG-48 and PO-CG-56) and width was ranged from 3.5 µm to 3.6

µm (all sixty three (63) isolates).

The degree of sporulation was compared with the growth patterns of the

pathogen. It was observed that isolates were having smooth surface showing more

sporulation compared with rough surface isolates but the isolates having smooth

surface (PO-CG-9 PO-CG-22, PO-CG-26, PO-CG-10, PO-CG-28, PO-CG-8, PO-

CG-11, PO-CG-18, PO-CG-27, PO-CG-52 and PO-CG-63) produced poor

sporulation (Table 4.9).

The isolates which showed excellent sporulation of index-4 were having

greyish white mycelium (PO-CG-1 and PO-CG-47), whitish grey mycelium (PO-

CG-16, PO-CG-45 and PO-CG-61), grey mycelium (PO-CG-40 and PO-CG-55)

greyish white mycelium (PO-CG-47) and blackish grey mycelium (PO-CG-59).

The isolates which showed poor sporulation of index-1 were having greyish white

mycelium (PO-CG-9, PO-CG-28, PO-CG-8 and PO-CG-18), whitish black

mycelium (PO-CG-22), white mycelium (PO-CG-26 and PO-CG-11), blackish

white (PO-CG-10), grey mycelium (PO-CG-27), blackish grey (PO-CG-52) and

whitish grey mycelium (PO-CG-63). (Table 4.8).

With regard to sporulation (Table 4.9), excellent sporulation (Index 4) was

noticed in PO-CG-1, PO-CG-16, PO-CG-40, PO-CG-45, PO-CG-55, PO-CG-59,

PO-CG-47 and PO-CG-61 whereas PO-CG-9, PO-CG-22, PO-CG-26, PO-CG-10,

PO-CG-28, PO-CG-8, PO-CG-11, PO-CG-18, PO-CG-27, PO-CG-52 and PO-

CG-63 isolates showed poor sporulation index. Variations in sporulation capacity

was also noticed among the isolates.

Plate 4.3 Pure culture, conidia and mycelium of P. oryzae after 14 days

of incubation at 280C temperature

The size and shape of spores are important criteria for classification and

identification of Pyricularia species. The results of the present study indicated that

morphological variation in terms of conidial size and sporulation and isolates

which has poor sporulation also recorded high disease severity.

These results are in accordance with the findings of Srivastava et al. (2014)

and Aoki (1935) who reported existence of variability among the isolates of M.

grisea with respect to conidial size and was well documented by many workers.

The present study observed that the colony diameter of different isolates

ranged from 77-90 mm, was accordance with the findings of Gashaw et al. (2014)

reported the colony diameters ranging from 67.40 to 82.50 mm and the conidial

shape of the different groups were pyriform (pear-shaped) with rounded base and

narrowed towards the tip which is pointed or blunt.

Veeraraghavan and Padmanabhan (1965) reported that the dimensions

(40X) of conidia produced by M. grisea ranged from 17.6 to 24.0 µm in length and

Conidia Conidia with mycelium Pure culture

8.0 to 9.6 µm in width. Nishikado (1917) measured the size of the conidia (100X)

and it was 16-33 x 5-9 μm. Usually 22-27 x 7-8 μm with a small basal appendage,

other dimensions were, basal appendage 1.2 – 1.8 (1.6) μm in width, basal cell 4.8-

11.5 (7.8) μm, middle cell 1.8-11.5 (6.6) μm, apical cell 6-14 (7) μm in length.

Tochinoi and Shimamura (1932) classified 39 isolates of P. grisea on the

basis of conidial structures and recorded the length of conidia ranged from 19.3-

29.9 µm and width ranged from 3.0-8.5 µm (100X). In the present study where the

length of conidia ranged from 8-11 µm and width ranged from 3.5-3.6 µm (40X).

In addition to this size and sporulation index was determined which was ranged

from 28-34 µm and 1-4, respectively.

Table 4.8 Conidial size and sporulation of different P. oryzae isolates

collected from different rice growing areas of Chhattisgarh

S. No. Isolates Conidia size (µm) (40x) approx.

Sporulation (1-4 index) Length Width Size

1 PO-CG-1 11.0 3.6 39.6 4

2 PO-CG-2 9.0 3.5 31.5 3

3 PO-CG-3 9.0 3.5 31.5 3

4 PO-CG-4 9.0 3.5 31.5 3

5 PO-CG-5 9.0 3.5 31.5 3

6 PO-CG-6 8.5 3.6 30.6 2

7 PO-CG-7 9.0 3.6 32.4 3

8 PO-CG-8 10.0 3.5 35.0 1

9 PO-CG-9 8.5 3.5 29.7 2

10 PO-CG-10 9.5 3.5 33.2 1

11 PO-CG-11 10.0 3.5 35.0 1

12 PO-CG-12 8.0 3.6 28.8 2

13 PO-CG-13 8.8 3.6 31.6 2

14 PO-CG-14 9.5 3.5 33.2 2

15 PO-CG-15 8.9 3.5 31.1 2

16 PO-CG-16 10.5 3.5 36.7 4

17 PO-CG-17 11.0 3.5 38.5 2

18 PO-CG-18 10.0 3.6 36.0 1

19 PO-CG-19 10.5 3.6 37.8 3

20 PO-CG-20 9.5 3.5 33.2 2

21 PO-CG-21 8.5 3.5 29.7 2

22 PO-CG-22 9.0 3.5 31.5 1

23 PO-CG-23 9.0 3.5 31.5 2

24 PO-CG-24 10.0 3.6 36.0 2

25 PO-CG-25 11.0 3.6 39.6 2

26 PO-CG-26 10.0 3.5 35.0 1

27 PO-CG-27 9.5 3.5 33.2 1

28 PO-CG-28 8.5 3.5 29.7 1

29 PO-CG-29 8.5 3.5 29.7 2

30 PO-CG-30 9.5 3.6 34.2 3

31 PO-CG-31 8.5 3.6 30.6 2

32 PO-CG-32 11.0 3.5 38.5 3

33 PO-CG-33 9.0 3.5 31.5 3

34 PO-CG-34 9.0 3.5 31.5 3

35 PO-CG-35 9.0 3.5 31.5 2

36 PO-CG-36 9.0 3.6 32.4 2

37 PO-CG-37 8.5 3.6 30.6 3

38 PO-CG-38 9.0 3.5 31.5 3

39 PO-CG-39 10.0 3.5 35.0 2

40 PO-CG-40 8.5 3.5 29.7 4

41 PO-CG-41 9.5 3.5 33.2 3

42 PO-CG-42 10.0 3.6 36.0 3

43 PO-CG-43 8.0 3.6 28.8 3

44 PO-CG-44 8.8 3.5 30.8 2

45 PO-CG-45 9.5 3.5 33.2 4

46 PO-CG-46 8.9 3.5 31.1 3

47 PO-CG-47 10.5 3.5 36.7 4

48 PO-CG-48 11.0 3.6 39.6 3

49 PO-CG-49 10.0 3.6 36.0 3

50 PO-CG-50 10.5 3.5 36.7 2

51 PO-CG-51 9.5 3.5 33.2 2

52 PO-CG-52 8.5 3.5 29.7 1

53 PO-CG-53 9.0 3.5 31.5 3

54 PO-CG-54 9.0 3.6 32.4 2

55 PO-CG-55 10.0 3.6 36.0 4

56 PO-CG-56 11.0 3.5 38.5 3

57 PO-CG-57 10.0 3.5 35.0 3

58 PO-CG-58 9.5 3.5 33.2 2

59 PO-CG-59 8.5 3.5 29.7 4

60 PO-CG-60 8.5 3.6 30.6 3

61 PO-CG-61 9.5 3.6 34.2 4

62 PO-CG-62 8.5 3.5 29.7 2

63 PO-CG-63 8.0 3.5 28.0 1

Table 4.9 Sporulation Index of different isolates of P. oryzae

S.

No. Sporulation No. of isolates

No. of

spores/microscopic

field (10x)

Index

1 Excellent 8 > 36 4

2 Good 22 25-36 3

3 Fair 23 13-24 2

4 Poor 10 < 12 1

4.1.8 Genetic diversity analysis using SSR markers

Sixty three (63) isolates of P. oryzae collected from thirteen districts of

Chhattishgarh were multiplied on potato dextrose broth (PDB) medium, DNA was

extracted by using CTAB method and analysed the genetic variability by using

SSR based molecular markers. Initially 13 SSR markers were screened for their

amplification potential, MGM-1 and MGM-21 were identified for the genetic

variability.

4.1.8.1 Allelic polymorphism and diversity analysis of P. oryzae

Sixty three isolates were assessed by using primers but among the 13

primers only two primers were amplified with sixty three (63) isolates of P.

oryzae. In the present study the polymorphic SSR markers detected a total of 4

alleles among the sixty three (63) isolates. Two (2) alleles were detected in MGM-

1 and MGM-21. The PIC values obtained for MGM 1 were 0.35 and MGM 21

0.29. (Table 4.10 and Fig. 4.4 and 4.5). In contrast to the present study, Kaye et al.

(2003) reported that 2-6 with average of 2.9 alleles per locus. Similar observations

were made by Zheng et al. (2008) with nine isolates. It is noteworthy here that

Kaye et al. (2003) analyzed a small collection of M. grisea isolates. Variation in

allele number in the present study could be due to small population size

(Varshney et al., 2009). Similarly, Suzuki et al. (2009) reported about 18 alleles

per locus among the 48 field isolates of M. grisea from two natural populations

from Japan. However, up to 9 alleles per locus were reported among the 96 isolates

from central Brazil (Brondani et al., 2000). The difference in the number of alleles

detected in P. oryzae isolates was significant and could be related to the sampling

strategy used to get well isolates in these areas. The PIC value ranged from 0.29 to

0.35 (Table 4.10).Similar observations were made by Brondani et al. (2000) who

found PIC (polymorphism information content) value for the Central Brazilian M.

grisea were 0.54 for MGM-1 and 0.44 for MGM-21 markers. Similar

observations, on PIC value were reported by Zheng et al. (2008).

The higher gene diversity values of the present study can be attributed to

the diverse nature of M. grisea isolates as analyzed in the study of Kaye et al.

(2003). Nevertheless, the reported PIC values for three SSR primer pairs may be

useful for selecting comparatively more informative markers in future for

assessment of molecular diversity of M. grisea isolates from India or elsewhere.

4.1.8.2 Cluster analysis

Magnoporthe grisea marker (MGM) primers scores were used to create a

data matrix to analyse genetic relationships using the NTSYS-pc software program

version 2.02 described by Rholf, (1993). Dendrogram constructed based on

Jaccard’s similarity coefficient using the marker data from P. oryzae isolates with

UPGMA analysis separated into clusters. Cluster analysis classified the isolates

with similarity range from 0 to 1.00. Overall topology of the dendrogram indicated

the presence of two major groups among sixty three (63) isolates. Several groups

were observed for subpopulations indicating high genetic variability within the

isolates. Out of sixty three (63) isolates, fifty seven (57) isolates were clustered

together in one group and remaining six isolates were clustered in another group.

Cluster-I further divided into three sub clusters (IA, IB and 1C). The sub cluster IA

consists of 8 isolates showed 95% similarity. Among these, most of the isolates

were collected from Bastar, Kanker, Dhamtari, Balrampur, Surajpur and Surguja

districts. The sub cluster IB consists of 34 isolates of these, most of the isolates

were collected from Bastar, Kanker, Dhamtari, Raipur, Bemetara, Bilaspur,

Balrampur, Surguja and Surajpur districts and the isolates showed 95% similarity.

The sub cluster IC consists of 15 isolates with 98% similarity and most of the

isolates from Bastar, Surajpur, Surguja, Balrampur, Gariyabandh, Narayanpur and

Kanker districts. (Fig. 4.4 and 4.5). Second cluster includes 6 isolates with 95%

similarity from Bastar, Dantewada, Janjgir-Champa, Balrampur and Surajpur

districts. (Figure 4.6).

The results are in close proximity with the findings of Mohan et al. (2012)

who observed great extent of variation among the isolates collected from different

endemic areas. Isolates collected from coastal Andhra Pradesh (Maruteru and

Nellore) share the high similarity of 64 % with Assam isolates. However the

present study the clusters IA showed 95% similarity, IB showed 95% and IC

showed 98% similarity, collected from rice growing areas. The less genetic

variation among these sixty three (63) isolates may be due to similar geography,

rice ecosystems and semi-dwarf in rice cultivation.

SSRs have been used only in few studies (Brondani et al., 2000, Kaye et

al., 2003, Zheng et al., 2008 and Suzuki et al., 2009) to assess the molecular

diversity in M. grisea that provided more information than rep-PCR analysis.

MGR-based fingerprinting was also reported by several workers (Viji et al., 2000,

Tosa et al., 2007, Tanaka et al., 2009, Le et al., 2010).

Genetic diversity of M. grisea isolates was evaluated by Mohan et al.

(2012) using 12 microsatellite primers and the PIC values were estimated for all

the markers, a high PIC value of 0.60 was observed with MGM - 21 and a low

PIC value of 0.24 was observed with MGM - 24, while the Pot2 primer displayed

a PIC value of 0.26. Similarly in the present study the PIC values of MGM-1 and

MGM-21 were 0.35 and 0.29.

Motlagh et al. (2015) evaluated the genetic diversity of P. grisea by using 14

microsatellite primers. Primer SSR43, 44 had the most polymorphic information

content (PIC = 0.85), observed number of alleles (na = 8), effective number of

alleles (ne = 3.76), Nei’s expected heterozygosity (Ne = 0.861) and Shannon’s

information index (I = 1.38).

Table 4.10 Polymorphic SSR markers and their PIC values

S. No. Primer No of bands

detected

No of alleles

detected PIC values

1 MGM-1 60 2 0.35

2 MGM-21 57 2 0.29

50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

50 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

50 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63

Figure 4.4 Amplification pattern of the marker MGM-1

50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

50 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

50 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63

Figure 4.5 Amplification pattern of the marker MGM-21

Figure 4.6 Dendrogram depiciting the genetic relationship of 63 isolates of P. oryzae collected from different regions of

Chhattisgarh on similarity coefficients calculated from SSR data

IA

IB

IC

Cluster-I

Cluster-II

4.2 Multilocation Evaluation of Near Isogenic Lines (NIL’S)

Carrying Different Blast Resistance Genes

The trial was conducted in Chhattisgarh and Telangana during Kharif 2016-

17. The introgressed lines having resistance genes in BPT5204, Improved Samba

mahsuri, Swarna and IR-64 were collected from the ICAR-IIRR, Rajendranagar.

These lines were screened for blast reaction at four different locations. Phenotypic

screening of these lines were carried out during Rabi 2017 and Kharif 2017 in

different agro climatic locations viz., IIRR Hyderabad, KVK Dhamatari (C.G.),

RMDCARS Ambikapur (C.G.) and SGCARS Jagdalpur (C.G.). Selected lines with

target genes, susceptible checks (HR-12 and CO-39) and resistant check (Rasi)

were incorporated for confirmation. These results indicated that MSP-1

(BPT5204×C101LAC), MSP-3 (BPT5204×Tetep), MSP-6

(BPT5204×C101LAC×C101A5×Tetep), MSP-7 (Swarna×C101LAC), MSP-8

(Swarna×C101A51), MSP-9 (Swarna×Tetep), MSP-11

(Swarna×C101LAC×Tetep), MSP-12 (Swarna×C101LAC×C101A5×Tetep),MSP-

13 (IR64×C101A51), MSP-14 (IR64×Tetep) and MSP-16 (Improved Samba

mahsuri×Tetep) showed complete resistance reaction (0-3) to blast disease at four

regions and susceptible parent as a control check, which had the maximum disease

incidence (7-9). MSP-2 (BPT5204×C101A51) showed resistance at IIRR,

Hyderabad and KVK, Dhamtari, highly resistance at RMDCARS, Ambikapur and

moderate resistance at SGCARS, Jagdalpur. MSP-4

(BPT5204×C101LAC×C101A51) showed resistance at IIRR Hyderabad,

RMDCARS, Ambikapur and SGCARS, Jagdalpur (C.G.), while moderate

resistance at KVK, Dhamtari. MSP-5 (BPT5204×C101LAC×Tetep) showed

moderate resistance at IIRR Hyderabad and RMDCARS, Ambikapur, while

resistance showed at SGCARS, Jagdalpur and highly resistance showed at KVK,

Dhamtari. MSP-10 (Swarna×C101LAC×C101A51) and MSP-15 (Improved

Samba mahsuri×C101A51) showed resistance at IIRR Hyderabad and SGCARS,

Jagdalpur while highly resistance showed at RMDCARS, Ambikapur and

moderate resistance showed at KVK, Dhamtari (Table 4.11).

Kulakarni and Chopra (1982) reported that the significant effect of

genotype and environment interaction might suggest that genotypes possess

different resistant genes is a structures of the population, in terms of virulence

genes varied across different locations.

Abamu et al. (1998) studied effects and Multiplicative Interaction Models

which are widely used for analyzing main-effects and genotype by-environment

(G×E) interactions in multilocation variety trials to gain insight into G×E in rice

blast, and identify genotypes with high and stable resistance to the disease.

Tadukan carrying resistance gene Pi-ta showed small lesions infecting <2%

leaf area indicating a very high level of durable resistance to blast disease. The

METs clearly demonstrated the expression of a high degree of resistance in A57

carrying three resistance genes (Pi-1, Pi-2 and Pi-4). A57 was identified as the best

line that exhibited resistance to blast across the country in all rice growing

environments irrespective of ecosystems (Muralidharan et al., 2004).

Similar trial was also conducted by Ghazanfar et al. (2009) found that the

prevalence of the resistance against rice blast pathogen was more common in the

course as compared to the fine grain germplasm lines of rice.

Lines with gene combinations Pi1+Pi2+Pi33+Pi54 and Pi1+Pi2+Pi33

were highly resistant to blast disease than those with single genes indicating that

these non-allelic genes have a complementary effect (Divya et al., 2013).

Challagulla et al. (2015) reported that the13 rice genotypes screened for

resistance of Australian rice genotypes against blast fungus, AAT9 expressed a

highly resistant response and AAT4, AAT6, AAT10, AAT11, AAT13, AAT17 and

AAT18 expressed resistance at various stages.

Ramesh et al. (2015) observed that the introgressed lines (ILM-16 and

ILM-29) with three genes (Pi1, Pi2 and Pi54) showed varied resistant reaction at

different locations. The introgressed lines (ILM-10, ILM-11, ILM-15 and ILM-30-

4) with two resistance genes (Pi1 and Pi2) showed moderately resistant reaction.

The introgressed line (ILM-30) with two resistance genes (Pi2 and Pi54) showed

moderately resistant reaction at three different locations.

The results of the present study are in agreement with the observation and

made by the above scientists.

Table 4.11 Performance of rice cultivars BPT5204, ISM, Swarna and IR-64 introgressed lines with blast resistance genes under

different agro climatic regions

SN Designation Cross Combination Genes Disease reaction to blast 0-9 Scale (IRRI, 1996)*

Ambikapur R/S Jagdalpur R/S Dhamtari R/S Hyderabad R/S

1 MSP-1 BPT5204×C101LAC Pi1 3.33±0.58 R 3.67±0.58 R 3.00±0.00 R 3.00±0.00 R

2 MSP-2 BPT5204×C101A51 Pi2 1.67±0.58 HR 4.00±0.00 MR 2.00±0.00 R 2.50±0.58 R

3 MSP-3 BPT5204×TETEP Pi54 3.67±0.58 R 3.33±0.58 R 1.67±0.58 HR 3.50±0.58 R

4 MSP-4 BPT5204×C101LAC×C101A51 Pi1 and Pi2 3.67±0.58 R 2.33±0.58 R 4.67±0.58 MR 3.00±0.00 R

5 MSP-5 BPT5204×C101LAC×TETEP Pi1 and Pi54 4.00±0.00 MR 3.00±0.00 R 1.67±0.58 HR 4.00±0.00 MR

6 MSP-6 BPT5204×C101LAC×C101A51×TETEP Pi1, Pi2 and Pi54 2.67±0.58 R 2.33±0.58 R 1.00±0.00 HR 2.50±0.58 R

7 MSP-7 SWARNA×C101LAC Pi1 1.00±0.00 HR 3.33±0.58 R 1.00±0.00 HR 1.50±0.58 HR

8 MSP-8 SWARNA×C101A51 Pi2 3.67±0.58 R 3.67±0.58 R 1.00±0.00 HR 2.50±0.58 R

9 MSP-9 SWARNA×TETEP Pi54 1.00±0.00 HR 3.33±0.58 R 1.67±0.58 HR 2.00±0.00 R

10 MSP-10 SWARNA×C101LAC×C101A51 Pi1 and Pi2 1.33±0.58 HR 2.67±0.58 R 4.67±0.58 MR 3.00±0.00 R

11 MSP-11 SWARNA×C101LAC×TETEP Pi1 and Pi54 3.67±0.58 R 2.33±0.58 R 3.00±0.00 R 1.50±0.58 HR

12 MSP-12 SWARNA×C101LAC×C101A51×TETEP Pi1, Pi2 and Pi54 3.00±0.00 R 1.67±0.58 HR 2.67±0.58 R 2.50±0.58 R

13 MSP-13 IR-64×C101A51 Pi2 2.00±0.00 R 3.33±0.58 R 2.67±0.58 R 2.00±0.00 R

14 MSP-14 IR-64×TETEP Pi54 1.00±0.00 HR 3.33±0.58 R 1.00±0.00 HR 3.00±0.00 R

15 MSP-15 ISM×C101A51 Pi2 1.00±0.00 HR 2.67±0.58 R 5.67±0.58 MR 3.00±0.00 R

16 MSP-16 ISM×TETEP Pi54 1.00±0.00 HR 2.33±0.58 R 1.67±0.58 HR 2.50±0.58 R

18 BPT 5204 Recurrent parent - 7.33±0.58 S 7.33±0.58 S 5.67±0.58 MR 7.50±0.58 S

17 SWARNA Recurrent parent - 8.67±0.58 HS 8.33±0.58 HS 6.33±0.58 S 8.50±0.58 HS

19 ISM Recurrent parent - 7.00±0.00 S 7.00±0.00 S 5.67±0.58 MR 7.50±0.58 S

20 IR-64 Recurrent parent - 2.67±0.58 R 3.33±0.58 R 4.67±0.58 MR 3.00±0.00 R

21 C101LAC Donor parent Pi1 3.00±0.00 R 5.33±0.58 MR 1.00±0.00 HR 3.00±0.00 R

22 C101A51 Donor parent Pi2 4.00±0.00 MR 4.67±0.58 MR 1.00±0.00 HR 3.00±0.00 R

23 TETEP Donor parent Pi54 1.00±0.00 HR 2.67±0.58 R 1.00±0.00 HR 1.00±0.00 HR

24 RASI Resistant check - 1.00±0.00 HR 2.33±0.58 R 1.00±0.00 HR 3.00±0.00 R

25 CO-39 Susceptible check - 7.67±0.58 S 8.67±0.58 HS 5.00±0.00 MR 9.00±0.00 HS

26 HR-12 Susceptible check - 9.00±0.00 HS 9.00±0.00 HS 6.33±0.58 S 9.00±0.00 HS

*Blast scale (IRRI, 1996), 0- HR, 1-R, 2 to 3-MR, 4 to 5-MS, 6 to 7-S, 8 to 9-HS; ISM-Improved Samba Mahsuri,

R/S- Resistant/Susceptible, HR-Highly Resistance, R-Resistance, MR-Moderate resistant, MS- Moderate Susceptible, S- Susceptible, HS- Highly Susceptible

4.3 Evaluation of the Bio-efficacy of Ocimum Leaf Decoctions For

Management of Rice Blast

4.3.1 In-vitro efficacy of extract of Ocimum spp. against P. oryzae

P. oryzae was tested against different Ocimum species (Ocimum sanctum,

Ocimum basilicum and Ocimum gratissimum) extracts by poisoned food

technique. These Ocimum species extracts were prepared in both water and

methanolic extract in three different concentrations i.e., 50%, 75% and 100% and

0.5%, 1% and 10%, respectively (Table 4.12 and Plate 4.4a&b). The water extract

of O. sanctum in three different concentrations i.e., 100%, 75% and 50% recorded

the inhibition of fungal growth as 92.59 per cent (6.67 mm), 31.86 per cent (61.33

mm) and 7.41 per cent (83.33 mm), respectively over the control while in case of

O. basilicum, inhibition of the fungal growth was 89.26 per cent (9.67 mm), 21.86

per cent (70.33 mm) and 2.59 per cent (87.67 mm) at 100%, 75% and 50%

concentrations, respectively, similarly O. gratissimum recorded 90.37 per cent

(8.67 mm), 27.41 per cent (65.33 mm) and 4.33 per cent (85.67 mm) of inhibition

of the fungal growth at 100%, 75% and 50% concentrations, respectively over the

control.

The methanolic extract of Ocimum species showed effective results,

reduced growth of P. oryzae as compared to the water extract. The methanolic

extract of O. sanctum, 10%, 1% and 0.5% reduced inhibition of fungal growth

were 96.67 per cent (3 mm), 40.74 per cent (53.67 mm) and 10.74 per cent (80.33

mm), respectively while O. basilicum reduced, 90.74 per cent (8.33mm), 27.41 per

cent (65.33 mm) and 5.196 per cent (85.33mm) inhibition of the fungal growth

over the control. The O. gratissimum reduced inhibition of the fungal growth were

91.86 per cent (7.33 mm), 31.86 per cent (61.33 mm) and 7.41 per cent (83.33

mm) at 10%, 1% and 0.5%, respectively over the control.

Similarly 100 % water extract of O. sanctum, inhibited the maximum

fungal radial growth (6.67 mm) while 50% of water extract inhibited minimum

fungal growth (83.33 mm), O. basilicum in 100 % water extract reduced the

maximum fungal growth (9.67 mm) while in 50% water extract reduced minimum

fungal growth (87.67 mm), while in case of O. gratissimum, reduced maximum

(8.67 mm) fungal growth in 100% water extract and minimum (85.67 mm) in 50%

water extract. Similarly, methanollic extract also inhibition the maximum fungal

growth in 10% of three Ocimum species (O. sanctum, O. basilicum and O.

gratissimum) and minimum in 0.5% concentration.

Of three species of Ocimum, the O. sanctum was reduced maximum

inhibition of the fungal growth i.e., 92.59 per cent (6.67 mm) and 96.67 per cent

(3.00 mm) in both water and methanolic extract at 100% and 10% concentrations,

respectively (Figure 4.7).

4.3.2 In-vivo efficacy of Ocimum leaf decoction in the management of rice

blast disease

The efficacy of three Ocimum species were assessed during Kharif 2016

and Kharif 2017 under uniform blast nursery (UBN) conditions. Observations were

recorded on leaf blast severity at four different intervals. In unsprayed control

nursery, the leaf blast PDI was 25.56 per cent, 57.41 per cent, 64.44 per cent, and

92.96 per cent. The differences in PDI before first spray in different nursery

indicated uniform distribution of rice blast (Table 4.13 a and b).

The Ocimim leaf decoction was evaluated against rice blast during Kharif

2016-17, it was observed that 50%, 75% and 100% of Ocimum sanctum in the

water extract showed 40.37 per cent, 30.37 per cent and 26.67 per cent PDI at

seven days after first spray, 53.33 per cent, 40.74 per cent and 28.15 per cent at

seven days after second spray, 74.07 per cent, 62.96 per cent and 39.63 per cent

PDI at seven days after third spray were recorded. Similarly, in the methanolic

extract 38.15 per cent, 29.26 per cent and 25.93 per cent PDI after seven days of

first spray, 51.48 per cent, 38.15 per cent and 28.15 per cent PDI after seven days

of second spray and 84.81 per cent, 68.89 per cent and 29.26 per cent PDI after

seven days of third spray at 0.5%, 1% and 10% were observed.

Table 4.12 Efficacy of Ocimum leaf decoctions against P. oryzae in in-vitro conditions

S.

No. Ocimum species

Water extract concentration (B-1) Methanolic extract concentration (B-2)

50 %

(C-1)

Per cent

Inhibition

75 %

(C-2)

Per cent

Inhibition

100 %

(C-3)

Per cent

Inhibition

0.5 %

(C-1)

Per cent

Inhibition

1 %

(C-2)

Per cent

Inhibition

10 %

(C-3)

Per cent

Inhibition

1

Ocimum

sanctum

(A-1)

83.33

(65.88) 7.41

61.33

(51.53) 31.86

6.67

(14.95) 92.59

80.33

(63.65) 10.74

53.67

(47.08) 40.74

3.00

(9.97) 96.67

2 Ocimum

basilicum (A-2)

87.67

(69.42) 2.59

70.33

(56.98) 21.86

9.67

(18.10) 89.26

85.33

(67.46) 5.19

65.33

(53.91) 27.41

8.33

(16.77) 90.67

3

Ocimum

gratissimum

(A-3)

85.67

(67.73) 4.33

65.33

(53.91) 27.41

8.67

(17.11) 90.37

83.33

(65.88) 7.41

61.33

(51.53) 31.86

7.33

(15.70) 91.86

4 Control (A-4) 90.00 (71.54) 90.00 (71.54)

*Figures in the parentheses are angular transformed values

Coefficient of Variation- 1.54

Factors C.D. SE (d) SE (m)

Factor (A) 0.29 0.15 0.1

Factor (B) 0.21 0.1 0.07

Factor C 0.25 0.13 0.09

Intraction AxB 0.41 0.21 0.15

Intraction AxC 0.51 0.25 0.18

Intraction BxC 0.36* 0.18 0.13

Intraction AxBxC 0.71* 0.36 0.25

* Significance

Figure 4.7 In vitro evaluation of water and methanolic extract of Ocimum leaf

decoction against P. oryzae

0

10

20

30

40

50

60

70

80

90

100

T-1 T-2 T-3 T-4 T-5 T-6 T-7 T-8 T-9 C

Per

Cen

t D

isea

se I

nd

ex

Treatments

Water extract Methanolic extract

Plate 4.4.a Efficacy of Ocimum leaf decoctions against P. oryzae in in-vitro

conditions with water extract

A. T-1 O. sanctum (50%), T-2 O. sanctum (75%), T-3 O. sanctum (100%),

T-4 O. basilicum (50%), T-5 O. basilicum (75%), T-6 O. basilicum

(100%), T-7 O. gratissimum(50%), T-8 O. gratissimum(75%), T-9 O.

gratissimum(100%),

C- Control

T-6 T-4

T-9 T-7

T-2

T-8

T-5

T-1 T-3

C

Plate 4.4.b Efficacy of Ocimum leaf decoctions against P. oryzae in in-vitro conditions with

methanolic extract

B. T-1 O. sanctum (50%), T-2 O. sanctum (75%), T-3 O. sanctum (100%), T-4

O. basilicum (50%), T-5 O. basilicum (75%), T-6 O. basilicum (100%), T-7

O. gratissimum(50%), T-8 O. gratissimum(75%), T-9 O. gratissimum(100%),

C- Control

T-6

T-9

1 3

4

7

C

The O. basilicum, the PDI of 40.00 per cent, 38.89 per cent and 35.93 per cent

in seven days after first spray, 49.26 per cent, 47.04 per cent and 36.30 per cent in

seven days after second spray and 80.0 per cent, 65.56 per cent and 48.52 per cent in

seven days after third spray were recorded with water extract. Similarly, the PDI of

39.26 per cent, 37.41 per cent and 34.81 per cent in seven days after first spray, 55.56

per cent, 48.15 per cent and 35.93 per cent in seven days after second spray and 89.63

per cent, 72.59 per cent and 36.67 per cent in seven days after third spray were

recorded with methanolic extract.

The O. gratissimum, the PDI of 42.59 per cent, 41.11 per cent and 34.44 per

cent in seven days after first spray, 47.78 per cent, 41.85 per cent and 39.26 per cent

in seven days after second spray and 82.96 per cent, 70.0 per cent and 51.85 per cent

in seven days after third spray were recorded with water extract. Similaraly, the PDI

of 41.48 per cent, 40.37 per cent and 34.44 per cent in seven days after first spray,

53.70 per cent, 45.93 per cent and 34.81 per cent in seven days after second spray and

85.56 per cent, 70.74 per cent and 34.44 per cent in seven days after third spray were

recorded with methanolic extract.

All the three Ocimum species, O. sanctum reduced blast pathogen in in-vivo

conditions. The lowest PDI (29.26%) was observed with O. sanctum @ 10%

methanolic extract and it was showed non- significant difference with the tricyclazole

which was recorded 28.52 per cent PDI in seven days after third spray (Table 4.13 a

and 4.13 b and Figure 4.8).

In the present study efficacy of Ocimum leaf decoction against blast disease

were tested in in vivo conditions. This results were agreement with the report of

workers worked on different pathogens with Ocimum extracts (Tewari, 1995; Tewari

and Mishra, 1990; Tewari, 2008; Upadhyaya et al., 2012). Significant inhibition of

mycelial growth in in-vitro condition with O. sanctum leaf extract (Tewari, 1995) and

ethanolic extract developed from O. sanctum ethanolic extract was tested against blast

disease of rice by Upadhyaya et al., 2012.

In the present study, Ocimum leaf extracts were assessed under in vitro and in

vivo conditions. The results showed significant effect in case of water and methanolic

extracts of O. sanctum. Some workers (Tewari and Nayak, 1991; Qasem and Abu-

Blan, 1996 and Amadioha, 2000) have worked on botanicals to control different

pathogens.

Neem leaf extract was found effective but comparably less significant than

standard fungicides and bio-agent in minimizing leaf blast intensity in rice (Gohel and

Chauhan, 2015 Amadioha, 2000). Plant extracts were tested for the control of (P.

grisea) blast of rice under field condition (Netam et al. (2011, Olufolaji et al. 2015,

Pandey (2015), Ramezani and Abdollahi (2015), Shafaullah and Khan (2016).

Table 4.13 a. Efficacy of Ocimum leaf extract in water for the control of rice

blast under UBN condition during Kharif 2016-17

Treatment (%) PDI (%)

Before spray 7 DA1S 7 DA2S 7 DA3S

O.sanctum (50) 25.56 40.37 (39.44)bc

53.33 (46.91) b

74.07 (59.41)c

O.sanctum (75) 25.93 30.37 (33.43)e 40.74 (39.67)

de 62.96 (52.52)

e

O.sanctum (100) 24.81 26.67 (31.09)f 28.15 (32.04)

g 39.63 (39.02)

g

O.basilicum (50) 26.67 40.00 (39.23)c 49.26 (44.58)

c 80.00 (63.44)

b

O.basilicum (75) 25.93 38.89 (38.57)c 47.04 (43.30)

c 65.56 (54.09)

e

O.basilicum (100) 26.67 35.93 (36.82)d 36.30 (37.05)

f 48.52 (44.15)

f

O.gratissimum (50) 25.19 42.59 (40.74)b 47.78 (43.73)

c 82.96 (65.66)

b

O.gratissimum (75) 24.81 41.11 (39.88)bc

41.85 (40.31) d

70.00 (56.80) d

O.gratissimum (100) 26.67 34.44 (35.93)d 39.26 (38.80)

e 51.85 (46.06)

f

Tricyclazole (600ppm) 25.56 16.67 (24.08)g 19.26 (26.02)

h 28.52 (32.28)

h

Control (Water spray) 25.56 57.41 (49.26)a 64.44 (53.40)

a 92.96 (74.76)

a

CD (0.05) 1.35 1.37 2.56

CV 2.14 1.99 2.82

In a coloum means followed by a common letter are not significantly different

at the 5% level DMRT (Doncon multiple range test).

Table 4.13 b. Efficacy of Ocimum leaf extract in methanol for the control of rice

blast under UBN condition during Kharif 2016-17

Treatment PDI (%)

Before spray 7 DA1S 7 DA2S 7 DA3S

O.sanctum (50) 24.81 38.15 (38.15) de

51.48 (45.85) d

84.81 (67.07) c

O.sanctum (75) 26.67 29.26 (32.74)g 38.15 (38.15)

g 68.89 (56.10)

e

O.sanctum (100) 26.67 25.93 (30.61)h 28.15 (32.04)

i 29.26 (32.75)

g

O.basilicum (50) 28.15 39.26 (38.80) cd

55.56 (48.19) b

89.63 (71.22) b

O.basilicum (75) 26.3 37.41 (37.71)e 48.15 (43.94)

e 72.59 (58.43)

d

O.basilicum (100) 27.04 34.81 (36.16)f 35.93 (36.83)

h 36.67 (37.27)

f

O.gratissimum (50) 27.04 41.48 (40.09)b 53.70 (47.12)

c 85.56 (67.70)

c

O.gratissimum (75) 27.78 40.37 (39.45)bc

45.93 (42.67) f 70.74 (57.25)

de

O.gratissimum (100) 27.41 34.44 (35.93)f 34.81 (36.16)

h 34.44 (35.93)

f

Tricyclazole (600ppm) 25.56 15.56 (23.23)i 19.26 (26.02)

j 28.52 (32.29)

g

Control (Water spray) 25.56 57.41 (49.26)a 64.44 (53.40)

a 92.96 (74.76)

a

CD (0.05) 0.81 0.9 1.75

CV 1.3 1.29 1.92

In a coloum means followed by a common letter are not significantly different

at the 5% level DMRT (Doncon multiple range test).

Figure 4.8 Management of rice blast under UBN condition in Ocimum extract

0.00

10.00

20.00

30.00

40.00

50.00

60.00

70.00

80.00

90.00

100.00

Per

cen

t D

isease

In

dex

Treatments

7 days after last spray Water extract 7 days after last spray Methanolic extract

The previous reports in these line and research explained about efficacy of

botanicals against rice blast (P. oryzae) that the bioassay test conducted through

standard mycelial growth exhibited MIC of A. marmelos extract at 1% (Rout and

Tewari, 2012).

Some workers (Upadhyaya and Tewari (2013), Upadhyaya and Tewari (2014)

ethanolic extract producted from O. sanctum L. leaves as biofungitoxicant in the

management of rice blast disease and reported that the mycelial growth was

completely inhibited at 0.1 per cent concentration of the product.

In the present study, O. sanctum with water and methanolic extract at 100 %

and 10 % respectively, are significantly effective and comparable with the

tricyclazole, this efficacy nearer to tricyclazole are aggrement with Gohel and

Chauhan (2015).

CHAPTER – V

SUMMARY AND CONCLUSIONS

In the present investigations, studies were carried out pertaining to cultural,

morphological, pathogenic and genetic diversity in the pathogen, management of blast

disease of rice with Ocimum leaf decoction. Studies were also carried out on

introgressed lines carrying blast resistant genes under different agro-climatic

locations. The lab, glasshouse and molecular experiments were conducted at ICAR-

IIRR, Rajendranagar, Hyderabad (Telangana). The multi-location trials were

conducted at ICAR-IIRR Hyderabad, RMDCARS Ambikapur, SGCARS Jagdalpur

and KVK Dhamtari. The results obtained in these investigations are summarized

below.

A roving survey was conducted during Kharif 2016 and Kharif 2017 in

Chhattisgarh state to assess the incidence of rice blast in different agro climatic

regions and to collect different rice blast isolates from different locally cultivated rice

verities viz., Swarna, Mahamaya, Bamleshwari, Indira Sona, MTU 1001, MTU 1010,

Safari, Indira Sugandhit Dhan, Karma mahsuri, Jirafal, IR-36, Badshah, Gomati, Pusa

sugandhit, Dubraj, PAC-507, Poineer, US-312, US-350, Maheshwari, Indira Barani

Dhan-1, Dayal and Danteshwari. P. oryzae fungus was isolated and purified on oat

meal agar medium (OMA) by adopting single spore isolation method. The single

spore cultures were maintained OMA medium, preserved on potato dextrose broth

and stored at -20°C temperature.

The results indicated that per cent disease index in different agro climatic

regions ranged from 20.00% to 87.78%. In Bastar district, Safari and Maheshwari

varieties were recorded with 20.00% of the disease incidence and in Jagdalpur,

Swarna was recorded 87.78%. The maximum per cent disease index was noticed in

Jagdalpur (87.78%) followed by Surguja (85.56%) and Balrampur (84.44%). The PDI

of blast in different cultivars and locations was significant. The results indicate that,

the mean blast PDI recorded in Chhattisgarh plain zone was 35.49 per cent, in North

hills zone 47.16 per cent, and in Bastar Plateau was 47.25 per cent.

Of the cultivars studied the highest PDI of 87.78 per cent was recorded on

Swarna (Jagdalpur) variety and lowest PDI of 20.00 per cent was recorded on Safari

(Bastar) and Maheshwari (Surajpur) respectively. These results indicated variation in

PDI which was influenced by the geographical area under different cultivation

practices.

Pathogenicity tests of these isolates revealed that highly significant differences

were observed among the isolates. The result indicated that highest PDI 96.30 per

cent were recorded in four isolates i.e., PO-CG-16, PO-CG-37, PO-CG-40 and PO-

CG-55 and the lowest PDI 51.85 per cent were found in sixteen isolates i.e., PO-CG-

6, PO-CG-10, PO-CG-17, PO-CG-19, PO-CG-20, PO-CG-22, PO-CG-24, PO-CG-25,

PO-CG-28, PO-CG-30, PO-CG-33, PO-CG-34, PO-CG-36, PO-CG-42, PO-CG-47

and PO-CG-53.

The primary aim of this study was to examine the relativity of P. oryzae

isolates that represent the wide collection of races from Chhattisgarh. A total of 15

races (IA-48, IA-30, IA-14, ID-16, IA-8, IB-55, IA-46, IC-16, IA-40, IA-64, IG-2,

IA-46, IB-32, IA-124 and IA-93) were detected among 15 isolates (Table 4.8 and

4.9). The most frequently occurred isolate was IA (10 isolates) followed by IB (2

isolates) and IC, ID, IG (1 isolate).

Variation in colony surface morphology revealed that, isolates having smooth

surface showed more sporulation compared with rough surface isolates. Vegetative

growth of most of isolates showed greyish white appearance and greyish black (PO-

CG-60), grey (PO-CG-5, PO-CG-6, PO-CG-27, PO-CG-38, PO-CG-39, PO-CG-40,

PO-CG-41, PO-CG-46, PO-CG-49, PO-CG-53, PO-CG-55, PO-CG-56, PO-CG-57,

PO-CG-58 and PO-CG-62), white (PO-CG-7, PO-CG-15, PO-CG-26, PO-CG-42,

PO-CG-43, PO-CG-48, PO-CG-2, PO-CG-4, PO-CG-11, PO-CG-17 and PO-CG-24),

whitish grey (PO-CG-9, PO-CG-16, PO-CG-21, PO-CG-29, PO-CG-30, PO-CG-36,

PO-CG-44, PO-CG-45, PO-CG-50, PO-CG-51, PO-CG-61, PO-CG-63 and PO-CG-

54), blackish white (PO-CG-10 and PO-CG-12), blackish grey (PO-CG-35, PO-CG-

52, PO-CG-59, PO-CG-31) and whitish black (PO-CG-20, PO-CG-22, PO-CG-33 and

PO-CG-34).

Colony growth of P. oryzae isolates on oat meal agar medium revealed

significant differences among the isolates from different locations. The colony

diameter ranged between 77 mm (PO-CG-14 and PO-CG-52) to 90 mm (PO-CG-10,

PO-CG-11, PO-CG-22, PO-CG-34, PO-CG-36, PO-CG-42, PO-CG-43, PO-CG-48,

PO-CG-49 and PO-CG-50). The isolates which showed excellent sporulation of

index-4 were having greyish white mycelium (PO-CG-1 and PO-CG-47), whitish

grey mycelium (PO-CG-16, PO-CG-45 and PO-CG-61), grey mycelium (PO-CG-40

and PO-CG-55) greyish white mycelium (PO-CG-47) and blackish grey mycelium

(PO-CG-59). The isolates which showed poor sporulation of index-1 were having

greyish white mycelium (PO-CG-9, PO-CG-28, PO-CG-8 and PO-CG-18), whitish

black mycelium (PO-CG-22), white mycelium (PO-CG-26 and PO-CG-11), blackish

white (PO-CG-10), grey mycelium (PO-CG-27), blackish grey (PO-CG-52) and

whitish grey mycelium (PO-CG-63).

In all isolates, observations were recorded on the conidial size (L×W). The

shape of the conidia was pyriform. The size of the conidia ranged between 28.0µm

(PO-CG-63) to 39.6 µm (PO-CG-1, PO-CG-25 and PO-CG-48). The length of the

conidia ranged from 8 µm (PO-CG-12, PO-CG-43 and PO-CG-63) to 11 µm (PO-

CG-1, PO-CG-17, PO-CG-25, PO-CG-32, PO-CG-48 and PO-CG-56) and width

ranged from 3.5 µm to 3.6 µm (all 63 isolates).

Studies on genetic variability indicated that, the polymorphic SSR markers in

the present study detected a total of 4 alleles among the 63 P. oryzae isolates assayed.

2 alleles were detected in MGM-1 and MGM-21. The PIC values obtained for MGM

1 was 0.35 and MGM 21 was 0.29. Overall topology of the dendrogram indicated the

presence of two major groups among 63 isolates. Several groups were observed for

subpopulations indicating high genetic variability with in the isolates. Out of 63

isolates, fifty seven isolates were clustered together in one group and remaining six

isolates were clustered in another group.

The sixteen introgressed lines were evaluated along with donor parents,

recurrent parents, resistant and susceptible checks. These lines were gene pyramided

with board spectrum of blast resistant genes i.e., Pi1, Pi2 and Pi54. The results

confirmed that, MSP-1 and MSP-7 carrying Pi1, MSP-3, MSP-9, MSP-14 and MSP-

16 carrying Pi54, MSP-6 and MSP-12 carrying Pi1, Pi2 and Pi54 genes respectively,

MSP-8 and MSP-13 carrying Pi2 and MSP-11 carrying Pi1 and Pi54 genes, were

showed complete resistant reaction to blast disease at four locations. While MSP-4

carrying Pi1 and Pi2 genes, MSP-10 carrying Pi1 and Pi2 genes, MSP-15 carrying

Pi2 gene, were moderately resistant at KVK Dhamtari. Similarly MSP-2 with Pi2

gene at SGCARS, Jagdalpur and MSP-5 with Pi2 and Pi54 genes at RMDCARS,

Ambikapur and ICAR-IIRR, Hyderabad showed moderately resistant reaction

respectively.

In vitro evaluation of three Ocimum sp. leaf decoction for management of rice

blast, P. oryzae was tested by poisoned food technique. Of the three different species

of Ocimum, O. sanctum was inhibiting the maximum fungal growth of 92.59 per cent

(6.67 mm) with water extract at 100% and 96.67 per cent (3.00 mm) with methanolic

extract at 10% concentrations.

Under glasshouse conditions, O. sanctum reduced the growth of P. oryzae

which showed the lowest PDI 29.26 per cent with methanolic extract at 10%

concentration and it showed non- significant difference with the tricyclazole which

was recorded 28.52 per cent PDI, seven days after last spray.

SUGGESTIONS AND FUTURE STRATEGIES

1. Distinctive patterns of pathogenicity and genetic diversity observed in the present

investigations emphasize the variability in P. oryzae population in Chhattisgarh.

A well-planned strategy to monitor virulence changes in the pathogen population

and resistance breakdown in host cultivars and identification and incorporation of

novel resistance genes will help in reducing the chances of epidemics and losses

from blast.

2. Indiscriminate use of chemicals by farmers will lead to the development of

resistance in the blast pathogen. Results on Ocimum leaf decoction sensitivity

provides information for further research on judicious application of these

Ocimum sp. which will be useful to the farmers.

3. Investigators should be encouraged to conduct on- farm evaluations of crude plant

extracts against a wide range of pathogens.

4. In vitro trials have become too narrow for us to base our conclusion of bio-

efficacy of crude extracts against pathogenic fungi upon.

5. Given proven phyto-fungal toxicity of the plant materials and assertions on their

effectiveness especially from actual field trials in the management of plant health

challenges; many concerted and directed efforts and thrusts should hence be

geared toward chemical examinations of the plant materials in all future

investigations with a view to:

Determining their phytochemical compositions;

Isolating their active ingredients;

Elucidating and characterizing the structure of isolates so as to enhance:

Studies on their modes of action on pathogens,

Phytotoxicity of the principles on host plants and,

Possible means of improving their effectiveness and synthesis.

6. Cost-benefit evaluations should be incorporated scientifically establish the cost

effectiveness of the plant extracts vis-a-viz synthetic chemical products.

7. Appropriate tests on the mammalian toxicity of plant extracts are encouraged and

should be thoroughly and speedily conducted to overcome the challenges of bans

of products after introduction into the wider market.

REFERENCES

Abamu, F.J., Akinsola, E.A. and Alluri, K. 1998. Applying the AMMI models to

understand genotype-by-environment (GE) interactions in rice reaction to

blast disease in Africa. Int. J. Pest Manage., 44: 239-245.

Akator, S.K., Adjata, D.K., Hode, G.Y., Awande, S., Dieng, I., Sere, Y. and Yawovi,

M.D.G. 2014. Cultural and Pathological studies of Pyricularia oryzae isolates

at abomey Calavi in Benin. Plant Pathology Journal, 13(1): 44-49.

Amadioha, A.C. 2000. Controlling rice blast in vitro and in vivo with extracts of

Azadirachta indica, Crop Protection, 19: 287-290.

Anderson, J.A., Churchill, G.A., Autrique, J.E., Tanksley, S.D. and Sorrels, M.E.

1993. Optimizing parental selection for genetic linkage maps. Genome., 36:

181-186.

Annonymous, 1996. Standard Evaluation System for Rice (SES). International Rice

Research Institute. Philippines.

Annonymous, 2010. Rice blast. International Rice Research Institute.

www.knowledgebank.irri. org/factsheetsPDFs/.Rice FactSheets.

Annonymous, 2014. Rice blast. International Rice Research Institute.

www.knowledgebank.irri. org/factsheetsPDFs/.Rice FactSheets.

Annonymous, 2016-17. www.agricoop.nic.in.

Annonymous, 2016-17.www.krishidarshika.cg.nic.in.

Annonymous, 2017. Foreign Agricultural Service/USDA Office of Global Analysis.

Anwar, A., Teli, M.A., Bhat, G.N., Parry, G.A. and Wani, S.A. 2009. Characterization

status of rice blast (Pyricularia grisea), cultivar reaction and races of its causal

fungus in temperate Agro-ecosystem of Kashmir, India. SAARC Journal of

Agriculture, 7(2): 25-37.

Aoki, Y. 1935. Physiological specialization in the rice blast fungus, Pyricularia

oryzae. Annals of Phytopathological Society of Japan, 5: 107.

Asfaha, M.G., Selvaraj, T. and Woldeab, G. 2015. Assessment of disease intensity

and isolates characterization of blast disease Pyricularia oryzae Cavara from

South West of Ethiopia. International Journal of Life Sciences, 3(4): 271-286.

Ashkani, S., Rafii, M.Y., Rusli, I., Sariah, M., Abdullah, A.S.N., Rahim, A.H. and

Latif, M.A. 2012. SSRs for Marker-Assisted Selection for Blast Resistance in

Rice (Oryza sativa L.). Plant Molecular Biology, 30: 79-86.

Astolifi, G. 1828. Congetturasullamalattia dcl brusonecheinfesta del riso. Annals of

the university of technology. Milano, 6. 198. (Special publication, section of

mycology. Disease survey USDA No. 6, 13, 1954)

Atkins, J.G., Robert, A.L., Adair, C.R., Goto, K., Kozaka, T., Yanagida, R., Yamada,

M. and Matsumto, S. 1967. An international set of rice varieties for

differentiating races of Pyricularia oryzae. Phytopathology, 57: 297-301.

Awoderu, V.A., Esuruoso, O.F. and Adeosun, O.O. 1991. Growth and conidia

production in race NG-5/IA-65 of Pyricularia oryzae Cav. In vitro. Journal of

Basic Microbiology, 31(3): 163-168.

Batsa, B.K. and Tamang, D.B. 1983. Preliminary report on the study of millet

diseases in Nepal. In: Maize and Finger millet, 10th

Summer crops workshop,

Rampur, Nepal, p. 23-28.

Bhat, Z.A., Ahangar, M.A., Sanghera, G.S. and Mubarak, T. 2013. Effect of cultivar,

fungicide spray and nitrogen fertilization on management of rice blast under

temperate ecosystem. International Journal of Science, Environment and

Technology, 2(3): 410 – 415.

Bonman, J.M. 1992. Durable resistance to rice blast disease-environmental influences.

Euphytica, 63(1-2): 115-123.

Bonman, J.M., Vergel de Dios, T.I., Bandong, J.M. and Lee, E.J. 1987. Pathogenic

variability of monoconidial isolates of Pyricularia oryzae in Korea and in the

Philippines. Plant Disease, 71: 127-130.

Bonman, J.M., Vergel, D., Dios, T.I. and Khin, M.M. 1986. Physiologic

specialization of Pyricularia oryzae in the Philippines. Plant Disease, 70: 767-

769.

Boza, E.J., Correll, J.C., Lee, F.N., Moldenhauer, K.A.K. and Gibbons, J.W.

2006. Screening of the rice breeder germplasm to seven races of the rice blast

pathogen Pyricularia grisea. AAES Research Series, 550: 51-59.

Brondani, C., Pereira, R., Brondani, V., Garrido, L. D. R. and Ferreira, M. E. 2000.

Development of microsatellite markers for the genetic analysis of

Magnaporthe grisea. Genetics and Molecular Biology, 23(4): 753-762.

Bryan, G.T., Wu, K., Farrall, L., Jia, Y., Hershey, H.P., Adams, S.M., Tarchini, R.,

Donaldson, G., Faulk, K. and Valent, B. 2000. A single amino acid difference

distinguishes resistant and susceptible alleles of the rice blast resistance gene

Pi-ta. Plant Cell, 12: 2033–2045.

Bussaban, B., Lumyong, S., Lumyong, P., Seelanan, T., Park, D.C., Mckenzie, E.H.C.

and Hyde, K.D. 2005. Molecular and morphological characterization of

Pyricularia and allied genera. Mycologia., 97(5): 1002-1011.

Castilla, N., Savary, S., Veracruz, C.M. and Leung, H. 2009. Rice Blast: Rice Fact

Sheets. International Rice Research Institute, 1-3.

Chadha, S and Gopalakrishna, T. 2005. Genetic diversity of Indian isolates of rice

blast pathogen (Magnaporthe grisea) using molecular markers. Current

Science. 88 (9):1466-1469.

Challagulla, V., Bhattarai, S. and Midmore, D.J. 2015. In-vitro vs in-vivo inoculation:

screening for resistance of Australian rice genotypes against blast fungus. Rice

Science, 22(2): 132-137.

Chao, C.T., Moldenhauer, K.A.K. and Ellingboe, A.H. 1999. Genetic analysis of

resistance/susceptibility in individual F3 families of rice against strains of

Magnaporthe grisea containing different genes for avirulence. Euphytica.,

109: 183–190.

Chen, D., Zeigler, R.S., Leung, H. and Nelson, R.J. 1995. Population structure of

Pyricularia grisea at two screening sites in the Philippines. Phytopathology,

85: 1011-1020.

Chen, H.L., Chen, B.T., Zhang, D.P., Xie, Y.F. and Zhang, Q. 2001. Pathotypes of

Pyricularia grisea in rice fields of central and southern China. Plant Dis., 85:

843-850.

Choi, Gyung Ja, Jang, Kyoung Soo, Kim, Jin-Seok, Lee, Seon-Woo, Cho, Jun Young,

Cho, Kwang Yun and Kim, Jin –Cheol. 2004. In-vivo antifungal activities of

57 plant extract against six plant pathogenic fungi. Plant Pathology Journal,

20(3): 184-191.

Correa-victoria, F.J and Zeigler, R.S. 1993. Pathogenic variability in Pyricularia

grisea at a rice blast “hot-spot” breeding site in Eastern Colombia. Plant

Disease, 77: 1029-1035.

Correll, J.C., Harp, T.L., Guerber, J.C., Zeigler, R.S., Liu, B., Cartwright, R.D. and

Lee, F.N. 2000. Characterization of Pyricularia grisea in the United States

using independent genetic and molecular markers. Phytopathology, 90: 1396-

1404.

*Delassus, M. 1973. Luttechimiquecontre la pyriculariose du rizen Casamance

(Sénégal). In: Séminaire ADRAO sur la protection des plantesenriziculture,

Monrovia, Liberia. 220-225.

Divya, B., Robin, S., Rabindran, R., Manjunath, H., Valarmathi, P. and Joel, A.J.

2014. Resistance reaction of gene introgressed lines against rice blast

(Pyricularia oryzae) disease. Australasian Plant Pathol., 43: 177-191.

Enyiukwu, D.N., Awurum, A.N., Ononuju, C.C. and Nwaneri, J.A. 2014.

Significance of characterization of secondary metabolites from extracts of

higher plants in plant disease management. Int. J. Adv. Agric. Res., 2: 8-28.

Gashaw, G., Alemu, T. and Tesfaye, K. 2014. Morphological, physiological and

biochemical studies on Pyricularia grisea isolates causing blast disease on

finger millet in Ethiopia. Journal of Applied Biosciences, 74: 6059- 6071.

George, M.L.C., Nelson, R.J., Zeigler, R.S. and Leung, H. 1998. Rapid population

analysis of Magnaporthe grisea by using rep-PCR and endogenous repetitive

DNA sequences. Phytopathology, 88: 223–229.

Ghatak, A., Willocquet, L., Savary, S. and Kumar, J. 2013. Variability in

aggressiveness of rice blast (Magnaporthe oryzae) isolates originating from

rice leaves and necks: a case of pathogen specialization. www.plosone.org.,

8(6): 66180

Ghazanfar, M.U., Wakas, W., Sahi, S.T. and Saleem, Y. 2009. Influence of various

fungicides on the management of rice blast disease. Mycopathology, 7(1): 29-

34.

Gohel, N.M. and Chauhan, H.L. 2015. Integrated management of leaf and neck blast

disease of rice caused by Pyricularia oryzae. African Journal of Agricultural

Research, 10(19): 2038-2040.

Goto, K. 1960. Progress report of the joint research on the rice blast fungus,

Pyricularia oryzae (Fascicle 1). Disease Insect Forecast Series, No. 5: 1-98.

Goto, K. 1965. Physiologic races of Pyricularia oryzae in Japan. Bulletin of Plant

Disease, 5: 1- 89.

Gupta, P.K. and Varshney, R.K. 2000. The development and use of microsatellite

markers for genetic analysis and plant breeding with emphasis on bread

wheat. Euphytica, 113: 163-185.

Gurjar, M.K., Ali, S., Akhtar, M. and Singh, K.S. 2002. Efficacy of plant extracts in

plant disease management. Agricultural Sciences, 3(3): 425-433.

Hai, L.H., Kim, P.V., Du, P.V., Thuy, T.T.T. and Thanh, D.N. 2007. Grain yield and

grain-milling quality as affected by rice blast disease (Pyricularia grisea), at

my Thanh Nam, Cailay, Tien Giang. Omonrice, 15: 102-107.

Hajimo, K. 2001. Rice Blast Disease. Pesticide Outlook, 23-25.

*Hamer, J.E., Farrall, L., Orbach, M.J., Valent, B. and Chumley, F.G. 1989. Host

species specific conservation of family repeated DNA sequence in the genome

of a fungal plant pathogen. Proceedings of the National Academy of Sciences,

86: 9981-9985.

Han, S.S., Ra, D.S. and Nelson, R.J. 1993. Comparison of phylogenetic trees and

pathotypes of Pyricularia oryzae in Korea. Journal Agricultural Sciences, 35:

315-323.

Hawksworth, D.L. 1990. CMI Descriptions of Fungi and Bacteria.

Mycopathologia, 111(2): 109.

Hebert, T.T. 1971. The perfect stage of Pyricularia grisea. Phytopathology, 61: 83-

87.

Helentjaris, T.G.K., Solacum, M., Siedenstrang, C. and Wegman, S. 1985.

Restriction fragment length polymorphisms as probes for plant diversity

and their development as tools for applied plant breeding. Plant Molecular

Biology, 5: 109-118.

Hossain, M., Ali, A.Md. and Hossain, M.D. 2017. Occuence of blast disease in rice in

Bangladesh. American Journal of Agricultural Sciences, 4(4): 74-80.

Hossain, M.D. 2000. Studies on blast disease of rice caused by Pyricularia grisea

(Cooke) Sacc. in upland areas. M.Sc. (Ag) Thesis, University of Agricultural

Sciences, Dharwad, p. 52-53.

Hossain, M.M and Kulakarni, S. 2001. In-vitro evaluation of fungicides and neem

based formulations against blast of rice. Journal of Maharashtra Agricultural

University, 26 (2): 151-153.

Inukai, T., Nelson, R.J., Zeigler, R.S., Sarkarung, S., Mackill, D.J., Bonman, J.M.,

Takamure, T. and Kinoshita, T. 1994. Allelism of blast resistance genes in

near-isogenic lines of rice. Phytopathology, 84: 1278–1283.

Jagadeeshwar, R.N., Varma, R.G., Reddy, P.R.R., Raju, C.S., Vanisree, S., Reddy,

B.G. and Dayakar, S. 2014. Screening of new fungicides against location

specific diseases of rice occurring in Southern Telangana zone of Andhra

Pradesh. The J. Res. ANGRAU, 42(1): 18- 21.

Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P. and Valent, B. 2000. Direct

interaction of resistance gene and avirulence gene products confers rice blast

resistance. The EMBO Journal, 19(15): 4004-4014.

Kachroo, P., Leong, S.A. and Chattoo, B.B. 1994. Pot2, an inverted repeat transposon

from the rice blast fungus Magnaporthe grisea. Molecular and General

Genetics, 245: 339–348.

Karthikeyan, V., Rajarajan, R. and Gnanamanickam, S.S. 2013. Virulence

characteristic analysis and identification of new pathotypes of rice blast fungus

(Magnaporthe grisea) from India. Life Sciences Feed, 2(1): 7- 12.

Kato, H. and Kozaka, T. 1974. Effect of temperature on lesion enlargement and

sporulation of Pyricularia oryzae in rice leaves. Phytopathology, 64: 828-830.

Kaye, C., Milazzo, J., Rozenfeld, S., Lebrun, M.H. and Tharreau, D. 2003. The

development of simple sequence repeat (SSR) markers for Magnaporthe

grisea and their integration into an established genetic linkage map. Fungal

Genetics and Biology, 40: 207-214.

Khush, G.S. and. Jena, K.K. 2009. Current status and future prospects for research on

blast resistance in rice (Oryza sativa L.). Advances in genetics, genomics and

control of rice blast. Springer Science, Netherlands.

Kim, C.K. 1994. Blast management in high input, high yield potential, temperate rice

ecosystems. In: Zeigler, R.S and Leong, S.A (eds.) - Rice Blast Disease. CAB

International, Wallingford, UK.

Kim, C.K. and Yoshino, R. 2000. Sporulation of Pyricularia grisea on different

stages of rice in the field. Plant Pathology, 16(3): 147-150.

Koh, Y.J., Hwang, B.K. and Chung, H.S. 1987. Adult-plant resistance of rice to leaf

blast. Phytopathology, 77: 232-236.

Koutroubas, S.D., Katsantonis, D., Ntanos, D.A. and Lupotto, E. 2009. Blast disease

influence on agronomic and quality traits of rice varieties under Mediterranean

conditions. Turk Journal of Agriculture, 33: 487-494.

Kulakarni, R.N. and Chopra, V.L. 1982. Environment as the cause of differential

interaction between host cultivars and pathogenic races. Phytopathology, 72:

1384-1386.

Kulkarni, S. and Govindu, H.C. 1976. Studies on the blast disease of ragi in

Karnataka. Physiological studies of leaf and neck isolates of Pyricularia

setariae Nishikado. Mysore Journal of agricultural Sciences, 10: 627-631.

Kumar, A. and Singh, R.A. 1995. Differential response of Pyricularia grisea isolates

from rice, finger millet and pearl millet to media, temperature, pH and light.

Indian Journal of Mycology and Plant Pathology, 25: 238-242.

Kumar, J., Nelson, R.J. and Zeigler, R.S. 1999. Population structure and dynamics of

Magnaporthe grisea in the Indian Himalayas. Genetics, 152(3): 971-984.

Le, M.T., Arie, T. and Teraoka. 2010. Population dynamics and pathogenic races of

rice blast fungus Magnaporthe oryzae in the Mekong Delta in Vietnam.

Journal of General Plant Pathology, 76: 177-182.

Levy, M., Fernando, J., Correa-Victoria., Zeigler, R.S., Xu, S. and Hamer, J.E. 1993.

Genetic diversity of the rice blast fungus in a disease nursery in

Colombia. Phytopathology, 83: 1427-1433.

Levy, M., Romao, J., Marchtti, M.A. and Hamer, J.E. 1991. DNA fingerprinting with

a dispersed repeated sequence resolves pathotype diversity in the rice blast

fungus. Plant Cell, 3: 95-102.

Li, C.Y., Li, J.B., Liu, L., Yang, J., Su, Y., Wang, Y.Y., Xie, Y., Ye, M. and Zhu,

Y.Y. 2007. Development of mini satellite markers in phytopathogenic fungus

Magnaporthe grisea. Molecular Ecology Notes, 7(6): 978-980.

*Lilly, V.G. and Barnett, H.L. 1951. Physiology of the Fungi. McGraw Hill Book Co.

Inc. New York, p. 441.

Ling, K.C. and Ou, S.H. 1969. Standardization of the International race numbers of

Pyricularia oryzae cav. Phytopathology, 59: 339–342.

Luo, Y., Tang, N.G., Febellar, D.O. and TeBeest. 1998. Risk analysis of yield losses

caused by rice leaf blast associated with temperature changes above and below

for five Asian countries. Journal of Agricultural Ecosystem & Environment,

68: 197-205.

Mackill, D.J. and Bonman, J.M. 1992. Inheritance of blast resistance in near-isogenic

lines of rice. Phytopathology, 82: 746–749.

Mahesh, P., Shakywar, R.C, Dinesh, S. and Shyam, S. 2012. Prevalence of insect

pests, natural enemies and diseases in SRI (System of Rice Intensification) of

rice cultivation in North Eastern Region. Annals of Plant Protection Sciences,

20(2): 375-379.

Maheshwari, R. and Sharma, I.R. 2013. Prevalence and distribution of blast disease

(Pyricularia oryzae cav.) on rice plants in paddy growing areas of the Bundi

district, Rajasthan. Asian Journal of Plant Science and Research, 3(1): 108-

110.

Mathur, R.S., Bajpai, G.K., Chauhan, L.S. and Verma, S.C. 1964. Assesment of

losses caused by paddy blast. Plant Disease Research, 48: 711-718.

*Mc Rae, W. 1922. Report of the imperial mycologist. Scientific Report. Pusa

Agricultural Research Institute. 44-50.

McDonald, B.A and Linde, C. (2002). The population genetics of plant pathogens and

breeding strategies for durable resistance. Annual Review of Phytopathology,

40: 349-379.

Meena, B.S. 2005. Morphological and molecular variability of rice blast pathogen,

Pyricularia grisea (Cooke) Sacc.Department of Plant Pathology, College of

Agriculture, Dharwad University of Agricultural Sciences, Dharwad, p. 12-54.

Mew, T.W. and Gonzales, P. 2002. A Handbook of Rice Seedborne Fungi.

International Rice Research Institute, Los Banos, Philippines, p. 83.

Moghaddam, M.H.S. and Soltani, J. 2013. An investigation on the effects of

photoperiod, aging and culture media on vegetative growth and sporulation of

rice blast pathogen Pyricularia oryzae. Progress in Biological Sciences, 3(2):

135-143.

Mohan, M.S., Madhav, S.M., Prasad, S.M., Ramadevi, S.J.S, Kumar, R.G. and

Viraktamath, B.C. 2012. Analysis of population structure of Magnaporthe

grisea using genome specific microsatellite markers. Current Trends in

Biotechnology and Pharmacy, 6(2): 173-182.

Motlagh, M.R.S. and Javadzadeh, A. 2010. Evaluation of the reaction of Alisma plant

agoaquatica and some rice cultivars to Curvularia lunatain the north of Iran.

Journal of Food, Agriculture and Environment, 8: 3-4.

Motlagh, M.R.S., Hbibi, F. and Ebadi, A. 2015. Genetic diversity of Pyricularia

grisea, the causal agent of rice blast by SSR. Acta Scientiarum Polonorum

Hortorum Cultus, 14(1): 15-28.

Mukundvariar, C.M., Cruz, V., Carello, M.G., Bhatt, J.C. and Sangar, R.B.S. 2006.

Rice blast in India and strategies to develop durable resistant cultivars.

Advances in genetics genomics and control of rice blast, 359-368.

Muralidharan, K., Krishnaveni, D., Laha, G.S., Reddy, C.S., Srinivasprasad, M. and

Sridhar, R. 2004. Performance of rice blast resistance genes in multi-

environment tests in India. Indian Phytopath., 57(3): 260-266.

Netam, R.S., Bahadur, A.N., Tiwari, U. and Tiwari, R.K.S. 2011. Efficacy of plant

extracts for the control of (Pyricularia grisea) blast of rice under field

conditions of Bastar, Chattisgarh. Research Journal of Agricultural Sciences,

2(2): 269-271.

Nicholas, J.T. 2003. On the trail of a cereal killer: exploring the biology of

Magnaporthe grisea. Annu. Rev. Microbiol., 57: 177–202.

*Nishikado, Y. 1917. Studies on rice blast fungus. Iohara Inst. land hw. Forsch Ber.

1: 179-219.

Olufolaji, D.B., Adeosun, B.O. and Onasanya, R.O. 2015. In-vitro investigation on

antifungal activity of some plant extracts against Pyricularia oryzae. Nig. J.

Biotech, 29: 38-43.

Onega, G., Wydra, K., Koopman, B., Sere, Y. and Tiedemann, A.V. 2015. Population

structure, pathogenicity and mating type distribution of Magnaporthe oryzae

isolates from east Africa. Phytopathology, 105(8): 1137-1145.

Ou, S.H. 1972. Studies on stable resistance to rice blast disease in rice breeding.

International Rice Research Institute, Manila, p. 227-237.

Ou, S.H. 1985. Rice Disease. 2nd ed. Commonwealth Mycological Institute, Kew,

Surrey, England. 201.

Ou, S.H. and Ayed, M.R. 1968. Pathogenic races Pyricularia oryzae originating from

single lesion and monoconidial cultures. Phytopathology, 58: 179-182.

Ou, S.H., Nuque, F.L., Ebron, T.T. and Awodens, V.A. 1970. Pathogenic races of

Pyricularia oryzae derived from monoconidial cultures. Plant Disease rep.,

54: 1045-1049.

Padmanabhan, S.Y. 1965. Studies on Forecasting outbreaks of blast disease of rice.

Central Rice Research Institute Cuttack, p. 117-129.

Padmanabhan, S.Y. 1974. Fungal diseases of rice in India. 1st Ed. Indian council of

Agriculture Research, New Delhi, p. 15.

Padmanabhan, S.Y., Chakrabarti, N.K., Mathur, S.C. and Veeraraghavan, J. 1970.

Identification of pathogenic races of Pyricularia oryzae in India.

Phytopathology, 60: 1574 - 1577.

Padmavati, G., Ram, T., Satyanarayana, K. and Mishra, B. 2005. Identification of

blast (Magnaporthe grisea) resistance genes in rice. Current Science, 88(4):

628-630.

Panda, G., Sahu, C., Yadav, M.K., Aravindan, S., Umakanta, N., Raghu, S.,

Prabhukarthikeyan, S.R., Lenka, S., Tiwari, J.K., Kar, S. and Jena, M. 2017.

Morphological and molecular characterization of Magnaporthe oryzae from

Chhattisgarh. Oryza., 54(3): 330-336.

Pandey, S. 2015. Efficacy of leaf extracts in controlling leaf blast and brown spot in

rice (Oryza sativa L.). International Journal of Recent Scientific Research

Research, 6(7): 5476-5479.

Park, S.Y., Milgroom, M.G., Han, S.S., Kang, S. and Lee, Y.H. 2008a. Genetic

differentiation of Magnaporthe oryzae populations from scouting plots and

commercial rice fields in Korea. Phytopathology, 98: 436-442.

Park, W.M., Lee, Y.S., Wolf, G. and Heitefus, R. 2008b. Differentiation of

physiological races of the rice blast fungus, Pyricularia oryzae Cav. by PAGE

electrophoresis. Journal of Phytopathology, 117(2): 113-121.

Pasha, A., Babaeian-Jelodar, N., Bagheri, N., Nematzadeh, G. and Khosravi, V. 2013.

A field evaluation of resistance to Pyricularia oryzae in rice genotypes.

International Journal of Agriculture and Crop Sciences, 4: 390-394.

Pawar, A.D., Gautam, K.S., Singh, S.P. and Sharma, M.C. 2000. Rapid roving

survey. Pestology, 24: 81-86.

Perezsendin, M., De, L. A. and Barrios, G.J. 1982. Biological aspects of Pyricularia

oryzae. Ciencias de la Agricultural, 12: 111-113.

Pinheiro, T.M., Araújo, L.G., Silva-Lobo, V.L., Prabhu, A.S. and Filippi, M.C. 2012.

Tagging microsatellite marker to a blast resistance gene in the irrigated rice

cultivar Cica-8. Crop Breeding and Applied Biotechnology, 12: 164-170.

Prabhu, A.S., Filippi, M.C., Silva, G.B., SilvaLobo, V.L. and Morais, O.P. 2009. An

unprecedented outbreak of rice blast on a newly released cultivar BRS

Colosso in Brazil". Springer Science. Netherlands.

Prasad, M.S., Madhav, S., Laha, G.S., Ladhalakhmi, D., Krishnaveni, D.,

Mangrauthia, S.K., Balachandran, S.M., Sundaram, R.M., Arunakranthi, B.,

Madhan Mohan, K., Madhavi, K.R., Kumar, V. and Viraktamath, B.C. 2011.

Technical Bulletin No. 57. Directorate of Rice Research (ICAR),

Rajendranagar, Hyderabad-500030, A.P, India, p. 1-50.

Puri, K.D., Shrestha, S.M., Joshi, K.D. and KC, G.B. 2006. Reaction of different rice

lines against leaf and neck blast under field condition of Chaitwan Valley.

Journal of Institutional Agricultural and Animal Sciences, 27: 37-44.

Qasem, J.R., Abu-Blan, H.A., 1966. Fungicidal activity of some common weed

extracts against different plant pathogenic fungi. J. Phytopathol., 144: 157-

161.

Ram, B.K., Sundar, M.S., Hira, K.M. and Gopal, B.K.C. 2012. Study on differential

response of Pyricularia grisea isolates from rice, finger millet and panicum

sp. with local and alien media, and their host range. Nepal Journal of Science

and Technology, 13(2): 7-14.

Ram, T., Majumder, T.N.D., Mishra, B., Ansari, M.M. and Padmavathi, G. 2007.

Introgression of broad spectrum blast resistance genes into cultivated rice

(Oryza sativa sp.indica) from wild rice Oryza rufipogon.Current Science,

92(2): 225-230.

*Ramakrishnan, K.V. 1948. Studies on the morphology, physiology and parasitism of

the genus Pyricularia in Madras. Proceedings:Indian Academy Science,

27(6): 174-193.

Ramappa, H.K., Ravishankar, C.R. and Prakash, P. 2002. Estimation of yield loss and

management of blast in finger millet (ragi). Proceedings of Asian Congress of

Mycology and Plant Pathology. 1-4 Oct 2002, University of Mysore, Mysore,

India, p. 195.

Ramesh, B.S., Reddy, P.N. and Prasad, M.S. 2015. Studies on management of rice

blast through host plant resistance and fungicide. Ph. D. Thesis, PJTSAU,

Telangana, p. 1-170.

Ramesh, B.S., Srinivas, P., Aruna, J., Vijay, S., Rani, P.Ch.D., Reddy, P.N. and

Prasad, M.S. 2017. Survey of Magnaporthe grisea isolates around Andhra

Pradesh and Telangana States, India. International Journal of Current

Microbiology and Applied Sciences, 6(5): 61-70.

Ramezani, H. and Abdollahi, M. 2015. Management of Alternaria brassicae through

some plants extract. Int. J. Pure App. Biosci., 3(2): 108-112.

*Rangaswamy, G. and Subramanian, T.V. 1957. Estimation of loss due to blast

disease of rice. Science and Culture, 23: 192-193.

Reddy, A.P.K. and Bonman, J.M. 1987. Recent epidemics 82 of rice blast in India and

Egypt. Plant Dis., 71: 850.

Rohlf, F.J. 1993. NTSYS-pc: Numerical Taxonomy and Multivariate Analysis System

Version 2.0. Setauket, New York: Exeter Software.

Roumen, E., Levy, M. and Notteghem, J.L.1995. Characterization of the European

population of the blast pathogen Magnaporthe grisea. Cahiries Options

Maediterraneennes, 15(3): 119-124.

Rout, S. and Tewari, S.N. 2012. Amalab-e, a formulated botanical product potential

against rice blast incitant Pyricularia grisea. The Bioscan, 7(3): 547-552.

Saifulla Khan, A.M., Khan, N.A. and Mohammad, Y. 2011. Effect of epidemiological

factors on the incidence of paddy blast (Pyricularia oryzae) disease. Pakistan

Journal of Phytopathology, 23(2): 108-111.

*Sasaki, R. 1923. Existence of strains in rice blast fungus. Journal of Plant Protection

Tokyo, 9: 631-644.

Satish, S., Raghvendra, M.P., Mohan, D.C., Raveesha, K.A. 2010. In-vitro evaluation

of the antifungal potentiality of Polyalthia longifolia against some sorghum

grain moulds. J Agric Technol., 6(1): 135–150.

Shafaullah and Khan, M. A. 2016. Management of Pyricularia grisea, the rice blast

pathogen through botanical pesticides. International Journal of Science and

Research, 5(1): 973-976.

Shahijahandar, M., Hussain, S., Nabi, G.H. and Masood, M. 2010. Prevalence and

distribution of blast disease (Magnaporthe grisea) on different components of

rice plants in paddy growing areas of the Kashmir Valley. International

Journal of Pharma and Biosciences, 1(3): 4.

Sharma, T.R., Chauhan, R.S., Singh, B.M., Sagar, V., Paul, R. and Rathour, R. 2002.

RAPD and virulence analysis of Magnaporthe grisea rice populations from

north-western Himalayan region of India. Journal of Phytopathology, 150:

649-656.

Shull, V. and Hamer, J. E. 1994. Genomic structure and variability in Pyricularia

grisea. In :Zeigler, R.S., Leong, S.A and Teng, P.S. (eds.) - Rice Blast

Disease. Commonw. Agric. Bur. Int. Willingford, U.K, p. 65-86.

Silue, G.B., Notteghem, J.L. and Tharreau, D. 1992. Evidence for a gene-for-gene

relationship in the Oryza sativa Magnoporthe gresea- pathosystem.

Phytopathology, 82: 577-580.

Silva, G.B., Araújo, L.G., Lobo,V.L.S., Prabhu, A.S., Rêgo, M.C.F., Paes, E.T and

Filippi, M.C.C. 2011. Use of local rice cultivars as additional differentials to

identify pathotypes of Pyricularia oryzae. Bragantia, Campinas, 70(4): 860-

868.

Silva, G.B., Prabhu, A.S., Filippi, M.C.C., Trindade, M.G., Araujo, L.G. and

Zambolim, L. 2009. Genetic and phenotypic diversity of Magnaporthe oryzae

from leaves and panicles of rice in commercial fields in the State of Goias,

Brazil. Tropical Plant Pathology, 34(2): 71-76.

Singh, A.K., Singh, P.K., Madhuri, A., Singh, N.K. and Singh, U.S. 2015. Molecular

screening of blast resistance genes in rice using ssr markers. Plant Pathology

Journal, 31(1): 12-24.

Singha and Maibangsa, M. 2003. Prevalence of physiological races of Pyricularia

oryzae in Assam. Indian Journal of Mycology and Plant Pathology, 21: 119-

120.

Srinivasprasad, M., Sangitkumar and Lakshmi Prasad, M. S. 1998. Weed hosts of rice

blast fungus in Meghalaya, India. Oryza, 35(4): 384 – 385.

Srivastava, D., Shamim, Md., Kumar, D., Pandey, P., Khan, N.A. and Singh, S.N.

2014. Morphological and molecular characterization of Pyricularia oryzae

causing blast disease in rice (Oryzae sativa) from North India. International

Journal of Scientific and Research Publications, 4(7): 2250-3153.

*Sun, G.C., Sun, S.Y. and Shez, Z.T. 1989. Conditions for sporulation of rice blast

(Bl) fungus. IRRN, 14(5): 12-13.

Suzuki, F., Suga, H., Tomimura, K., Fuji, S., Arai, M., Koba, A. and Nakajima, T.

2009. Development of simple sequence repeats markers for Japanese isolates

of Magnaporthe grisea. Molecular Ecology Resources, 9: 588-590.

Tanaka, A.K., Hayashi, N., Yanagihara, S. and Fukuta, Y. 2016. Diversity and

distribution of rice blast (Pyricularia oryzae Cavara) races in Japan. Plant

Disease, 100: 816-823

Tanaka, M., Nakayashiki, H. and Tosa, Y. 2009. Population structure of Eleusine

isolates of Pyricularia oryzae and its evolutionary implications. Journal of

General Plant Pathology, 75: 173-180.

Teng, P.S. 1994. The epidemiological basis for blast management. In: Zeigler R.S and

Leong, S.A. (eds.) - Rice Blast Disease. CAB International, Wallingford, UK.

Elsevier, 51(3): 367-369.

Tewari, S.N. 1995. Ocimum sanctum L., a botanical fungicide for rice blast control.

Trop Sci., 35: 263–273.

Tewari, S.N. 2008. Strategic approach for management of rice blast through eco-

friendly botanical products, CRRI Research Bulletin 1. Cuttack (India):

Central Rice Research Institute, Indian Council of Agricultural Research, p.

84.

Tewari, S.N. and Nayak, M. 1991. Activity of four-plant leaf extracts against three

fungal pathogens of rice. Tropical Agric. (Trinidad), 68: 373-375.

Tewari, S.N. and Patra, B.C. 2006. Potential of green plant based products in the

management of the most destructive disease of rice-blast. Paper presented at:

2nd International Rice Congress Science Technology and Trade for Peace and

Prosperity; October 9–13; New Delhi. p. 419–420.

Tewari, S.N., Mishra, M. 1990. Aegle marmelos Corr. a botanical source of fungicide.

Extended summary. In: Murlidharan K, Rao KV, Satyanarayan K, Prasad

GSV, Siddiq EA, editors. Proceedings of the International Symposium Rice

Research: New Frontiers; Nov. 15–18. Hyderabad: Directorate of Rice

Research. p. 250–251.

*Thomas, K.M. 1941. Detailed administration report of the government mycologist,

Madras for the year 1940 – 41. p. 53 – 74.

Tochinai, Y. and Shimamura, M. 1932. Studies on the physiologic specialization in

Pyricularia oryzae Br. et. Cav. Annals of the phytopathoglocial society of

Japan, 2: 414-441.

Torres, C.Q. 1986. Effect of plant age on the expression of resistance to Pyricularia

oryzae Cav. in upland rice varieties. Ph.D. thesis, University of the Philippines

at Los Bafios, Laguna, Philippines, p. 82.

Tosa, Y., Uddin, W., Viji, G., Kang, S. and Mayama, S. 2007. Comparative genetic

analysis of Magnaporthe oryzae isolates causing gray leaf spot of perennial

rye grass turf in the United States and Japan. Plant Disease, 91: 517-524.

Upadhyaya, S. and Tewari, S. N. 2014. Fungitoxic potential of Ocimum sanctum

essential oil based formulated product in management of collar-rot disease of a

rice based crop, groundnut. International Journal of Advanced Scientific and

Technical Research, 4(4): 148-155.

Upadhyaya, S. and Tewari, S.N. 2013. Oscilene-e, an ethanolic extract producted

from Ocimum sanctum L. leaves as biofungitoxicant in the management

strategy of rice blast disease. Journal of Agricultural Technology, 9(4): 877-

888.

Upadhyaya, S., Behera, J. and Tewaria, S. N. 2012. Integrated management of foliar

blast through ecofriendly formulated product, Oscext-e developed from

Ocimum sanctum ethanolic extract. Archives of Phytopathology and Plant

Protection, 45(19): 2290–2300.

Valent, B., Crawford, M.S., Weaver, C.G. and Chumley, F.G. 1986. Genetic studies

of pathogenicity and fertility of Magnaporthe grisea. Iowa State J. Res., 60:

569–594.

Vanaraj, P., Kandasamy, S., Ambalavanan, S., Ramalingam, R. and Sabariyappan, R.

2013. Variability in Pyricularia oryzae from different rice growing regions of

Tamil Nadu, India. Afr. J. Microbiol. Res., 7(26): 3379-3388.

Varshney, R., Pande, S., Kannan, S., Mahendar, T., Sharma, M., Gaur, P. and

Hoisington, D. 2009. Assessment and comparison of AFLP and SSR based

molecular genetic diversity in Indian isolates of Ascochytarabiei, a causal

agent of Ascochyta blight in chickpea (Cicer arietinum L.). Mycological

Progress, DOI 10.1007/s11557-008-0581-1.

*Veeraraghavan, J. and Padmanabhan, S.Y. 1965. Studies on host range of

Pyricularia oryzae Cav. Proceedings of Indian Academy of Sciences, 61: 109-

120.

Verma, R.N. and Sengupta, T.K. 1985. Survey of crop diseases in Tripura I diseases

of rice. Oryza, 22: 92–96.

Viji, G., Gnanamanickam, S.S. and Levy, M. 2000. DNA polymorphisms of isolates

of Magnaporthe grisea from India that is pathogenic to finger millet and rice.

Mycological Research, 104(2): 161-167.

Wang, Z.X., Yano, M., Yamanouchi, U., Iwamoto, M., Monna, L., Hayasaka, H.,

Katayose, Y. and Sasaki, T. 1999. The Pi-b gene for rice blast resistance

belongs to the nucleotide binding and leucine-rich repeat class of plant disease

resistance genes. The Plant Journal, 19: 55–64.

Wattanpayakul, W., Polthanee, A., Siri, B., Bhadalung, N.N. and Promkhambut, A.

2011. Effect of Silicon in suppressing blast disease and increasing grain yield

of organic rice in North east Thailand. Asian Journal of Plant Protection,

5(4):134.

Wheeler, W.B. 2002. Role of research and regulation in 50 years of pest management

in agriculture. J Agric Food Chem., 50: 4151–4155.

Wise, R.P. 2000. Disease resistance: What’s brewing in barley geno- mics. Plant

Disease, 84:1160–1170.

Xia, J.Q., Correll, J.C., Lee, F.N., Ross, W.J. and Rhoads, D.D. 2000. Regional

population diversity of Pyricularia grisea in Arkansas and the influence of

host selection. Plant Disease, 84: 877-884.

Xia, T.Q., Correll, J.C., Lee, F.N., Marchetti, M.A. and Rhoads, D.D. 1993. DNA

fingerprinting to examine micro-geographic variation in the M. grisea (P.

grisea) population in two rice field in Arkansans. Phytopathology, 83: 1029 -

1035.

Yaegashi, H. and Nishihara, N. 1976. Production of the perfect stage in Pyricularia

from cereals and grasses. Annals of the Phytopathological Society of Japan,

42: 511-515.

Yaegashi, H. and Udagawa, S. 1978. The taxonomical identity of the perfect sate of

Pyricularia grisea and its allies. Canidian Journal of Botany, 56: 180–183.

Yeh, W.H. and Bonman, J.M., 1986. Assessment of partial resitance to Pyricularia

oryzae in six rice cultivars. Plant Pathology, 35: 319-323.

Yu, Z.H., Mackill, D.J., Bonman, J.M., Mccouch, S.R., Guideroni, E., Notteghem,

J.L. and Tanksley, S.D. 1996. Molecular mapping of genes for resistance to

rice blast (Pyricularia grisea Sacc.). Theor.Appl. Genet., 93: 859–863.

Zeigler, R.S., Cuoc, L.X., Scott, R.P., Bernardo, M.A., Chen, D., Valent, B. and

Nelson, R.J. 1995. The relationship between phylogeny and virulence in

Pyricularia grisea in the Philippines. Phytopathology, 85: 443-451.

Zheng, Y., Zhang, G., Lin, F., Wang, Z., Jin, G., Yang, L., Wang, Y., Chen, X., Xu,

Z., Zhao, X., Wang, H., Lu, J., Lu, G. and Wu, W. 2008. Development of

microsatellite markers and construction of genetic map in rice blast pathogen

Magnaporthe grisea. Fungal Genetics and Biology, 45: 1340-1347.

* Original references not seen