dispersal, fishing, and the conservation of ...fk096nf3828/...v abstract a central goal of ecology...
TRANSCRIPT
![Page 1: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/1.jpg)
DISPERSAL, FISHING, AND THE CONSERVATION OF MARINE SPECIES
A DISSERTATION
SUBMITTED TO THE DEPARTMENT OF BIOLOGY
AND THE COMMITTEE ON GRADUATE STUDIES
OF STANFORD UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
Malin La Farge Pinsky
June 2011
![Page 2: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/2.jpg)
http://creativecommons.org/licenses/by-nc/3.0/us/
This dissertation is online at: http://purl.stanford.edu/fk096nf3828
© 2011 by Malin La Farge Pinsky. All Rights Reserved.
Re-distributed by Stanford University under license with the author.
This work is licensed under a Creative Commons Attribution-Noncommercial 3.0 United States License.
ii
![Page 3: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/3.jpg)
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Stephen Palumbi, Primary Adviser
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Rodolfo Dirzo
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Elizabeth Hadly
Approved for the Stanford University Committee on Graduate Studies.
Patricia J. Gumport, Vice Provost Graduate Education
This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file inUniversity Archives.
iii
![Page 4: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/4.jpg)
iv
![Page 5: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/5.jpg)
v
Abstract
A central goal of ecology is to understand the forces driving the distribution
and abundance of organisms. However, understanding the population dynamics of
high-dispersal species, their conservation, and the connections between population
dynamics and evolution remains difficult. It is in this context that marine organisms
provide a particularly intriguing and challenging study system. Their population
dynamics are often highly stochastic, most species have a great ability to disperse, and
as the last group of wild species exploited commercially, their ecology and evolution
can be strongly influenced by human behavior. By using population genetics,
modeling, and meta-analysis, this thesis investigates the spatial ecology of reef fish
and the causes and evolutionary consequences of global fisheries collapse.
One of the first challenges in understanding spatial population dynamics is
obtaining accurate measurements of dispersal abilities. This has been especially
difficult for marine species with pelagic larvae. In Chapter 1, I apply a new approach
to measuring single-generation dispersal kernels in Clark’s anemonefish (Amphiprion
clarkii) in the central Philippines (Pinsky et al. 2010 Evolution 64(9): 2688-2700).
After developing two methods for measuring the strength of local genetic drift, my
results suggest that larval dispersal kernels in A. clarkii had a spread near 11 km (4-27
km). This study shows that ecologically relevant larval dispersal can be estimated with
widely available genetic methods when effective density is measured carefully
through cohort sampling and ecological censuses.
In Chapter 2, I use dispersal kernels to develop a model for population
openness. Openness refers to the degree to which populations are replenished by
immigrants or by local production, a factor that has strong implications for population
dynamics, species interactions, and response to exploitation. It is also a population
trait that has been increasingly measured empirically, though we have until now
lacked theory for predicting population openness. I show that considering habitat
isolation elegantly explains the existence of surprisingly closed populations in high
![Page 6: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/6.jpg)
vi
dispersal species, and that relatively closed populations are expected when patch
spacing is more than twice the standard deviation of a species’ dispersal kernel. In
addition, empirical scales of habitat patchiness on coral reefs are sufficient to create
both largely open and largely closed populations. We predict that habitat patchiness
has strong control over population replenishment pathways for a wide range of marine
and terrestrial species with a highly dispersive life stage.
While the first tow chapters have strong implications for the design of regional
marine protected areas, I turn to global conservation questions in Chapters 3 and 4. I
first ask which marine fishes are most vulnerable to human impacts (Pinsky et al. 2011
Proceedings of the National Academy of Sciences doi/10.1073/pnas.1015313108).
Surveys of terrestrial species have suggested that large-bodied species and top
predators are the most at risk, but there has been no global test of this hypothesis in the
sea. Contrary to expectations, two datasets compiled from around the world suggest
that up to twice as many fisheries for small, low trophic level species have collapsed
as compared to those for large predators.
I then show that collapsed and overfished species have lower genetic diversity
than their close relatives (Pinsky & Palumbi, in prep). While the ecological and
ecosystem impacts of harvesting wild populations have long been recognized, it has
been controversial how widespread evolutionary impacts are. Using a meta-analytical
approach across 37 taxonomically paired comparisons, I find on average 19% fewer
alleles per locus in overfished species, but little difference in heterozygosity. I confirm
with simulations that these results are consistent with a recent population bottleneck.
These results suggest that the genetic impacts of overharvest are widespread, even
among abundant species. A loss of allelic richness has implications for the long-term
evolutionary potential of species.
![Page 7: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/7.jpg)
vii
Acknowledgements
I could not have completed these last five years without the support, encouragement,
and enthusiasm of those around me. While this list is incomplete, I am indebted to:
My Advisor
Steve Palumbi
My Committee
Elizabeth Hadly
Fiorenza Micheli
Steve Gaines
Rodolfo Dirzo
Chris Lowe
Collaborators
Olaf Jensen, Dan Ricard, Boris Worm, Ray Hilborn, Trevor Branch, Katie Arkema,
Greg Guannel, Mary Ruckelshaus, Anne Guerry, Marcel van Tuinen, Doug Kennett,
Seth Newsome, Serge Andréfouët, Humberto Montes, Jr. and the Visayas State
University Marine Lab, Amado Blanco and the Project Seahorse Foundation, Rose-
Liza Eisma-Osorio and the Coastal Conservation and Education Foundation
Colleagues in the Palumbi Lab
Melissa Pespeni, Jason Ladner, Carolyn Tepolt, Alison Haupt, Ryan Kelly, Dan
Barshis, Tom Oliver, Mollie Manier, Heather Galindo, Liz Alter, Emily Jacobs-
Palmer, Kelly Barr, Kristen Ruegg, Vanessa Michelou, Arjun Sivasundar, Pierre De
Wit, Marina Oster, Hannah Jaris, Veronica Searles, and Mark Walker
My Cohort
Julie Stewart, Nishad Jayasundara, Kevin Miklasz, Aaron Carlisle, Posy Busby,
Camila Donati, Beth Pringle, and Jason Ladner
Hopkins Marine Station Scientists and Staff
Kristy Kroeker, Cheryl Logan, Judit Pungor, Giulio de Leo, Salvador Jorgensen,
Chelsea Wood, Steve Litvin, Doug McCauley, Mark Denny, Ashley Greenley, Ashley
![Page 8: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/8.jpg)
viii
Booth, Tom Hata, Megan Jensen, Ishbel Kerkez, Dane Klinger, Judy Thompson, Joe
Wible, Doreen Zelles, Chris Patton, Freya Sommer, Carol Reeb, John Lee, Jim
Watanabe, Bob Doudna, Peter Ferrante, Barbara Compton, and Vicki Pearse
Stanford University Scientists and Staff
Jessica Blois, Judsen Bruzgul, Sarah McMenamin, Paula Spaeth, Lily Li, Dmitri
Petrov, Valeria Kiszka, Matt Pinheiro, and Jennifer Mason
Funding
National Science Foundation Graduation Fellowship, National Defense Science and
Engineering Graduation Fellowship, International Society for Reef Studies and the
Ocean Conservancy, Earl & Ethel Myers Oceanographic Trust, Jane Miller Scholars,
Friends of Hopkins, Woods Institute for the Environment, Center for Ocean Solutions,
National Center for Ecological Analysis and Synthesis, and Stanford Department of
Biology
and My Family
Kristin Hunter-Thomson
Rob, Margaret, and Maia Pinsky
![Page 9: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/9.jpg)
ix
Table of Contents
Abstract........................................................................................................................... v
Acknowledgements ......................................................................................................vii
Table of Contents .......................................................................................................... ix
List of Tables...............................................................................................................xiii
List of Figures.............................................................................................................. xiv
Introduction .................................................................................................................... 1
Statement on Multiple Authorship ..................................................................... 5
References .......................................................................................................... 6
Chapter 1: Using isolation by distance and effective density to estimate dispersal
scales in anemonefish ..................................................................................... 11
1.1. Abstract...................................................................................................... 11
1.2. Introduction ............................................................................................... 12
1.3. Materials and Methods .............................................................................. 14
1.3.1. Study system............................................................................... 14
1.3.2. Ecological surveys...................................................................... 15
1.3.3. Genetic samples.......................................................................... 16
1.3.4. Genetic analysis.......................................................................... 17
1.3.5. Isolation by distance ................................................................... 17
1.3.6. Effective density from temporal method.................................... 18
1.3.7. Effective density from census density........................................ 20
1.3.8. Uncertainty ................................................................................. 21
1.4. Results ....................................................................................................... 22
1.4.1. Adult density .............................................................................. 22
1.4.2. Genetic analysis.......................................................................... 23
1.4.3. Temporal estimates of effective density..................................... 24
1.4.4. Effective density from census density........................................ 24
1.4.5. Dispersal distance....................................................................... 25
![Page 10: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/10.jpg)
x
1.5. Discussion.................................................................................................. 25
1.5.1. The central role of effective density and census density ............ 26
1.5.2. Effective density from genetic diversity?................................... 27
1.5.3. Assumptions of dispersal calculations........................................ 28
1.5.4. Comparison to other measures of larval dispersal...................... 29
1.5.5. Reef patchiness and comparison to self-recruitment.................. 30
1.6. Conclusions and future directions ............................................................. 31
1.7. Acknowledgments ..................................................................................... 32
1.8. References ................................................................................................. 33
1.9. Tables ........................................................................................................ 40
1.10. Figures ..................................................................................................... 43
Chapter 2: Open and closed seascapes: where does habitat patchiness create
populations with low immigration? .............................................................. 49
2.1. Abstract...................................................................................................... 49
2.2. Introduction ............................................................................................... 49
2.3. Materials and Methods .............................................................................. 53
2.3.1. Model.......................................................................................... 53
2.3.2. Simplifications for applying the model ...................................... 55
2.3.3. Application to simple seascapes................................................. 56
2.3.4. Application to remotely sensed seascapes.................................. 56
2.4. Results ....................................................................................................... 56
2.4.1. Population openness in simple seascapes................................... 56
2.4.2. Comparison to empirical studies ................................................ 57
2.4.3. Closed populations within empirical seascapes ......................... 58
2.5. Discussion.................................................................................................. 60
2.5.1. A new language for marine connectivity: immigration and
emigration................................................................................. 61
2.5.2. Immigration in naturally patchy landscapes............................... 62
2.5.3. Model limitations........................................................................ 63
![Page 11: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/11.jpg)
xi
2.5.4. Future directions......................................................................... 64
2.6. Acknowledgments ..................................................................................... 65
2.7. References ................................................................................................. 65
2.8. Figures ....................................................................................................... 70
Chapter 3: Unexpected patterns of fisheries collapse in the world’s oceans ........ 79
3.1. Abstract...................................................................................................... 79
3.2. Introduction ............................................................................................... 79
3.3. Materials and Methods .............................................................................. 81
3.3.1. Data sources................................................................................ 81
3.3.2. Fishery collapses – Assessment data.......................................... 82
3.3.3. Fishery collapses – Landings data.............................................. 82
3.3.4. Fisheries characteristics.............................................................. 84
3.3.5. Life history traits ........................................................................ 84
3.3.6. Statistical models........................................................................ 85
3.3.7. Phylogenetically independent contrasts ..................................... 86
3.4. Results ....................................................................................................... 87
3.5. Discussion.................................................................................................. 89
3.6. Acknowledgements ................................................................................... 92
3.7. References ................................................................................................. 93
3.8. Tables ........................................................................................................ 98
3.9. Figures ..................................................................................................... 108
3.10. Supplementary Material ........................................................................ 117
Chapter 4: Genetic impacts of overfishing are widespread.................................. 127
4.1. Abstract and Introduction ........................................................................ 127
4.2. Results and Discussion ............................................................................ 128
4.3. Materials and Methods ............................................................................ 132
4.3.1. Literature selection ................................................................... 132
4.3.2. Analysis .................................................................................... 133
![Page 12: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/12.jpg)
xii
4.3.3. Simulations ............................................................................... 134
4.4. Acknowledgements ................................................................................. 135
4.5. References ............................................................................................... 135
4.6. Figures ..................................................................................................... 139
4.7. Supplementary Material .......................................................................... 143
![Page 13: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/13.jpg)
xiii
List of Tables
Table 1.1. Microsatellite loci used in Amphiprion clarkii............................................ 40
Table 1.2. Densities of A. clarkii compiled from the literature.................................... 41
Table 1.3. Sample sizes of A. clarkii at each site ......................................................... 42
Table 3.1. Species with stocks that had collapsed according to stock assessments and
in the landings database.................................................................................... 98
Table 3.2. Parameters for models predicting the proportion of stocks collapsed within
each species .................................................................................................... 104
Table 3.S1. Additional sources consulted for data on egg diameter and fecundity ... 117
Table 4.S1. References for the overfished and control species ................................... 143
![Page 14: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/14.jpg)
xiv
List of Figures Figure 1.1. Cebu and Leyte Islands in the central Philippines ..................................... 43
Figure 1.2. Census densities of A. clarkii in Cebu and Leyte, Philippines .................. 44
Figure 1.3. Genetic distance between A. clarkii populations in Cebu and Leyte......... 45
Figure 1.4. Graph illustrating the calculation of dispersal spread................................ 46
Figure 1.5. Effects of reef patchiness on the self-recruitment fraction ........................ 47
Figure 2.1. Diagram illustrating habitat patchiness and dispersal................................ 70
Figure 2.2. Maps of coral reef seascapes that were analyzed for openness ................. 71
Figure 2.3. Percent immigration on a one-dimensional coastline or a two-dimensional
grid.................................................................................................................... 72
Figure 2.4. Percent immigration with advection .......................................................... 73
Figure 2.5. Variation in openness across patchy seascapes.......................................... 74
Figure 2.6. Population openness within each of 17 coral reef seascapes ..................... 75
Figure 2.7. Mean immigration plotted against mean nearest neighbor distance .......... 76
Figure 2.8. The exact level of immigration depends on grid size ................................ 77
Figure 3.1. Life history patterns of fished species...................................................... 108
Figure 3.2. Collapses in the assessment database in relation to life history traits...... 109
Figure 3.3. Collapses in the landings database in relation to life history traits .......... 110
Figure 3.4. Life history trends in the proportion of overfished stocks (assessment data)
........................................................................................................................ 111
Figure 3.5. Life history patterns with an alternative definition of collapse (landings
data) ................................................................................................................ 112
Figure 3.6. Life history trends in the magnitude of decline ....................................... 113
Figure 3.7. Life history patterns after correcting for relative fishery mortality
(assessment data) ............................................................................................ 114
Figure 3.8. Life history patterns after correcting for phylogeny (assessment data) ... 115
Figure 3.9. Life history patterns after correcting for phylogeny (landings data) ....... 116
Figure 4.1. Illustration of paired comparisons............................................................. 139
![Page 15: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/15.jpg)
xv
Figure 4.2. Overfished species have consistently lower allelic richness than closely
related control species ..................................................................................... 140
Figure 4.3. Overfished species have similar heterozygosity when compared to closely
related control species ..................................................................................... 141
Figure 4.4. Expected loss of allelic richness and heterozygosity from simulated
bottlenecks ...................................................................................................... 142
![Page 16: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/16.jpg)
xvi
![Page 17: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/17.jpg)
1
Introduction
A central goal of ecology has long been to understand the forces driving the
distribution and abundance of organisms. Asking questions about why populations
fluctuate, or why animals are found here but not there, help us to understand the
structure of the natural world around us. In addition, the answers to these questions
provide guidance as we try to conserve the beauty and value that we derive from
nature, both on land and in the sea.
Early research on fluctuations in natural populations emphasized external
influences on the abundance of animals, such as the effects of disease or weather on
mortality (Andrewartha & Birch 1954). In the 1950s and 1960s, the emphasis
switched to intrinsic forces that regulate populations, including density-dependence, or
the tendency for populations to grow when rare and to decline when overly abundant
(Krebs 1995). Further developments have revealed the influence of non-linear
dynamics within populations (Higgins et al. 1997) and uncovered the importance of
large-scale and predictable climate forcing (Bjørnstad & Grenfell 2001). Areas of
active research include investigations on the role that dispersal between populations
plays in determining population persistence (Levins 1969; Hanski 1998; Hastings &
Botsford 2006) and the interplay between evolution and ecology (Stockwell et al.
2003). In addition, the fingerprint of human influences are being seen across an ever-
greater number of systems (Vitousek et al. 1997; Palumbi 2001). In the current
synthesis, the challenge is to understand how this range of forces drives population
dynamics through time and space, and how their relative influence changes with
species and setting (Bjørnstad & Grenfell 2001).
It is in this context that marine species provide a particularly intriguing and
challenging study system. Their population dynamics tend to be highly stochastic,
most species have a great ability to disperse, and as the last group of wild species
exploited commercially, their dynamics and evolution can be strongly influenced by
human behavior. These factors have largely foiled traditional approaches to population
dynamics, and many aspects of marine population dynamics remain poorly known
![Page 18: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/18.jpg)
2
despite the substantial effort we invest in counting and enumerating those that are
commercially important. In addition, harvest was the only major human influence on
marine populations for centuries, but this is now rapidly changing as mineral
extraction, shipping, renewable energy, and recreation begin to crowd the seascape
(Crowder et al. 2006). Where, when, and how much development will be consistent
with vibrant, healthy, and productive marine ecosystems in the future are all pressing
questions.
For many years, marine ecologists viewed populations as largely open, with
dynamics determined by the vagaries of ocean currents that deliver marine larvae each
year (Roughgarden et al. 1988; Caley et al. 1996; Siegel et al. 2008). Most marine
fish, and nearly three-quarters of marine invertebrates, have pelagic larvae that
disperse for weeks or months (Scheltema 1986). These factors lead marine species to
generally have greater dispersal abilities than species on land (Kinlan & Gaines 2003).
Taken to an extreme, the view of open populations posits that local interactions
between individuals of the same or different species, or local levels of exploitation, are
largely irrelevant, and that chance arrival or the direction of ocean currents are all that
matters for population dynamics and community composition (Sale 1977; Roberts
1997). Even if not taken so far, this view of well-mixed marine populations permeates
fisheries management, and populations are often managed as large stocks that span
hundreds of kilometers.
In more recent years, however, evidence has accumulated that some marine
populations are actually quite closed at scales less than a kilometer, and instead
replenished primarily by local reproduction (Jones et al. 1999; Swearer et al. 1999;
Almany et al. 2007). Discovery of genetic breaks within marine populations also hint
that dispersal may not be as extensive as once thought (Barber et al. 2000; Taylor &
Hellberg 2003). This has helped to drive a growing realization that dispersal distances
in marine species may not be as extensive as previously thought (Levin 2006).
Dramatic strides have also been made in modeling the oceanographic currents that
presumably carry larvae from birth until settling (James et al. 2002; Siegel et al.
![Page 19: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/19.jpg)
3
2008), but without empirical measurements of larval dispersal distances, it remains
uncertain how accurate such models are.
Basic quantities such as how far marine larvae actually travel have remained
difficult to measure because their small size, large number, and high mortality rates
preclude standard tracking methods. Therefore, dispersal distances for marine species
remain largely unknown, even though this basic quantity sets the spatial scale of
marine population dynamics and by extension, the appropriate spatial scales of
conservation (Botsford et al. 2001). We currently sit at a point where substantial
theory for marine metapopulations exists (e.g., Armsworth 2002; Hastings & Botsford
2006; Figueira 2009), but we have yet to ground this theory in empirical research. My
first chapter begins to address this problem by developing a new method for
measuring larval dispersal kernels with population genetics (Pinsky et al. 2010).
One of the practical needs driving this interest in spatial marine populations
dynamics is the dramatic trend in marine conservation towards spatial management.
Marine protected areas (MPAs), marine reserves, and now marine spatial management
(Crowder & Norse 2008) are all premised on the idea of setting aside particular areas
of the ocean for particular humans uses or for the lack thereof. How will these choices
affect marine populations? These questions are inherently spatial and have helped
spark efforts to map the ocean’s habitats. These data are often used for choosing
appropriate sites for MPAs (Leslie et al. 2003), and yet on land, such habitat
patchiness has also long been recognized as an important influence on the dispersal of
organisms between populations (Schumaker 1996). In my second chapter, I expand
from the larval dispersal distances in my first chapter to show that, in coral reefs, the
spacing between habitat patches has a strong influence on the openness of marine
populations as well (Pinsky et al. in review). More generally, there is a need to focus
more attention on the effects of habitat patchiness on the spatial dynamics of marine
populations and their conservation, something that is just now becoming possible.
As mentioned above, there are also strong fingerprints of human influence on
marine populations dynamics, particularly those species that are directly harvested for
food or other uses. In some locations, fishing has denuded reefs of large predators
![Page 20: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/20.jpg)
4
(Stevenson et al. 2006) or removed habitat important for many species (Thrush et al.
1998). How the uncoordinated actions of many fisheries around the world add up to a
coherent pattern of impacts across marine species, however, has been controversial
(Pauly et al. 1998; Worm et al. 2009; Branch et al. 2010). These questions inherently
address broad trends in the nature of human preferences, economic forces, the practice
of natural resource management, and, at the core, the sensitivity of species to human
impacts. While large species are most vulnerable to human impacts on land (Cardillo
et al. 2005), I show in my third chapter that fishing acts in a fundamentally different
way across species and has driven both large and small species to collapse with similar
probabilities (Pinsky et al. 2011). Part of the lesson from this chapter is that we
severely impact even those populations that grow the fastest and are presumably the
least sensitive. There are also hints that environmental variability plays a role in some
of these collapses, and the interaction between exploitation and environmental
variability remains an interesting area of research.
In addition to these cross-species impacts, fishing may also have evolutionary
impacts within species (Sharpe & Hendry 2009). This linkage between evolutionary
impacts and population dynamics challenges traditional, non-evolutionary approaches
to understanding population ecology and reflects a growing trend towards recognizing
that evolutionary and ecological processes can act on similar timescales (Stockwell et
al. 2003). In the short term, the collapse and lack of recovery in Atlantic cod (Gadus
morhua) may be due in part to evolutionary changes towards smaller size and early
maturation that were induced by fishing (Olsen et al. 2004). Over the longer term,
researchers have also suggested that fishing can drive a loss of genetic diversity within
species, with implications for the ability of species to adapt to environmental change
(Hauser et al. 2002). My fourth chapter shows that this loss of genetic diversity affects
not only a few isolated species, but is widespread across those that are overfished.
This finding suggests a strong connection between the short-term demographic
consequences of fishing, and of any harvest of wild species, and long-term
evolutionary impacts.
![Page 21: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/21.jpg)
5
Throughout, my dissertation has integrated a diverse set of approaches to
advance marine conservation biology, with a focus on spatial ecology and meta-
analysis to understand large-scale trends. Population genetics in particular has proved
a useful tool, both for tracking larvae through the ocean to understand dispersal and to
track evolutionary consequences of population declines. The growing availability of
ecological information across wide temporal, spatial, and taxanomic scales has also
opened an entirely new set of questions for inquiry, and harnessing this information
was crucial for my third and fourth chapters.
Moving forward, considerable work continues to be needed on the spatial
ecology and spatial dynamics of marine populations. The high levels of dispersal and
stochasticity continue to challenge the simple models developed so far, and the link
between theory and empirical patterns continues to be weak. Linking these will require
innovative fieldwork and practical modeling. Continuing to apply genetic tools to
these ecological questions will likely be an important approach, as will greater
integration with oceanographic information. The analysis of large spatial and temporal
datasets are also likely provide new advances, and there have been some exciting
developments in this area already (Gouhier et al. 2010). The large datasets from
fisheries that are now available are likely to provide important sources of data against
which to test hypotheses. Finally, the influences of climate change on marine
populations are both substantial and largely unknown. Dispersal provides many
marine species with a method for reaching more suitable conditions when climate
changes, but scaling up from the local impacts of climate change to the large scale
spatial dynamics of marine species, including range shifts, remains challenging and in
important area of future work.
Statement on Multiple Authorship
Throughout my tenure as a Ph.D. student, I have benefited tremendously from
collaborations both within Stanford and outside. However, I am the first author and
primary contributor to each of my dissertation chapters, including the design, data
collection, analysis, and writing. The paragraphs below explain the roles of my co-
![Page 22: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/22.jpg)
6
authors, while acknowledgments after each chapter thank the many other individuals
who helped make these projects a reality.
The fieldwork in the central Philippines that forms the core of Chapter 1
benefited greatly from the assistance of Humberto Montes, Jr. in navigating the local
culture, providing access to a field station, and arranging the logistics of fieldwork.
Steve Palumbi helped to design the project, design the analysis, and write the
manuscript.
In Chapter 2, Serge Andréfouët and Sam Purkis provided the remote sensing
data and provided input on the analysis methods. Steve Palumbi helped to design the
analysis and write the manuscript.
For Chapter 3, Olaf Jensen and Steve Palumbi helped to design the analysis
and write the paper, while Dan Ricard provided stock assessment data.
Steve Palumbi helped to design and write Chapter 4.
References
Almany G.R., Berumen M.L., Thorrold S.R., Planes S. & Jones G.P. (2007). Local
replenishment of coral reef fish populations in a marine reserve. Science, 316,
742-744.
Andrewartha H.G. & Birch L.C. (1954). The Distribution and Abundance of Animals.
The University of Chicago Press, Chicago, IL.
Armsworth P.R. (2002). Recruitment limitation, population regulation, and larval
connectivity in reef fish metapopulations. Ecology, 83, 1092-1104.
Barber P.H., Palumbi S.R., Erdmann M.V. & Moosa M.K. (2000). A marine Wallace's
line? Nature, 406, 692-693.
Bjørnstad O.N. & Grenfell B.T. (2001). Noisy clockwork: time series analysis of
population fluctuations in animals. Science, 293, 638-43.
doi:10.1126/science.1062226
![Page 23: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/23.jpg)
7
Botsford L.W., Hastings A. & Gaines S.D. (2001). Dependence of sustainability on
the configuration of marine reserves and larval dispersal distance. Ecol. Lett.,
4, 144-150.
Branch T.A., Watson R., Fulton E.a., Jennings S., McGilliard C.R., Pablico G.T.,
Ricard D. & Tracey S.R. (2010). The trophic fingerprint of marine fisheries.
Nature, 468, 431-435. doi:10.1038/nature09528
Caley M.J., Carr M.H., Hixon M.A., Hughes T.P., Jones G.P. & Menge B.A. (1996).
Recruitment and the local dynamics of open marine populations. Annu. Rev.
Ecol. Syst., 27, 477-500.
Cardillo M., Mace G.M., Jones K.E., Bielby J., Bininda-Emonds O.R.P., Sechrest W.,
Orme C.D.L. & Purvis A. (2005). Multiple causes of high extinction risk in
large mammal species. Science, 309, 1239-1241.
Crowder L. & Norse E. (2008). Essential ecological insights for marine ecosystem-
based management and marine spatial planning. Mar. Policy, 32, 772-778.
doi:10.1016/j.marpol.2008.03.012
Crowder L.B., Osherenko G., Young O.R., Airamé S., Norse E.A., Baron N., Day
J.C., Douvere F., Ehler C.N., Halpern B.S., Langdon S.J., McLeod K.L.,
Ogden J.C., Peach R.E., Rosenberg A.A. & Wilson J.A. (2006). Resolving
mismatches in U.S. ocean governance. Science, 313, 617-618.
Figueira W.F. (2009). Connectivity or demography: Defining sources and sinks in
coral reef fish metapopulations. Ecol. Model., 220, 1126-1137.
Gouhier T.C., Guichard F. & Menge B.A. (2010). Ecological processes can
synchronize marine population dynamics over continental scales. P Natl Acad
Sci USA.
Hanski I. (1998). Metapopulation dynamics. Nature, 396, 41-50.
Hastings A. & Botsford L.W. (2006). Persistence of spatial populations depends on
returning home. Proc. Natl. Acad. Sci. USA, 103, 6067-6072.
Hauser L., Adcock G.J., Smith P.J., Bernal Ramírez J.H. & Carvalho G.R. (2002).
Loss of microsatellite diversity and low effective population size in an
![Page 24: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/24.jpg)
8
overexploited population of New Zealand snapper (Pagrus auratus). P Natl
Acad Sci USA, 99, 11742-11747.
Higgins K., Hastings A., Sarvela J.N. & Botsford L.W. (1997). Stochastic dynamics
and deterministic skeletons: population behavior of dungeness crab. Science,
276, 1431-1435. doi:10.1126/science.276.5317.1431
James M.K., Armsworth P.R., Mason L.B. & Bode L. (2002). The structure of reef
fish metapopulations: modelling larval dispersal and retention patterns. P Roy
Soc Lond B Bio, 269, 2079-2086.
Jones G.P., Milicich M.J., Emslie M.J. & Lunow C. (1999). Self-recruitment in a coral
reef fish population. Nature, 402, 802-804.
Kinlan B.P. & Gaines S.D. (2003). Propagule dispersal in marine and terrestrial
environments: a community perspective. Ecology, 84, 2007-2020.
Krebs C.J. (1995). Two paradigms of population regulation. Wildl. Res., 22, 1.
doi:10.1071/WR9950001
Leslie H., Ruckelshaus M., Ball I.R., Andelman S. & Possingham H.P. (2003). Using
siting algorithms in the design of marine reserve networks. Ecol. Appl., 13,
S185-S198.
Levin L.A. (2006). Recent progress in understanding larval dispersal: new directions
and digressions. Integr. Comp. Biol., 46, 282-297.
Levins R. (1969). Some demographic and genetic consequences of environmental
heterogeneity for biological control. Bulletin of the Entomological Society of
America, 15, 237-240.
Olsen E.M., Heino M., Lilly G.R., Morgan M.J., Brattey J., Ernande B. & Dieckmann
U. (2004). Maturation trends indicative of rapid evolution preceded the
collapse of northern cod. Nature, 428, 932-935.
Palumbi S.R. (2001). Humans as the world’s greatest evolutionary force. Science, 293,
1786-1790.
Pauly D., Christensen V., Dalsgaard J., Froese R. & Torres F., Jr. (1998). Fishing
down marine food webs. Science, 279, 860-863.
![Page 25: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/25.jpg)
9
Pinsky M., Jensen O.P., Ricard D. & Palumbi S.R. (2011). Unexpected patterns of
fisheries collapse in the world’s oceans. Proceedings of the National
Academies of Science. doi:10.1073/pnas.1015313108
Pinsky M., Montes H.R., Jr. & Palumbi S.R. (2010). Using isolation by distance and
effective density to estimate dispersal scales in anemonefish. Evolution, 64,
2688-2700. doi:10.1111/j.1558-5646.2010.01003.x
Pinsky M.L., Palumbi S.R., Andréfouët S. & Purkis S.J. (in review). Open and closed
seascapes: where does habitat patchiness create populations with low
immigration? P Roy Soc B-Biol Sci.
Roberts C.M. (1997). Connectivity and management of Caribbean coral reefs. Science,
278, 1454-1457.
Roughgarden J., Gaines S.D. & Possingham H. (1988). Recruitment dynamics in
complex life cycles. Science, 241, 1460-1466.
Sale P.F. (1977). Maintenance of high diversity in coral reef fish communities. The
American Naturalist, 111, 337-359.
Scheltema R.S. (1986). On dispersal and planktonic larvae of benthic invertebrates: an
eclectic overview and summary of problems. Bull. Mar. Sci., 39, 290-322.
Schumaker N.H. (1996). Using landscape indices to predict habitat connectivity.
Ecology, 77, 1210-1225.
Sharpe D.M.T. & Hendry A.P. (2009). Life history change in commercially exploited
fish stocks: an analysis of trends across studies. Evolutionary Applications, 2,
260-275. doi:10.1111/j.1752-4571.2009.00080.x
Siegel D.A., Mitarai S., Costello C.J., Gaines S.D., Kendall B.E., Warner R.R. &
Winters K.B. (2008). The stochastic nature of larval connectivity among
nearshore marine populations. P Natl Acad Sci USA, 105, 8974-8979.
Stevenson C., Katz L.S., Micheli F., Block B.A., Heiman K.W., Perle C., Weng K.,
Dunbar R. & Witting J. (2006). High apex predator biomass on remote Pacific
islands. Coral Reefs, 26, 47-51.
Stockwell C.A., Hendry A.P. & Kinnison M.T. (2003). Contemporary evolution meets
conservation biology. Trends Ecol. Evol., 18, 94-101.
![Page 26: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/26.jpg)
10
Swearer S.E., Caselle J.E., Lea D.W. & Warner R.R. (1999). Larval retention and
recruitment in an island population of a coral-reef fish. Nature, 402, 799-802.
Taylor M.S. & Hellberg M.E. (2003). Genetic evidence for local retention of pelagic
larvae in a Caribbean reef fish. Science, 299, 107-109.
Thrush S.F., Hewitt J.E., Cummings V.J., Dayton P.K., Cryer M., Turner S.J., Funnell
G.A., Budd R.G., Milburn C.J. & Wilkinson M.R. (1998). Disturbance of the
marine benthic habitat by commercial fishing: Impacts at the scale of the
fishery. Ecol. Appl., 8, 866-879.
Vitousek P.M., Mooney H.A., Lubchenco J. & Melillo J.M. (1997). Human
domination of Earth's ecosystems. Science, 277, 494-499.
Worm B., Hilborn R., Baum J.K., Branch T.A., Collie J.S., Costello C., Fogarty M.J.,
Fulton E.A., Hutchings J.A., Jennings S., Jensen O.P., Lotze H.K., Mace P.M.,
McClanahan T.R., Minto C., Palumbi S.R., Parma A.M., Ricard D., Rosenberg
A.A., Watson R. & Zeller D. (2009). Rebuilding global fisheries. Science, 325,
578.
![Page 27: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/27.jpg)
11
Chapter 1
Using isolation by distance and effective density
to estimate dispersal scales in anemonefish
1.1 Abstract
Robust estimates of dispersal are critical for understanding population
dynamics and local adaptation, as well as for successful spatial management. Genetic
isolation by distance patterns hold clues to dispersal, but understanding these patterns
quantitatively has been complicated by uncertainty in effective density. In this study,
we genotyped populations of a coral reef fish (Amphiprion clarkii) at 13 microsatellite
loci to uncover fine-scale isolation by distance patterns in two replicate transects.
Temporal changes in allele frequencies between generations suggested that effective
densities in these populations are 4-21 adults/km. A separate estimate from census
densities suggested that effective densities may be as high as 82-178 adults/km.
Applying these effective densities with isolation by distance theory suggested that
larval dispersal kernels in A. clarkii had a spread near 11 km (4-27 km). These kernels
predicted low fractions of self-recruitment in continuous habitats, but the same kernels
were consistent with previously reported, high self-recruitment fractions (30-60%)
when realistic levels of habitat patchiness were considered. Our results suggested that
ecologically relevant larval dispersal can be estimated with widely available genetic
methods when effective density is measured carefully through cohort sampling and
ecological censuses, and that self-recruitment studies should be interpreted in light of
habitat patchiness.
![Page 28: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/28.jpg)
12
1.2 Introduction
Dispersal drives population dynamics, range limits, and local adaptation, and
can thereby enhance ecosystem resilience (Roughgarden et al. 1988; Gaston 1996;
Nyström & Folke 2001; Lenormand 2002). Dispersal also sets the spatial scale of
ecological and evolutionary processes, and therefore determines the relative
importance of local and regional forces within ecosystems. In the ocean, marine
currents and long pelagic larval stages for most organisms create a high potential for
long-distance dispersal, despite relatively sedentary adults (Scheltema 1986;
Roughgarden et al. 1988; Mora & Sale 2002). High levels of genetic similarity across
wide ocean distances support this view of open populations (Palumbi 1992; Mora &
Sale 2002), where individual populations primarily receive recruits from other
populations rather than from themselves (Jones et al. 1999). However, recent tagging
evidence for short-distance larval dispersal (Swearer et al. 1999; Jones et al. 2005;
Almany et al. 2007; Planes et al. 2009; Saenz-Agudelo et al. 2009) and sharp genetic
breaks in species thought to have high dispersal (Barber et al. 2000; Taylor &
Hellberg 2003) suggest that marine dispersal may instead be surprisingly local. As
fisheries decline and coastal habitats degrade, identifying typical scales of marine
larval dispersal is critical for ecosystem-based management (Sale et al. 2005).
One difficulty in research to date is that most genetic and self-recruitment
analyses only measure a small portion of the dispersing individuals. Many genetic
methods are strongly influenced by rare, long-distance dispersal events (Slatkin 1987;
Waples & Gaggiotti 2006), and these methods are therefore most useful where
migration rates are low. However, rare events over evolutionary timescales may be
irrelevant to current ecological processes and management decisions. On the other
hand, tagging or parentage studies require recapture of individuals or their offspring,
and are therefore conducted over areas of limited extent. One danger of these studies is
that typical dispersal distances may be underestimated (Koenig et al. 1996).
Genetic approaches based on isolation by distance theory may present a middle
ground that estimates ecologically relevant dispersal parameters (Slatkin 1993;
![Page 29: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/29.jpg)
13
Rousset 1997; Palumbi 2003). When sampled over small spatial scales, these genetic
patterns are driven by effective population density and typical dispersal over the past
few generations, and are less affected by evolutionary or rare events (Rousset 1997;
Hardy & Vekemans 1999; Leblois et al. 2004). Highly polymorphic genetic markers
such as microsatellites makes sampling over small spatial scales both possible and
informative (Selkoe & Toonen 2006).
Isolation by distance patterns represent a balance between genetic drift and
dispersal, and strong isolation patterns can therefore result from either strongly limited
dispersal or low effective density. To date, isolation by distance patterns are often
interpreted as evidence that dispersal is limited by distance, but that distance remains
unknown. To understand dispersal distances quantitatively, we need information on
effective population density. While some studies have taken guesses at what effective
densities may be (Kinlan & Gaines 2003; Palumbi 2003; Buonaccorsi et al. 2004),
estimation of effective density in marine species is difficult. Census sizes for many
marine organisms are in the millions, but estimates of effective size in some species
are up to six orders of magnitude smaller (Hedgecock 1994; Hauser et al. 2002;
Árnason 2004; Hoarau et al. 2005). Practical approaches to empirically estimate
effective density are needed for a more accurate understanding of dispersal.
Anemonefish (genera Amphiprion and Premnas) provide a productive system
in which to develop these methods because previous research provides initial
expectations for their dispersal scales. They are also intensely exploited for the
aquarium trade (Shuman et al. 2005) and therefore strong candidates for conservation
within marine protected areas if dispersal scales are known. Larvae hatch after
approximately 7 days from benthic eggs laid adjacent to the parents’ anemone, then
spend 7-11 days in the pelagic ocean (Thresher et al. 1989) before settling onto a host
anemone for the rest of their lives (Fautin & Allen 1992). Genetic studies have
revealed low genetic distance between populations 1000 km apart on the Great Barrier
Reef, and this has been interpreted as 5 migrants per generation dispersing this
distance (Doherty et al. 1995). On the other hand, 25-60% self-recruitment fractions
have also been measured in anemonefish with artificial otolith tags and genetic
![Page 30: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/30.jpg)
14
parentage analysis (Jones et al. 2005; Almany et al. 2007; Planes et al. 2009; Saenz-
Agudelo et al. 2009). These high fractions suggest highly localized dispersal, though
the studies were conducted on relatively isolated islands. These disparate pieces of
evidence for dispersal scales in anemonefish have appeared difficult to reconcile.
In this study, we searched for isolation by distance patterns in a common coral
reef fish (A. clarkii) and take multiple approaches to estimate effective density. We
then used these estimates to derive more robust estimates of larval dispersal scales
than have been available previously. Finally, we determined whether our dispersal
estimates were consistent with long-distance or local dispersal.
1.3 Materials and Methods
1.3.1 Study system
Clark’s anemonefish (A. clarkii) is a species distributed throughout the Indo-
Pacific. Along the islands of Cebu and Leyte in the central Philippines, populations are
relatively continuous at the scale of kilometers, except where coral reefs are disrupted
by sandy sediment near major river outflows. Currents in this region reverse with the
seasonal monsoons, flowing primarily northwards along each coast during the
northeast monsoon in January and primarily southwards in August with the southwest
monsoon (USAID 2007). Based on an oceanographic model of the region, currents are
likely weakest in Ormoc Bay (< 15 cm/s) on the west coast of Leyte and strongest in
the shallow water between Bohol and Leyte (up to 100 cm/s) (USAID 2007).
Our study sites were 25 km apart along the east coast of Cebu (n = 10) and the
west coast of Leyte (n = 8) (Fig. 1.1). The two coastlines were chosen as replicates to
examine common processes affecting dispersal. We intentionally designed our
sampling over narrower spatial scales (223-252 km of coastline) than most marine
dispersal studies. Genetic differentiation of samples that are close together spatially
are more likely to represent recent rather than past migration rates because time to
equilibrium is shorter (Slatkin 1993; Hardy & Vekemans 1999).
![Page 31: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/31.jpg)
15
1.3.2 Ecological surveys
Census density of A. clarkii along coral reef coastlines was measured with
underwater visual transects while on SCUBA during August-October 2008. Visual
transects were swum parallel to the fringing reef. Two divers recorded the number and
size of each anemonefish on each anemone in two 5 m swaths that were randomly
located from 3 to 12 m deep. The two largest fish per anemone were considered the
breeding adults if they were at least 8 cm long (Ochi 1989). One diver towed a GPS
unit that recorded position every 15 seconds in order to precisely measure the length
of each transect path.
Transects were located exactly 25 km apart on each island, with locations
chosen by GPS prior to visiting the site (n = 10 on Cebu and n = 6 on Leyte).
Transects were not relocated if habitat was poor to ensure that we estimated an
unbiased, mean coastal density (D). Each transect was on average 71 ± 8 minutes and
655 ± 51 m long, for a total area surveyed of 111,000 m2. We chose to conduct fewer
but longer transects so as to average over small-scale spatial variability. The surveys
covered 1/40th of the length of the 475 km study area.
Area of each transect was calculated in ArcGIS 9.2 (ESRI, Redlands, CA)
from the GPS tracks. We multiplied census densities (fish per m2) by reef width to
calculate linear fish density (fish per km). We measured reef width at our sampling
sites from satellite photos in Google Earth.
In addition, two to six additional “reef surveys” were conducted during sample
collection dives in the vicinity of each study site specifically on high quality coral reef
habitat in Cebu (n = 27) and Leyte (n = 12). The underwater protocol for these reef
surveys was the same as for the census transects described above. These reef surveys
covered an additional 160,000 m2 of reef, spanning in total about 1/15th of the length
of our study area. When analyzing these reef surveys, however, we had to account for
the fact that they represented density on coral reef habitats rather than coast-wide
density. Therefore, we used ArcGIS and the Reefs at Risk coral reef map (Burke et al.
2002) to calculate the area of Cebu and Leyte’s coastline covered by reef habitat. We
then multiplied reef area (m2) by the density of fish on reef habitats (fish per m2) and
![Page 32: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/32.jpg)
16
divided by coastline length to get linear fish density (fish per km). This is the same
approach as applied by Puebla et al. (2009).
Finally, we compared our density estimates to those in the literature to ensure
that we were not greatly under- or over-estimating typical A. clarkii densities.
1.3.3 Genetic samples
We collected non-lethal finclips underwater from A. clarkii in August-October
2008 after capturing fish with dip and drive nets at our sampling sites. Sampling was
conducted at nearby locations if few or no fish were present at the precise sampling
site. The first twenty fish of any size were sampled, and samples were stored in 70%
ethanol. Size of each specimen was recorded to the nearest cm and location was
marked by GPS.
We extracted DNA from all samples with Nucleospin (Machery-Nagel,
Bethlehem, PA) or DNEasy 96 (Qiagen, Valencia, CA) column extraction kits. We
amplified and genotyped 13 microsatellite loci (Table 1.1). Two loci were found
through cross-species amplification of loci screened by Beldade et al. (2009), though
not published by them. These loci were B6 (F: 5’-3’ TGTCTTCTCCCCAAGTCAG,
R: 5’-3’ ACGAGGCTCAACATACCTG) and C1 (F: 5’-3’
GCGACCTTGTTATCACTGTC, R: 5’-3’ TTGGTTGGACTTTCTTTGTC).
Final concentrations in 10 µl PCR reactions were 1 µl genomic DNA, 1x
Fermentas PCR buffer, 3mM MgCl2, 500 nM fluorescently labeled primer, 500 nM
unlabeled primer, 40 µM each dNTP, and 0.1 µl (0.5 U) Fermentas Taq. Thermal
cycling consisted of a 94°C denaturing step for 2 minutes, followed by 30 cycles of
94°C for 45 seconds, annealing temperature for 45 seconds (Table 1.1), and 72°C for
45 seconds, followed by a final extension at 72°C for 1 minute. Some loci were
multiplexed using the Type-it Microsatellite PCR kit (Qiagen) and the manufacturer’s
PCR protocol with a 60°C or 57°C annealing temperature. PCR products were
genotyped on an Applied Biosystems 3730 (MRDDRC Molecular Genetics Core
Facility at Children's Hospital Boston) and analyzed in GeneMapper 4.0 (Applied
Biosystems, Foster City, CA). All genotypes were checked by eye.
![Page 33: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/33.jpg)
17
Genotyping error rate was assessed with duplicate, independent PCRs and
genotypes for 11 to 66 samples per locus.
1.3.4 Genetic analysis
We assessed genetic linkage and departure from Hardy-Weinberg Equilibrium
(HWE) in Genepop with 5000 iterations (Rousset 2008). Linkage and HWE were
assessed independently for each locus within each population, then p-values were
combined across populations with Fisher’s method (Sokal & Rohlf 1995). We report
Weir & Cockerham’s FIS estimate (Weir & Cockerham 1984). We calculated FST and
expected heterozygosity (He) in Arlequin 3.11 using the number of different alleles
between multilocus genotypes (Excoffier et al. 2005). We use α = 0.05 as our Type I
error rate throughout and apply Bonferroni corrections where appropriate (Rice 1989).
We assessed the presence of an isolation by distance pattern with a Mantel test
for each island and then calculated a combined p-value across both islands using
Fisher’s method (Sokal & Rohlf 1995). This combination is appropriate because data
from each island independently test the hypothesis of isolation by distance. We used
the smatr package in R 2.8.1 (Warton & Ormerod 2007) to calculate the slope of the
relationship with reduced major axis regression. This method is appropriate when
distance between populations is measured with error (Hellberg 1994; Sokal & Rohlf
1995). We also jackknifed over populations to ensure that one outlier population was
not having a large influence on our slope estimate.
1.3.5 Isolation by distance
Population genetics theory predicts that the balance between drift and
migration in a continuous population will result in a positive correlation of genetic and
geographic distance between samples (Rousset 1997). This relationship is called
isolation by distance. If the organism is distributed in a linear habitat and samples are
taken in discrete locations,
![Page 34: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/34.jpg)
18
(1)
where σ is the spread of the dispersal kernel, De is effective density, and m is
the slope of the relationship between FST/(1-FST) and geographic distance (Rousset
1997). Technically, spread is the standard deviation of parental position relative to
offspring position (Rousset 1997), otherwise known as the standard deviation of the
dispersal kernel. Dispersal spread (σ) can be estimated from Eq. 1 if the slope (m) and
effective density (De) are known. Effective density can be thought of as effective
population size (Ne) divided by the area occupied by this population. The same set of
factors that reduce Ne below census population size (N) (Frankham 1995) also reduce
De below census density (D) (Watts et al. 2007).
Isolation by distance theory is built on a Wright-Fisher model of reproduction,
assumes no selection, and assumes that the population is at drift-migration
equilibrium. The one-dimensional formula used here is appropriate when the length of
the habitat is greater than the width (Rousset 1997). This assumption seems
appropriate on our study reefs, which are hundreds of kilometers long and only
hundreds of meters wide.
1.3.6 Effective density from temporal method
Methods to estimate effective density from genetic data are not readily
available for continuous populations, though continuous populations are common in
the natural world. We take two, independent approaches to estimating effective
density in this paper. Our first approach uses temporal genetic change, while our
second approach is derived from census density (D).
The change in allele frequencies between cohorts contains information about
the effective size of the population, but this information can be confounded by
migration from surrounding populations. In general, allele frequencies will become
more similar to the source population if migration is strong, while frequencies will
![Page 35: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/35.jpg)
19
change independently of the source if drift is strong. The pseudo-maximum likelihood
method of Wang and Whitlock (2003) uses this information to estimate effective size
independently from immigration rates. Their method considers both temporal changes
in gene frequencies in a focal population and the gene frequencies in a source
population from which migrants arrive. The method assumes that there is no selection
and negligible mutation, that the source population can be identified, that gene
frequencies in the source population are stable, and that sampling does not impact the
availability of reproductive individuals (Wang & Whitlock 2003).
For the estimate of effective size as implemented in MNe 2.0 (Wang &
Whitlock 2003), we defined two cohorts of A. clarkii: the breeding adults (largest pair
on each anemone if ≥8cm) and the juveniles (≤6cm). A. clarkii grows to 6 cm in 2-3
years, reaches reproductive size at 5-6 years, and is known to live as long as 11 years
(Moyer 1986; Ochi 1986). We therefore assume these cohorts are parental and
offspring samples about one generation apart, though individual pairs of fish may be a
bit closer or further apart in age.
To define the source population, we first combined all non-focal samples
because differentiation between populations was low (“MNe-All”). As an alternative
definition of the source, we used the two populations flanking the focal population
(“MNe-Flanking”). In each case, we repeated the calculation separately with each
sampling site as the focal site. We report the median effective size across sites and
bootstrap percentile confidence intervals from 10,000 resamples with replacement
(Davison & Hinkley 1997).
These two approaches with MNe gave us estimates of local effective
population size. These estimates of effective size excluded the fish in other
populations centered 25 km and more in each direction. Therefore, we assumed that
the spatial extent of each local population extended halfway to each flanking
population (12.5 km in each direction). We converted local effective size to effective
density by dividing the effective size by the spatial extent of each local population (25
km).
![Page 36: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/36.jpg)
20
1.3.7 Effective density from census density
A number of factors reduce effective size below census size, including
fluctuations in population size through time, unequal sex ratios, variance in family
size, and variance in reproductive success (Frankham 1995). Marine species may be
most affected by variance in reproductive success because of family-correlated
survival through larval dispersal (sweepstakes recruitment) and age-related increases
in fecundity and offspring survival (Hauser et al. 2002; Hedrick 2005). Variance in
reproductive success is strongly affected by the mating system, number of mates,
fecundity, and longevity of a species, as well as the environmental variability a
population experiences (Clutton-Brock 1988). Because anemonefish have similar
mating systems and number of mates (permanent pair bonds, (Fautin & Allen 1992)),
similarly high fecundity (thousands to tens of thousands of eggs per year, (Richardson
et al. 1997)), similar lifespans (around a decade, (Fautin & Allen 1992)), and
experience relatively low environmental variability in tropical climates, we expect that
variance in reproductive success will be similar across anemonefish species.
To estimate variance in reproductive success for Amphiprion, we analyzed
genetic parentage studies by Jones et al. (2005) in A. polymnus and Planes et al. (2009)
in A. percula. These studies found that 15 of 33 or 77 of 270 potential breeding pairs
(respectively) produced locally recruiting larvae in 23 or 108 larvae sampled (Jones et
al. 2005; Planes, pers. comm.). Since observations of non-locally recruiting offspring
were not made, we needed to consider the limited sampling of these studies. We did
this by simulating breeding pairs (33 or 270) whose reproductive success was modeled
by a negative binomial distribution with a mean of two offspring per breeding pair (a
stable population) and a variance that we fit to the data. While a Poisson distribution is
often used when all parents have the same probability of reproducing, the negative
binomial can allow probability of reproducing to vary among parents (Bolker 2008).
From each simulation, we selected a subsample of the offspring (23 or 108) and
compared the number of parents represented in this sample to the number of parents
observed by Jones et al. or Planes et al. (15 or 77). We conducted 10,000 simulations
![Page 37: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/37.jpg)
21
for each of two hundred reproductive variance values between 2 and 100 on a log10
scale and selected the variance most likely to reproduce the observed values.
Equation 2 in Hedrick (2005) allows us to calculate the ratio of effective (Ne)
to census (N) population size as
(2)
where Vk is the variance in reproductive success. We then calculate De as
(3)
1.3.8 Uncertainty
Each step of our calculations contained a certain degree of uncertainty. Some
uncertainty resulted from uncertainty in parameter estimation, while other resulted
from uncertainty in which method to use to estimate effective density. We used both
temporal genetic and census methods to explore methodological uncertainty, and we
propagated parameter uncertainty through all of our calculations with bootstrap
resampling. To do the latter, we sampled the parameter values in Eqs. 1 and 3 from
probability distributions that reflected the uncertainty for each parameter (m, De, D, or
Ne/N) and repeated this 10,000 times. We used normal distributions for D and Ne/N,
but used a lognormal distribution for m because confidence intervals from reduced
major axis regression are asymmetric. For the MNe estimates of De, we sampled from
the bootstrapped distribution of medians (see above). In addition, we replicated our
calculations independently on two islands to examine the reliability of our results.
![Page 38: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/38.jpg)
22
1.4 Results
1.4.1 Adult density
Our surveys revealed coast-wide A. clarkii densities on Cebu (0.53 ± 0.16
fish/100 m2, n = 10) that were similar to densities on Leyte (0.55 ± 0.45 fish/100 m2, n
= 6), though Leyte densities were more variable and included numerous zeros (Fig
1.2). Leyte’s reefs are often found as small patches, and some surveys landed on sandy
habitat. The densities that we observed do not appear unusual for A. clarkii (Table
1.2). A literature search revealed mean (1.1 ± 0.47 fish/100 m2, n = 7) and median
densities (0.36 fish/100 m2, n = 7) that were similar to our observations.
Adults made up 13-66% of the fish in each survey, and adult densities were
higher on Cebu (0.21 ± 0.071 adults/100 m2, n = 10) than on Leyte (0.096 ± 0.064
adults/100 m2, n = 6). From satellite photos, we estimated that reefs in our study
region were approximately 150 m wide. Therefore, mean density (D) of A. clarkii in
Cebu was 317 ± 107 adults/km and 144 ± 96 adults/km in Leyte.
As an estimate of census density with a larger sample size, we also analyzed all
of our reef surveys on Cebu (0.25 ± 0.061 adults/100 m2, n = 27) and Leyte (0.16 ±
0.056 adults/100 m2, n = 12). We also estimated reef area to be 47 km2 along the 252
km east coast of Cebu and 32 km2 along the 223 km west coast of Leyte. Our
calculations therefore suggested a mean linear density from our reef surveys of 457 ±
114 adults/km (Cebu) and 231 ± 80 adults/km (Leyte). The coast-wide densities
calculated from reef surveys were higher than those from our census transects, but not
significantly so (p > 0.38). We would expect these densities to be higher because the
reef surveys were biased towards high quality coral reef habitats. In addition, the error
bounds on the reef surveys were of similar width to those from the census transects
despite twice the sample size, suggesting that additional survey effort would not
greatly reduce uncertainty in census density. Because the reef surveys are likely biased
high, and because the extra computational steps required to analyze the reef surveys
likely introduces additional error and bias that is difficult to quantify (particularly in
![Page 39: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/39.jpg)
23
the calculation of reef area), we use our census transects for all further calculations of
effective density.
1.4.2 Genetic analysis
Among 369 A. clarkii samples (Table 1.3) genotyped at 13 microsatellite loci,
the number of alleles per locus ranged from 3 to 18 (mean: 9.5) (Table 1.1). None of
the loci showed significant departure from HWE after combining p-values across
populations (p > 0.052 for all loci), though 13 of the 234 locus-by-population
comparisons (5.6%) were significant. Only one of 78 locus pairs (1.3%) showed
significant linkage (APR_Cf8 and NNG_028, p = 0.047), but this is likely due to the
number of comparisons we made rather than actual linkage. The genotyping error rate
was zero for eleven loci, and 3.2% or less for the remaining two loci (Table 1.1).
Expected heterozygosity ranged from 0.102 to 0.890 with a mean of 0.615 ± 0.067.
FSTs between any two sites were low (< 0.028) and 17 of 153 pair-wise
comparisons (11%) were significant (0.05 > p > 0.002). While more than the 5% of
comparisons expected to be significant by chance, none of these comparisons
remained significant after Bonferroni corrections. One interpretation of these data
would be to conclude that gene flow across the study area is common and that, if any
restrictions to gene flow exist, they are weak and not detectable with the current
sampling design.
However, as predicted by a drift-migration balance in continuous populations
with distance-limited dispersal, a positive relationship between genetic and geographic
distance was observed on both Cebu and Leyte with a combined p-value of 0.009 (Fig
1.3). The slope (m) in Leyte (1.89 x 10-4, 95% CI: 1.60 x 10-4 - 2.23 x 10-4) was higher
than that in Cebu (0.847 x 10-4, 95% CI: 0.630 x 10-4 - 1.14 x 10-4). To ensure that one
outlier population was not having a large influence on our slope estimates, we
jackknifed over populations. Jackknifed mean slopes were slightly steeper that linear
model slopes for both Leyte (2.04 x 10-4 ± 0.819 x 10-4) and Cebu (0.908 x 10-4 ±
0.256 x 10-4), but were well within the 95% CI for the original estimates. Similarly,
![Page 40: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/40.jpg)
24
removing the two loci with non-zero error rates (Cf29 and 65) led to somewhat steeper
slope estimates (2.2 x 10-4 in Leyte and 0.92 x 10-4 in Cebu).
1.4.3 Temporal estimates of effective density
As our first approach to calculating effective density, we estimated population
size for single sampling sites with our MNe-All method (the source defined as all non-
focal populations). MNe failed while profiling 95% confidence intervals for some
sampling sites, potentially due to low sample sizes, but still reported the maximum
likelihood estimates of effective size (Ne) in all cases. Median effective size across
sampling sites was 92 in Cebu (95% CI: 77 – 196) and 101 in Leyte (95% CI: 54 –
286). Based on 25 km of reef between sampling sites, this would be equivalent to a De
of 3.7 (Cebu, 95% CI: 3.1 – 7.8) or 4.0 (Leyte, 95% CI: 2.2 – 11) adults/km.
Because MNe is sensitive to misidentification of the source population of
immigrants (Wang & Whitlock 2003), we also reran the analysis while defining the
source as the two populations flanking each focal sampling site. The Ne estimates for
MNe-Flanking were generally larger, with a median size of 526 in Cebu (95% CI: 330
– 2360) and 327 in Leyte (95% CI: 150 – 5020). These higher sizes suggested higher
De of 21 (Cebu, 95% CI: 13 – 94) or 13 (Leyte, 95% CI: 6 – 200) adults/km.
1.4.4 Effective density from census density
Our second approach to estimating effective density was to consider previously
published information on reproductive success in Amphiprion and our observed census
densities on Cebu and Leyte. Our simulations of reproductive variance revealed that a
variance of 4.3 was most likely to produce the Jones et al. (2005) observations in A.
polymnus, while a variance of 6.0 was most likely to produce the Planes et al. (2009)
observations in A. percula. Using equation 2 suggested Ne/N ratios in Amphiprion of
0.63 or 0.50, with a mean of 0.57 ± 0.065.
Therefore, considering uncertainty in both D and Ne/N, our demographic
estimates of effective density are 178 ± 64 (Cebu) and 82 ± 55 (Leyte) adults/km.
![Page 41: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/41.jpg)
25
1.4.5 Dispersal distance
By using Eq. 1 and our isolation by distance slopes on Cebu and Leyte, we
could define the relationship between effective density and dispersal spread (the
diagonal lines in Fig 1.4), but we could not calculate dispersal spread (σ) without
knowing De. Our three estimates of De on each island provided us with six estimates
of dispersal spread (Fig. 1.4). From MNe-All, we estimated a dispersal spread of 27
km (Cebu, 95% CI: 20 - 33) or 18 km (Leyte, 95% CI: 10 - 25). Our estimates from
MNe-Flanking were lower because the effective density estimates were higher: 12 km
(Cebu, 95% CI: 6 – 16) and 10 km (Leyte, 95% CI: 2.5 - 15). Finally, our
demographic estimates of dispersal were the lowest at 4.1 km (Cebu, 95% CI: 2.9 –
7.2) and 3.9 km (Leyte, 95% CI: 2.6 – 12.4). Our estimates of dispersal were generally
higher in Cebu because the observed isolation by distance slope was shallower than on
Leyte, though this difference was partially compensated by the higher effective
density on Cebu.
Comparing the 95% confidence intervals around each estimate to the
differences between estimates, it became clear that the greatest source of uncertainty
was not in any one parameter’s estimate, but rather in which method to use to
calculate effective density. Our final range of dispersal spread estimates spanned a
factor of seven (4 to 27 km with median 11 km), reflecting remaining uncertainty in
the effective density of A. clarkii.
1.5 Discussion
Understanding dispersal scales in many organisms has been notoriously
difficult, and our research demonstrates that increased attention to effective density
can aid in the estimation of dispersal spread. Across two replicate coastlines of 220-
250 km in the Philippines, we found isolation by distance patterns in populations of A.
clarkii. These data suggest that dispersal distances are less than 220-250 km, but such
patterns cannot easily be compared to high self-recruitment rates in anemonefish. In
addition, we used multiple approaches to measure dispersal scale by estimating
![Page 42: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/42.jpg)
26
effective density. We observed temporal shifts in allele frequencies between adult and
juvenile cohorts that suggested effective densities of 4-21 adults/km. Census densities
of adults in our study area and low variance in reproductive success in Amphiprion
implied that effective density was perhaps as high as 82-178 adults/km. Using these
estimates of effective density with isolation by distance theory suggested that A.
clarkii dispersal spread is in the range of 4-27 km (median 11 km).
1.5.1 The central role of effective density and census density
Effective density is a central concept in the population genetics of continuous
populations because it is needed to convert isolation by distance signals into dispersal
estimates. However, little attention has been paid to the estimation of this quantity. By
collecting genetic data from multiple cohorts of A. clarkii along with ecological census
data, we were able to develop two independent estimates of effective density.
The first approach is based on shifts in genetic composition from generation to
generation using an explicit model that permits some local retention from a local
population as well as input from surrounding populations (Wang & Whitlock 2003).
The second is based on census density, because effective population sizes are typically
lower than current census sizes (Frankham 1995). For marine species such as cod,
snapper, plaice and oysters, evidence suggests that effective density is lower than
census density by five to six orders of magnitude (Hedgecock 1994; Hauser et al.
2002; Hoarau et al. 2002; Árnason 2004). If this were true for anemonefish, census
density would provide an upper bound that was much too high, and as a result, our
dispersal estimate would be much too low.
However, anemonefish occupy individual, easily observed, breeding habitats,
and adult density is the density of breeding pairs. This fact brings effective and census
densities into closer alignment. Data from parentage studies confirm this assumption
for anemonefish (A. polymnus and A. percula), where 29-45% of parents produced
local offspring. This observation suggested that about half of the census density might
provide a reasonable effective density estimate. Even using overall census density as
an upper bound would provide an informative guideline for these species.
![Page 43: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/43.jpg)
27
Without empirical estimates of effective density, the range of possible effective
densities in marine species is extremely large, and simple assumptions about effective
density could be dramatically incorrect. The methods we proposed with A. clarkii
narrowed this uncertainty considerably and allowed us to estimate dispersal distance
within an order of magnitude. Even with the remaining uncertainty, this is a
substantial improvement over previous knowledge.
1.5.2 Effective density from genetic diversity?
Beyond the temporal genetic and census data that we used in this paper, it may
also be possible to estimate effective density from genetic diversity. For example,
Puebla et al. (2009) proposed a method that used the program MIGRATE to estimate
effective population size, and then divided population size by reef length to estimate
density. However, this method assumes the island model of migration and requires
discrete and isolated populations within which isolation by distance processes do not
affect genetic diversity. These criteria are often difficult to meet in widely dispersing
marine species.
An alternative approach for estimating effective density may come from the
population genetic theory for continuous populations. For example, Wright showed
that in a continuous population Ne is affected not only by the number of individuals in
the population, but also by the size of what he called the genetic neighborhood
(Wright 1969). The neighborhood refers to the number of adults from which an
individual’s parents can be treated as if drawn at random. Wright provides equations
for the effective size, length, and neighborhood size of one-dimensional, continuous
populations (Wright 1969, pp. 298 and 302). These equations can be combined to
show that:
(4)
![Page 44: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/44.jpg)
28
where a varies from about 1.5 to 3.5 depending on the shape of the dispersal
kernel, and k is the length of habitat occupied by the population. Effective population
size (Ne) can be estimated from genetic diversity (e.g., Ne = θ/(4µ), where θ is a
measure of genetic diversity and µ is mutation rate). Eq. 4 may be most useful for
estimating bounds on effective density (De), as it relies on specifying a maximum or
minimum dispersal spread (σ). However, the scale of analysis is crucial, and it is
difficult to know what value to assume for k. If we use the diversity in our data set
measured over 475 km of coastline and assume that σ < 475 km, then De > 1.6
adults/km. If we instead assume that the diversity we observe applies across the
Philippines (k ≈ 24,000 km), then De > 0.23 adults/km. Estimating local θ in the
context of an isolation by distance model based on empirical data would be a
valueable topic for future research and theory.
1.5.3 Assumptions of dispersal calculations
A major assumption of our calculations is that the isolation by distance pattern
has reached a stationary phase close to drift-migration equilibrium under the current
demographic parameters. This stationary phase is reached within a few generations for
populations separated by 10σ, but may take tens or hundreds of generations for
populations separated by 100-1000σ (Hardy & Vekemans 1999; Vekemans & Hardy
2004). If A. clarkii spatial genetic patterns are not yet stationary, they are likely
becoming stronger with time because A. clarkii is exploited for the aquarium trade in
the Philippines and its density has likely declined as a result (Shuman et al. 2005).
Given the relatively small spatial scale of our study and the 5-10 yr generation time in
A. clarkii (see Methods), it appears that our estimate of dispersal should reflect an
ensemble average over the last few decades or perhaps century of dispersal. This
period is likely an ecological timescale relevant to ecology, conservation, and
management.
Isolation by distance estimates of dispersal also assume that effective density is
constant across space (Leblois et al. 2004). In reality, densities vary at both large and
small spatial scales. Simulations by Leblois revealed that isolation by distance patterns
![Page 45: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/45.jpg)
29
can be biased upwards if small sampling areas are immediately surrounded by a lower
density (Leblois et al. 2004), as might occur if coastlines are scouted for high
population densities and only sampled in those locations. We did not select our study
areas based on high density, and therefore do not expect this to be a problem. We are
not aware of analyses that examine the effects of spatial variation in effective density
within a study region.
In addition, we assume that demography, not selection, drives patterns of
genetic differentiation. Hardy-Weinberg Equilibrium at all of our loci and consistent
patterns of isolation by distance across multiple loci support this assumption (data not
shown). While the large variation in allelic richness across loci (3 to 18) suggests that
mutation rate may vary among the loci we examined, mutation rate does not strongly
affect isolation by distance patterns unless rates are much higher or lower than typical
microsatellites (Leblois et al. 2003).
1.5.4 Comparison to other measures of larval dispersal
Previous evidence for larval dispersal in Amphiprion appeared contradictory
because separate studies reported both relatively high effective migrant exchange (5
migrants/generation) between populations 1000 km apart on the Great Barrier Reef
(Doherty et al. 1995) and high fractions of self-recruitment (30-60%) to small, local
reefs (Jones et al. 2005; Almany et al. 2007). In comparison, the dispersal kernel that
we estimated predicts an effectively zero probability of any larvae traveling 1000 km.
However, many larvae moving shorter distances over multiple generations (stepping-
stone dispersal) can produce relatively low genetic divergence over large distances. In
fact, extrapolating the isolation by distance pattern that we observed to 1000 km
predicts that FST should equal 0.03 at this distance. This low predicted FST matches
well to the FST of 0.05 observed by Doherty et al. (1995), though our interpretation
based on an isolation by distance framework differs from their island model
calculation.
When compared to observations of high self-recruitment, our estimated
dispersal kernel for A. clarkii does not at first appear compatible. Typical dispersal of
![Page 46: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/46.jpg)
30
4-27 km appears unlikely to provide 30-60% self-recruitment. To investigate this
further, we simulated larval dispersal across a continuous habitat as a Gaussian
random number with the median dispersal spread calculated in our study (11 km) (Fig.
1.5a). We then measured self-recruitment to a 500 m section of reef, which is similar
in size to those studied for Amphiprion self-recruitment (Jones et al. 2005; Almany et
al. 2007). Under this model, we found that only 2% of arriving larvae on a continuous
reef were born by parents on the same reef (2% self-recruitment) (Fig. 1.5a). The self-
recruitment rate was similarly low for Laplacian dispersal kernels.
1.5.5 Reef patchiness and comparison to self-recruitment
While our results were not compatible on continuous habitats, another
possibility is that reef patchiness may strongly influence self-recruitment. Most self-
recruitment studies have been conducted on small habitat patches with the nearest
population more than 10 km away (Jones et al. 2005; Almany et al. 2007). We tested
the idea that reef patchiness is important by simulating larval dispersal as above, but
used 500 m patch reefs spaced every 10 or 15 km in place of a continuous reef. In this
patchy environment, self-recruitment rose to 36% or 56% (10 or 15 km spacing,
respectively) (Fig. 1.5b). Levels of self-recruitment similar to this have been measured
for a number of reef fish in habitats that are patchy at this spatial scale (Jones et al.
1999; Jones et al. 2005; Almany et al. 2007).
This high self-recruitment fraction in patchy habitats results from a low influx
of non-local larvae, not from large numbers of larvae remaining on local reefs. We
note that self-recruitment as measured by Jones et al. (2005) and similar studies
(percent of recruiting larvae that are from local parents) is different from local
retention (percent of dispersing larvae that recruit locally) (Botsford et al. 2009). Our
finding suggests that habitat patchiness may play an important role in creating high
self-recruitment but low local retention (Fig. 1.5c). This hypothesis should be testable
by conducting self-recruitment studies in both continuous and patchy habitats.
A number of other explanations for this discrepancy are possible. Some
authors have suggested that marine fish larvae may have a bimodal strategy in which
![Page 47: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/47.jpg)
31
some larvae are actively retained while others passively disperse (Armsworth et al.
2001). This possibility could be represented by a strongly leptokurtic dispersal kernel
with a very strong mode at zero distance and long tails away from the parents.
Another possibility is that dispersal spread (σ) varies dramatically among
species, from A. clarkii (this study) to A. polymnus (Jones et al. 2005) and A. percula
(Almany et al. 2007). Alternatively, Amphiprion dispersal spread might vary between
regions, from the Philippines (this study) to Papua New Guinea (Jones et al. 2005;
Almany et al. 2007), perhaps as a result of larval behavior or oceanographic currents.
Using our continuous habitat model above, dispersal spread would have to be very low
(600 m) for self-recruitment to reach 30%, and even lower (300 m) to reach 60% self-
recruitment. These dispersal spreads are one to two orders of magnitude below our
estimates of A. clarkii dispersal spread in the Philippines, and such strong variation
among species or regions appears unlikely.
We suggest that high fractions of self-recruitment in patchy habitats as well as
regular dispersal to surrounding reefs are both consistent with a single larval dispersal
strategy and do not require dispersal kernels to change shape dramatically either
among Amphiprion species or among study regions.
1.6 Conclusions and future directions
In the future, we predict that greater attention to effective density will provide
more robust estimates of dispersal and greater ability to interpret isolation by distance
patterns. Our study suggests that two additions to typical genetic sampling can aid in
the estimation of effective density. First, samples from two (or more) distinct cohorts
can be used to examine temporal changes in allele frequencies with MNe and derive
point estimates of effective density. Second, ecological surveys can put an upper
bound on effective density. These additions entail more field effort, but the gain is an
enhanced ability to understand dispersal.
Going forward, there is a clear need for further development of effective
density methods relevant to continuous populations. Our study showed that remaining
![Page 48: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/48.jpg)
32
uncertainty in dispersal distances derives largely from differences among methods for
calculating effective density rather than from uncertainty in parameters. New theory or
simulations that indicate the most appropriate methods or suggest new methods would
be quite useful at this point. As discussed above, genetic diversity may provide
insights into effective density if certain challenges can be resolved. In addition, the
intercept of the isolation by distance pattern may contain important but rarely used
information on effective density if one can make assumptions about the shape of the
dispersal kernel (see Rousset 1997).
Understanding ecological scales of dispersal in a wide range of organisms has
been complicated by methods that focus on exceptional rather than typical dispersers,
but isolation by distance approaches can address this problem when effective density
is estimated. In A. clarkii, our median dispersal spread estimates of 11 km appear
consistent with high self-recruitment rates if habitat patchiness is considered. Our
estimates of dispersal spread suggest that marine reserves for anemonefish would need
to be ten or more kilometers wide to be self-sustaining (Lockwood et al. 2002), or
integrated in dense marine reserve networks (Kaplan et al. 2006; Gaines et al. 2010).
Further efforts to integrate multiple sources of information on dispersal, such as
studies that combine both isolation by distance and parentage methods, will continue
to improve our understanding of dispersal.
As populations of many species continue to decline, accurate measurement of
dispersal distances will aid in effective management and conservation. Isolation by
distance genetic studies that account for the effective density of populations can
provide this important information.
1.7 Acknowledgments
MLP gratefully acknowledges support from a NSF Graduate Research
Fellowship, a NDSEG Fellowship, an International Society for Reef Studies/Ocean
Conservancy grant, a Stanford Biology SCORE grant, and a Myers Oceanographic
Trust grant. The authors also want to thank the Project Seahorse Foundation, the
Coastal Conservation and Education Foundation, G. Sucano, and A. Vailoces for
![Page 49: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/49.jpg)
33
critical assistance in the field. G. Bernardi generously shared primer sequences for us
to screen. R. Waples, S. Planes, and an anonymous reviewer provided helpful
comments on earlier versions of the manuscript.
1.8 References
Almany G.R., Berumen M.L., Thorrold S.R., Planes S. & Jones G.P. (2007). Local
replenishment of coral reef fish populations in a marine reserve. Science, 316,
742-744.
Armsworth P.R., James M.K. & Bode L. (2001). When to press one or turn back:
dispersal strategies for reef fish larvae. Am. Nat., 157, 434-450.
Árnason E. (2004). Mitochondrial cytochrome b DNA variation in the high-fecundity
Atlantic cod: trans-Atlantic clines and shallow gene genealogy. Genetics, 166,
1871-1885.
Barber P.H., Palumbi S.R., Erdmann M.V. & Moosa M.K. (2000). A marine Wallace's
line? Nature, 406, 692-693.
Beldade R., Holbrook S.J., Schmitt R.J., Planes S. & Bernardi G. (2009). Isolation and
characterization of 8 polymorphic microsatellite markers from the orange-fin
anemonefish, Amphiprion chrysopterus. Conservation Genetics Resources, 1,
333-335. doi:10.1007/s12686-009-9077-9
Bolker B.M. (2008). Ecological models and data in R. Princeton University Press,
Princeton.
Botsford L.W., White J.W., Coffroth M.-A., Paris C.B., Planes S., Shearer T.L.,
Thorrold S.R. & Jones G.P. (2009). Connectivity and resilience of coral reef
metapopulations in marine protected areas: matching empirical efforts to
predictive needs. Coral Reefs, 28, 327-337.
Buonaccorsi V.P., Westerman M., Stannard J., Kimbrell C., Lynn E. & Vetter R.D.
(2004). Molecular genetic structure suggests limited larval dispersal in grass
rockfish, Sebastes rastrelliger. Mar. Biol., 145, 779-788.
Burke L., Selig E.R. & Spalding M. (2002). Reefs at Risk in Southeast Asia. World
Resources Institute, Washington, DC.
![Page 50: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/50.jpg)
34
Buston P.M., Bogdanowicz S.M., Wong A. & Harrison R.G. (2007). Are clownfish
groups composed of close relatives? An analysis of microsatellite DNA
variation in Amphiprion percula. Mol. Ecol., 16, 3671-3678.
Clutton-Brock T.H. (1988). Reproductive success: studies of individual variation in
contrasting breeding systems. The University of Chicago Press, Chicago.
Davison A.C. & Hinkley D.V. (1997). Bootstrap methods and their application.
Cambridge University Press, New York.
Doherty P.J., Planes S. & Mather P. (1995). Gene flow and larval duration in seven
species of fish from the Great Barrier Reef. Ecology, 76, 2373-2391.
Elliott J.K. & Mariscal R.N. (2001). Coexistence of nine anemonefish species:
differential host and habitat utilization, size and recruitment. Mar. Biol., 138,
23-36.
Excoffier L., Laval G. & Schneider S. (2005). Arlequin (version 3.0): an integrated
software package for population genetics data analysis. Evolutionary
Bioinformatics, 1, 47-50.
Fautin D.G. & Allen G.R. (1992). Field guide to anemonefishes and their host sea
anemones. Western Australian Museum, Perth, Australia.
Frankham R. (1995). Effective population size/adult population size ratios in wildlife:
a review. Genet. Res., 66, 95-107.
Frisch A.J. & Hobbs J.-P.A. (2009). Rapid assessment of anemone and anemonefish
populations at the Keppel Islands [electronic resource]: a report to the Great
Barrier Reef Marine Park Authority. In: Townsville, QLD.
Gaines S.D., White C., Carr M.H. & Palumbi S.R. (2010). Designing marine reserve
networks for both conservation and fisheries management. P Natl Acad Sci
USA. doi:10.1073/pnas.0906473107
Gaston K.J. (1996). Species-range-size distributions: patterns, mechanisms and
implications. Trends Ecol. Evol., 11, 197-201.
Hardy O.J. & Vekemans X. (1999). Isolation by distance in a continuous population:
reconciliation between spatial autocorrelation analysis and population genetics
models. Heredity, 83, 145-154.
![Page 51: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/51.jpg)
35
Hattori A. (1994). Inter--group movement and mate acquisition tactics of the
protandrous anemonefish, Amphiphrion clarkii, on a coral reef, Okinawa. Jap.
J. Ichthyol., 41, 159-165.
Hauser L., Adcock G.J., Smith P.J., Bernal Ramírez J.H. & Carvalho G.R. (2002).
Loss of microsatellite diversity and low effective population size in an
overexploited population of New Zealand snapper (Pagrus auratus). P Natl
Acad Sci USA, 99, 11742-11747.
Hedgecock D. (1994). Does variance in reproductive success limit effective
population sizes of marine organisms? In: Genetics and evolution of aquatic
organisms (ed. Beaumont AR). Chapman & Hall New York, pp. 122-134.
Hedrick P.W. (2005). Large variance in reproductive success and the Ne/N ratio.
Evolution, 59, 1596-1599.
Hellberg M.E. (1994). Relationships between inferred levels of gene flow and
geographic distance in a philopatric coral, Balanophyllia elegans. Evolution,
48, 1829-1854.
Hoarau G., Boon E., Jongma D.N., Ferber S., Palsson J., Van der Veer H.W.,
Rijnsdorp A.D., Stam W.T. & Olsen J.L. (2005). Low effective population size
and evidence for inbreeding in an overexploited flatfish, plaice (Pleuronectes
platessa L.). P Roy Soc B-Biol Sci, 272, 497-503.
Hoarau G., Rijnsdorp A.D., Van der Veer H.W., Stam W.T. & Olsen J.L. (2002).
Population structure of plaice (Pleuronectes platessa L.) in northern Europe:
microsatellites revealed large-scale spatial and temporal homogeneity. Mol.
Ecol., 11, 1165-1176.
Jones G.P., Milicich M.J., Emslie M.J. & Lunow C. (1999). Self-recruitment in a coral
reef fish population. Nature, 402, 802-804.
Jones G.P., Planes S. & Thorrold S.R. (2005). Coral reef fish larvae settle close to
home. Curr. Biol., 15, 1314-1318.
Kaplan D.M., Botsford L.W. & Jorgensen S. (2006). Dispersal per recruit: an efficient
method for assessing sustainability in marine reserve networks. Ecol. Appl., 16,
2248-2263.
![Page 52: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/52.jpg)
36
Kinlan B.P. & Gaines S.D. (2003). Propagule dispersal in marine and terrestrial
environments: a community perspective. Ecology, 84, 2007-2020.
Koenig W.D., Van Vuren D. & Hooge P.N. (1996). Detectability, philopatry, and the
distribution of dispersal distances in vertebrates. Trends Ecol. Evol., 11, 514-
517.
Leblois R., Estoup A. & Rousset F. (2003). Influence of Mutational and Sampling
Factors on the Estimation of Demographic Parameters in a ‘‘Continuous’’
Population Under Isolation by Distance. Mol. Biol. Evol., 20, 491-502.
Leblois R., Rousset F. & Estoup A. (2004). Influence of spatial and temporal
heterogeneities on the estimation of demographic parameters in a continuous
population using individual microsatellite data. Genetics, 166, 1081-1092.
Lenormand T. (2002). Gene flow and the limits to natural selection. Trends Ecol.
Evol., 17, 183-189.
Liu S.-Y.V., Yu H.-T. & Dai C.-F. (2007). Eight microsatellite loci in Clark's
anemonefish, Amphiprion clarkii. Mol. Ecol. Notes, 7, 1169-1171.
Lockwood D.R., Hastings A. & Botsford L.W. (2002). The effects of dispersal
patterns on marine reserves: does the tail wag the dog? Theor. Popul. Biol., 61,
297-309.
Mora C. & Sale P.F. (2002). Are populations of coral reef fish open or closed? Trends
Ecol. Evol., 17, 422-428.
Moyer J.T. (1980). Influence of temperate waters on the behavior of the tropical
anemonefish Amphiprion clarkii at Miyake-jima, Japan. Bull. Mar. Sci., 30,
261-272.
Moyer J.T. (1986). Longevity of the anemonefish Amphiprion clarkii at Miyake-Jima,
Japan with notes on four other species. Copeia, 1986, 135-139.
Nyström M. & Folke C. (2001). Spatial resilience of coral reefs. Ecosystems, 4, 406-
417.
Ochi H. (1985). Temporal patterns of breeding and larval settlement in a temperate
population of the tropical anemonefish, Amphiprion clarkii. Jap. J. Ichthyol.,
32, 248-256.
![Page 53: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/53.jpg)
37
Ochi H. (1986). Growth of the anemonefish Amphiprion clarkii in temperate waters,
with special reference to the influence of settling time on the growth of 0-year
olds. Mar. Biol., 92, 223-229.
Ochi H. (1989). Mating behavior and sex change of the anemonefish, Amphiprion
clarkii, in the temperate waters of southern Japan. Environ. Biol. Fishes, 26,
257-275.
Palumbi S.R. (1992). Marine speciation on a small planet. Trends Ecol. Evol., 7, 114-
118.
Palumbi S.R. (2003). Population genetics, demographic connectivity, and the design
of marine reserves. Ecol. Appl., 13, S146-S158.
Planes S., Jones G.P. & Thorrold S.R. (2009). Larval dispersal connects fish
populations in a network of marine protected areas. P Natl Acad Sci USA, 106,
5693-5697.
Puebla O., Bermingham E. & Guichard F. (2009). Estimating dispersal from genetic
isolation by distance in a coral reef fish (Hypoplectrus puella). Ecology, 90,
3087-3098.
Quenouille B., Bouchenak-Khelladi Y., Hervet C. & Planes S. (2004). Eleven
microsatellite loci for saddleback clownfish Amphiprion polymnus. Mol. Ecol.
Notes, 4, 291-293.
Rice W.R. (1989). Analyzing tables of statistical tests. Evolution, 43, 223-225.
Richardson D.L., Harrison P.L. & Harriott V.J. (1997). Timing of spawning and
fecundity of a tropical and subtropical anemonefish (Pomacentridae:
Amphiprion) on a high latitude reef on the east coast of Australia. Mar. Ecol.
Prog. Ser., 156, 175-181.
Roughgarden J., Gaines S.D. & Possingham H. (1988). Recruitment dynamics in
complex life cycles. Science, 241, 1460-1466.
Rousset F. (1997). Genetic differentiation and estimation of gene flow from F-
statistics under isolation by distance. Genetics, 145, 1219-1228.
Rousset F. (2008). GENEPOP'007: a complete re-implementation of the GENEPOP
software for Windows and Linux. Molecular Ecology Resources, 8, 103-106.
![Page 54: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/54.jpg)
38
Saenz-Agudelo P., Jones G.P., Thorrold S.R. & Planes S. (2009). Estimating
connectivity in marine populations: an empirical evaluation of assignment tests
and parentage analysis under different gene flow scenarios. Mol. Ecol., 18,
1765-1776.
Sale P.F., Cowen R.K., Danilowicz B.S., Jones G.P., Kritzer J.P., Lindeman K.C.,
Planes S., Polunin N.V.C., Russ G.R., Sadovy Y.J. & Steneck R.S. (2005).
Critical science gaps impede use of no-take fishery reserves. Trends Ecol.
Evol., 20, 74-80.
Scheltema R.S. (1986). On dispersal and planktonic larvae of benthic invertebrates: an
eclectic overview and summary of problems. Bull. Mar. Sci., 39, 290-322.
Selkoe K.A. & Toonen R.J. (2006). Microsatellites for ecologists: a practical guide to
using and evaluating microsatellite markers. Ecol. Lett., 9, 615-629.
Shuman C.S., Hodgson G. & Ambrose R.F. (2005). Population impacts of collecting
sea anemones and anemonefish for the marine aquarium trade in the
Philippines. Coral Reefs, 24, 564-573.
Slatkin M. (1987). Gene Flow and the Geographic Structure of Natural-Populations.
Science, 236, 787-792.
Slatkin M. (1993). Isolation by distance in equilibrium and non-equilibrium
populations. Evolution, 47, 264-279.
Sokal R.R. & Rohlf F.J. (1995). Biometry. 3rd edn. W. H. Freeman and Company,
New York.
Swearer S.E., Caselle J.E., Lea D.W. & Warner R.R. (1999). Larval retention and
recruitment in an island population of a coral-reef fish. Nature, 402, 799-802.
Taylor M.S. & Hellberg M.E. (2003). Genetic evidence for local retention of pelagic
larvae in a Caribbean reef fish. Science, 299, 107-109.
Thresher R.E., Colin P.L. & Bell L.J. (1989). Planktonic duration, distribution and
population structure of western and central Pacific damselfishes
(Pomacentridae). Copeia, 420-434.
USAID (2007). Establishing Larval Exchange and Reef Connectivity Using Larval
Dispersal Models. In. USAID Cebu City, Cebu.
![Page 55: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/55.jpg)
39
Vekemans X. & Hardy O.J. (2004). New insights from fine-scale spatial genetic
structure analyses in plant populations. Mol. Ecol., 13, 921-935.
Wang J. & Whitlock M.C. (2003). Estimating effective population size and migration
rates from genetic samples over space and time. Genetics, 163, 429-446.
Waples R.S. & Gaggiotti O. (2006). What is a population? An empirical evaluation of
some genetic methods for identifying the number of gene pools and their
degree of connectivity. Mol. Ecol., 15, 1419-1439.
Warton D. & Ormerod J. (2007). smatr: (Standardized) Major Axis estimation and
testing routines. In: R package version 2.1.
Watts P.C., Rousset F., Saccheri I.J., Leblois R., Kemp S.J. & Thompson D.J. (2007).
Compatible genetic and ecological estimates of dispersal rates in insect
(Coenagrion mercuriale: Odonata: Zygoptera) populations: analysis of
'neighborhood size' using a more precise estimator. Mol. Ecol., 16, 737-751.
Watts P.C., Veltsos P., Soffa B.J., Gill A.B. & Kemp S.J. (2004). Polymorphic
microsatellite loci in the black-and-gold chromis, Neoglyphidodon nigroris
(Teleostei: Pomacentridae) Mol. Ecol. Notes, 4, 93-95.
Weir B.S. & Cockerham C.C. (1984). Estimating F-statistics for the analysis of
population structure. Evolution, 38, 1358-1370.
Wright S. (1969). Evolution and the genetics of populations. Volume 2: the theory of
gene frequencies. University of Chicago, Chicago.
![Page 56: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/56.jpg)
40
1.9 Tables
Table 1.1. Microsatellite loci used in Amphiprion clarkii.
Locus Annealing Temp (°C)
# of alleles
He FIS % error (# tested)
Reference
1359 53 7 0.602 0.040 0 (23) (Liu et al.
2007)
1578 58 5 0.439 0.117 0 (63) (Liu et al.
2007)
915 53 4 0.102 -0.012 0 (29) (Liu et al.
2007)
B6 53 14 0.878 -0.009 0 (32) this paper
C1 53 8 0.756 0.002 0 (30) this paper
D1 53 18 0.890 0.015 0 (27) (Beldade et al.
2009)
Cf29 53 18 0.823 -0.038 3.2 (31) (Buston et al.
2007)
Cf8 53 3 0.621 0.034 0 (27) (Buston et al.
2007)
45 58 12 0.695 0.038 0 (66) (Quenouille et
al. 2004)
65 53 12 0.700 -0.017 1.9 (52) (Quenouille et
al. 2004)
LIST12_004 58 3 0.203 0.026 0 (31) (Watts et al.
2004)
LIST12_012 53 4 0.558 0.060 0 (11) (Watts et al.
2004)
LIST12_028 53 15 0.730 0.027 0 (29) (Watts et al.
2004)
![Page 57: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/57.jpg)
41
Table 1.2. Densities of A. clarkii compiled from the literature.
Country Site Density (fish/100 m2)
Reference
Japan Murote Beach, Shikoku Island
3.2 (Ochi 1985)
Japan Miyake-jima 0.25 (Moyer 1980)
Japan Sesoko Island,
Okinawa 0.36 (Hattori 1994)
Philippines Olango inside MPA* 2 (Shuman et al. 2005) Philippines Olango outside MPA 0.15 (Shuman et al. 2005) Papua New
Guinea Madang 1.8 (Elliott & Mariscal 2001)
Australia Keppel Islands 0.0036 (Frisch & Hobbs 2009)
* MPA: Marine Protected Area
![Page 58: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/58.jpg)
42
Table 1.3. Sample sizes of A. clarkii at each site. Sites are listed south to north
on each island. Adults are the two largest fish on each anemone if they are at least 8
cm. Juveniles are defined as fish up to 6 cm.
Site Name Island # adults # juveniles Total samples Santander Cebu 10 5 20 Boljoon Cebu 8 7 20 Argao Cebu 9 8 20 Carcar Cebu 15 4 20
Minglanilla Cebu 12 6 20 Danao Cebu 12 7 20 Sogod Cebu 4 15 21
Tabogon Cebu 13 3 21 Daanbantayan Cebu 10 9 20 Malapascua Cebu 14 4 20
Pintuyan Leyte 11 4 17 Padre Burgos Leyte 11 6 19
Maasin Leyte 11 5 18 Inopacan Leyte 23 6 34 Baybay Leyte 12 6 19 Albuera Leyte 10 7 20
Ormoc City Leyte 11 9 20 Palompon Leyte 14 3 20
Total 369
![Page 59: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/59.jpg)
43
1.10 Figures
Figure 1.1. Cebu and Leyte Islands in the central Philippines. Black dots
indicate study sites. Rectangle in inset map shows location of primary map within the
Philippines.
![Page 60: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/60.jpg)
44
Figure 1.2. Census densities of A. clarkii in Cebu and Leyte, Philippines.
Lines are the adult density (solid with dots) and total density (dashed with dots) at
standard survey sites. Also shown are the total densities on sites chosen for having
high quality coral reefs (x).
![Page 61: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/61.jpg)
45
Figure 1.3. Genetic distance between A. clarkii populations in Cebu and Leyte,
shown with a reduced major axis regression against geographic distance. Cebu: p =
0.11, r2 = 0.04, m = 0.847 x 10-4, 95% CI: 0.630 x 10-4 - 1.14 x 10-4. Leyte: p = 0.01, r2
= 0.31, m = 1.89 x 10-4, 95% CI: 1.60 x 10-4 - 2.23 x 10-4).
![Page 62: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/62.jpg)
46
Figure 1.4. Graph illustrating the calculation of dispersal spread from the slope
of the isolation by distance relationship and estimates of effective density. By knowing
the slope, we can draw the solid lines (Cebu in black, Leyte in grey). By also knowing
the effective density, we can calculate the corresponding dispersal spread (various
dashed and dotted lines). Three estimates of effective density are shown for each
island: MNe-All (dashed), MNe-Flanking (dotted), and a demographic estimate from
census density (dash-dotted).
Effective density (adults/km)
Dis
pers
al s
prea
d (k
m)
0.001 0.01 0.1 1 10 100 1000 10000
0.1
110
100
1000
![Page 63: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/63.jpg)
47
Figure 1.5. Effects of reef patchiness on the self-recruitment fraction. In
continuous habitats (a), many of the recruiting larvae on a small patch of reef (center
of diagram) come from surrounding reefs and the self-recruitment fraction (fraction of
recruiting larvae that are from local parents) is low. In a patchy reef seascape (b), there
are few surrounding reefs from which larvae can arrive and the number of non-local
recruiting larvae will be low. Therefore, the self-recruitment fraction is high.
However, because self-recruitment is a measure of the larvae arriving at a local reef,
the few larvae that self-recruit may in reality be only a small fraction of all larvae that
disperse from a reef, leading to both high self-recruitment and low retention (c).
![Page 64: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/64.jpg)
48
![Page 65: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/65.jpg)
49
Chapter 2
Open and closed seascapes: where does habitat
patchiness create populations with low
immigration?
2.1 Abstract
Which populations are replenished primarily by immigrants and which by local
production remains a fundamental question in ecology with implications for
population dynamics, species interactions, and response to exploitation. However, we
lack methods for predicting population openness. Here, we develop a model for
openness and show that considering habitat isolation elegantly explains the existence
of surprisingly closed populations in high dispersal species, including marine
organisms. Relatively closed populations are expected when patch spacing is more
than twice the standard deviation of a species’ dispersal kernel. In addition, natural
scales of habitat patchiness on coral reefs are sufficient to create both largely open and
largely closed populations. Contrary to previous interpretations, largely closed marine
populations do not require unusually short dispersal distances. We predict that habitat
patchiness has strong control over population replenishment pathways for a wide
range of marine and terrestrial species with a highly dispersive life stage.
2.2 Introduction
Ecologists frequently classify populations as open or closed, depending on
whether they are replenished primarily by immigrants or by local production (Thomas
& Kunin 1999; Hixon et al. 2002). The degree to which a population is open to
regional inputs has important implications for a wide range of ecological and
![Page 66: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/66.jpg)
50
evolutionary processes, including population dynamics, recovery from disturbance,
community assembly, local adaptation, and response to exploitation (Palmer et al.
1996; Roberts 1997; Hixon et al. 2002; Lenormand 2002; Leibold et al. 2004). In each
of these examples, local patterns are more tightly coupled to local processes in closed
populations, but can only be understood in the context of regional processes in open
populations. For example, local recruitment does not depend on local production of
offspring in open populations, making them highly resilient to local disturbance and
exploitation (Roughgarden et al. 1988; Palmer et al. 1996; Roberts 1997).
An important question is therefore which populations are open, which closed,
and which somewhere in between. To date, only qualitative guidelines have existed
for predicting when regional processes should be more or less important. For example,
we expect largely open populations for species with a highly dispersive life stage,
including many plants, wind-dispersed insects, stream-dwelling species, and marine
organisms (Palmer et al. 1996; Thomas & Kunin 1999; Hixon et al. 2002; Mora &
Sale 2002). For many of these species, the defining characteristic is a bipartite life
history with a seed, larval or juvenile stage that disperses much further than relatively
sedentary adults. However, open populations are not expected for all species. For
example, local processes are expected to dominate for species with discrete
populations and little to no dispersal. In addition, the scale of investigation is can be
important (Hixon et al. 2002; Kinlan et al. 2005). At the widest scale of species’
ranges, populations are by definition closed.
Population openness is defined as one minus the probability that an arriving
recruit was born within the population in question, and it can therefore be measured
empirically (Hixon et al. 2002). A number of high-profile studies have revealed that
both direct and indirect measurements of openness do not always match expectations,
particularly in marine species thought to have high dispersal abilities (Jones et al.
1999; Swearer et al. 1999; Taylor & Hellberg 2003; Jones et al. 2005; Almany et al.
2007). These observations have prompted a range of explanations for how largely
closed populations can arise despite long-dispersal dispersal, including natural
selection against immigrants, mortality of dispersing individuals, and physical
![Page 67: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/67.jpg)
51
retention mechanisms (Paris & Cowen 2004; Shanks 2009; Marshall et al. 2010;
Shima et al. 2010). For marine species, one widespread interpretation is that dispersal
distances are much shorter than previously suspected (Warner & Cowen 2002; Levin
2006), and perhaps only hundreds of meters (Shanks 2009). The implicit assumption
in many of these interpretations is that surprisingly closed populations must be
evidence of very short dispersal distances.
What, however, constitutes a “surprisingly closed” population, and what is the
relationship between dispersal abilities and population openness? To date, this
question has been left to qualitative judgment and imprecise terms like high, low,
local, and regional. Surprisingly, we lack the quantitative theory to predict what level
of population openness we should expect in a given situation. Valuable guidance in
this context would set expectations by developing a baseline model against which
observations could be compared. In this way, true deviations from expectations could
more easily be detected. A model would also facilitate increased communication
among empiricists measuring population openness and theoreticians considering
spatial population dynamics, as has been called for repeatedly (Kinlan et al. 2005;
Botsford et al. 2009).
In this paper, we develop a simple model for population openness and use
marine species as an illustrative example because, as mentioned above, recent
empirical papers have highlighted what appear to be surprisingly closed populations in
these species. Our model considers dispersal ability as well as habitat patchiness. This
latter addition facilitates the application of our model to realistic landscapes and
seascapes, and, as we will show, is a critical consideration for openness. Most habitats
exist as patches in a less suitable matrix, including meadows, tree-fall gaps, forests,
mountain tops, riffle-pool arrays, and estuaries (Saunders et al. 1991; Andréfouët et al.
2006). While sometimes overlooked, habitats are also highly patchy in the sea,
including kelp forests, coral and rocky reefs, sheltered bays, and deep-sea vents
(Kritzer & Sale 2006). It remains unclear, however, whether natural scales of habitat
patchiness are likely to have an impact on population-level processes. In general,
patchiness is unimportant if long distance dispersal easily crosses habitat gaps (Wiens
![Page 68: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/68.jpg)
52
1989). Given the perception of long-distance dispersal for some species, it is perhaps
for this reason that habitat patchiness is often overlooked in empirical studies of
marine populations. However, there have yet to be any quantitative comparisons
between dispersal distances and empirical scales of marine habitat patchiness.
Renewed attention to habitat patchiness is also timely given the strong focus
on patchiness in metapopulation and landscape theory, including the effects of patch
number, patch spacing, patch quality, and matrix quality on population persistence and
density (e.g., Bascompte et al. 2002; Hastings & Botsford 2006; Moilanen & Hanski
2006; Figueira 2009; Kaplan et al. 2009; Shima et al. 2010). Similarly, protected area
and marine reserve theory have examined how population survival depends on reserve
size and spacing (Botsford et al. 2001; Lockwood et al. 2002; Gaines et al. 2010;
White et al. 2010). In this body of theory, however, the focus has largely been on
understanding a patch’s contribution to regional processes and persistence. In contrast,
the focus of our paper is on understanding where and when regional processes have
important impacts on local dynamics, and how this dynamic is mediated by landscape
structure. The relative roles of local and regional dynamics are measured by
population openness, and so far, a quantitative treatment of population openness has
been overlooked. From a local manager’s perspective, population openness critically
determines whether local over-harvest or conservation will have future consequences
for local persistence, or whether activities elsewhere will be a more important
consideration.
The goal of this paper, therefore, is to determine the conditions under which
habitat patchiness can create closed populations and ask whether these conditions are
likely to be common in marine ecosystems. To do so, we first develop a simple model
to connect habitat patchiness and dispersal ability to the degree of population
openness. We then examine whether previous empirical studies are likely to fit the
conditions for relatively closed populations. Finally, we ask whether such conditions
are likely to be common in the natural world by using a variety of coral reef seascapes
mapped by remote sensing. We argue that studies measuring self-recruitment or
population openness must be interpreted in the context of habitat patchiness. Some of
![Page 69: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/69.jpg)
53
the apparent conflict over open and closed marine populations may result from
previously underappreciated impacts of habitat patchiness on the source of larvae.
2.3 Materials and Methods
2.3.1 Model
To connect habitat patchiness to population openness, we start from a simple
connectivity metric inspired by metapopulation theory (Moilanen & Hanski 2006). We
calculate the number of immigrants (Si) into patch i:
where D(j,i) is the probability of a larva from patch j settling on patch i, and
N(j) is the number of offspring produced by patch j. We next use the same logic to
define the absolute number of individuals that return to the patch in which they were
born:
Ri = D(i,i)N(i)
where D(i,i) is the probability of returning to patch i.
Following previous convention, we include any mortality that occurs during
dispersal in the dispersal kernel (D), and so D sums to much less than one for most
marine species with high larval mortality (Botsford et al. 2009). The kernel
summarizes the impacts of many ‘biological barriers’ that occur during dispersal,
including predation and starvation that are related to time in the plankton or distance
(Marshall et al. 2010), but does not include any post-settlement mortality that might
favor (Hamilton et al. 2008) or select against (Marshall et al. 2010) immigrants. We
![Page 70: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/70.jpg)
54
define the kernel at settlement because most empirical measurements of openness are
made at or quite near the time of settlement rather than substantially later. Empirical
deviations from our model can suggest where such processes may be important,
however.
The two equations above allow us to model population openness. We define
immigration for a population as the fraction of settling individuals that are immigrants
(Fig. 2.1a-c):
(1)
where Ri and Si are the numbers of self-recruiting individuals and the number
of immigrants (respectively), as defined above. This equation directly measures
population openness as it has been defined previously (Hixon et al. 2002).
To connect our equation to empirical research, we note that immigration is
simply one minus self-recruitment, where self-recruitment is the probability that an
arriving recruit was born within the local population (Botsford et al. 2009). Self-
recruitment is commonly measured and reported by empirical studies of marine larval
dispersal (Jones et al. 1999; Swearer et al. 1999; Jones et al. 2005; Almany et al.
2007).
We also note that self-recruitment has commonly been confused with retention
(e.g., Kinlan et al. 2005), despite their substantial differences. Retention measures the
proportion of larvae produced in a local population that stays in that population:
(2)
![Page 71: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/71.jpg)
55
The key difference between self-recruitment and retention is that the former
indicates the source of locally settling individuals (Fig. 2.1a-c), while the latter
specifies the destination of locally produced individuals (Fig. 2.1d). The distinction
lies in the denominator: while self-recruitment is calculated as a fraction of all
recruiting individuals (Si + Ri), retention is calculated as a fraction of all locally
produced individuals (N). For further discussion, see Botsford et al. (2009).
To avoid future confusion, we define emigration as the fraction of locally
produced larvae that leave the local patch (Fig. 2.1d):
Ei = 1-Ti = 1 - D(i,i) (4)
Emigration is simply one minus retention. We use immigration and emigration
throughout our paper because we find these terms more intuitive than self-recruitment
and retention.
2.3.2 Simplifications for applying the model
To implement this model, we calculate immigration and emigration using
simple approximations for D(j,i) and N(j). We use a Gaussian dispersal kernel, a form
that arises both from a random walk dispersal process (Skellam 1951) and from
averaging across many quasi-random larval trajectories in a coastal ocean (Siegel et al.
2008). Dispersal ability is determined by the standard deviation of this kernel, which is
called the dispersal spread (Siegel et al. 2003). We center the dispersal kernel on zero
as our base scenario, but we investigate the effects of directional dispersal (e.g.,
advection by currents) by offsetting the kernel from zero by a mean displacement. We
scale advection to increase proportionally to the dispersal spread so that the ratio of
the two (the Peclet number) remains a constant (White et al. 2010). We also assume
that production of offspring depends only on patch area. Both the dispersal kernel and
production approximations could be replaced if oceanographic models of connectivity
(e.g., Cowen et al. 2006; Siegel et al. 2008) or metrics of local production (e.g.,
![Page 72: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/72.jpg)
56
Watson et al. 2010) were available. Finally, we conduct our calculations on a regular
grid, as recommended by Thomas & Kunin (1999) for assessing spatial population
structure.
2.3.3 Application to simple seascapes
To explore our model, we apply it first to highly simplified “dashed line”
coastlines. The dashed line is similar to many marine reserve models (e.g., Botsford et
al. 2001) and consists of an infinite, 1D array of 500 m habitat patches separated by
uninhabitable spaces. We also investigate a 2D grid of habitat patches. A half-
kilometer patch width is arbitrary, but allows comparison to previous field studies.
Spacing between adjacent patches is measured from patch center to patch center.
2.3.4 Application to remotely sensed seascapes
To determine whether closed populations are likely to be common, we
analyzed 17 coral reef seascapes. These seascapes were previously classified from 30
m spatial resolution Landsat satellite images (Andréfouët et al. 2006; Wabnitz et al.
2010). The individual seascapes (Fig. 2.2) were chosen to represent the global
diversity of coral reefs. For analysis, the reefs were converted to a 500 x 500 m grid.
Grid cells were specified as suitable habitat if greater than 50% of the cell was covered
by coral reef. We calculated I for each grid cell with Eq. 1 and a symmetrical,
bivariate Gaussian dispersal kernel. Because few patches were isolated by land (see
Fig. 2.2), we did not prevent larvae from dispersing across land.
2.4 Results
2.4.1 Population openness in simple seascapes
We first tested our model on a dashed line of habitat patches (Fig. 2.1b). In this
context, I can vary from nearly 0% to nearly 100%, depending on the relative values
of dispersal distance and habitat spacing (Fig. 2.3). As expected, high spacing between
![Page 73: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/73.jpg)
57
habitat patches and short dispersal creates closed populations with low immigration
(lower right of Fig. 2.3), while the opposite creates open populations (upper left of
Fig. 2.3). Changing the scale of analysis (different patch size) has negligible impact on
this graph because all patches in this simple model are the same size, and larger
patches have both more local recruits and more immigrants. In two dimensions (Fig.
2.3b), patches tend to be somewhat more open for the same patch spacing and
dispersal distance because there are a greater number of surrounding patches to
contribute immigrants. Patches are also more open in advective environments because
fewer larvae return to the patch from which they were born (Fig. 2.4).
As a general guideline, our model predicts relatively closed populations if
spacing is more than about twice the mean dispersal (diagonal of Fig. 2.3). The precise
transition point can be somewhat lower if the kernel is leptokurtic rather than
Gaussian, and so this guideline tends to be conservative. The transition point is higher
in advective environments (Fig. 2.4).
An example illustrates the important difference between self-recruitment and
retention. For a species with 10 km mean dispersal in a habitat with 25 km gaps
between patches, populations have both low retention (>98% of larvae emigrate) and
high self-recruitment (only 21% of settling larvae are immigrants). This situation
corresponds to the lower right of Fig. 2.3.
When habitat spacing is about twice the mean dispersal distance, small
differences in dispersal or spacing will have relatively large effects on I (along the
diagonal of Fig. 2.3). If marine environments are patchy at scales similar to an
organism’s dispersal ability, seascapes should contain both relatively open and
relatively closed populations (high and low I, respectively).
2.4.2 Comparison to empirical studies
It appears that many recent marine larval tagging studies have been conducted
in the zone where both open and closed populations are likely, and particular care
must therefore be used when interpreting their results. For example, three studies
observed immigration of 40-70% (self-recruitment of 30-60%) to ~500 m habitat
![Page 74: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/74.jpg)
58
patches in four species of coral reef fish (genera Amphiprion and Chaetodon) (Jones et
al. 2005; Almany et al. 2007; Planes et al. 2009). Previous interpretations of these
studies inferred a dispersal distance of 100-500 m (Shanks 2009). However, this
interpretation did not consider that, in all three studies, the nearest habitat patch was 5-
20 km away (Jones et al. 2005; Almany et al. 2007; Planes et al. 2009). Using the
patch spacing and immigration reported by these studies, we delineated their
parameter space with the dashed polygon in Fig. 2.3 (vertical sides: 5-20km; top and
bottom sides: 40-70% immigration).
While none of these studies measured mean dispersal distance, our model
allowed us to infer what it might be. In particular, the model suggests that mean
dispersal of 3.5-26 km (1D) or 2.5-14 km (2D) would be most compatible with the
studies’ observations (the range along the y-axis for the polygons in Fig. 2.3). The 1D
approximation is most appropriate for Jones et al. 2005 (near a coastline), while 2D is
more appropriate for the other two studies (in the middle of a bay). Our models shows
that these populations should have been dramatically more closed if average dispersal
was <2 km. By considering habitat patchiness, we show that dispersal distances may
be one to two orders of magnitude greater than previous interpretations suggested.
Recent field studies suggest that our model result is reasonable, despite its
substantial simplifications. Population genetics suggest a dispersal spread of
approximately 10 km in another Amphiprion species (Pinsky et al. 2010). Similarly,
other studies suggest that dispersal distances in reef fish are usually tens of kilometers
or greater (Puebla et al. 2009).
2.4.3 Closed populations within empirical seascapes
Upon examining empirical seascapes, we found that they had both open and
relatively closed populations. We first show examples from the Bahamas with 2 km
dispersal spread and from Papua New Guinea with 5 km dispersal (Fig. 2.5). These
distances were chosen to illustrate the range of I predicted within each seascape. In
both, the patches embedded in continuous sections of reef had high I (up to 98%) and
would be classified as open at this scale. In addition, a small number of patches were
![Page 75: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/75.jpg)
59
more isolated and had I as low as 44%. These latter patches received up to 56% of
their recruits from local parents (56% self-recruitment) and would appear quite closed.
We next applied our models across 17 coral reef seascapes (Fig. 2.2) to ask
whether all seascapes are likely to contain closed populations. We found surprising
similarities among seascapes (Fig. 2.6). While seascapes on average were open across
all dispersal distances (Fig. 2.6a), we also found that all seascapes contained at least
some isolated patches that were largely closed and had low I (Fig. 2.6b). All seascapes
exhibited a similar relationship between openness and dispersal distance, with a
threshold near 10 km (Fig. 2.6b). Closed patches were most likely for species with
mean dispersal < 5 km. Some fish and many marine invertebrates likely fall in this
category (Shanks 2009).
Substantial variation between seascapes is also apparent. On continuous reefs
such as Northwest Belep (New Caledonia 2), patches were generally open even at
short dispersal distances. In highly patchy seascapes such as Kimbe Bay (Papua New
Guinea 3), some patches were moderately closed even for dispersal distances up to 10
km. The somewhat unique curve in the Java Sea (Indonesia 1) was created because
two adjacent patches were the most isolated and therefore had a predicted I near 50%
for dispersal distances of 2-5 km (Fig. 2.6b). However, all seascapes were open for
species with average dispersal >20 km.
Average nearest neighbor distance was a reasonable predictor of average
openness (I) within seascapes (Fig. 2.7) (p < 0.003, r2 > 46%). Seascapes with wider
spacing had lower I, and the populations in these patchier seascapes were more closed.
We conducted the above analyses at only a single grid scale to illustrate a
general pattern. Following the logic of our models, analyses with a larger grid size
(e.g. 1 x 1 km) would generally show populations that are more closed (Fig. 2.8).
Similarly, a smaller grid size would show populations that are more open. Our chosen
grid scale made our results relevant to previous studies, but higher spatial resolution
remote sensing products (e.g., 30 m) are available to resolve small reefs that may be
important stepping stones for low dispersal species (Andréfouët et al. 2006).
![Page 76: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/76.jpg)
60
2.5 Discussion
By examining a simple model, we have determined conditions under which
habitat patchiness can have strong impacts on immigration and population openness.
We found that relatively closed populations with few immigrants are more common
where patch spacing is more than twice the dispersal spread. When investigating
realistic levels of habitat patchiness, we found that a wide range of coral reef
seascapes are likely to contain a mixture of isolated, relatively closed populations with
low immigration and open populations with substantially more immigration. We
found that patch spacing alone can explain why a number of recent studies have found
surprisingly high fractions of self-recruitment in marine fishes otherwise characterized
by long-distance dispersal.
Our criteria for closed populations provide quantitative guidance on an issue
that has been discussed qualitatively for many years (Hixon et al. 2002; Mora & Sale
2002; Warner & Cowen 2002). Our models of patchy habitats indicated that largely
closed populations could arise for many species even at commonly encountered levels
of patch isolation. Where a patch is isolated by more than twice the average dispersal
distance, relatively few individuals will immigrate from other patches and we should
expect the population to be relatively closed. This criterion should be relevant not only
to marine species with larval dispersal, but also to insects, stream-dwelling aquatic
organisms, plants with seeds, and other organisms with one life stage that disperses
further than others.
We also note that our two-times rule for closed populations should not be
confused with previous criteria for self-persistent populations. Theory suggests that
isolated populations are more likely to survive on patches at least twice as wide as
mean dispersal distance (Botsford et al. 2001; Lockwood et al. 2002; White et al.
2010). Under such conditions, the fraction of larvae emigrating from the patch is low
enough that the population can be sustained on local production alone. As a result,
self-persistence depends on the relation between patch size and dispersal, while in
contrast, population openness depends on patch spacing and dispersal.
![Page 77: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/77.jpg)
61
Appreciating the difference between persistence and openness is especially
important for interpreting recent studies investigating the source of larvae recruiting to
populations (e.g., Jones et al. 1999; Swearer et al. 1999; Jones et al. 2005; Almany et
al. 2007). For example, it would be incorrect to assume that dispersal distances must
be less than 500 m to explain largely closed populations of reef fish on 500 m habitat
patches (Jones et al. 2005; Almany et al. 2007; Planes et al. 2009), as some authors
have done (e.g., Shanks 2009). If average dispersal was <500 m, these populations
should have had virtually 0% immigration, rather than the 40-70% immigration
observed. Instead, our model for population openness provides a quantitative method
for interpreting these studies, and suggests that dispersal is one to two orders of
magnitude greater than previously suspected. Therefore, these populations appear
unlikely to be self-persistent. These differences between criteria for persistence and
for population openness, and between immigration and emigration, are critical for
understanding marine larval dispersal and for appropriately interpreting the empirical
evidence for larval connectivity that is now available (Botsford et al. 2009).
2.5.1 A new language for marine connectivity: immigration and
emigration
More generally, past misinterpretations of larval dispersal may result in part
from confusion over the terms often used to describe marine connectivity. Self-
recruitment and retention sound like similar ideas, and yet refer to substantially
different concepts (Botsford et al. 2009). As our example from the dashed line habitats
showed, self-recruitment can be high even if retention is very low.
For this reason, we advocate a new, more intuitive vocabulary to describe
population connectivity: the fraction of immigrants and the fraction of emigrants. The
fraction of immigrants is simply the proportion of all settling recruits that are
immigrants, which describes the source of recruits to the next generation. This is the
same as population openness: open populations have high immigration fractions, while
fully closed populations have no immigrants. In contrast, the fraction of emigrants is
the proportion of locally produced larvae that emigrate. This describes the destination
![Page 78: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/78.jpg)
62
of local larvae. The Methods section of this paper included mathematical formulations
for both terms. The fractions of immigrants and emigrants are simply one minus self-
recruitment or retention (respectively), and so can easily be inserted in the literature.
We believe that this change is important because there is much less chance that
immigration and emigration will be misinterpreted or confused.
2.5.2 Immigration in naturally patchy landscapes
By analyzing a broad range of coral reef seascapes, we showed that natural
variation in patch spacing is sufficient to have strong control over immigration rates,
determining both whether and where populations are more open or closed. It has long
been clear that extremely isolated islands harbor closed populations with little
immigration (Robertson 2001), but it has not been clear that habitats are also
sufficiently patchy at scales of 10s of km to create largely closed populations. Our
results indicated that across 17 coral reef seascapes, populations with little
immigration were always present, particularly for species with dispersal spread less
than 10 km. Our maps of predicted immigration fractions provide initial hypotheses
for where openness should be higher or lower, and these hypotheses can be tested with
field observations. These simple models, however, do not consider oceanographic
currents that are also likely to be important.
More generally, our analysis showed that the location of a population is
important for determining how that population is replenished. A study undertaken
within a continuous string of habitat patches is likely to encounter open populations
with high immigration in which larval supply or recruitment is independent of local
production. In contrast, studies on more isolated habitat patches may encounter
relatively closed populations with little immigration where local production has a
strong impact on larval supply. This realization adds habitat configuration as an
important aspect to consider in debates about the sources of regulation and density
dependence in populations (Hixon et al. 2002). Models assuming open population
dynamics (e.g., Bascompte et al. 2002) will be more appropriate in relatively
continuous habitats, while models assuming partially closed dynamics (e.g., Bolker &
![Page 79: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/79.jpg)
63
Pacala 1999) will be more appropriate in more isolated patches. The conclusion is
appropriate for a wide range of marine and terrestrial species with a dispersive life
stage.
We chose to focus on coral reefs in this paper because there are readily
available global data on their distribution, but we expect that our results will be
broadly relevant across many habitats, both marine and terrestrial. While the
patchiness of terrestrial habitats have long been recognized (Saunders et al. 1991), we
also emphasize that many marine habitats are patchy as well, including estuaries,
rocky reefs, deep sea vents, seamounts, rocky intertidal habitats, kelp forests,
mangroves, seagrasses, tide pools, and sheltered bays (Kritzer & Sale 2006). Many
marine species specialize on a single or small number of these habitat types, and hence
many species have patchy, fragmented distributions. We therefore predict that these
species will have both open and more closed populations. New efforts to map marine
habitats, including with remote sensing, will be an important step towards
understanding the role of patchiness in local demography (Andréfouët et al. 2006;
Purkis et al. 2007).
As may have become clear, immigration fractions and population openness are
matters of scale (Wiens 1989; Levin 1992). As other authors have noted, picking a
wider spatial scale for investigation will reveal more strongly closed populations,
while at a finer scale (e.g., a single coral head), populations will be almost entirely
open (Wiens 1989; Hixon et al. 2002). Temporal scale is also an important
consideration, and our focus in this paper has been on single-generation, ecological
time scales. Over evolutionary time scales of many generations, however, rare long
distance dispersal events and multigenerational dispersal across intermediate stepping
stones may keep populations evolutionarily connected even if they are ecologically
quite closed (Waples 1998).
2.5.3 Model limitations
Our model represents the interactions of larval transport, behavior, and
survival as a dispersal kernel, and it captures the locations of larval production and
![Page 80: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/80.jpg)
64
settlement with a habitat map. These are clearly simplifications of marine dispersal,
but our model’s complexity is comparable to many useful metapopulation models
(Moilanen & Hanski 2006). Models that also consider ocean currents would add
accuracy to our predictions, but won’t change our general conclusion that both
relatively open and closed populations are likely to co-exist within seascapes.
Oceanographic features such as jets and gyres can create consistent places that favor
transport or retention of larvae (Cowen et al. 2006), while heterogeneities in water
quality can alter larval survival and affect population openness (Shima et al. 2010).
Larval transport is also temporally stochastic (Siegel et al. 2008), and this temporal
variability may be sufficient to switch populations between open and closed.
2.5.4 Future directions
Moving forward, it is interesting to note that conditions for persistence
typically depend on fractions of emigration (Botsford et al. 2001; Lockwood et al.
2002; Byers & Pringle 2006; Hastings & Botsford 2006), while empirical studies
measure immigration or dispersal distance. Dispersal kernels, as used in this study,
provide one method for translating between dispersal distance, immigration and
emigration. Parameterizing such kernels requires at least knowledge of kernel width,
but we lack such estimates for the vast majority of marine species because measuring
larval dispersal remains difficult.
Existing methods for estimating dispersal distances include isolation-by-
distance genetic methods (Puebla et al. 2009; Pinsky et al. 2010), invasion rate
estimates (Shanks 2009), and mark-recapture studies or their recent variations with
natural and artificial tags (Jones et al. 1999; Swearer et al. 1999; Jones et al. 2005;
Planes et al. 2009). All of these methods come with caveats, however. Isolation-by-
distance methods require knowledge of genetic effective density, which remains
difficult to estimate empirically. Invasion rates are dominated by rare long-distance
dispersal events, and therefore overestimate average dispersal distance (Higgins &
Richardson 1999). Mark-recapture experiments tend to underestimate average
dispersal because short-distance dispersers are easier to find (Koenig et al. 1996).
![Page 81: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/81.jpg)
65
In conclusion, we argue that natural scales of habitat patchiness are likely to
have strong impacts on immigration and population openness for marine species.
Seascape geography likely has a larger and more easily detectable role in determining
population openness than has been appreciated to date, particularly for species with
mean dispersal less than a few tens of kilometers.
2.6 Acknowledgements
We thank S. Gaines for helpful conversations during this project, and three
anonymous referees for constructive suggestions on earlier drafts. M. L. P. was
supported by a NSF Graduate Research Fellowship.
2.7 References
Almany G.R., Berumen M.L., Thorrold S.R., Planes S. & Jones G.P. (2007). Local
replenishment of coral reef fish populations in a marine reserve. Science, 316,
742-744.
Andréfouët S., Muller-Karger F.E., Robinson J.A., Kranenburg C.J., Torres-Pulliza
D., Spraggins S.A. & Murch B. (2006). Global assessment of modern coral
reef extent and diversity for regional science and management applications: a
view from space. Proceedings of the 10th International Coral Reef
Symposium, Okinawa, Japan. June 28-July 2, 2004, 1732-1745.
Bascompte J., Possingham H.P. & Roughgarden J.D. (2002). Patchy populations in
stochastic environments: critical number of patches for persistence. The
American Naturalist, 159, 128-37.
Bolker B.M. & Pacala S.W. (1999). Spatial Moment Equations for Plant Competition:
and the Spatial Strategies Understanding Advantages of Short Dispersal. The
American Naturalist, 153, 575-602.
![Page 82: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/82.jpg)
66
Botsford L.W., Hastings A. & Gaines S.D. (2001). Dependence of sustainability on
the configuration of marine reserves and larval dispersal distance. Ecol. Lett.,
4, 144-150.
Botsford L.W., White J.W., Coffroth M.-A., Paris C.B., Planes S., Shearer T.L.,
Thorrold S.R. & Jones G.P. (2009). Connectivity and resilience of coral reef
metapopulations in marine protected areas: matching empirical efforts to
predictive needs. Coral Reefs, 28, 327-337.
Byers J.E. & Pringle J.M. (2006). Going against the flow: retention, range limits and
invasions in advective environments. Mar. Ecol. Prog. Ser., 313, 27-41.
Cowen R.K., Paris C.B. & Srinivasan A. (2006). Scaling of connectivity in marine
populations. Science, 311, 522-527.
Figueira W.F. (2009). Connectivity or demography: Defining sources and sinks in
coral reef fish metapopulations. Ecol. Model., 220, 1126-1137.
Gaines S.D., White C., Carr M.H. & Palumbi S.R. (2010). Designing marine reserve
networks for both conservation and fisheries management. P Natl Acad Sci
USA. doi:10.1073/pnas.0906473107
Hamilton S.L., Regetz J. & Warner R.R. (2008). Postsettlement survival linked to
larval life in a marine fish. P Natl Acad Sci USA, 105, 1561-1566.
Hastings A. & Botsford L.W. (2006). Persistence of spatial populations depends on
returning home. Proc. Natl. Acad. Sci. USA, 103, 6067-6072.
Higgins S.I. & Richardson D.M. (1999). Predicting plant migration rates in a changing
world: the role of long‐distance dispersal. The American Naturalist, 153, 464-
475.
Hixon M.A., Pacala S.W. & Sandin S.A. (2002). Population regulation: historical
context and contemporary challenges of open vs. closed systems. Ecology, 83,
1490-1508.
Jones G.P., Milicich M.J., Emslie M.J. & Lunow C. (1999). Self-recruitment in a coral
reef fish population. Nature, 402, 802-804.
Jones G.P., Planes S. & Thorrold S.R. (2005). Coral reef fish larvae settle close to
home. Curr. Biol., 15, 1314-1318.
![Page 83: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/83.jpg)
67
Kaplan D.M., Botsford L.W., O'Farrell M.R., Gaines S.D. & Jorgensen S. (2009).
Model-based assessment of persistence in proposed marine protected area
designs. Ecol. Appl., 19, 433-448.
Kinlan B.P., Gaines S.D. & Lester S.E. (2005). Propagule dispersal and the scales of
marine community process. Divers. Distrib., 11, 139-148.
Koenig W.D., Van Vuren D. & Hooge P.N. (1996). Detectability, philopatry, and the
distribution of dispersal distances in vertebrates. Trends Ecol. Evol., 11, 514-
517.
Kritzer J.P. & Sale P.F. (eds.) (2006). Marine metapopulations. Elsevier Academic
Press, New York.
Leibold M.A., Holyoak M., Mouquet N., Amarasekare P., Chase J.M., Hoopes M.F.,
Holt R.D., Shurin J.B., Law R., Tilman D., Loreau M. & Gonzalez A. (2004).
The metacommunity concept: a framework for multi-scale community
ecology. Ecol. Lett., 7, 601-613.
Lenormand T. (2002). Gene flow and the limits to natural selection. Trends Ecol.
Evol., 17, 183-189.
Levin L.A. (2006). Recent progress in understanding larval dispersal: new directions
and digressions. Integr. Comp. Biol., 46, 282-297.
Levin S.A. (1992). The problem of pattern and scale in ecology. Ecology, 73, 1943-
1967.
Lockwood D.R., Hastings A. & Botsford L.W. (2002). The effects of dispersal
patterns on marine reserves: does the tail wag the dog? Theor. Popul. Biol., 61,
297-309.
Marshall D.J., Monro K., Bode M., Keough M.J. & Swearer S. (2010). Phenotype-
environment mismatches reduce connectivity in the sea. Ecol. Lett., 13, 128-
40.
Moilanen A. & Hanski I. (2006). Connectivity and metapopulation dynamics in highly
fragmented landscapes. In: Connectivity Conservation. Cambridge University
Press Cambridge, pp. 44-71.
![Page 84: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/84.jpg)
68
Mora C. & Sale P.F. (2002). Are populations of coral reef fish open or closed? Trends
Ecol. Evol., 17, 422-428.
Palmer M.A., Allan J.D. & Butman C.A. (1996). Dispersal as a regional process
affecting the local dynamics of marine and stream benthic invertebrates.
Trends Ecol. Evol., 11, 322-326.
Paris C.B. & Cowen R.K. (2004). Direct evidence of a biophysical retention
mechanism for coral reef fish larvae. Limnol. Oceanogr., 49, 1964-1979.
Pinsky M., Montes H.R., Jr. & Palumbi S.R. (2010). Using isolation by distance and
effective density to estimate dispersal scales in anemonefish. Evolution, 64,
2688-2700. doi:10.1111/j.1558-5646.2010.01003.x
Planes S., Jones G.P. & Thorrold S.R. (2009). Larval dispersal connects fish
populations in a network of marine protected areas. P Natl Acad Sci USA, 106,
5693-5697.
Puebla O., Bermingham E. & Guichard F. (2009). Estimating dispersal from genetic
isolation by distance in a coral reef fish (Hypoplectrus puella). Ecology, 90,
3087-3098.
Purkis S.J., Kohler K.E., Riegl B.M. & Rohmann S.O. (2007). The statistics of natural
shapes in modern coral reef landscapes. The Journal of Geology, 115, 493-508.
Roberts C.M. (1997). Connectivity and management of Caribbean coral reefs. Science,
278, 1454-1457.
Robertson D.R. (2001). Population maintenance among tropical reef fishes: Inferences
from small-island endemics. P Natl Acad Sci USA, 98, 5667-5670.
Roughgarden J., Gaines S.D. & Possingham H. (1988). Recruitment dynamics in
complex life cycles. Science, 241, 1460-1466.
Saunders D.A., Hobbs R.J. & Margules C.R. (1991). Biological consequences of
ecosystem fragmentation: a review. Conserv. Biol., 5, 18-32.
Shanks A.L. (2009). Pelagic larval duration and dispersal distance revisited.
Biological Bulletin, 216, 373-385.
![Page 85: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/85.jpg)
69
Shima J.S., Noonburg E.G. & Phillips N.E. (2010). Life history and matrix
heterogeneity interact to shape metapopulation connectivity in spatially
structured environments. Ecology, 91, 1215-24.
Siegel D.A., Kinlan B.P. & Gaines S.D. (2003). Lagrangian descriptions of marine
larval dispersion. Mar. Ecol. Prog. Ser., 260, 83-96.
Siegel D.A., Mitarai S., Costello C.J., Gaines S.D., Kendall B.E., Warner R.R. &
Winters K.B. (2008). The stochastic nature of larval connectivity among
nearshore marine populations. P Natl Acad Sci USA, 105, 8974-8979.
Skellam J.G. (1951). Random dispersal in theoretical populations. Biometrika, 38,
196-218.
Swearer S.E., Caselle J.E., Lea D.W. & Warner R.R. (1999). Larval retention and
recruitment in an island population of a coral-reef fish. Nature, 402, 799-802.
Taylor M.S. & Hellberg M.E. (2003). Genetic evidence for local retention of pelagic
larvae in a Caribbean reef fish. Science, 299, 107-109.
Thomas C.D. & Kunin W.E. (1999). The spatial structure of populations. J. Anim.
Ecol., 68, 647-657.
Wabnitz C.C., Andréfouët S. & Muller-Karger F.E. (2010). Measuring progress
toward global marine conservation targets. Front. Ecol. Environ., 8, 124-129.
Waples R.S. (1998). Separating the wheat from the chaff: Patterns of genetic
differentiation in high gene flow species. J. Hered., 89, 438-450.
Warner R.R. & Cowen R.K. (2002). Local retention of production in marine
populations: evidence, mechanisms, and consequences. Bull. Mar. Sci., 70,
S245-S249.
Watson J.R., Mitarai S., Siegel D.A., Caselle J.E., Dong C. & McWilliams J.C.
(2010). Realized and potential larval connectivity in the Southern California
Bight. Mar. Ecol. Prog. Ser., 401, 31-48.
White J.W., Botsford L.W., Hastings A. & Largier J.L. (2010). Population persistence
in marine reserve networks: incorporating spatial heterogeneities in larval
dispersal. Mar. Ecol. Prog. Ser., 398, 49-67.
Wiens J.A. (1989). Spatial scaling in ecology. Funct. Ecol., 3, 385-397.
![Page 86: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/86.jpg)
70
2.8 Figures
Figure 2.1. Habitats can be continuous (a) or patchy (b, c, and d). (a) In
continuous habitats, large numbers of immigrants into the focal population (in black)
create a population that is largely open. (b) In patchy environments, fewer immigrants
reach the focal population, and the population is therefore more closed. (c) If the
spacing between patches is small relative to dispersal abilities, the openness of the
population will not be affected by habitat patchiness (compare to a). (d) Low
immigration and high emigration can both occur at the same time in patchy habitats.
![Page 87: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/87.jpg)
71
Figure 2.2. Maps of coral reef seascapes that were analyzed for openness.
Scale bars are 10 km long and north is up. Each seascape has been simplified to a 500
x 500 m grid, and only grid cells with > 50% reef coverage were retained. Seascapes
with sparse reefs < 500 x 500 m may look quite different after this processing (e.g.,
Glover’s Reef in Belize). The gray shading is land.
Bahamas 1 − Nassau Bahamas 2 − Ragged Is. Indonesia 1 − Java Sea Indonesia 2 − SW Sulawesi Indonesia 3 − N Sulawesi
New Caledonia 1 − NE Noumea New Caledonia 1 − NW Belep Panama − N San Blas Papua New Guinea 1 − Numata Is. Papua New Guinea 2 − Panasia Is.
Papua New Guinea 3 − Kimbe Bay Tuamotu − Fakarava Vanuatu − Lakatoro Western Solomon − Choiseul Belize 1 − Yucatan − Harvest Cay
Belize 2 − Yucatan − Columbus Cay Belize 3 − Yucatan − Glovers Reef
![Page 88: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/88.jpg)
72
Figure 2.3. Percent immigration (I) into patches predicted from a Gaussian
dispersal kernel in a patchy habitat that is a) a one-dimensional coastline (similar to
Fig. 2.1b) or b) a two-dimensional grid. Patches are 500 m wide and spacing measures
the distance between patch centers. When spacing between patches is more than about
twice the dispersal spread, I is low and % self-recruitment is high (lower right).
Dashed polygon outlines the habitat spacing and values of I measured by three marine
population openness studies (Jones et al. 1999; Almany et al. 2007; Planes et al.
2009).
![Page 89: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/89.jpg)
73
Figure 2.4. Percent immigration (I) into a 1D array of patches with a Gaussian
dispersal kernel displaced from zero to model advection. The Peclet number (kernel
displacement/dispersal spread) is a) 0.25, b) 0.75, or c) 1.5. Otherwise, compare to
Fig. 2.3a.
0 10 20 30 40
510
1520
2530
Dis
pers
al s
prea
d (k
m)
a)
0 10 20 30 40
510
1520
2530
Habitat spacing (km)
Dis
pers
al s
prea
d (k
m)
c)
0 10 20 30 40
510
1520
2530
Habitat spacing (km)
b)
● 0% Immigration
20%
40%
60%
80%
100% Immigration
![Page 90: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/90.jpg)
74
Figure 2.5. Variation in openness (% immigration, I) across patchy seascapes.
(a) Ragged Island, Bahamas (2 km dispersal spread). (b) Kimbe Bay, Papua New
Guinea (5 km dispersal spread). Grid cells were 500 m squares and the dispersal
kernel was bivariate Gaussian. Each seascape has both many well-connected reefs
with high immigration and a smaller number of relatively closed populations with as
little as 44% immigration (56% self-recruitment).
![Page 91: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/91.jpg)
75
Figure 2.6. Population openness (% immigration, I) within each of 17 coral
reef seascapes, as related to dispersal spread. Mean (a), minimum (b), and maximum
(c) are calculated across all grid cells within a seascape. Minimum and maximum
immigration indicates the most or least closed habitat patch (respectively) in each
seascape. Each line represents one seascape. Immigration was calculated to 500 x 500
m grid cells. See Fig. 2.2 for maps and locations of each seascape.
![Page 92: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/92.jpg)
76
Figure 2.7. Mean immigration (I) across 500 x 500 m grid cells plotted against
mean nearest neighbor distance within each seascape. Each point is one of the 17
seascapes analyzed in this paper.
![Page 93: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/93.jpg)
77
Figure 2.8. The exact level of immigration (I) depends in part on the grid size
used for the analysis. Larger grids tend to have lower I. (a and d) Average I across all
patches in a seascape, (b and e) minimum I within a seascape, and (c and f) maximum
I within a seascape (similar to Fig. 2.4). Top row shows NW Belep in New Caledonia.
Lower row shows Kimbe Bay, Papua New Guinea.
1 2 5 10 20 50 100
040
80
Dispersal spread (km)
Imm
igra
tion
(%) a)
1 2 5 10 20 50 100
040
80
Dispersal spread (km)
b)
1 2 5 10 20 50 100
040
80
Dispersal spread (km)
c)
1 2 5 10 20 50 100
040
80
Dispersal spread (km)
Imm
igra
tion
(%) d)
1 2 5 10 20 50 100
040
80Dispersal spread (km)
e)
1 2 5 10 20 50 100
040
80
Dispersal spread (km)
f)
Grid size (m)2505007501000
![Page 94: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/94.jpg)
78
![Page 95: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/95.jpg)
79
Chapter 3
Unexpected patterns of fisheries collapse in the
world’s oceans
3.1 Abstract
Understanding which species are most vulnerable to human impacts is a
prerequisite for designing effective conservation strategies. Surveys of terrestrial
species have suggested that large-bodied species and top predators are the most at risk,
and it is commonly assumed that such patterns also apply in the ocean. However, there
has been no global test of this hypothesis in the sea. We analyzed two fisheries
datasets (stock assessments and landings) to determine the life history traits of species
that have suffered dramatic population collapses. Contrary to expectations, our data
suggest that up to twice as many fisheries for small, low trophic level species have
collapsed as compared to those for large predators. These patterns contrast with those
on land, suggesting fundamental differences in the ways that industrial fisheries and
land conversion affect natural communities. Even temporary collapses of small, low
trophic level fishes can have ecosystem-wide impacts by reducing food supply to
larger fish, seabirds, and marine mammals.
3.2 Introduction
Overfishing is one of the most serious conservation concerns in marine
ecosystems (Worm et al. 2009), but understanding which species are most at risk
remains a challenge. On land, life history traits are strong predictors of extinction risk
(Fisher & Owens 2004), and vulnerable species often have large body size and high
trophic level (Fisher & Owens 2004; Cardillo et al. 2005). In marine ecosystems, the
![Page 96: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/96.jpg)
80
well-publicized declines of large predatory fishes (Baum et al. 2003; Myers & Worm
2003) suggest that similar trends may also be common in the sea. However, research
to date has found or proposed a wide range of life history characteristics that cause
high vulnerability, including large body size (Jennings et al. 1998; Dulvy et al. 2003;
Reynolds et al. 2005; Olden et al. 2007), late maturity (Jennings et al. 1998; Reynolds
et al. 2005), long lifespan (Jennings et al. 1998; Denney et al. 2002; Dulvy et al.
2003; Reynolds et al. 2005; Winemiller 2005), low fecundity and high parental
investment in offspring (King & McFarlane 2003; Winemiller 2005), or high trophic
level (Pauly et al. 1998; Fisher & Owens 2004). Understanding which traits, or
combinations of traits, are most useful for predicting vulnerability has been difficult
because analyses have been limited to regional comparisons or narrow species groups,
and because reliable global data have not been available to more broadly test which
types of fishes are most likely to suffer fisheries collapse.
In addition, there are reasons to believe that regional or terrestrial life history
trends might not apply globally in the ocean. For example, fishery biologists often
recommend higher harvest rates for fast-growing, highly productive species, and lower
harvest rates for species with lower productivity (Hilborn & Walters 1992). Where
implemented, these adjustments might reduce the resilience of fast-growing species
and put all harvested species at similar risks of decline. In addition, economic forces
or management regime may be more important than life history in determining
whether fishing effort is successfully controlled (Costello et al. 2008; Sethi et al.
2010). Small pelagic species, while often possessing a rapid growth rate, are also
highly catchable and therefore susceptible to overfishing (Beverton 1990). Finally, the
conflict with human development that is particularly acute for large, terrestrial
mammals (Cardillo et al. 2005) may be smaller in open ocean ecosystems far from
coastlines.
In this paper, we used two independent fisheries databases to determine which
stocks have collapsed to low population abundance. Our first database contained 223
scientific stock assessments for 120 species. For these assessments, a stock was
defined as collapsed if its minimum annual biomass (BMIN) fell to < 20% of the
![Page 97: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/97.jpg)
81
biomass necessary to support maximum sustainable yield (BMSY) (Worm et al. 2009).
In addition, we examined global landings reported by the Food and Agriculture
Organization (FAO) for 1950-2006. We treated each FAO statistical area as a stock,
for a total of 891 stocks across 458 species. For landings data, a stock was defined as
collapsed if landings remained below 10% of the average of the five highest landings
recorded for more than two years. We found this definition to have the lowest
misclassification rate (18%) when we evaluated it against stocks for which we had
both biomass and catch timeseries (see Methods). In most misclassifications (14 of
24), we failed to detect collapses that had occurred, suggesting that our landings
definition is relatively conservative. Finally, we assessed the prevalence of collapse
across a broad range of life history traits, including lifespan, age of maturity, body
size, trophic level (TL), growth rate, fecundity, and parental investment in offspring
(egg size) (Froese & Pauly 2010).
3.3 Materials and Methods
3.3.1 Data sources
We downloaded stock assessments on June 9, 2010 from the RAM Legacy
database (Worm et al. 2009). The database was compiled in 2009 and 2010 from
countries around the world, and assessments were the most current available at that
time. In particular, we extracted time series of catch, model-estimated biomass, and
fishing mortality rates from 1950-2008. The final year included in the timeseries was
on average 2006 ± 1.5 (s.d.) (range: 2000-2008) and duration was on average 39.6 ±
12.4 (s.d.) yrs (range: 10 to 59 yrs). We also extracted reference points for BMSY and
FMSY (the biomass and instantaneous fishing mortality rate, respectively, that result in
maximum sustainable yield). We only used assessments for fishes (not invertebrates).
Our landings database contained statistics reported to the Food and Agriculture
Organization of the United Nations (downloaded from
http://www.fao.org/fishery/statistics/software/fishstat/en, December 2009). Only
species-level records for fish with cumulative landings > 1000 tons were retained,
![Page 98: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/98.jpg)
82
while invertebrates and records for species groups (e.g., “Cods” or “Flatfishes”) were
removed. We removed records with low cumulative catches to avoid minor and
experimental fisheries, and results were similar when we only retained records with
total landings > 10,000 tons. Data were reported in one of 19 major statistical areas,
and one species in one area was considered a stock.
3.3.2 Fishery collapses – Assessment data
For the assessments, we analyzed biomass relative to BMSY. Stocks that fell
below 20% or 50% of BMSY were defined as collapsed or overfished, respectively. We
also recorded the maximum depletion as BMIN/ BMSY, where BMIN is the minimum
biomass in the timeseries. The length of collapse was the maximum number of
consecutive years that a stock was below 20% of BMSY.
In cases where neither BMSY nor a proxy used in place of BMSY was reported in
the stock assessment, we followed (Worm et al. 2009) and estimated BMSY from
Schaefer surplus-production models fit to the assessment time series of annual total
biomass and total catch or landings. Surplus-production models are commonly used in
fisheries science and allow calculation of both carrying capacity and maximum
sustainable yield (Worm et al. 2009). Models were fit in AD Model Builder
(http://admd-project.org) assuming normally distributed errors. We only used time
series greater than 20 years. We used surplus-production models to find reference
points for 92 of 223 stocks.
To examine sensitivity to our choice of model form, we also fit a Fox surplus-
production model. Compared to the Schaefer model, the Fox model assumes that BMSY
is a smaller fraction of unfished biomass (37% instead of 50%). Only five stocks
(2.2%) were reclassified using this approach, and in all cases this was from collapsed
to not collapsed. This small change did not affect our results.
3.3.3 Fishery collapses – Landings data
The choice of appropriate definitions for fisheries collapse in landings data has
been contentious because some apparent collapses may result from stochasticity or
![Page 99: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/99.jpg)
83
changes in reporting, management, or fishing practices rather than population status
(Wilberg & Miller 2007; de Mutsert et al. 2008). By focusing only on true species
(rather than species groups), we avoid false collapses that would otherwise appear
when reporting improves and species groups begin to be reported as individual
species. However, if management measures severely restrict landings to allow
rebuilding of an overfished stock, a stock’s landings could appear collapsed even if
biomass was overfished but not fully collapsed. Changes in fleet capacity or fishing
efficiency could also reduce landings independently from changes to population
abundance.
To avoid false detection of collapses in landings to the extent possible, we
evaluated a range of potential collapse definitions. For each definition, a stock was
defined as collapsed when annual landings fell below 10% of a reference level for a
specified window of time. The reference level was the maximum annual landings
averaged over one or five years. While one year has been used before (Worm et al.
2006), the five-year average was used here to avoid false collapses triggered by a
single, spuriously high year of landings (Wilberg & Miller 2007). As our time
window, we used either one (Worm et al. 2006), two, or four consecutive years
(Mullon et al. 2005). We only looked for collapses in the years following the
maximum annual landings.
We tested the landings-based definitions against the stock assessments for
which we had both biomass and catch or landings data (n = 131). Taking the
assessment-based collapse definitions to be accurate, the 5-yr reference/2-yr window
collapse definition for landings data had a somewhat lower error rate than the others
and misclassified 24 stocks (18%). Of these, 14 collapsed stocks were not detected by
the landings definition, while 10 un-collapsed stocks were falsely detected. Falsely
detected collapses tended to be for species with longer lifespans than those that we
failed to detect (p = 0.006). In comparison, the lax 1-yr maximum/1-yr window
collapse definition misclassified 28 stocks (21%). Other combinations of threshold and
time window produced intermediate numbers of misclassified stocks. Therefore, we
![Page 100: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/100.jpg)
84
used the 5-yr maximum/2-yr window definition of collapse for landings data in our
paper.
3.3.4 Fisheries characteristics
We defined fishery initiation as the year in which landings reached 10% of the
maximum annual landings within a stock. Relative fishing mortality for a stock in the
assessment database was defined as the maximum instantaneous fishing mortality rate
(maximum F) divided by the fishing mortality predicted to produce maximum
sustainable yield (FMSY). Where FMSY was not available, we estimated FMSY from a
Schaefer surplus-production model, as above (Worm et al. 2009). We used a 5-yr
running mean to average out noise, producing maximum F5-yr/FMSY. Both metrics were
averaged across all stocks within a species.
3.3.5 Life history traits
We extracted information on each species’ maximum total length (cm),
maximum weight (kg), lifespan (yr), age of maturity (yr), trophic level, growth rate,
fecundity (eggs/individual), and parental investment in offspring from Ref. (Froese &
Pauly 2010). Growth rate was measured as the exponent (K) in the von Bertalanffy
growth function (von Bertalanffy 1938). Offspring investment was measured as egg
diameter (mm). We supplemented fecundity and egg diameter data with literature
searches because sample size was low for these traits (Table 3.S1). We used the
average if multiples values were available. For the one stock assessment conducted on
a species group (“Redfish species” on the Newfoundland-Labrador Shelf), we
averaged the life history characteristics for the two species targeted by this fishery
(Sebastes mentella and S. fasciatus).
For comparison of collapse rates among species with opposing traits, we
compared the upper and lower quartiles for each trait. For example, we define top
predators as species in the upper quartile of all trophic levels, and low trophic level
species as those in the lowest quartile. Thresholds were chosen independently for
![Page 101: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/101.jpg)
85
species in the assessment and landings databases, and so are slightly different between
the two.
We used log-transformed values for lifespan, age of maturity, weight, length,
growth rate, fecundity, and egg diameter. Because length and weight are highly
correlated (Pearson correlation: p < 0.0001, ρ = 0.89 on log-transformed variables),
we only report results for weight. We did not consider reproductive lifespan (lifespan
minus age of maturity) because it is highly correlated to lifespan (Pearson correlation:
p < 0.0001, ρ = 0.99 on log-transformed variables). Other life history traits remain
somewhat correlated (e.g., lifespan and growth rate or length and trophic level), but
our conclusions do not depend on multiple regressions that would be affected by this
lack of independence.
3.3.6 Statistical models
We fit generalized linear models (GLMs) with binomial errors and a logit link
(Dobson 2002) to predict the probability of a stock collapsing within each species
(either assessment or landings data). In other words, the proportion of stocks collapsed
within each species i was assumed to follow a binomial distribution with mean pi. The
linear predictor of pi was
log(pi/(1-pi)) = ß1,j + ß2,jxi,j
where ß1,j and ß2,j are the fitted coefficients for trait j, and xi,j is the value of
trait j for species i. The traits (x) were life history or fisheries characteristics. The
binomial error model accounted for the fact that variance changes with the number of
stocks within each species. Fitting the models to species-level (rather than stock-level)
data avoided pseudoreplication of species. We used the same format to fit models to
the proportion of overfished stocks. For maximum depletion in the assessment data,
we used standard linear models.
![Page 102: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/102.jpg)
86
Next, we evaluated models with all possible combinations of life history
variables:
log(pi/(1-pi)) = ßxi
where ß is a vector of parameters and xi a vector of life history traits for
species i. The models did not include interactions between variables because of the
large number of potential combinations. We only tested these models on species for
which we had complete life history data (N = 55 for assessment data, N = 67 for
landings) .We evaluated all models within a model-choice framework (Burnham &
Anderson 2002) and retained the minimal adequate models with an Akaike’s
Information Criterion (AIC) within 2 of the lowest AIC. We also tested the specific
hypothesis that species adapted to stable environments, as indicated by low fecundity
and high parental investment in offspring (Winemiller 2005), would be more
vulnerable to fisheries collapse. We did this by fitting a model with fecundity, egg
diameter, and their interaction. In all cases, we evaluated a model’s significance with a
chi-squared test comparing the reduction in deviance between a null model (only the
mean) and the focal model.
To test whether fishery characteristics affected our results, we used the
assessment data to build a GLM for the proportion of stocks collapsed as a function of
relative fishing mortality. We then used the model residuals in linear regressions that
included each of the life history characteristics.
3.3.7 Phylogenetically independent contrasts
To correct for shared evolutionary history among species, we fit linear
regressions through the origin on phylogenetically independent contrasts generated
with the Analyses of Phylogenetics and Evolution (ape) package (Paradis et al. 2004)
in R 2.12.1. We used a simple phylogeny based upon the taxonomic classification of
each species and equal branch lengths. In all cases, the response variable was the
![Page 103: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/103.jpg)
87
proportion of stocks collapsed within each species. This approach cannot account for
differences in variance driven by the number of stocks in each species.
3.4 Results
We first examined life history traits of species targeted by global fisheries.
Though fisheries caught the entire range of trophic levels and growth rates seen among
marine fish, fisheries tended to catch larger, higher trophic level, and slower-growing
species (p < 10-7) (Fig. 3.1). In addition, the very smallest species (< 8 cm) did not
appear in global, industrial fisheries. There were no substantial size or trophic level
differences between the species that appear in the global landings database and those
that appear in the scientific stock assessments, though the latter are on average
somewhat slower growing (p = 10-10).
Overall, we found that 17.0% or 25.1% of the stocks in each species had
collapsed, on average, in the assessment (n = 52) or landings data (n = 223),
respectively. In addition, 23.3% or 34.9% of species had experienced at least one stock
collapse (assessments n = 28, or landings n = 160, respectively, Table 3.1).
One hypothesis was that large, high trophic level species would show a higher
incidence of collapse than small, low trophic level species. Instead, the assessment
data revealed fisheries collapses across the range of life history traits (Fig. 3.2a-e).
Among top predators (TL > 4.2), 12% of stocks had collapsed, while twice the
percentage (25%) had collapsed among low trophic level fishes (TL < 3.3). Among
large species (> 16 kg), 16% of stocks had collapsed, while 29% had collapsed in
small species (< 2.5 kg).
While the above comparisons suggested more collapses in small, low trophic
level fishes, Generalized Linear Models fit to the assessment data showed that the
proportion of stock collapses was not significantly related to trophic level (p = 0.15),
weight (p = 0.26), longevity (p = 0.10), age of maturity (p = 0.92), fecundity (p =
0.77), or investment in offspring (p = 0.99) (Table 3.2). The incidence of collapse,
however, was somewhat higher for fast growing species (p = 0.019).
![Page 104: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/104.jpg)
88
The landings data generally supported the conclusion that large, top predators
are not more vulnerable than small, low trophic level fishes (Fig. 3.3a-e). Among top
predators (TL > 4.2), 26% of stocks had collapsed, while a similar percentage (21%)
had collapsed in low trophic level species (TL < 3.4). Similarly, 36% of stocks had
collapsed in large species (> 30 kg), while 31% had collapsed in small species (< 2.4
kg). Models suggested that the proportion of stocks collapsed did not change with
trophic level (p = 0.22), fecundity (p = 0.23), or investment in offspring (p = 0.52).
Trends were weakly towards more collapses among long-lived species (p = 0.012),
those with later maturity (p = 0.036), heavier species (p = 0.014), and those with
slower growth (p = 0.048), opposite to the trends in the assessment data. Trends were
not significant after correction for multiple comparisons.
In addition, we examined whether combinations of life history traits might
predict vulnerability, since multiple traits are often necessary for defining a life history
strategy (Winemiller 2005). However, combining life history traits in multiple
regression models could only predict 14% or 8% of the deviance in the data (p = 0.046
or p = 0.15, assessments and landings, respectively, Table 3.2), suggesting that
collapse incidence was not strongly related to life history in any combination. For the
models based on assessment data, higher growth rate was the most frequently included
trait, but these models suggested that species with higher growth rates experienced a
higher incidence of fisheries collapse. Previous authors have proposed that fishes with
low fecundity and high investment in offspring (large egg diameter) may be
particularly vulnerable to fishing (Winemiller 2005), but we did not find evidence that
this life history combination could explain the incidence of fishery collapses (0.8% or
1.1% of deviance explained, p = 0.79 or 0.59 within the assessment and landings data,
respectively).
We also explored the relationship between life history and alternative measures
of vulnerability, including incidence of overfished stocks (BMIN < 50% BMSY),
maximum depletion (BMIN/BMSY), and a less strict definition of landings collapse
(landings below 10% of the single highest landings recorded for a single year). All
trends were similar to those reported above (Fig. 3.4, 3.5, and 3.6). Removing small
![Page 105: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/105.jpg)
89
pelagic species (families Engraulidae and Clupeidae) known to fluctuate strongly with
climate (Chavez et al. 2003) also did not change our results.
As we would expect, incidence of collapse was higher for species that
experienced greater relative fishing mortality (p = 1 x 10-5, 22% of deviance explained
among assessment data) and a longer history of developed fisheries (p = 5 x 10-5, 5.8%
of deviance explained among landings data) (Fig. 3.2f-g and 3.3f). However,
correcting for fisheries characteristics did not change the relationships between
collapse and life history (Fig. 3.7).
We also corrected for evolutionary relationships because phylogenetic history
can reduce the independence of species-level data (Felsenstein 1985). However, using
phylogenetically independent contrasts only revealed weaker relationships between
life history and incidence of collapse. These relationships reduced the discrepancy in
model results between assessment and landings data (Fig. 3.8 and Fig. 3.9).
Finally, we examined whether collapses last longer for certain life histories. In
the assessment data, collapses are longer (18.5 yrs) for long-lived species (lifespan >
44 yrs) than for short-lived species (5.1 yrs, lifespan < 14 yrs, p = 0.028). Other life
history comparisons were not significant (p > 0.21).
3.5 Discussion
Small, short-lived species have what is sometimes called a “fast” life history
strategy that is presumed to make them less vulnerable to fisheries (Jennings et al.
1998; Reynolds et al. 2005). In contrast, our review of global fisheries revealed that
these fast species collapse just as often as species with slower life histories. We found
collapsed stocks in short-lived species such as summer flounder (Paralichthys
dentatus) and Spanish mackerel (Scomberomorus maculatus) and among small, fast-
growing species like capelin (Mallotus villosus) and herring (Clupea harengus and C.
pallasii). Species low in the food chain had also collapsed, including winter flounder
(Pseudopleuronectes americanus) and chub mackerel (Scomber japonicus). While
these collapses are well known to local fishermen and managers, the general
prevalence of collapse among these types of species has not been recognized.
![Page 106: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/106.jpg)
90
Our data suggest that species with fast life histories have at least as high a
probability (per stock) of declining to low abundance as larger, slower species, which
is dramatically different than the pattern among terrestrial species (Fisher & Owens
2004; Cardillo et al. 2005). Why might fast species be more vulnerable in the ocean
than we would expect? One explanation may be that fisheries management often
recommends higher exploitation rates for species with faster life histories and greater
productivity. For example, our assessment database revealed that the fishing mortality
predicted to supply maximum sustainable yield (FMSY) for long-lived rockfishes
(Sebastes spp.) is 0.07 (average of 20 stocks) while FMSY for short-lived skipjack tuna
is 0.42 (average of three stocks). Managing with these or similar reference points can
thus equalize the impact of fishing across species, a process with no widespread
equivalent on land. When fishing rate is correctly determined relative to species’
biology, life history should not be an important determinant of fish collapse.
This rationale may also explain differences between the assessment and
landings data. Many of the species in the landings database are not managed with
scientific stock assessments, and, presumably, fishing mortality is less closely matched
to stock productivity. Under such conditions, we might expect life history to be more
important for determining fisheries collapse and slow species to collapse more often.
In fact, collapses were slightly more common among long-lived species in the
landings database (Fig. 3.3a). Among the more closely managed stocks in the
assessment database, this trend was absent.
In addition, a fast life history may actually increase vulnerability to collapse.
Populations of short-lived species can grow or decline quickly in response to climatic
shifts (Chavez et al. 2003), and a rapid decline in productivity often requires similarly
rapid reductions in fishing effort to prevent collapse (Bakun & Broad 2003). If
fisheries management lags behind these biophysical changes, a population can be
driven to collapse (Bakun & Broad 2003; Fryxell et al. 2010). The high harvest rates
on many short-lived species also mean that errors in setting harvest rates can have
particularly severe consequences. In addition, we note that environmental variability
along can drive variation in fish abundance (Baumgartner et al. 1992; Chavez et al.
![Page 107: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/107.jpg)
91
2003), and when of sufficiently large magnitude, this variation will be detected as a
collapse by our methods. Short-lived species may be particularly sensitive to such
environmental variability because of their fast growth rates and short generation times
(Winemiller 2005). Long-lived species respond more slowly to changes in climatic
conditions because they store more biomass in older age groups and are less dependent
on recent recruitment success (Winemiller 2005).
Our findings contrast with previous studies suggesting that population declines
in marine species are correlated with large size, late age of maturity, slow growth rate,
and high trophic level (Jennings et al. 1998; Jennings et al. 1999a; Jennings et al.
1999b; Dulvy et al. 2000; Dulvy & Reynolds 2002; Byrnes et al. 2007; Olden et al.
2007). However, previous analyses focused primarily on the North Atlantic (Jennings
et al. 1998; Jennings et al. 1999a; Dulvy et al. 2000) or on bycatch and artisanally
fished species (Jennings et al. 1999b; Dulvy et al. 2000; Dulvy & Reynolds 2002;
Byrnes et al. 2007). The particular decline of large, high trophic level species appears
to be a unique pattern of the North Atlantic that does not apply globally (Essington et
al. 2006; Fisher et al. 2010). Bycatch and artisanally fished species are less likely to
appear in the stock assessments or global landings that we analyzed. The adjustment
of fishing pressure as a function of species’ productivity, as explained above, is also
unlikely to occur for these weakly or un-managed species. The small proportion of
marine fishes that have been assessed under the World Conservation Union’s
(IUCN’s) Red List of Threatened Species (Baillie et al. 2004) have tended to be larger
species, perhaps helping to explain why listed, threatened species tend to be larger
than unlisted species (Olden et al. 2007).
While our paper has focused on testing whether lifespan, age of maturity, size,
trophic level, growth rates, fecundity, and offspring investment are useful predictors of
fisheries collapse, life histories are multifaceted strategies that include traits we could
not examine. However, many life history traits among fishes are strongly correlated,
including body size, natural mortality, size at maturity, and population growth rate at
low abundance (Roff 1984; Charnov 1993; Frisk et al. 2001; Denney et al. 2002). In
addition, our use of multivariate models allowed us to test whether combinations of
![Page 108: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/108.jpg)
92
traits might be useful predictors of collapse. We note that life history evolution often
reflects a complex adaptive response to the scales of environmental variation (Roff
2002; Winemiller 2005), and life histories often diverge from a simple slow vs. fast
dichotomy (Winemiller 2005).
The high incidence of collapse that we uncover among small, short-lived, low
trophic level species has important implications for ecosystem structure and function,
especially in “wasp-waisted” ecosystems where a few species play a large role in
transferring food energy to higher trophic level fishes, birds, and marine mammals
(Cury et al. 2000). For example, sandeels (Ammodytes marinus) are targeted by the
largest single-species fishery in the North Sea, and declining sandeel abundance
causes severely reduced breeding success in seabirds (Frederiksen et al. 2004). Other
studies suggest similar sensitivity to a few small fish species across a range of seabirds
and pinnipeds (Duffy 1983; Guénette et al. 2006; Crawford 2007). Even though
short-lived species may recover more quickly from collapse than other fishes
(Hutchings 2000), collapses in small, low trophic level species can last from years to
decades (Beverton 1990). These durations are long enough to have substantial impacts
on the food web (Duffy 1983; Frederiksen et al. 2004; Crawford 2007).
In summary, analysis of stock assessment and global landings databases
revealed that patterns of vulnerability in the ocean are dramatically different from
those on land, and that both small and large fishes are vulnerable to collapse. A major
driver of differences between marine and terrestrial vulnerabilities may be the
importance of harvest versus habitat loss in these different ecosystems. A halt to
overfishing is needed across the full spectrum of life histories, not just for top
predators, to reduce the incidence of fishery collapses and to avoid the ecological,
economic, and social disruption that they cause.
3.6 Acknowledgements
This research was part of an NCEAS Distributed Graduate Seminar. The
authors thank R. Froese, T. Branch, R. Hilborn, B. Worm, and S. Tracey for insightful
feedback and access to data. NSF and NDSEG graduate fellowships (MLP), a David
![Page 109: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/109.jpg)
93
H. Smith Postdoctoral Fellowship (OPJ), NSF CAMEO grant #1041678 (OPJ), and
the Census of Marine Life/Future of Marine Animal Populations (DR) provided
generous support. Financial support for the assessment database was provided by
NSERC grants to J. A. Hutchings and a Canadian Foundation for Innovation Grant to
H. Lotze.
3.7 References
Baillie J.E.M., Hilton-Taylor C. & Stuart S. (eds.) (2004). 2004 IUCN Red List of
threatened species: a global species assessment. IUCN, Gland, Switzerland
and Cambridge, UK.
Bakun A. & Broad K. (2003). Environmental 'loopholes' and fish population
dynamics: comparative pattern recognition with focus on El Niño effects in the
Pacific. Fish. Oceanogr., 12, 458-473.
Baum J.K., Myers R.A., Kehler D.G., Worm B., Harley S.J. & Doherty P.A. (2003).
Collapse and conservation of shark populations in the Northwest Atlantic.
Science, 299, 389-392.
Baumgartner T.R., Soutar A. & Ferreira-Bartrina V. (1992). Reconstruction of the
history of Pacific sardine and northern anchovy populations over the past two
millenia from sediments of the Santa Barbara basin, California. CalCOFI
Reports, 33, 24-40.
Beverton R.J.H. (1990). Small marine pelagic fish and the threat of fishing: Are they
endangered? J. Fish Biol., 37, 5-16.
Burnham K.P. & Anderson D.R. (2002). Model selection and multimodel inference: a
practical information-theoretic approach. 2nd edn. Springer, New York.
Byrnes J.E., Reynolds P.L. & Stachowicz J.J. (2007). Invasions and extinctions
reshape coastal marine food webs. PLoS One, 2, e295.
Cardillo M., Mace G.M., Jones K.E., Bielby J., Bininda-Emonds O.R.P., Sechrest W.,
Orme C.D.L. & Purvis A. (2005). Multiple causes of high extinction risk in
large mammal species. Science, 309, 1239-1241.
![Page 110: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/110.jpg)
94
Charnov E.L. (1993). Life history invariants: some explorations of symmetry in
evolutionary ecology. Oxford University Press, Oxford.
Chavez F.P., Ryan J., Lluch-Cota S.E. & Ñiquen M.C. (2003). From anchovies to
sardines and back: multidecadal change in the Pacific Ocean. Science, 299,
217-21.
Costello C., Gaines S.D. & Lynham J. (2008). Can catch shares prevent fisheries
collapse? Science, 321, 1678-1681.
Crawford R.J.M. (2007). Food, fishing and seabirds in the Benguela upwelling
system. Journal of Ornithology, 148, 253-260.
Cury P., Bakun A., Crawford R.J.M., Jarre A., Quiñones R.A., Shannon L.J. &
Verheye H.M. (2000). Small pelagics in upwelling systems: patterns of
interaction and structural changes in “wasp-waist” ecosystems. ICES J. Mar.
Sci., 57, 603-618.
de Mutsert K., Cowan J.H., Essington T.E. & Hilborn R. (2008). Reanalyses of Gulf
of Mexico fisheries data: landings can be misleading in assessments of
fisheries and fisheries ecosystems. P Natl Acad Sci USA, 105, 2740-2744.
Denney N.H., Jennings S. & Reynolds J.D. (2002). Life-history correlates of
maximum population growth rates in marine fishes. P Roy Soc Lond B Bio,
269, 2229-2237.
Dobson A.J. (2002). An Introduction to Generalized Linear Models. 2nd edn.
Chapman & Hall, Boca Raton.
Duffy D.C. (1983). Environmental uncertainty and commercial fishing: effects on
Peruvian guano birds. Biol. Conserv., 26, 227-238.
Dulvy N.K., Metcalfe J.D., Glanville J., Pawson M.G. & Reynolds J.D. (2000).
Fishery stability, local extinctions, and shifts in community structure in skates.
Conserv. Biol., 14, 283-293.
Dulvy N.K. & Reynolds J.D. (2002). Predicting extinction vulnerability in skates.
Conserv. Biol., 16, 440-450.
Dulvy N.K., Sadovy Y. & Reynolds J.D. (2003). Extinction vulnerability in marine
populations. Fish Fish., 4, 25-64.
![Page 111: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/111.jpg)
95
Essington T.E., Beaudreau A.H. & Wiedenmann J. (2006). Fishing through marine
food webs. P Natl Acad Sci USA, 103, 3171-3175.
Felsenstein J. (1985). Phylogenies and comparative method. Am. Nat., 125, 1-15.
Fisher D.O. & Owens I.P.F. (2004). The comparative method in conservation biology.
Trends Ecol. Evol., 19, 391-398.
Fisher J.A.D., Frank K.T. & Leggett W.C. (2010). Global variation in marine fish
body size and its role in biodiversity–ecosystem functioning. Mar. Ecol. Prog.
Ser., 405, 1-13.
Frederiksen M., Wanless S., Harris M.P., Rothery P. & Wilson L.J. (2004). The role
of industrial fisheries and oceanographic change in the decline of North Sea
black-legged kittiwakes. J. Appl. Ecol., 41, 1129-1139.
Frisk M.G., Miller T.J. & Fogarty M.J. (2001). Estimation and analysis of biological
parameters in elasmobranch fishes: a comparative life history study. Can. J.
Fish. Aquat. Sci., 58, 969-981.
Froese R. & Pauly D. (eds.) (2010). FishBase. World Wide Web electronic
publication. www.fishbase.org. Visited 4/01/2011.
Fryxell J.M., Packer C., McCann K., Solberg E.J. & Saether B.E. (2010). Resource
Management Cycles and the Sustainability of Harvested Wildlife Populations.
Science, 328, 903-906.
Guénette S., Heymans S.J.J., Christensen V. & Trites A.W. (2006). Ecosystem models
show combined effects of fishing, predation, competition, and ocean
productivity on Steller sea lions (Eumetopias jubatus) in Alaska. Can. J. Fish.
Aquat. Sci., 63, 2495-2517.
Hilborn R. & Walters C.J. (1992). Quantitative fisheries stock assessment: choice,
dynamics, and uncertainty. Kluwer Academic Publishers, Boston.
Hutchings J.A. (2000). Collapse and recovery of marine fishes. Nature, 406, 882-885.
Jennings S., Greenstreet S.P.R. & Reynolds J.D. (1999a). Structural change in an
exploited fish community: a consequence of differential fishing effects on
species with contrasting life histories. J. Anim. Ecol., 68, 617-627.
![Page 112: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/112.jpg)
96
Jennings S., Reynolds J.D. & Mills S.C. (1998). Life history correlates of responses to
fisheries exploitation. P Roy Soc Lond B Bio, 265, 333-339.
Jennings S., Reynolds J.D. & Polunin N.V.C. (1999b). Predicting the vulnerability of
tropical reef fishes to exploitation with phylogenies and life histories. Conserv.
Biol., 13, 1466-1475.
King J.R. & McFarlane G.A. (2003). Marine fish life history strategies: applications to
fishery management. Fish. Manage. Ecol., 10, 249-264.
Mullon C., Fréon P. & Cury P. (2005). The dynamics of collapse in world fisheries.
Fish Fish., 6, 111-120.
Myers R.A. & Worm B. (2003). Rapid worldwide depletion of predatory fish
communities. Nature, 423, 280-283.
Olden J.D., Hogan Z.S. & Zanden M.J.V. (2007). Small fish, big fish, red fish, blue
fish: size-biased extinction risk of the world's freshwater and marine fishes.
Global Ecol. Biogeogr., 16, 694-701.
Paradis E., Claude J. & Strimmer K. (2004). APE: Analyses of phylogenetics and
evolution in R language. Bioinformatics, 20, 289-290.
Pauly D., Christensen V., Dalsgaard J., Froese R. & Torres F., Jr. (1998). Fishing
down marine food webs. Science, 279, 860-863.
Reynolds J.D., Dulvy N.K., Goodwin N.B. & Hutchings J.A. (2005). Biology of
extinction risk in marine fishes. P Roy Soc B-Biol Sci, 272, 2337-2344.
Roff D.A. (1984). The evolution of life history parameters in teleosts. Can. J. Fish.
Aquat. Sci., 41, 989-1000.
Roff D.A. (2002). Life history evolution. Sinauer Associates, Sunderland, MA.
Sethi S.A., Branch T.A. & Watson R. (2010). Global fishery development patterns are
driven by profit but not trophic level. P Natl Acad Sci USA, 107, 12163-12167.
von Bertalanffy L. (1938). A Quantitative Theory of Organic Growth (Inquiries on
Growth Laws. II.). Hum Biol, 10, 181-213.
Wilberg M.J. & Miller T.J. (2007). Comment on "Impacts of biodiversity loss on
ocean ecosystem services". Science, 316, 1285c.
![Page 113: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/113.jpg)
97
Winemiller K.O. (2005). Life history strategies, population regulation, and
implications for fisheries management. Can. J. Fish. Aquat. Sci., 62, 872-885.
Worm B., Barbier E.B., Beaumont N., Duffy J.E., Folke C., Halpern B.S., Jackson
J.B.C., Lotze H.K., Micheli F., Palumbi S.R., Sala E., Selkoe K.A., Stachowicz
J.J. & Watson R. (2006). Impacts of biodiversity loss on ocean ecosystem
services. Science, 314, 787-790.
Worm B., Hilborn R., Baum J.K., Branch T.A., Collie J.S., Costello C., Fogarty M.J.,
Fulton E.A., Hutchings J.A., Jennings S., Jensen O.P., Lotze H.K., Mace P.M.,
McClanahan T.R., Minto C., Palumbi S.R., Parma A.M., Ricard D., Rosenberg
A.A., Watson R. & Zeller D. (2009). Rebuilding global fisheries. Science, 325,
578.
![Page 114: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/114.jpg)
98
3.8 Tables
Table 3.1. Species with stocks that had collapsed a) according to stock
assessments (<20% of BMSY) and b) in the landings database (< 10% of the average of
the five highest years of landings, for at least two consecutive years). The species have
been sorted by family.
a) Species Family Number of
stocks Proportion of
stocks collapsed Trachurus murphyi Carangidae 1 1 Clupea harengus harengus Clupeidae 10 0.4 Clupea pallasii pallasii Clupeidae 5 1 Sardinops sagax Clupeidae 2 1 Scorpaenichthys marmoratus Cottidae 2 0.5 Gadus macrocephalus Gadidae 4 0.5 Gadus morhua Gadidae 17 0.59 Melanogrammus aeglefinus Gadidae 8 0.38 Pollachius virens Gadidae 4 0.25 Rexea solandri Gempylidae 2 0.5 Lutjanus campechanus Lutjanidae 1 1 Merluccius hubbsi Merlucciidae 2 0.5 Mallotus villosus Osmeridae 2 0.5 Paralichthys dentatus Paralichthyidae 1 1 Hippoglossoides elassodon Pleuronectidae 2 0.5 Hippoglossoides platessoides Pleuronectidae 2 0.5 Lepidopsetta polyxystra Pleuronectidae 1 1 Limanda aspera Pleuronectidae 1 1 Limanda ferruginea Pleuronectidae 4 1 Pseudopleuronectes americanus Pleuronectidae 3 0.67 Reinhardtius hippoglossoides Pleuronectidae 3 0.33 Cynoscion regalis Sciaenidae 1 1 Scomber japonicus Scombridae 1 1 Scomberomorus maculatus Scombridae 1 1 Sebastes alutus Sebastidae 3 0.33 Sebastes levis Sebastidae 1 1 Sebastes paucispinis Sebastidae 1 1 Epinephelus niveatus Serranidae 1 1
![Page 115: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/115.jpg)
99
b) Species Family Number of
stocks Proportion of
stocks collapsed Albula vulpes Albulidae 1 1 Anoplopoma fimbria Anoplopomatidae 3 0.33 Ariomma indica Ariommatidae 1 1 Caranx crysos Carangidae 2 0.5 Caranx hippos Carangidae 3 0.33 Decapterus russelli Carangidae 3 0.33 Gnathanodon speciosus Carangidae 1 1 Megalaspis cordyla Carangidae 4 0.25 Seriola lalandi Carangidae 3 0.33 Trachinotus carolinus Carangidae 1 1 Trachurus declivis Carangidae 2 0.5 Trachurus japonicus Carangidae 2 0.5 Trachurus lathami Carangidae 1 1 Trachurus symmetricus Carangidae 2 1 Nemadactylus bergi Cheilodactylidae 1 1 Chirocentrus dorab Chirocentridae 4 0.5 Alosa pseudoharengus Clupeidae 2 0.5 Alosa sapidissima Clupeidae 4 0.75 Brevoortia aurea Clupeidae 1 1 Brevoortia pectinata Clupeidae 1 1 Brevoortia tyrannus Clupeidae 2 0.5 Clupea pallasii pallasii Clupeidae 3 0.33 Clupeonella cultriventris Clupeidae 1 1 Dussumieria elopsoides Clupeidae 1 1 Etrumeus teres Clupeidae 3 0.33 Opisthonema oglinum Clupeidae 3 0.67 Sardinella zunasi Clupeidae 1 1 Sardinops sagax Clupeidae 7 0.43 Spratelloides gracilis Clupeidae 2 0.5 Sprattus fuegensis Clupeidae 1 1 Tenualosa ilisha Clupeidae 2 0.5 Coryphaena hippurus Coryphaenidae 9 0.11 Cyclopterus lumpus Cyclopteridae 1 1 Eleginops maclovinus Eleginopidae 2 1 Elops saurus Elopidae 3 0.33 Cetengraulis edentulus Engraulidae 1 1
![Page 116: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/116.jpg)
100
Engraulis mordax Engraulidae 2 0.5 Engraulis ringens Engraulidae 1 1 Gadus morhua Gadidae 1 1 Gadus ogac Gadidae 1 1 Melanogrammus aeglefinus Gadidae 1 1 Microgadus tomcod Gadidae 1 1 Thyrsites atun Gempylidae 4 0.5 Conodon nobilis Haemulidae 1 1 Orthopristis chrysoptera Haemulidae 1 1 Ophiodon elongatus Hexagrammidae 2 0.5 Hypoptychus dybowskii Hypoptychidae 1 1 Istiophorus platypterus Istiophoridae 7 0.86 Makaira indica Istiophoridae 5 0.8 Makaira nigricans Istiophoridae 11 0.55 Tetrapturus albidus Istiophoridae 4 0.75 Tetrapturus audax Istiophoridae 7 0.71 Lamna nasus Lamnidae 2 0.5 Lates calcarifer Latidae 4 0.25 Lutjanus argentiventris Lutjanidae 2 0.5 Lutjanus purpureus Lutjanidae 2 0.5 Coryphaenoides rupestris Macrouridae 1 1 Macrourus berglax Macrouridae 1 1 Lopholatilus chamaeleonticeps Malacanthidae 2 1 Megalops atlanticus Megalopidae 2 0.5 Megalops cyprinoides Megalopidae 1 1 Mene maculata Menidae 2 0.5 Merluccius bilinearis Merlucciidae 1 1 Merluccius productus Merlucciidae 2 0.5 Stephanolepis cirrhifer Monacanthidae 1 1 Salilota australis Moridae 2 0.5 Morone saxatilis Moronidae 2 1 Joturus pichardi Mugilidae 2 0.5 Valamugil seheli Mugilidae 1 1 Dissostichus eleginoides Nototheniidae 5 0.2 Patagonotothen brevicauda Nototheniidae 1 1 Patagonotothen ramsayi Nototheniidae 1 1 Genypterus chilensis Ophidiidae 1 1 Hypomesus pretiosus Osmeridae 1 1 Mallotus villosus Osmeridae 2 1 Thaleichthys pacificus Osmeridae 1 1
![Page 117: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/117.jpg)
101
Paralichthys dentatus Paralichthyidae 2 0.5 Pseudopentaceros richardsoni Pentacerotidae 1 1 Urophycis chuss Phycidae 1 1 Prolatilus jugularis Pinguipedidae 1 1 Atheresthes stomias Pleuronectidae 2 0.5 Glyptocephalus cynoglossus Pleuronectidae 1 1 Hippoglossoides elassodon Pleuronectidae 2 1 Hippoglossoides platessoides Pleuronectidae 1 1 Hippoglossus hippoglossus Pleuronectidae 1 1 Hippoglossus stenolepis Pleuronectidae 2 0.5 Lepidopsetta bilineata Pleuronectidae 2 0.5 Limanda aspera Pleuronectidae 2 0.5 Limanda ferruginea Pleuronectidae 1 1 Pleuronectes quadrituberculatus Pleuronectidae 2 0.5 Reinhardtius hippoglossoides Pleuronectidae 3 0.33 Eleutheronema tetradactylum Polynemidae 3 0.67 Polyprion americanus Polyprionidae 3 0.33 Polyprion oxygeneios Polyprionidae 2 0.5 Stereolepis gigas Polyprionidae 1 1 Pomatomus saltatrix Pomatomidae 10 0.1 Rhinobatos percellens Rhinobatidae 1 1 Rhinobatos planiceps Rhinobatidae 1 1 Oncorhynchus kisutch Salmonidae 3 0.67 Oncorhynchus tshawytscha Salmonidae 3 0.33 Salmo salar Salmonidae 1 1 Salvelinus alpinus alpinus Salmonidae 1 1 Argyrosomus hololepidotus Sciaenidae 5 0.2 Argyrosomus regius Sciaenidae 3 0.33 Atractoscion aequidens Sciaenidae 1 1 Atractoscion nobilis Sciaenidae 1 1 Atrobucca nibe Sciaenidae 1 1 Cynoscion regalis Sciaenidae 2 1 Genyonemus lineatus Sciaenidae 1 1 Menticirrhus littoralis Sciaenidae 1 1 Menticirrhus saxatilis Sciaenidae 1 1 Micropogonias undulatus Sciaenidae 2 0.5 Paralonchurus peruanus Sciaenidae 1 1 Pogonias cromis Sciaenidae 3 0.67 Sciaenops ocellatus Sciaenidae 1 1 Totoaba macdonaldi Sciaenidae 1 1
![Page 118: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/118.jpg)
102
Umbrina canosai Sciaenidae 1 1 Acanthocybium solandri Scombridae 6 0.17 Euthynnus affinis Scombridae 4 0.25 Euthynnus lineatus Scombridae 2 0.5 Katsuwonus pelamis Scombridae 13 0.31 Sarda chiliensis chiliensis Scombridae 2 1 Sarda sarda Scombridae 6 0.17 Scomber japonicus Scombridae 11 0.09 Scomber scombrus Scombridae 2 0.5 Scomberomorus cavalla Scombridae 3 0.67 Scomberomorus guttatus Scombridae 4 0.25 Thunnus alalunga Scombridae 14 0.29 Thunnus albacares Scombridae 13 0.23 Thunnus maccoyii Scombridae 6 0.83 Thunnus obesus Scombridae 12 0.42 Thunnus orientalis Scombridae 3 0.67 Thunnus thynnus Scombridae 5 0.6 Thunnus tonggol Scombridae 4 0.25 Lepidorhombus whiffiagonis Scophthalmidae 1 1 Scophthalmus aquosus Scophthalmidae 1 1 Sebastes alutus Sebastidae 3 1 Sebastes entomelas Sebastidae 2 1 Sebastes goodei Sebastidae 1 1 Sebastes mentella Sebastidae 1 1 Sebastes paucispinis Sebastidae 1 1 Sebastes pinniger Sebastidae 1 1 Epinephelus analogus Serranidae 1 1 Epinephelus morio Serranidae 2 1 Mycteroperca xenarcha Serranidae 1 1 Argyrops spinifer Sparidae 1 1 Pagellus bellottii Sparidae 2 0.5 Pagrus pagrus Sparidae 2 0.5 Stenotomus chrysops Sparidae 1 1 Pampus argenteus Stromateidae 4 0.25 Peprilus paru Stromateidae 2 0.5 Peprilus triacanthus Stromateidae 2 0.5 Saurida undosquamis Synodontidae 2 0.5 Sphoeroides maculatus Tetraodontidae 1 1 Galeorhinus galeus Triakidae 3 0.33 Chelidonichthys capensis Triglidae 1 1
![Page 119: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/119.jpg)
103
Chelidonichthys kumu Triglidae 3 0.33 Xiphias gladius Xiphiidae 14 0.14 Zeus faber Zeidae 5 0.4 Zoarces americanus Zoarcidae 1 1
![Page 120: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/120.jpg)
104
T
able 3.2. Parameters for m
odels predicting the proportion of stocks collapsed within each species. a) Single-variable
regressions with G
eneralized Linear M
odels (GL
Ms) for stock assessm
ent species, b) single-variable GL
Ms for species w
ith landings
data, c) minim
al adequate models from
multiple regressions w
ith stock assessment species, d) m
inimal adequate m
odels from m
ultiple
regressions for species with landings data. C
onfidence Intervals (CIs) for single-variable G
LM
s refer to the coefficient. The L
og
column indicates w
hether the explanatory variable has been log-transformed. M
inimal adequate m
odels were chosen as those w
ith the
lowest A
IC (∆
AIC
< 2) from am
ong all possible GL
Ms w
ithout interactions.
a) Life H
istory Trait
n Intercept
Coefficient
Low
er 95%
CI
Upper
95% C
I N
ull D
eviance R
esidual D
eviance p
Log
Longevity (yr)
97 0.24
-0.41 -0.92
0.068 139.51
136.69 0.10
* A
ge of maturity (yr)
96 -1.1
-0.03 -0.63
0.56 130.7
130.69 0.92
* L
ength (cm)
120 -0.17
-0.23 -0.75
0.28 157
156.25 0.39
* W
eight (kg) 93
-0.12 -0.1
-0.28 0.074
137.68 136.41
0.26 *
Trophic level
120 0.32
-0.4 -0.96
0.15 157
154.97 0.15
G
rowth rate (K
) 120
-0.0047 0.71
0.13 1.3
157 151.28
0.019 *
Fecundity (eggs) 93
-1.4 0.025
-0.14 0.2
134.07 133.98
0.77 *
Egg diam
eter (mm
) 97
-1.2 -0.0047
-0.82 0.72
134.46 134.46
0.99 *
Fishery Initiation (yr) 46
60 -0.031
-0.083 0.015
67.54 65.83
0.20
Relative Fishing
Mortality
99 -2.4
1.6 0.94
2.4 128.17
99.7 1.2x10
-5 *
![Page 121: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/121.jpg)
105
b) L
ife
His
tory
Tra
it
n In
terc
ept
Coe
ffic
ient
L
ower
95
% C
I U
pper
95
% C
I N
ull
Dev
ianc
e R
esid
ual
Dev
ianc
e p
Log
Lon
gevi
ty (
yr)
206
-1.9
0.
33
0.07
3 0.
59
318.
88
312.
54
0.01
2 *
Age
of
mat
urity
(yr
) 21
6 -1
.4
0.3
0.02
1 0.
57
302.
91
298.
46
0.03
6 *
Len
gth
(cm
) 45
7 -2
.0
0.19
0.
0047
0.
37
616.
05
612.
01
0.04
5 *
Wei
ght (
kg)
267
-2.0
0.
11
0.02
2 0.
19
390.
13
383.
98
0.01
4 *
Tro
phic
leve
l 45
7 -1
.7
0.16
-0
.093
0.
43
616.
05
614.
5 0.
22
G
row
th r
ate
(K)
447
-1.4
-0
.22
-0.4
3 -0
.003
4 60
3.48
59
9.51
0.
048
* Fe
cund
ity (
eggs
) 17
2 -1
.7
0.05
-0
.029
0.
14
243.
22
241.
73
0.23
*
Egg
dia
met
er (
mm
) 15
5 -0
.79
-0.1
2 -0
.52
0.25
24
9.64
24
9.23
0.
52
* Fi
sher
y In
itiat
ion
(yr)
20
8 69
-0
.035
-0
.053
-0
.019
31
2.24
29
4.07
5.
4x10
-5
![Page 122: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/122.jpg)
106
c) Intercept
log L
ongevity log
Maturity
log W
eight T
rophic level
log G
rowth
Rate
log F
ecundity log E
gg D
iameter
Residual
Deviance
(Null =
96.9)
%
Deviance
AIC
p
0.71
0.99
89.6 7.50%
114.93
0.05 0.33
0.67
1.3
87.8
9.40%
115.11 0.063
0.83
1.2
0.79
88 9.20%
115.32
0.057 2.1
-0.46
0.73
88.1
9.10%
115.41 0.039
2.1
-0.45 0.91
0.76
86.6 11%
115.92
0.1 0.49
0.6
1.5
0.67 86.7
11%
115.95 0.081
3.9 -0.58
-0.8
88.7 8.50%
116.03
0.031 0.96
-0.8
1.1 0.21
1.2 84.8
12%
116.08 0.032
1.5
0.57
-0.38 1.1
86.9 10%
116.17
0.086 2.1
-0.78
91.1
6%
116.43 0.037
0.056
0.69
-0.76 1.5
0.25 1.1
83.3 14%
116.57
0.046 4.5
-0.74
-0.87
0.7 87.4
9.80%
116.72 0.093
1.4
-0.65 0.81
0.11
87.5 9.70%
116.76
0.077 0.92
-0.034
0.93
89.5
7.60%
116.84 0.064
-0.34
0.75
1.5
0.059
87.6 9.60%
116.88
0.093 0.59
0.059
1
89.6
7.50%
116.91 0.082
0.64
1
0.007
89.6 7.50%
116.92
0.062
![Page 123: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/123.jpg)
107
d)
Inte
rcep
t lo
g L
onge
vity
lo
g M
atur
ity
log
Wei
ght
Tro
phic
le
vel
log
Gro
wth
R
ate
log
Fec
undi
ty
log
Egg
D
iam
eter
Res
idua
l D
evia
nce
(Nul
l = 1
07.7
)
%
Dev
ianc
e A
IC
p
-0.4
1
0.45
0.
23
-0.8
1
99.4
7.
70%
14
5.8
0.2
-0.0
11
0.19
-0
.83
-0.4
1
10
0.2
7%
146.
58
0.15
-1
.3
0.
39
10
4.4
3.10
%
146.
8 0.
14
0.53
-0
.32
0.72
0.
24
-0.9
3
98.7
8.
40%
14
7.07
0.
15
-1.4
-0
.36
104.
9 2.
60%
14
7.28
0.
6 0.
0042
-0.3
9 -0
.44
102.
9 4.
50%
14
7.28
0.
31
-0.4
8
0.5
0.23
-0
.79
-0.1
1 99
.2
7.90
%
147.
62
0.27
-0
.35
0.
35
0.22
-0
.82
-0.1
4
99
.2
7.90
%
147.
63
0.2
-0.6
9
0.47
0.
22
-0.7
9
0.02
8
99.3
7.
80%
14
7.67
0.
09 9 0.
26
0.2
-0.7
7
103.
4 4%
14
7.78
0.
1
![Page 124: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/124.jpg)
108
3.9 Figures
Figure 3.1. Life history patterns of fished species. Histograms for all marine
fish (black), species in the landings database (grey), and species in the assessment
database (white) for a) length (N = 16548/457/120 for all/landings/assessments), b)
trophic level (N = 16548/457/120), and c) growth rate (N = 14118/447/120).
Length (cm)
Prop
ortio
n0.
00.
20.
4
100 101 102 103
a)
Trophic Level0.
000.
150.
30
2 3 4 5
b)
Growth Rate (K)
0.00
0.15
0.30
10!2 10!1 100 101
c)
![Page 125: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/125.jpg)
109
Figure 3.2. Collapses in the assessment database in relation to life history
traits. Traits include a) lifespan (N = 97), b) age of maturity (N = 96), c) weight (N =
93), d) trophic level (N = 120), e) growth rate (N = 120), f) fecundity (N = 93), g)
investment in offspring (egg diameter, N = 97), h) year of fishery initiation (N = 46),
and i) relative fishing mortality (N = 99). Each dot represents the proportion of stocks
collapsed within a species. All x-axes are log-transformed except those for trophic
level and fishery initiation. Dashed line is the best fit from a Generalized Linear
Model.
Longevity (yr)
Prop
ortio
n co
llaps
ed
3 10 30 100
0.0
0.5
1.0
a)
Age of maturity (yr)1 3 10 30
0.0
0.5
1.0
b)
Weight (g)102 103 104 105
0.0
0.5
1.0
c)
Trophic Level
Prop
ortio
n co
llaps
ed
2 3 4
0.0
0.5
1.0
d)
Growth rate (K)0.04 0.10 0.40
0.0
0.5
1.0
e)
Fecundity (# eggs)101 103 105 107
0.0
0.5
1.0
f)
Egg diameter (mm)
Prop
ortio
n co
llaps
ed
1 3 10 30
0.0
0.5
1.0
g)
Fishery initiation (yr)1960 1980 2000
0.0
0.5
1.0
h)
Fishing mortality0.1 1.0 10.0
0.0
0.5
1.0
i)
![Page 126: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/126.jpg)
110
Figure 3.3. Collapses in the landings database in relation to life history traits.
Traits include a) lifespan (N = 206), b) age of maturity (N = 216), c) weight (N = 267),
d) trophic level (N = 457), e) growth rate (N = 447), f) fecundity (N = 172), g)
investment in offspring (egg diameter, N = 155), and h) year of fishery initiation (N =
208). Also see notes for Figure 2.
Longevity (yr)
Prop
ortio
n co
llaps
ed
3 10 30 100
0.0
0.5
1.0
a)
Age of maturity (yr)1 3 10 30
0.0
0.5
1.0
b)
Weight (g)102 103 104 105
0.0
0.5
1.0
c)
Trophic Level
Prop
ortio
n co
llaps
ed
2 3 4
0.0
0.5
1.0
d)
Growth rate (K)0.04 0.40
0.0
0.5
1.0
e)
Fecundity (# eggs)101 103 105 107
0.0
0.5
1.0
f)
Egg diameter (mm)
Prop
ortio
n co
llaps
ed
1 3 10 30
0.0
0.5
1.0
g)
Fishery initiation (yr)1960 1980 2000
0.0
0.5
1.0
h)
![Page 127: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/127.jpg)
111
Figure 3.4. Life history trends in the proportion of overfished stocks
(BMIN/BMSY < 50%) from the assessment data. Compare to Figure 2. Life history
characteristics include a) lifespan (p = 0.064, N = 97), b) age of maturity (p = 0.0095,
N = 96), c) maximum weight (p = 0.27, N = 93), d) trophic level (p = 0.0042, N =
120), e) growth rate (p = 0.010, N = 120), f) fecundity (p = 0.47, N = 93), g)
investment in offspring (egg diameter, p = 0.22, N = 97), h) year of fishery initiation
(p = 0.084, N = 46), and i) relative fishing mortality (p = 4 x 10-7, N = 99). All x-axes
are log-transformed except those for trophic level and fishery initiation. Each dot
represents one species. Dashed line is the best fit from a Generalized Linear Model.
Longevity (yr)
Prop
ortio
n ov
erfis
hed
3 10 30 100
0.0
0.5
1.0
a)
Age of maturity (yr)1 3 10 30
0.0
0.5
1.0
b)
Weight (g)102 103 104 105
0.0
0.5
1.0
c)
Trophic Level
Prop
ortio
n ov
erfis
hed
2 3 4
0.0
0.5
1.0
d)
Growth rate (K)0.04 0.10 0.40
0.0
0.5
1.0
e)
Fecundity (# eggs)101 103 105 107
0.0
0.5
1.0
f)
Egg diameter (mm)
Prop
ortio
n ov
erfis
hed
1 3 10 30
0.0
0.5
1.0
g)
Fishery initiation (yr)1960 1980 2000
0.0
0.5
1.0
h)
Fishing mortality0.1 1.0 10.0
0.0
0.5
1.0
i)
![Page 128: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/128.jpg)
112
Figure 3.5. Life history patterns with an alternative definition of collapse for
landings data. For this figure, a stock is considered collapsed if it falls below 10% of
the maximum annual landings for a single year (our lax definition). Life history
characteristics include a) lifespan (p = 0.78, N = 206), b) age of maturity (p = 0.087, N
= 216), c) maximum weight (p = 0.0020, N = 267), d) trophic level (p = 0.23, N =
457), e) growth rate (p = 0.025, N = 447), f) fecundity (p = 0.13, N = 172, g)
investment in offspring (egg diameter, p = 0.29, N = 155), and h) year of fishery
initiation (p = 3 x 10-6, N = 208).
Longevity (yr)
Prop
ortio
n co
llaps
ed
3 10 30 100
0.0
0.5
1.0
a)
Age of maturity (yr)1 3 10 30
0.0
0.5
1.0
b)
Weight (g)102 103 104 105
0.0
0.5
1.0
c)
Trophic Level
Prop
ortio
n co
llaps
ed
2 3 4
0.0
0.5
1.0
d)
Growth rate (K)0.04 0.40
0.0
0.5
1.0
e)
Fecundity (# eggs)101 103 105 107
0.0
0.5
1.0
f)
Egg diameter (mm)
Prop
ortio
n co
llaps
ed
1 3 10 30
0.0
0.5
1.0
g)
Fishery initiation (yr)1960 1980 2000
0.0
0.5
1.0
h)
![Page 129: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/129.jpg)
113
Figure 3.6. Life history trends in the magnitude of decline (BMIN/BMSY). Small
values represent a species that reached low abundance. Life history characteristics
include a) lifespan (p = 0.22, N = 97), b) age of maturity (p = 0.035, N = 96), c)
maximum weight (p = 0.24, N = 93), d) trophic level (p = 0.0016, N = 120), e) growth
rate (p = 0.034, N = 120), f) fecundity (p = 0.44, N = 93), g) investment in offspring
(egg diameter, p = 0.04, N = 97), h) year of fishery initiation (p = 0.41, N = 46), and i)
relative fishing mortality (p = 5 x 10-10, N = 99). Compare to Figure 2. Each dot
represents one species. Y-axes are log-transformed.
Longevity (yr)
Max
imum
dep
letio
n
3 10 30 100
10!2
10!1
100
a)
Age of maturity (yr)1 3 10 30
10!2
10!1
100
b)
Weight (g)102 103 104 105
10!2
10!1
100
c)
Trophic Level
Max
imum
dep
letio
n
2 3 4
10!2
10!1
100
d)
Growth rate (K)0.04 0.10 0.40
10!2
10!1
100
e)
Fecundity (# eggs)101 103 105 107
10!2
10!1
100
f)
Egg diameter (mm)
Max
imum
dep
letio
n
1 3 10 30
10!2
10!1
100
g)
Fishery initiation (yr)1960 1980 2000
10!2
10!1
100
h)
Fishing mortality0.1 1.0 10.0
10!2
10!1
100
i)
![Page 130: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/130.jpg)
114
Figure 3.7. Correcting for relative fishery mortality has little impact on the
sign of the relationship between collapse probability and life history traits (assessment
data). Life history characteristics include a) lifespan (p = 0.025, N = 83), b) age of
maturity (p = 0.82, N = 82), c) maximum weight (p = 0.21, N = 75), d) trophic level
(p = 0.45, N = 99), e) growth rate (p = 0.039, N = 99), f) fecundity (p = 0.89, N = 77),
and g) investment in offspring (egg diameter, p = 0.43, N = 78). Y-axes represent the
residuals from a GLM that predicted the proportion of stocks collapsed from relative
fishing mortality. Positive values on the y-axes represent species that are more
collapsed than expected from fishery characteristics.
Longevity (yr)
Res
idua
ls
3 10 30 100
−10
12
a)
Age of maturity (yr)1 3 10 30
−10
12
b)
Weight (g)102 103 104 105
−10
12
c)
Trophic Level
Res
idua
ls
2 3 4
−10
12
d)
Growth rate (K)0.04 0.10 0.40
−10
12
e)
Fecundity (# eggs)101 103 105 107
−10
12
f)
Egg diameter (mm)
Res
idua
ls
1 3 10 30
−10
12
g)
![Page 131: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/131.jpg)
115
Figure 3.8. Correcting for phylogeny with the assessment data also suggests
that incidence of collapse does not increase with life history traits, but does increase
when overfishing occurs. The y-axes are phylogenetically independent contrasts on the
proportion of stocks collapsed. The x-axes are contrasts on life history traits, including
a) lifespan (p = 0.37, N = 96), b) age of maturity (p = 0.64, N = 95), c) maximum
weight (p = 0.60, N = 92), d) trophic level (p = 0.90, N = 119), e) growth rate (p =
0.88, N = 119), f) fecundity (p = 0.55, N = 92), g) investment in offspring (egg
diameter, p = 0.60, N = 96), h) year of fishery initiation (p = 0.59, N = 45), and i)
relative fishing mortality (p = 1.2 x 10-5, N = 98). Dashed line is the best fit from a
linear regression through the origin.
−1.0 0.0 1.0
−1.0
0.0
1.0
Longevity contrast
Col
laps
ed c
ontra
st a)
−1.5 −0.5 0.5
−1.0
0.0
1.0
Maturity contrast
b)
−3 −1 1 2 3
−1.0
0.0
1.0
Weight contrast
c)
−1.0 0.0 0.5 1.0
−1.0
0.0
1.0
Trophic contrast
Col
laps
ed c
ontra
st d)
−1.0 0.0 1.0
−1.0
0.0
1.0
Growth rate contrast
e)
−4 0 2 4 6
−1.0
0.0
1.0
Fecundity contrast
f)
−1.5 −0.5 0.5
−1.0
0.0
1.0
Egg diam. contrast
Col
laps
ed c
ontra
st g)
−30 −10 10 30
−1.0
0.0
0.5
Initiation contrast
h)
−2 −1 0 1 2 3
−1.0
0.0
0.5
Mortality contrast
i)
![Page 132: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/132.jpg)
116
Figure 3.9. Correcting for phylogeny with the landings data also suggests that
incidence of collapse does not increase with life history traits. The y-axes are
phylogenetically independent contrasts on the proportion of stocks collapsed. The x-
axes are contrasts on life history traits, including a) lifespan (p = 0.098, N = 205), b)
age of maturity (p = 0.36, N = 215), c) maximum weight (p = 0.099, N = 266), d)
trophic level (p = 0.12, N = 456), e) growth rate (p = 0.041, N = 446), f) fecundity (p =
1.0, N = 171), g) investment in offspring (egg diameter, p = 0.50, N = 154), and h)
year of fishery initiation (p = 0.13, N = 207). Dashed line is the best fit from a linear
regression through the origin.
−1.5 −0.5 0.5 1.5
−1.0
0.0
1.0
Longevity contrast
Col
laps
ed c
ontra
st a)
−2 −1 0 1 2
−1.0
0.0
1.0
Maturity contrast
b)
−4 −2 0 2 4
−1.0
0.0
0.5
1.0
Weight contrast
c)
−1.5 −0.5 0.5 1.5
−1.0
0.0
1.0
Trophic contrast
Col
laps
ed c
ontra
st d)
−2 −1 0 1
−1.0
0.0
1.0
Growth rate contrast
e)
−5 0 5
−1.0
0.0
1.0
Fecundity contrast
f)
−1.5 −0.5 0.5
−1.0
0.0
0.5
1.0
Egg diam. contrast
Col
laps
ed c
ontra
st g)
−40 −20 0 20 40
−1.0
0.0
0.5
Initiation contrast
h)
![Page 133: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/133.jpg)
117
3.10 Supplementary Material
Table 3.S1. Additional sources consulted for data on a) egg diameter and b)
fecundity.
a) Species Data References Atheresthes stomias 1 Balistes capriscus 2 Brevoortia patronus 3 Dissostichus mawsoni 4 Engraulis anchoita 5 Eopsetta jordani 6, 7 Epinephelus morio 8 Genypterus blacodes 9 Genypterus capensis 10 Glyptocephalus zachirus 6 Hexagrammos decagrammus 11 Hippoglossus stenolepis 7, 12 Limanda aspera 12 Lophius americanus 13, 14 Lopholatilus chamaeleonticeps 15 Lutjanus analis 16 Mallotus villosus 17, 18 Merluccius australis 19 Merluccius capensis 10, 20 Merluccius paradoxus 21 Merluccius hubbsi 22 Micromesistius australis 23 Microstomus pacificus 12 Mycteroperca microlepis 24 Ocyurus chrysurus 25 Pagrus pagrus 26 Parophrys vetulus 12 Pleurogrammus monopterygius 27 Pleuronectes quadrituberculatus 28, 29 Raja rhina 7 Reinhardtius hippoglossoides 12, 20 Rhomboplites aurorubens 30 Scomberomorus cavalla 31, 32 Scomberomorus maculatus 33 Sebastes aleutianus 7
![Page 134: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/134.jpg)
118
Sebastes alutus 7 Sebastes entomelas 7 Sebastes flavidus 7 Sebastes melanops 34 Sebastes paucispinis 7 Sebastes pinniger 7 Sebastes polyspinis 35 Sebastes ruberrimus 7 Sebastolobus alascanus 7 Sebastolobus altivelis 7 Seriola dumerili 36 Seriolella brama 37 Seriolella punctata 33 Squalus acanthias 7 Theragra chalcogramma 7, 32 Thunnus alalunga 7 Thunnus albacares 33 Thunnus obesus 33 Thunnus thynnus 32 Trachurus capensis 10 Urophycis tenuis 14
b) Species Data References Atheresthes stomias 38 Balistes capriscus 2 Centropristis striata 39 Dissostichus eleginoides 4 Dissostichus mawsoni 4 Engraulis anchoita 40 Eopsetta jordani 6, 7 Genypterus blacodes 9 Glyptocephalus cynoglossus 41 Glyptocephalus zachirus 6 Hexagrammos decagrammus 42 Hippoglossus stenolepis 7 Katsuwonus pelamis 43 Lepidopsetta bilineata 7 Merluccius capensis 21 Merluccius paradoxus 21 Micromesistius australis 44, 45 Micromesistius australis 46 Pagrus pagrus 47 Paralichthys dentatus 32
![Page 135: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/135.jpg)
119
Parophrys vetulus 7 Platichthys stellatus 7 Pleurogrammus monopterygius 48 Pleuronectes quadrituberculatus 28 Pollachius virens 49 Pseudopleuronectes americanus 50 Raja rhina 7 Rhomboplites aurorubens 30 Sebastes aleutianus 7 Sebastes alutus 51 Sebastes alutus 7 Sebastes entomelas 52 Sebastes entomelas 53 Sebastes entomelas 51 Sebastes entomelas 7 Sebastes goodei 51 Sebastes levis 51 Sebastes paucispinis 53 Sebastes paucispinis 51 Sebastes paucispinis 7 Sebastes pinniger 53 Sebastes pinniger 51 Sebastes pinniger 7 Sebastes ruberrimus 7 Seriolella brama 37 Tautoga onitis 54 Thunnus alalunga 7 Thunnus obesus 55 Thunnus thynnus 32 Urophycis tenuis 56
1. Blood, DM, AC Matarese, and MS Busby. 2007. Spawning, egg development,
and early life history dynamics of arrowtooth flounder (Atheresthes stomias) in
the Gulf of Alaska. U.S. Dept. of Commerce. National Marine Fisheries
Service Professional Paper NMFS 7.
2. Simmons, CM. 2008. Gray triggerfish, Balistes capriscus, reproductive
behavior, early life history, and competitive interactions between red snapper,
Lutjanus campechanus, in the
northern Gulf of Mexico. Auburn University, Ph.D. dissertation.
![Page 136: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/136.jpg)
120
3. Hettler, WF. 1984. Description of eggs, larvae, and early juveniles of Gulf
menhaden, Brevoortia patronus, and comparisons with Atlantic menhaden, B.
tyrannus, and yellowfin menhaden, B. smithi. Fishery Bulletin 82(1): 85-95.
4. Kock, K-H and A Kellerman. 1991. Reproduction in Antarctic notothenioid
fish. Antarctic Science 3(2): 125-150.
5. de Ciechomski, JD. 1973. The size of the eggs of the Argentine anchovy,
Engraulis anchoita (Hubbs & Marini) in relation to the season of the year and
to the area of spawning. J Fish Biol 5: 393-398.
6. Pearcy, WG, MJ Hosie, and SL Richardson. 1977. Distribution and duration of
pelagic life of larvae of Dover sole, Microstomus pacificus; Rex sole,
Glyptocephalus zachirus; and Petrale sole, Eopsetta jordani, in waters off
Oregon. Fishery Bulletin 75(1): 173-183.
7. King, JR and GA McFarlane. 2003. Marine fish life history strategies:
applications to fishery management. Fisheries Management and Ecology
10(4): 249-264.
8. Colin, PL, CC Koenig, and WA Laroche. 1996 in Biology, fisheries and
culture of tropical groupers and snappers, eds Arreguin-Sanchez, F, JL
Munro, MC Balgos, and D Pauly (ICLARM, Makati City, Philippines), pp
399-414.
9. Graham, DH. 1939. Breeding habits of the fishes of Otago Harbour and
adjacent seas. Transactions and Proceedings of the Royal Society of New
Zealand 69: 361-372.
10. Brownell, CL. 1979. Stages in the early development of 40 marine fish species
with pelagic eggs from the Cape of Good Hope. Ichthyological Bulletin of the
J. L. B. Smith Institute of Ichthyology 40: 1-84.
11. DeMartini, EE. 1986. Reproductive colorations, parental behavior and egg
masses of kelp greenling, Hexagrammos decagrammus, and whitespotted
greenling, H. stelleri. Northwest Science 60(1): 32-35.
12. Ahlstrom, EH, K Amaoka, DA Hensley, HG Moser, and BY Sumida. 1984 in
Ontogeny and Systematics of Fishes, ed Moser, HG (American Society of
Ichthyologists and Herpetologists), pp 640-670.
![Page 137: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/137.jpg)
121
13. Everly, AW. 2002. Stages of development of the goosefish, Lophius
americanus, and comments on the phylogenetic significance of the
development of the luring apparatus in Lophiiformes. Environmental Biology
of Fishes 64: 393-417.
14. Markle, DF and L-A Frost. 1985. Comparative morphology, seasonality, and a
key to planktonic fish eggs from the Nova Scotian shelf. Canadian Journal of
Zoology 63: 246-257.
15. Grimes, CB, CF Idelberger, KW Able, and SC Turner. 1988. The reproductive
biology of tilefish, Lopholatilus chamaeleonticeps Goode and Bean, from the
United States Mid-Atlantic Bight, and the effects of fishing on the breeding
system. Fishery Bulletin 86(4): 745-762.
16. Watanabe, WO, EP Ellis, SC Ellis, J Chaves, and C Manfredi. 1998. Artificial
propagation of mutton snapper Lutjanus analis, a new candidate marine fish
species for aquaculture. Journal of the World Aquaculture Society 29(2): 176-
187.
17. Gjosaeter, H. 1998. The population biology and exploitation history of capelin
(Mallotus villosus) in the Barents Sea. Sarsia 83: 453-496.
18. Stergiou, KI. 1989. Capelin Mallotus villosus (Pisces: Osmeridae), glaciations,
and speciation: a nomothetic approach to fisheries ecology and reproductive
biology. Marine Ecology Progress Series 56: 211-224.
19. Bustos, CA, F Balbontin, and MF Landaeta. 2007. Spawning of the southern
hake Merluccius australis (Pisces: Merlucciidae) in Chilean fjords. Fisheries
Research 83: 23-32.
20. Pepin, P and RA Myers. 1991. Significance of egg and larval size to
recruitment variability of temperate marine fish. Canadian Journal of
Fisheries and Aquatic Sciences 48: 1820-1828.
21. Osborne, RF, YC Melo, MD Hofmeyer, DW Japp. 1999. Serial spawning and
batch fecundity of Merluccius capensis and M. paradoxus. South African
Journal of Marine Science 21: 211-216.
![Page 138: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/138.jpg)
122
22. Brown, DR, E Leonarduzzi, and LM Andiarena. 2004. Age, growth and
mortality of hake larvae (Merluccius hubbsi) in the north Patagonian shelf.
Scientia Marina 68(2): 273-283.
23. Laptikhovsky, V and P Brickle. 2009. Aspects of embryonic development in
two southwest Atlantic gadiform fish: tadpole codling, Salilota australis
(Mordiae), and southern blue whiting, Micromesistius australis (Gadidae).
Acta Icthyologica et Piscatoria 39(2): 127-130.
24. Roberts, DE, Jr. and RA Schlieder. 1983. Induced sex inversion, maturation,
spawning and embryogeny of the protogynous grouper, Mycteroperca
microlepis. Journal of the World Mariculture Society 14: 639-649.
25. Riley, CM, GJ Holt, and CR Arnold. 1995. Growth and morphology of larval
and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fishery
Bulletin 93:179-185.
26. Mihelakakis, A, T Yoshimatsu, and C Tsolkas. 2001. Spawning in captivity
and early life history of cultured red porgy, Pagrus pagrus. Aquaculture 199:
333-352.
27. McDermott, SF and SA Lowe. 1997. The reproductive cycle and sexual
maturity of Atka mackerel, Pleurogrammus monopterygius, in Alaska Waters.
Fishery Bulletin 95: 321-333.
28. Zhang, CI, TK Wilderbuer, and GE Walters. 1998. Biological characteristics
and fishery assessment of Alaska plaice, Pleuronectes quadrituberculatus, in
the Eastern Bering Sea. Marine Fisheries Review 60(4): 16-27.
29. Matarese, AC, AW Kendall, Jr., DM Blood, and BM Vinter. 1989. Laboratory
guide to early life history stages of Northeast Pacific fishes. U.S. Department
of Commerice, NOAA Technical Report NMFS 80. 652 p.
30. Grimes, CB and GR Huntsman. 1980. Reproductive biology of the vermillion
snapper, Rhomboplites aurorubens, from North Carolina and South Carolina.
Fishery Bulletin 78(1): 137-146.
31. Finucane, JH, LA Collins, HA Brusher, and CH Saloman. 1986. Reproductive
biology of king mackerel, Scomberomorus cavalla, from the southeastern
United States. Fishery Bulletin 84(4): 841-50.
![Page 139: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/139.jpg)
123
32. Elgar, MA. 1990. Evolutionary compromise between a few large and many
small eggs: comparative evidence in teleost fish. Oikos 59(2): 283-287.
33. Pauly, D and RSV Pullin. 1988. Hatching time in spherical, pelagic, marine
fish eggs in response to temperature and egg size. Environmental Biology of
Fishes 22(4): 261-271.
34. Boehlert, GW and MM Yoklavich. 1984. Reproduction, embyronic energetics,
and the maternal-fetal relationship in the viviparous genus Sebastes (Pisces:
Scorpaenidae). Biol Bull 167: 354-370.
35. Chilton, E. 2007. Maturity of female northern rockfish Sebastes polyspinis in
the central Gulf of Alaska. Alaska Fishery Research Bulletin 12(2): 264-269.
36. Mylonas, CC, N Papandroulakis, A Smboukis, M Papadaki, and P Divanach.
2004. Induction of spawning of cultured greater amberjack (Seriola dumerili)
using GnRHa implants. Aquaculture 237: 141-154.
37. Knuckey, IA and KP Sivakumaran. 2001. Reproductive characteristics and
per-recruit analyses of blue warehou (Seriolella brama): implications for the
South East Fishery of Australia. Marine & Freshwater Research 52: 575-587.
38. Zimmermann, M. 1997. Maturity and fecundity of arrowtooth flounder,
Atheresthes stomias, from the Gulf of Alaska. Fishery Bulletin 95: 598-611.
39. Waltz, W, WA Roumillat, PK Ashe. 1979. Distribution, age structure, and sex
composition of the black sea bass, Centropristis striata, sampled along the
southeastern coast of the United States. South Carolina Marine Resources
Center Technical Report 32, pp. 18.
40. Pajaro, M, GJ Macchi, and RP Sanchez. 1997. Fertility and reproductive
frequency of Patagonia and Buenos Aires stocks of the Argentine anchovy
(Engraulis anchoita). Revista de Investigacion y Desarollo Pesquero 11: 19-
39.
41. Burnett, J, MR Ross, SH Clark. 1992. Several biological aspects of the witch
flounder (Glyptocephalus cynoglossus (L.)) in the Gulf of Maine-Georges
Bank region. J Northw Atl Fish Sci 12: 15-25
![Page 140: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/140.jpg)
124
42. Crow, KD, DA Powers, and G Bernardi. 1997. Evidence for multiple maternal
contributors in nests of kelp greenling (Hexagrammos decagrammus,
Hexagrammidae). Copeia 1997(1): 9-15.
43. Batts, BS. 1972. Sexual maturity, fecundity, and sex ratios of the skipjack tuna,
Katsuwonus pelamis (Linnaeus), in North Carolina waters. Transactions of the
American Fisheries Society 101: 626-637.
44. Macchi, GJ and M Pajaro. 1999. Features of the reproductive biology of the
southern blue whiting (Micromesistius australis). INIDEP Documento
Cientifico 5: 67-79.
45. Macchi, GJ, M Pajaro, OC Wohler, MJ Acevedo, RL Centurion, DG Urteaga.
2005. Batch fecundity and spawning frequency of southern blue whiting
(Micromesistius australis) in the southwest Atlantic Ocean. New Zealand
Journal of Marine and Freshwater Research 39: 993-1000.
46. Pajaro, M and GJ Macchi. 2001. Spawning pattern, length at maturity, and
fecundity of the southern blue whiting (Micromesistius australis) in the south-
west Atlantic Ocean. New Zealand Journal of Marine and Freshwater
Research 35: 375-385.
47. Manooch, CS III. 1976. Reproductive cycle, fecundity, and sex ratios of the
red porgy, Pagrus pagrus (Pisces: Sparidae) in North Carolina. Fishery
Bulletin 74: 775-781.
48. McDermott, SF, KP Maslenikov, DR Gunderson. 2007. Annual fecundity,
batch fecundity, and oocyte atresia of Atka mackerel (Pleurogrammus
monopterygius) in Alaskan waters. Fishery Bulletin 105: 19-29.
49. Cargnelli, LM, SJ Griesbach, DB Packer, PL Berrien, DL Johnson, WW
Morse. 1999. Pollock, Pollachius virens, life history and habitat
characteristics. U.S. Dept. of Commerce, NOAA Technical Memorandum,
NMFS-NE-131: 1-30.
50. Buckley, LJ, AS Smigielski, TA Halavik, EM Caldarone, BR Burns, GC
Laurence. 1991. Winter flounder Pseudopleuronectes americanus reproductive
success. II. Effects of spawning time and female size on size, composition and
viability of eggs and larvae. Marine Ecology Progress Series 74: 125-135.
![Page 141: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/141.jpg)
125
51. Haldorson, L and M Love. 1991. Maturity and fecundity in the rockfishes,
Sebastes spp., a review. Marine Fisheries Review 53(2): 25-31.
52. Boehlert, GW, WH Barss, and PB Lamberson. 1982. Fecundity of the widow
rockfish, Sebastes entomelas, off the coast of Oregon. Fishery Bulletin 80:881-
884.
53. Phillips, JB. 1964. Life history studies on ten species of rockfish (Genus
Sebastodes). California Department of Fish & Game Fish Bulletin 126:1-70.
54. White, GG, TA Munroe, and HM Austin. 2003. Reproductive seasonality,
fecundity, and spawning frequency of tautog (Tautoga onitis) in the lower
Chesapeake Bay and coastal waters of Virginia. Fishery Bulletin 101(2): 424-
442.
55. Sun, C-L, S-L Chu, S-Z Yeh. 2006. Reproductive biology of bigeye tuna in the
western and central Pacific Ocean. Western and Central Pacific Fisheries
Commission WCPFC-SC2-2006/BI WP-1. pp. 22
56. Beacham, TD and SJ Nepszy. 1980. Some aspects of the biology of white
hake, Urophycis tenuis, in the southern Gulf of St. Lawrence. Journal of
Northwest Atlantic Fishery Science 1: 49-54.
![Page 142: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/142.jpg)
126
![Page 143: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/143.jpg)
127
Chapter 4
Genetic impacts of overfishing are widespread
4.1 Abstract and Introduction
The harvesting of wild populations has a range of important impacts, including
changes in life history traits, depression of abundance, and alterations of community
composition (Dayton et al. 1998; Jennings & Kaiser 1998; Hutchings & Baum 2005;
Myers et al. 2007). Evolutionary impacts of harvest, however, have been less
frequently considered as part of routine management (Jørgensen et al. 2007). While
harvest can cause loss of genetic variation and the evolution of life history traits
(Allendorf et al. 2008), it is controversial how widespread such impacts are in the
wild. The greatest uncertainty surrounds species with high abundance, including most
marine fishes, because genetic drift during harvest is not expect to be strong enough to
reduce genetic diversity. However, a small number of case studies have reported such
reductions (Hauser et al. 2002). If these impacts are indeed rare, genetic diversity
across a range of overfished species should be similar to that in more stable congeners
and confamilials. In contrast, we found that allelic richness in overfished species was
on average 18% lower (p = 0.008) across 37 comparisons involving 88 species.
Heterozygosity was not significantly lower (-1.2%, p = 0.66), and we confirmed with
simulations that these results are consistent with a recent population bottleneck.
Genetic impacts of overharvest appear to be widespread even among abundant
species. A loss of allelic richness has implications for the long-term evolutionary
potential of species, and more generally, these evolutionary impacts deserve greater
attention as a routine aspect of natural resource management.
![Page 144: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/144.jpg)
128
4.2 Results and Discussion
Using a meta-analytical framework for this study, we compiled data on 11,259
microsatellite loci from 185 studies of 88 species (Table 4.S1). These data allowed us
to ask whether overfished species have lower diversity than their close relatives (Fig.
4.1). Such an approach allows a wider range of species to be studied than those few
with historical samples (Hauser et al. 2002). If being overfished has no genetic impact,
then diversity should be equivalent in the two groups. Conversely, if diversity is
consistently lower in overfished species, this would suggest that population declines in
marine fish have evolutionary impacts. We used other species known to be fished as
controls so as to avoid known life history differences, including differences in pre-
fishing abundance, between fished and unfished species (Sethi et al. 2010; Pinsky et
al. 2011).
In 26 of our 37 comparisons, there were fewer alleles per locus (A50) among
overfished species (Fig. 4.2), including for species that ranged from small menhaden
(Brevoortia sp.) and herring (Clupea sp.) to large bluefin tuna (Thunnus thynnus) and
long-lived rockfish (Sebastes crameri and levis). On average, overfished species had
18% fewer alleles at microsatellite loci than closely related control species, and this
was significantly different from zero in both a random effects model (p = 0.008) and a
nonparametric Wilcoxon signed rank text (p = 0.015). As would be expected from a
recent bottleneck, expected heterozygosity (He) was slightly but not significantly
negative (Fig. 4.3, -1.2% lower, p = 0.66).
Across taxon groups, the response to fishing appears to differ (QT = 3053, p <
0.0001 and QT = 1503, p < 0.0001 for A50 and He respectively). Population size,
magnitude of decline, average duration overfished, and time since the species became
overfished did not explain significant amounts of this heterogeneity (p > 0.1, mixed
effects models).
The differences in allelic richness could suggest a loss of diversity in
overfished species, or they could represent consistent differences between overfished
and control species that are unrelated to overfishing. Because our evidence for loss is
![Page 145: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/145.jpg)
129
indirect (a cross-taxa rather than cross-time comparison), it is important to consider
alternative explanations. In microsatellites, amplifications of loci developed in non-
focal species (cross-species loci), selection of high diversity loci, differences in
sampling effort, or differences in repeat size are all possible biases (Rico et al. 1996;
Ellegren 2004; Väli et al. 2008). Cross-species loci, however, were more prevalent
among our control species (42% of loci) than among our overfished species (27%, p <
0.0001, chi-squared test). Similarly, loci from primer notes – where low-diversity loci
are more likely to be reported – were more common among our control species (28%
vs. 8% of loci, p < 0.0001). Both trends reduce diversity among the control species
and make our comparison more conservative. In addition, sampling effort was higher
among the overfished species (n = 122 vs. n = 55, p < 0.0001, t-test), suggesting a
greater ability to detect alleles and a more conservative test. We did not detect a trend
in our data towards lower allelic richness among loci with longer repeat size (p = 0.68,
linear regression), though repeat sizes were on average somewhat longer among our
overfished species (2.7 bp) than our control species (2.3 bp, p < 0.001, t-test).
In addition, consistent differences in natural (pre-fishing) population
abundance between overfished and control species could create the differences in
allelic richness that we observed. However, abundant species are typically fished first
(Sethi et al. 2010), and species with longer histories of fishing are more likely to
collapse (Pinsky et al. 2011). It therefore seems likely that our overfished species had
a higher pre-fishing abundance than the control species. In addition, overfished species
do not exhibit unique life histories when compared against other fished species
(Pinsky et al. 2011). Finally, average landings and body size have both been suggested
as proxies for abundance in fishes (McCusker & Bentzen 2010). Our overfished
species had higher but not significantly different landings (9000 vs. 2820 metric tons
per year, p = 0.09) and lower but not significantly different body size (73 vs. 85 cm, p
= 0.26). Both trends suggest, if anything, a higher pre-fishing abundance among
overfished species (McCusker & Bentzen 2010).
Finally, our data from overfished species likely include some populations that
are not overfished. Similarly, our control species likely include some that are in reality
![Page 146: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/146.jpg)
130
overfished, but that haven’t yet been identified as such. Our comparison is therefore
even more conservative and the true difference may be greater than we measured.
While our data are correlational rather than direct evidence, we believe the most
parsimonious explanation is that overfishing led to a reduction in diversity.
We next simulated and analytically calculated population bottlenecks for a
range of initial population sizes to determine whether a 19% loss of allelic richness is
reasonable for marine fishes (Fig. 4.4). Our analysis suggested that these results in fact
should be common if populations with an initial effective size less than 5,000 declined
90% more than five generations ago (Fig. 4.4b,d). A 90% decline from pre-fishing
biomass is reasonable to expect for heavily overfished marine species (Myers &
Worm 2003; Worm et al. 2009). Weaker bottlenecks (50% decline) could also
produce these patterns in populations with smaller effective sizes and bottlenecks
further in the past (Fig. 4.4a,c).
In summary, across a significant majority of overfished species, we found that
genetic diversity was lower than in closely related fishes that had not been overfished.
These results suggest that the genetic impacts of overfishing are widespread. While
previous studies have indicated that overfishing can reduce genetic diversity under
some circumstances (Hauser et al. 2002), this is the first study to suggest that such
impacts are common.
A reduction in genetic diversity among overfished species could be caused by
selection or by genetic drift. Fishing can exert strong selective pressures on target
species (Jørgensen et al. 2007), potentially reducing effective population size (Ne) by
increasing the variance in reproductive success among individuals (Hare et al. 2010).
However, recombination should quickly narrow this effect to the region of the genome
near selected loci, leaving only “outlier loci” affected by genetic draft. Obvious outlier
loci in our overfished species were not apparent, but the available data did not allow
formal statistical tests for outliers and we cannot entirely discount this process.
In contrast, a reduction in effective population size can drive genetic drift to
erode diversity throughout the genome. Census and effective population sizes are
often correlated by a scaling factor (Ne/N) that depends in part on life history
![Page 147: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/147.jpg)
131
characteristics (Frankham 1995; Turner et al. 2006; Portnoy et al. 2008), and a decline
in census size can therefore increase the strength of genetic drift. The Ne/N ratio may
be quite small for marine species (Hauser et al. 2002). Drift is expected to act more
quickly and severely on allelic richness than on heterozygosity (Maruyama & Fuerst
1985), and, as shown by our simulations, the loss of diversity we observed was
consistent with effective population size decreases of 50-90% from initial effective
sizes of 102-104. These initial sizes appear reasonable for a wide range of marine
fishes, though the upper end is large enough so as to be difficult to measure precisely
with existing population genetic methods (Hare et al. 2010). Therefore, we propose
that widespread genetic impacts should be expected when harvest causes 90% declines
in abundance.
The microsatellite loci we examined are putatively neutral, but our results
suggest that genetic drift in marine fishes is also strong enough to reduce diversity at
neutral or weakly selected loci that would otherwise be adaptive in future
environments. The ability of a species to evolve and survive in future conditions
depends on the number of alleles and the traits conferred by them, particularly in
rapidly changing environments (Allendorf et al. 2008). Once lost, creation of new
alleles ultimately depends on the slow process of mutation, and recovery of lost allelic
richness will therefore be slow.
The demographic and ecological impacts of harvest have long been considered
and documented, while the evolutionary impacts, particularly in abundant species,
have been less widely appreciated. Our results suggest that a wide range of species
have lost alleles as a result of overfishing. Milder loss is also likely to accompany
even typical levels of fishing, which frequently reduce stocks by half or more. It is
difficult to put a precise cost on such loss, but it is clear that the ability to adapt in
coming decades will be crucial as species are faced with rapidly changing climatic
conditions.
![Page 148: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/148.jpg)
132
4.3 Materials and Methods
4.3.1 Literature selection
For our research, we collected population genetic studies on overfished focal
fishes and control species closely related to these focal species. We focused on
microsatellites because of their widespread use, large number of loci available per
species, presumed neutrality, and high variability. We used the RAM Legacy stock
assessment database (Worm et al. 2009) to identify 71 species of fish that have had at
least one overfished population (biomass less than 50% of that predicted to sustain
maximum sustainable yield, BMSY) (Pinsky et al. 2011). We then conducted searches
in ISI Web of Science and Google Scholar with species name and “microsatellite” as
keywords to identify relevant studies. We also searched species synonyms as listed in
Fishbase (Froese & Pauly 2010).
For comparison against these overfished species, we compiled studies from
congeners not known to be overfished, or from confamilials when more than one
congener was not available. We restricted our control groups to fished species that
appeared in global landings reported to the UN Food and Agricultural Organization
(FAO) (downloaded from http://www.fao.org/fishery/statistics/software/fishstat/en,
December 2009). We limited our set of controls because fished species, including
those that are overfished, generally have a higher abundance than unfished species
(Sethi et al. 2010). Overfished species and those that are fished but not overfished,
however, have quite similar life histories (Pinsky et al. 2011). In addition, we only
compared marine species to other marine species, and only anadromous to
anadromous (DeWoody & Avise 2000). We also excluded endangered or critically
endangered species from the control species, as defined by the IUCN Redlist (Baillie
et al. 2004). Studies were collected until May 1, 2011.
From each study, we recorded allelic richness (A), expected heterozygosity
(He), sample size for each locus, whether the locus was originally developed in a
different species (cross-species amplification), and whether the study was a primer
![Page 149: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/149.jpg)
133
note. Because A is dependent on sample size, we used Ewen’s sampling formula to
correct all measures to a standard sample size of 50 (A50), the median in our dataset
(Ewens 1972). To best estimate neutral diversity for all of our species, we only
included data from wild populations sampled after the species became overfished and
with a sample size > 10. We excluded loci linked to Expressed Sequence Tags (ESTs),
as these are more likely to be under selection. Because most studies focus on high
diversity microsatellites, we also excluded monomorphic loci and those expressly
chosen for low diversity (e.g., some used for forensic analysis).
4.3.2 Analysis
The effect of population decline was measured as the natural log of the
response ratio (Hedges et al. 1999),
where XE and XC are the mean diversity in the overfished species and in the
control species. Ln-transformed response ratios are commonly used in metaanalysis
for their ease of interpretation and approximate normality. However, we discuss our
results in terms of un-transformed response ratios for ease of interpretation.
To calculate mean diversity within a species or group of species, we weighted
each locus (i) by its sample size (wi),
where Xi is diversity at a locus in a population from a species. By counting
each locus separately, this approach has the effect of weighting more heavily those
populations, studies, and species with a higher sample size and more loci. Because a
![Page 150: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/150.jpg)
134
small number of studies had very high sample size, we used the minimum of 200 or a
study’s sample size as wi. Not using this cap did not alter our conclusions.
In meta-analysis, individual effect sizes are typically weighted by the inverse
of the variance to account for each effect size’s precision (Hedges et al. 1999). We
calculated variance of L for each comparison as
where S and n are the standard deviation and the sample size for either the
overfished (E) or the control (C) species. The total number of loci, summed across
populations and across studies, was used as sample size. This approach treats each
locus within a population within a study as an independent replicate of the diversity
within a species.
We fit a random-effects model to calculate a mean response across all taxa
(Hedges et al. 1999). This model allows for variation between taxa to account for the
wide range of species examined. We used the test statistic QT to determine if there was
significant heterogeneity between groups in the effect size (Hedges et al. 1999). To
examine whether we could explain this variation, we fit mixed effects models with a
range of predictor variables. These variables included average annual landings from
1950-2006 as a proxy for population size (McCusker & Bentzen 2010), magnitude of
decline as the minimum fraction of BMSY reached by a species, average duration in
years for which a species was overfished, and the average number of years after the
species became overfished that the samples were collected. These additional data were
extracted from the stock assessments and the FAO landings. We conducted all
analyses in R with the metafor package (Viechtbauer 2010).
4.3.3 Simulations
To examine expected loss of allelic richness following a bottleneck, we
implemented a forward Wright-Fisher genetic model by sampling 2Nb alleles each
![Page 151: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/151.jpg)
135
generation, where Nb is the effective size after the bottleneck. We calculated allelic
richness from a random sample of 100 alleles (50 individuals) in each generation. The
model was initialized with equilibrium allele frequency distributions from a locus with
a stepwise mutation model (SMM) in a population with 2Ne alleles (pre-bottleneck)
provided by the coalescent simulator Simcoal2 (Laval & Excoffier 2004). We
conducted 1000 independent simulations at each of Ne = 10x, where x = [2, 2.5, 3, 3.5,
4] and where Nb/Ne = 50 or 90%. We sampled populations 1-30 generations after the
bottleneck.
Because heterozygosity declines predictably as
where Ho is pre-bottleneck heterozygosity and Ht is heterozygosity in
generation t (Frankham et al. 2002), we evaluated this equation to generate
expectations for heterozygosity after a bottleneck. Neither this equation nor our allelic
richness simulations consider mutation, which is reasonable given the short time frame
that we examined (30 generations).
4.4 Acknowledgments
The authors thank Dan Ricard and Olaf Jensen for help with the RAM Legacy
database. M.L.P. was supported by a NSF Graduate Research Fellowship.
4.5 References
Allendorf F.W., England P.R., Luikart G., Ritchie P.A. & Ryman N. (2008). Genetic
effects of harvest on wild animal populations. Trends Ecol. Evol., 23, 327-337.
![Page 152: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/152.jpg)
136
Baillie J.E.M., Hilton-Taylor C. & Stuart S. (eds.) (2004). 2004 IUCN Red List of
threatened species: a global species assessment. IUCN, Gland, Switzerland
and Cambridge, UK.
Dayton P.K., Tegner M.J., Edwards P.B. & Riser K.L. (1998). Sliding baselines,
ghosts, and reduced expectations in kelp forest communities. Ecol. Appl., 8,
309-322.
DeWoody J.A. & Avise J.C. (2000). Microsatellite variation in marine, freshwater,
and anadromous fishes compared with other animals. J. Fish Biol., 56, 461-
473.
Ellegren H. (2004). Microsatellites: simple sequences with complex evolution. Nature
Reviews Genetics, 5, 435-45. doi:10.1038/nrg1348
Ewens W.J. (1972). The sampling theory of selectively neutral alleles. Theor. Popul.
Biol., 3, 87-112.
Frankham R. (1995). Effective population size/adult population size ratios in wildlife:
a review. Genet. Res., 66, 95-107.
Frankham R., Ballou J.D. & Briscoe D.A. (2002). Introduction to conservation
genetics. Cambridge University Press, New York.
Froese R. & Pauly D. (eds.) (2010). FishBase. World Wide Web electronic
publication. www.fishbase.org. Visited 4/01/2011.
Hare J.A., Alexander M.A., Fogarty M.J., Williams E.H. & Scott J.D. (2010).
Forecasting the dynamics of a coastal fishery species using a coupled climate-
population model. Ecol. Appl., 20, 452-64.
Hauser L., Adcock G.J., Smith P.J., Bernal Ramírez J.H. & Carvalho G.R. (2002).
Loss of microsatellite diversity and low effective population size in an
overexploited population of New Zealand snapper (Pagrus auratus). P Natl
Acad Sci USA, 99, 11742-11747.
Hedges L.V., Gurevitch J. & Curtis P.S. (1999). The Meta-Analysis of Response
Ratios in Experimental Ecology. Ecology, 80, 1150.
Hutchings J.A. & Baum J.K. (2005). Measuring marine fish biodiversity: temporal
changes in abundance, life history and demography. Philosophical
![Page 153: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/153.jpg)
137
Transactions of the Royal Society of London B: Biological Sciences, 360, 315-
338. doi:10.1098/rstb.2004.1586
Jennings S. & Kaiser M.J. (1998). The effects of fishing on marine ecosystems and
communities. Adv. Mar. Biol., 34, 201-352. doi:10.1006/jfbi.2000.1373
Jørgensen C., Enberg K., Dunlop E.S., Arlinghaus R., Boukal D.S., Brander K.,
Ernande B., Gårdmark A., Johnston F., Matsumura S., Pardoe H., Raab K.,
Silva A., Vainikka A., Dieckmann U., Heino M. & Rijnsdorp A.D. (2007).
Managing evolving fish stocks. Science, 318, 1247-1248.
Laval G. & Excoffier L. (2004). SIMCOAL 2.0: a program to simulate genomic
diversity over large recombining regions in a subdivided population with a
complex history. Bioinformatics, 20, 2485-2487.
Maruyama T. & Fuerst P.A. (1985). Population bottlenecks and nonequilibrium
models in population genetics. II. Number of alleles in a small population that
was formed by a recent bottleneck. Genetics, 111, 675-689.
McCusker M.R. & Bentzen P. (2010). Positive relationships between genetic diversity
and abundance in fishes. Mol. Ecol., 19, 4852-4862.
Myers R.A., Baum J.K., Shepherd T.D., Powers S.P. & Peterson C.H. (2007).
Cascading effects of the loss of apex predatory sharks from a coastal ocean.
Science, 315, 1846-1850.
Myers R.A. & Worm B. (2003). Rapid worldwide depletion of predatory fish
communities. Nature, 423, 280-283.
Pinsky M., Jensen O.P., Ricard D. & Palumbi S.R. (2011). Unexpected patterns of
fisheries collapse in the world’s oceans. Proceedings of the National
Academies of Science. doi:10.1073/pnas.1015313108
Portnoy D.S., McDowell J.R., McCandless C.T., Musick J.a. & Graves J.E. (2008).
Effective size closely approximates the census size in the heavily exploited
western Atlantic population of the sandbar shark, Carcharhinus plumbeus.
Conserv. Genet., 10, 1697-1705. doi:10.1007/s10592-008-9771-2
![Page 154: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/154.jpg)
138
Rico C., Rico I. & Hewitt G.M. (1996). 470 million years of conservation of
microsatellite loci among fish species. Proceedings. Biological sciences / The
Royal Society, 263, 549-57.
Sethi S.A., Branch T.A. & Watson R. (2010). Global fishery development patterns are
driven by profit but not trophic level. P Natl Acad Sci USA, 107, 12163-12167.
Turner T.F., Osborne M.J., Moyer G.R., Benavides M.A. & Alò D. (2006). Life
history and environmental variation interact to determine effective population
to census size ratio. Proceedings of the Royal Society B: Biological Sciences,
273, 3065-73.
Väli U., Einarsson A., Waits L. & Ellegren H. (2008). To what extent do microsatellite
markers reflect genome-wide genetic diversity in natural populations? Mol.
Ecol., 17, 3808-17. doi:10.1111/j.1365-294X.2008.03876.x
Viechtbauer W. (2010). Conducting meta-analyses in R with the metafor package.
Journal of Statistcal Software, 36, 1-48.
Worm B., Hilborn R., Baum J.K., Branch T.A., Collie J.S., Costello C., Fogarty M.J.,
Fulton E.A., Hutchings J.A., Jennings S., Jensen O.P., Lotze H.K., Mace P.M.,
McClanahan T.R., Minto C., Palumbi S.R., Parma A.M., Ricard D., Rosenberg
A.A., Watson R. & Zeller D. (2009). Rebuilding global fisheries. Science, 325,
578.
![Page 155: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/155.jpg)
139
4.6 Figures
Figure 4.1. Paired comparisons between an overfished species and its close
relatives. For example, average allelic richness (A50) and expected heterozygosity (He)
are lower in the overfished Pagrus auratus than in other members of the Sparidae
family.
A50 = 10.2He = 0.736
A50 = 16.6He = 0.846
![Page 156: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/156.jpg)
140
Figure 4.2. Overfished species have consistently lower allelic richness (A50)
than closely related control species. Each box represents the ratio of overfished/control
diversity with 95% confidence intervals. The average ratio (82%) with 95% CI is
indicated by the diamond.
RE Model
0.22 0.37 0.61 1.00 1.65 2.72 4.48
Aoverfished Acontrol
Lutjanus analisScomber japonicusMallotus villosusSebastes pinnigerSebastes mentellaTrachurus murphyiSebastes mystinusSebastes fasciatusMelanogrammus aeglefinusMycteroperca microlepisPleuronectes platessaSebastes paucispinisCynoscion regalisSebastes ruberrimusPseudopleuronectes americanusSebastes alutusGadus macrocephalusGadus morhuaLutjanus campechanusMerlangius merlangusTheragra chalcogrammaThunnus thynnusPagrus pagrusSardinops sagaxMerluccius hubbsiMicromesistius poutassouEngraulis encrasicolusLepidorhombus whiffiagonisPagrus auratusClupea pallasiiSprattus sprattusSebastes crameriBrevoortia patronusClupea harengusBrevoortia tyrannusSebastes levisPlatichthys stellatus
![Page 157: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/157.jpg)
141
Figure 4.3. Overfished species have similar heterozygosity (He) as compared
to closely related control species. Each box represents the ratio of overfished/control
diversity with 95% confidence intervals. The average ratio (99%) with 95% CI is
indicated by the diamond.
RE Model
0.37 0.61 1.00 1.65
Hoverfished Hcontrol
Lutjanus analisScomber japonicusSebastes mentellaSebastes alutusSebastes mystinusSebastes fasciatusSebastes pinnigerMycteroperca microlepisSebastes ruberrimusGadus morhuaGadus macrocephalusMicromesistius poutassouTheragra chalcogrammaMelanogrammus aeglefinusSebastes paucispinisSebastes crameriMerlangius merlangusMallotus villosusTrachurus murphyiThunnus thynnusSardinops sagaxEngraulis encrasicolusPleuronectes platessaMerluccius hubbsiClupea pallasiiLutjanus campechanusPagrus auratusSprattus sprattusPlatichthys stellatusClupea harengusPagrus pagrusBrevoortia tyrannusCynoscion regalisPseudopleuronectes americanusBrevoortia patronusLepidorhombus whiffiagonis
![Page 158: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/158.jpg)
142
Figure 4.4. Expected loss of allelic richness (a,b) and heterozygosity (c,d)
from simulated bottlenecks of 50% (a,c) and 90% (b,d). Contour lines indicate
proportion of diversity remaining. Initial effective population size (Ne) is indicated
along the y-axis, and generations post-bottleneck are indicated along the x-axis.
Contours bend back toward the right for low Ne because few alleles are present pre-
bottleneck, and therefore only a small proportion can be lost.
Ne
0.85
0.9
0.95
1
1
102
103
104
a)
0.6
5
0.7
0.75
0.8
0.85
0.9
0
.95
1
b)
Generations
Ne
0.8
0.9
1
0 5 10 20 30
102
103
104
c)
Generations
Ne
0.3 0.4 0.5 0.6
0.7 0.8
0.9
1
0 5 10 20 30
d)
![Page 159: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/159.jpg)
143
4.7 Supplemental Information
Table 4.S1. References for the overfished species and the control species
against which they were compared.
Overfished species
Common name Control taxon Control species References
Brevoortia patronus
Gulf menhaden
Clupeidae Sardina pilchardus 1-6
Brevoortia tyrannus
Atlantic menhaden
Clupeidae Sardina pilchardus 1, 3-6
Clupea harengus Atlantic herring
Clupeidae Sardina pilchardus 4, 5, 7-11
Clupea pallasii Pacific herring
Clupeidae Sardina pilchardus 4, 5, 12-22
Cynoscion regalis
Gray weakfish
Sciaenidae
Argyrosomus regius, Cynoscion nebulosus, Larimichthys polyactis, Micropogonias furnieri, Miichthys miiuy, Sciaenops ocellatus
23-39
Engraulis encrasicolus
European anchovy
Engraulis Engraulis japonicus 40-43
Gadus macrocephalus
Pacific cod
Gadidae Trisopterus minutus 44-47
Gadus morhua Atlantic cod
Gadidae Trisopterus minutus 47-60
Lepidorhombus whiffiagonis Megrim Scophthalmidae
Lepidorhombus boscii, Psetta maxima, Scophthalmus rhombus
61-69
Lutjanus analis Mutton snapper
Lutjanus Lutjanus argentimaculatus, L. synagris
70-75
Lutjanus campechanus
Northern red snapper
Lutjanus Lutjanus argentimaculatus, L. synagris
70-72, 75-78
Mallotus villosus Capelin Osmeridae Osmerus mordax, Thaleichthys pacificus
79-85
Melanogrammus aeglefinus Haddock Gadidae Trisopterus minutus
47, 86-88
![Page 160: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/160.jpg)
144
Merlangius merlangus Whiting Gadidae Trisopterus minutus
47, 89, 90
Merluccius hubbsi
Argentine hake
Merluccius
Merluccius albidus, M. australis, M. bilinearis, M. gayi, M. merluccius
91-95
Micromesistius poutassou
Blue whiting
Gadidae Trisopterus minutus 47, 96-98
Mycteroperca microlepis Gag Mycteroperca
Mycteroperca bonaci, M. phenax
99-103
Pagrus auratus Squirefish Sparidae
Acanthopagrus schlegelii, Dentex dentex, Lithognathus mormyrus, Pagellus erythrinus, Sparus aurata
67, 104-117
Pagrus pagrus Common seabream
Sparidae
Acanthopagrus schlegelii, Dentex dentex, Lithognathus mormyrus, Pagellus erythrinus, Sparus aurata
67, 104, 105, 108, 110-118
Platichthys stellatus
Starry flounder
Pleuronectidae Platichthys flesus, Pseudopleuronectes herzensteini
61, 119-122
Pleuronectes platessa
European plaice
Pleuronectidae Platichthys flesus, Pseudopleuronectes herzensteini
61, 119, 120, 122-129
Pseudopleuronectes americanus
Winter flounder
Pleuronectidae Platichthys flesus, Pseudopleuronectes herzensteini
61, 119, 120, 122, 130-132
Sardinops sagax South American pilchard
Clupeidae Sardina pilchardus 4, 5, 133
![Page 161: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/161.jpg)
145
Scomber japonicus
Chub mackerel
Scombridae
Auxis rochei, Katsuwonus pelamis, Scomber australasicus, S. brasiliensis, Scomberomorus cavalla, S. commerson, S niphonius, T. alalunga, T. albacares, T. atlanticus, T. obesus, T. orientalis
134-159
Sebastes alutus Pacific ocean perch
Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-168
Sebastes crameri Darkblotched rockfish
Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167, 169
Sebastes fasciatus
Acadian redfish
Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167, 170-174
Sebastes levis Cowcod Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167
Sebastes mentella
Deepwater redfish
Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167, 170-177
Sebastes mystinus
Blue rockfish
Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167, 178-180
![Page 162: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/162.jpg)
146
Sebastes paucispinis Bocaccio Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167, 181
Sebastes pinniger
Canary rockfish
Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167, 182, 183
Sebastes ruberrimus
Yelloweye rockfish
Sebastes
Sebastes aleutianus, S. carnatus, S. entomelas, S. flavidus, S. goodei, S. melanops, S. melanostomus
160-167, 184
Sprattus sprattus European sprat
Clupeidae Sardina pilchardus 4, 5, 185, 186
Theragra chalcogramma
Alaska pollock
Gadidae Trisopterus minutus 47, 187-190
Thunnus thynnus Northern bluefin tuna
Thunnus
Thunnus alalunga, T. albacares, T. atlanticus, T. obesus, T. orientalis
134, 135, 139, 141-144, 147, 149, 151-153, 191-193
Trachurus murphyi Inca scad Trachurus
Trachurus japonicus, T. trachurus
194-197
1. Anderson J.D. & Karel W.J. (2007). Genetic evidence for asymmetric
hybridization between menhadens (Brevoortia spp.) from peninsular Florida. J.
Fish Biol., 71, 235-249. doi:10.1111/j.1095-8649.2007.01597.x
2. Anderson J.D. & McDonald D.L. (2007). Morphological and genetic
investigations of two western Gulf of Mexico menhadens (Brevoortia spp.). J.
Fish Biol., 70, 139-147. doi:10.1111/j.1095-8649.2007.01326.x
3. Anderson J.D. (2007). Systematics of the North American menhadens:
molecular evolutionary reconstructions in the genus Brevoortia (Clupeiformes:
Clupeidae). Fish. Bull., 205, 368-378.
![Page 163: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/163.jpg)
147
4. Gonzalez E.G. & Zardoya R. (2007). The relative role of life-history traits and
historical factors in shaping genetic population structure of sardines (Sardina
pilchardus). BMC Evol. Biol., 7, 1-12. doi:10.1186/1471-2148-7-197
5. Gonzalez E.G. & Zardoya R. (2007). Isolation and characterization of
polymorphic microsatellites for the Sardine Sardina pilchardus (Clupeiformes:
Clupeidae). Mol. Ecol. Notes, 7, 519- 521. doi:10.1111/j.1471-
8286.2006.01640.x
6. Lynch A.J., Mcdowell J.R. & Graves J.E. (2010). A molecular genetic
investigation of the population structure of Atlantic Menhaden (Brevoortia
tyrannus). Fish. Bull., 108, 87-97.
7. Bekkevold D., André C., Dahlgren T.G., Clausen L.A.W., Torstensen E.,
Mosegaard H., et al. (2005). Environmental correlates of population
differentiation in Atlantic Herring. Evolution, 59, 2656-2668.
8. Bekkevold D., Clausen L.A.W., Mariani S., André C., Christensen T.B. &
Mosegaard H. (2007). Divergent origins of sympatric herring population
components determined using genetic mixture analysis. Mar. Ecol. Prog. Ser.,
337, 187-196.
9. Jørgensen H.B.H., Hansen M.M. & Loeschcke V. (2005). Spring-spawning
Herring (Clupea harengus L.) in the southwestern Baltic Sea: do they form
genetically distinct spawning waves? ICES J. Mar. Sci., 62, 1065-1075.
doi:10.1016/j.icesjms.2005.04.007
10. Jørgensen H.B.H., Hansen M.M., Bekkevold D., Ruzzante D.E. & Loeschcke
V. (2005). Marine landscapes and population genetic structure of Herring
(Clupea harengus L.) in the Baltic Sea. Mol. Ecol., 14, 3219-3234.
doi:10.1111/j.1365-294X.2005.02658.x
11. Mariani S., Hutchinson W.F., Hatfield E.M.C., Ruzzante D.E., Simmonds E.J.,
Dahlgren T.G., et al. (2005). North Sea Herring population structure revealed
by microsatellite analysis. Mar. Ecol. Prog. Ser., 303, 245-257.
12. Beacham T.D., Schweigert J.F., MacConnachie C., Le K.D., Labaree K. &
Miller K.M. (2001). Population structure of Herring (Clupea pallasi) in British
![Page 164: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/164.jpg)
148
Columbia: an analysis using microsatellite loci. Canadian Science Advisory
Secretariat Research Document 2001/128. Department of Fisheries and Oceans
Canada, Nanaimo, BC.
13. Beacham T.D., Schweigert J.F., MacConnachie C., Le K.D., Labaree K. &
Miller K.M. (2002). Population structure of Herring (Clupea pallasi) in British
Columbia determined by microsatellites, with comparisons to southeast Alaska
and California. Research Canadian Science Advisory Secretariat Document
2002/109. Department of Fisheries and Oceans Canada, Nanaimo, BC.
14. Beacham T.D., Schweigert J.F., MacConnachie C., Le K.D. & Flostrand L.
(2008). Use of microsatellites to determine population structure and migration
of Pacific Herring in British Columbia and adjacent regions. Trans. Am. Fish.
Soc., 137, 1795-1811. doi:10.1577/T08-033.1
15. Kitada S., Kitakado T. & Kishino H. (2007). Empirical Bayes inference of
pairwise FST and its distribution in the genome. Genetics, 177, 861-873.
doi:10.1534/genetics.107.077263
16. Sugaya T., Sato M., Yokoyama E., Nemoto Y., Fujita T., Okouchi H., et al.
(2008). Population genetic structure and variability of Pacific Herring Clupea
pallasii in the stocking area along the Pacific coast of northern Japan. Fish.
Sci., 74, 579-588. doi:10.1111/j.1444-2906.2008.01561.x
17. Miller K.M., Laberee K., Schulze A.D. & Kaukinen K.H. (2001).
Development of microsatellite loci in Pacific Herring (Clupea pallasi). Mol.
Ecol. Notes, 1, 131-132.
18. Mitchell D.M. (2006). Biocomplexity and metapopulation dynamics of Pacific
Herring (Clupea pallasii) in Puget Sound, Washington. Master of Science.
University of Washington, Seattle.
19. O'Connell M., Dillon M.C. & Wright J.M. (1998). Development of primers for
polymorphic microsatellite loci in the Pacific Herring (Clupea harengus
pallasi). Mol. Ecol., 7, 358-360.
![Page 165: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/165.jpg)
149
20. O'Connell M., Dillon M.C., Wright J.M., Bentzen P., Merkouris S.E. & Seeb
J.E. (1998). Genetic structuring among Alaskan Pacific Herring populations
identified using microsatellite variation. J. Fish Biol., 53, 150-163.
21. Olsen J.B., Lewis C.J., Kretschmer E.J., Wilson S.L. & Seeb J.E. (2002).
Characterization of 14 tetranucleotide microsatellite loci derived from Pacific
Herring. Mol. Ecol., 2, 101-103.
22. Small M.P., Loxterman J.L., Frye A.E., Von Bargen J.F., Bowman C. &
Young S.F. (2005). Temporal and spatial genetic structure among some Pacific
Herring populations in Puget Sound and the southern Strait of Georgia. Trans.
Am. Fish. Soc., 134, 1329-1341. doi:10.1577/T05-050.1
23. Anderson J.D. & Karel W.J. (2010). Population genetics and dynamics of
Spotted Seatrout in the estuarine waters of Texas. Fisheries and Aquaculture
Journal, 2010, FAJ2.
24. Chapman R.W., Ball A.O. & Mash L.R. (2002). Spatial homogeneity and
temporal heterogeneity of Red Drum (Sciaenops ocellatus) microsatellites:
Effective population sizes and management implications. Mar. Biotechnol., 4,
589-603. doi:10.1007/s10126-002-0038-5
25. Chen S.-L., Xing S.-C., Xu G.-B., Liao X. & Yang J.-F. (2009). Isolation and
characterization of 10 polymorphic microsatellite loci from Small Yellow
Croaker (Pseudosciaena polyactis). Conserv. Genet., 10, 1469-1471.
doi:10.1007/s10592-008-9762-3
26. Cordes J.F. & Graves J.E. (2003). Investigation of congeneric hybridization in
and stock structure of Weakfish (Cynoscion regalis) inferred from analyses of
nuclear and mitochondrial DNA loci. Fish. Bull., 101, 443-450.
27. D'Anatro A., Pereira A.N. & Lessa E.P. (2011). Genetic structure of the White
Croaker, Micropogonias furnieri Desmarest 1823 (Perciformes: Sciaenidae)
along Uruguayan coasts: contrasting marine, estuarine, and lacustrine
populations. Environ. Biol. Fishes. doi:10.1007/s10641-011-9799-x
28. Gold J.R. & Turner T.F. (2002). Population structure of Red Drum (Sciaenops
ocellatus) in the northern Gulf of Mexico, as inferred from variation in
![Page 166: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/166.jpg)
150
nuclear-encoded microsatellites. Mar. Biol., 140, 249-265.
doi:10.1007/s002270100692
29. Gold J.R., Stewart L.B. & Ward R. (2003). Population structure of Spotted
Seatrout (Cynoscion nebulosus) along the Texas Gulf coast, as revealed by
genetic analysis. In: Biology of the Spotted Seatrout (ed. Bortone SA). CRC
Press Boca Raton, FL, pp. 17-29.
30. Karlsson S., Renshaw M.A., Rexroad III C.E. & Gold J.R. (2008). PCR
primers for 100 microsatellites in Red Drum (Sciaenops ocellatus). Molecular
Ecology Resources, 8, 393-398. doi:10.1111/j.1471-8286.2007.01969.x
31. Karlsson S., Renshaw M.A., Rexroad III C.E. & Gold J.R. (2008).
Microsatellite primers for Red Drum (Sciaenops ocellatus). Fish. Bull., 106,
476-482.
32. Li J., Feng F. & Yue G.H. (2006). Twelve novel polymorphic microsatellites
in a marine fish species, Yellow Croaker Larimichthys polyactis. Mol. Ecol.
Notes, 6, 188- 190. doi:10.1111/j.1471-8286.2005.01188.x
33. Molecular Ecology Resources Primer Development Consortium, Andree K.,
Axtner J., Bagley M.J., Barlow E.J., Beebee T.J.C., et al. (2010). Permanent
genetic resources added to Molecular Ecology Resources Database 1 April
2010 – 31 May 2010. Molecular Ecology Resources, 10, 1098-1105.
34. Renshaw M.A., Gawriluk T.R. & Gold J.R. (2009). Characterization of Red
Drum microsatellite markers in Spotted Seatrout. N. Am. J. Aquacult., 71, 374-
379. doi:10.1577/A08-070.1
35. Wang R.X., Xu T.J., Sun Y.N. & He G.Y. (2010). Polymorphic microsatellite
loci from two enriched genomic libraries for the genetic analysis of the Miiuy
Croaker, Miichthys miiuy (Sciaenidae). Gen. Mol. Res., 9, 931-934.
doi:10.4238/vol9-2gmr806
36. Molecular Ecology Resources Primer Development Consortium, Anderson
C.M., Aparicio G.J., Atangana A.R., Beaulieu J., Bruford M.W., et al. (2010).
Permanent genetic resources added to Molecular Ecology Resources Database
![Page 167: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/167.jpg)
151
1 December 2009–31 January 2010. Molecular Ecology Resources, 10, 576-
579.
37. Ward R., Bowers K., Hensley R., Mobley B. & Belousi E. (2007). Genetic
variability in Spotted Seatrout (Cynoscion nebulosus), determined with
microsatellite DNA markers. Fish. Bull., 105, 197-206.
38. Wiley B.A. & Chapman R.W. (2003). Population structure of Spotted Seatrout,
Cynoscion nebulosus, along the Atlantic coast of the U.S. In: Biology of the
Spotted Seatrout (ed. Bortone SA). CRC Press Boca Raton, FL.
39. Molecular Ecology Resources Primer Development Consortium, Almany G.R.,
Arruda M.P.D., Arthofer W., Atallah Z.K., Beissinger S.R., et al. (2009).
Permanent genetic resources added to Molecular Ecology Resources Database
1 May 2009–31 July 2009. Molecular Ecology Resources, 9, 1460-1466.
40. Landi M., Garoia F., Piccinetti C. & Tinti F. (2005). Isolation of polymorphic
microsatellite loci from the European Anchovy, Engraulis encrasicolus. Mol.
Ecol. Notes, 5, 266-268. doi:10.1111/j.1471-8286.2005.00892.x
41. Pakaki V., Magoulas A. & Kasapidis P. (2009). New polymorphic
microsatellite loci for population studies in the European Anchovy, Engraulis
encrasicolus (L.). Molecular Ecology Resources, 9, 1406-1409.
doi:10.1111/j.1755-0998.2009.02678.x
42. Yu H.-T., Lee Y.-J., Huang S.-W. & Chiu T.-S. (2002). Genetic analysis of the
populations of Japanese Anchovy (Engraulidae: Engraulis japonicus) using
microsatellite DNA. Mar. Biotechnol., 4, 471-479. doi:10.1007/s10126-002-
0035-8
43. Zarraonaindia I., Pardo M.A., Iriondo M., Manzano C. & Estonba A. (2009).
Microsatellite variability in European Anchovy (Engraulis encrasicolus) calls
for further investigation of its genetic structure and biogeography. ICES J.
Mar. Sci., 66, 2176-2182.
44. Canino M.F., Spies I.B. & Hauser L. (2005). Development and
characterization of novel di- and tetranucleotide microsatellite markers in
![Page 168: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/168.jpg)
152
Pacific Cod (Gadus macrocephalus). Mol. Ecol. Notes, 5, 908-910.
doi:10.1111/j.1471-8286.2005.01109.x
45. Cunningham K.M. (2007). Population genetics of Pacific Cod (Gadus
macrocephalus): evidence for large and small scale population structure.
Master of Science. University of Washington, Seattle.
46. Kim M.-J., An H.S. & Choi K.-H. (2010). Genetic characteristics of Pacific
Cod populations in Korea based on microsatellite markers. Fish. Sci., 76, 595-
603. doi:10.1007/s12562-010-0249-z
47. Zhang D.-X., Smith J.A., Rico C. & Hewitt G.M. (2001). Isolation and
characterization of 10 microsatellite loci in Poor Cod Trisopterus minutus (L).
Mol. Ecol. Notes, 1, 50-52.
48. Beacham T.D., Brattey J., Miller K.M., Le K.D. & Withler R.E. (2002).
Multiple stock structure of Atlantic Cod (Gadus morhua) off Newfoundland
and Labrador determined from genetic variation. ICES J. Mar. Sci., 59, 650-
665. doi:10.1006/jmsc.2002.1253
49. Bentzen P., Taggart C.T., Ruzzante D.E. & Cook D. (1996). Microsatellite
polymorphism and the population structure of Atlantic Cod (Gadus morhua) in
the northwest Atlantic. Can. J. Fish. Aquat. Sci., 53, 2706-2721.
50. Bradbury I.R., Snelgrove P.V.R., Bentzen P., de Young B., Gregory R.S. &
Morris C.J. (2009). Structural and functional connectivity of marine fishes
within a semi-enclosed Newfoundland fjord. J. Fish Biol., 75, 1393-1409.
doi:10.1111/j.1095-8649.2009.02391.x
51. Brooker A.L., Cook D., Bentzen P., Wright J.M. & Doyle R.W. (1994).
Organization of microsatellites differs between mammals and cold-water
teleost fishes. Can. J. Fish. Aquat. Sci., 51, 1959-1966.
52. Hutchinson W.F., Carvalho G.R. & Rogers S.I. (2001). Marked genetic
structuring in localised spawning populations of Cod Gadus morhua in the
North Sea and adjoining waters, as revealed by microsatellites. Mar. Ecol.
Prog. Ser., 223, 251-260.
![Page 169: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/169.jpg)
153
53. Hutchinson W.F., van Oosterhout C., Rogers S.I. & Carvalho G.R. (2003).
Temporal analysis of archived samples indicates marked genetic changes in
declining North Sea Cod (Gadus morhua). Proceedings of the Royal Society B:
Biological Sciences, 270, 2125-2132. doi:10.1098/rspb.2003.2493
54. Miller K.M., Le K.D. & Beacham T.D. (2000). Development of tri- and
tetranucleotide repeat microsatellite loci in Atlantic Cod. Molcular Ecology, 9,
238-239.
55. Ruzzante D.E., Taggart C.T., Cook D. & Goddard S.V. (1996). Genetic
differentiation between inshore and offshore Atlantic Cod (Gadus morhua) off
Newfoundland: microsatellite DNA variation and antifreeze level. Can. J.
Fish. Aquat. Sci., 53, 634-645.
56. Ruzzante D.E., Taggart C.T. & Cook D. (1996). Spatial and temporal variation
in the genetic composition of a larval Cod (Gadus morhua) aggregation: cohort
contribution and genetic stability. Can. J. Fish. Aquat. Sci., 53, 2695-2705.
57. Ruzzante D.E., Taggart C.T., Cook D. & Goddard S.V. (1997). Genetic
differentiation between inshore and offshore Atlantic Cod (Gadus morhua) off
Newfoundland: a test and evidence of temporal stability. Can. J. Fish. Aquat.
Sci., 54, 2700-2708.
58. Ruzzante D.E., Taggart C.T. & Cook D. (1998). A nuclear DNA basis for
shelf- and bank-scale population structure in northwest Atlantic Cod (Gadus
morhua): Labrador to Georges Bank. Mol. Ecol., 7, 1663-1680.
59. Ruzzante D.E., Taggart C.T., Lang S. & Cook D. (2000). Mixed-stock analysis
of Atlantic Cod near the Gulf of St. Lawrence based on microsatellite DNA.
Ecol. Appl., 10, 1090-1109.
60. Ruzzante D.E., Wroblewski J.S., Taggart C.T., Smedbol R.K., Cook D. &
Goddard S.V. (2000). Bay-scale population structure in coastal Atlantic Cod in
Labrador and Newfoundland, Canada. J. Fish Biol., 56, 431-447.
doi:10.1006/jfbi.1999.1168
61. Bouza C., Presa P., Castro J., Sánchez L. & Martínez P. (2002). Allozyme and
microsatellite diversity in natural and domestic populations of Turbot
![Page 170: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/170.jpg)
154
(Scophthalmus maximus) in comparison with other Pleuronectiformes. Can. J.
Fish. Aquat. Sci., 59, 1460-1473. doi:10.1139/F02-114
62. Coughlan J.P., Imsland A.K., Galvin P.T., Fitzgerald R.D., Naevdal G. &
Cross T.F. (1998). Microsatellite DNA variation in wild populations and
farmed strains of Turbot from Ireland and Norway: a preliminary study. J. Fish
Biol., 52, 916-922.
63. Coughlan J.P., McCarthy E., McGregor D., O'Donoghue P., Galvin P.T.,
Fitzgerald R.D., et al. (1996). Four polymorphic microsatellites in Turbot
Scophthalmus maximus. Anim. Genet., 27, 433-442.
64. Danancher D. & Garcia-Vazquez E. (2009). Population differentiation in
Megrim (Lepidorhombus whiffiagonis) and Four Spotted Megrim
(Lepidorhombus boscii) across Atlantic and Mediterranean waters and
implications for wild stock management. Mar. Biol., 156, 1869-1880.
doi:10.1007/s00227-009-1219-9
65. Florin A.-B. & Höglund J. (2007). Absence of population structure of Turbot
(Psetta maxima) in the Baltic Sea. Mol. Ecol., 16, 115-126.
doi:10.1111/j.1365-294X.2006.03120.x
66. Iyengar A., Piyapattanakorn S., Heipel D.A., Stone D.M., Howell B.R., Child
A.R., et al. (2000). A suite of highly polymorphic microsatellite markers in
Turbot (Scophthalmus maximus L.) with potential for use across several
flatfish species. Mol. Ecol., 9, 365-378.
67. Liu Y.G., Liu L.X., Li Z.X., Gao A.Y., Lin H., Li B.F., et al. (2007).
Development of polymorphic microsatellite from RAPD bands of Black Sea
Bream Acanthopagrus schlegeli. Mol. Ecol. Notes, 7, 1178-1180.
doi:10.1111/j.1471-8286.2007.01823.x
68. Nielsen E.E., Nielsen P.H., Meldrup D. & Hansen M.M. (2004). Genetic
population structure of Turbot (Scophthalmus maximus L.) supports the
presence of multiple hybrid zones for marine fishes in the transition zone
between the Baltic Sea and the North Sea. Mol. Ecol., 13, 585 - 595.
doi:10.1046/j.1365-294X.2004.02097.x
![Page 171: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/171.jpg)
155
69. Pardo G.B., Casas L., Fortes G.G., Bouza C., Martínez P., Clark M.S., et al.
(2005). New microsatellite markers in Turbot (Scophthalmus maximus) derived
from an enriched genomic library and sequence databases. Mol. Ecol. Notes, 5,
62-64. doi:10.1111/j.1471-8286.2004.00834.x
70. Karlsson S., Saillant E. & Gold J.R. (2009). Population structure and genetic
variation of Lane Snapper (Lutjanus synagris) in the northern Gulf of Mexico.
Mar. Biol., 156, 1841-1855. doi:10.1007/s00227-009-1217-y
71. Ovenden J.R. & Street R. (2003). Genetic population structure of Mangrove
Jack, Lutjanus argentimaculatus (Forsskål). Marine And Freshwater Research,
54, 127-137.
72. Renshaw M.A., Karlsson S. & Gold J.R. (2007). Isolation and characterization
of microsatellites in Lane Snapper (Lutjanus synagris), Mutton Snapper
(Lutjanus analis), and Yellowtail Snapper (Ocyurus chrysurus). Mol. Ecol.
Notes, 7, 1084-1087. doi:10.1111/j.1471-8286.2007.01785.x
73. Shulzitski K. (2005). A genetic assessment of population connectivity in
Mutton Snapper, Lutjanus analis. Master of Science. University of North
Carolina, Wilmington.
74. Shulzitski K., McCartney M.A. & Burton M.L. (2009). Population
connectivity among Dry Tortugas, Florida, and Caribbean populations of
Mutton Snapper (Lutjanus analis), inferred from multiple microsatellite loci.
Fish. Bull., 107, 501-509.
75. Zhang J., Cai Z. & Huang H. (2006). Isolation and characterization of
microsatellite loci from Mangrove Red Snapper Lutjanus argentimaculatus.
Mol. Ecol. Notes, 6, 408-411. doi:10.1111/j.1471-8286.2006.01251.x
76. Gold J.R., Pak E. & Richardson L.R. (2001). Microsatellite variation among
Red Snapper (Lutjanus campechanus) from the Gulf of Mexico. Mar.
Biotechnol., 3, 293-304. doi:10.1007/s10126-001-0004-7
77. Saillant E. & Gold J.R. (2006). Population structure and variance effective size
of Red Snapper (Lutjanus campechanus) in the northern Gulf of Mexico. Fish.
Bull., 104, 136-148.
![Page 172: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/172.jpg)
156
78. Saillant E., Bradfield S.C. & Gold J.R. (2006). Genetic impacts of shrimp
trawling on Red Snapper (Lutjanus campechanus) in the northern Gulf of
Mexico. ICES J. Mar. Sci., 63, 705-713. doi:10.1016/j.icesjms.2005.12.005
79. Bradbury I.R., Coulson M.W., Campana S.E. & Bentzen P. (2006).
Morphological and genetic differentiation in anadromous Smelt Osmerus
mordax (Mitchill): disentangling the effects of geography and morphology on
gene flow. J. Fish Biol., 69, 95-114. doi:10.1111/j.1095-8649.2006.01263.x
80. Bradbury I.R., Campana S.E. & Bentzen P. (2008). Low genetic connectivity
in an estuarine fish with pelagic larvae. Can. J. Fish. Aquat. Sci., 65, 147-158.
doi:10.1139/F07-154
81. Coulson M.W., Paterson I.G., Green A., Kepkay R. & Bentzen P. (2006).
Characterization of di- and tetranucleotide microsatellite markers in Rainbow
Smelt (Osmerus mordax). Mol. Ecol. Notes, 6, 942- 944. doi:10.1111/j.1471-
8286.2006.01409.x
82. Gordos K., Kenchington E., Hamilton L.C., Nakashima B.S. & Taggart C.T.
(2005). Atlantic Capelin (Mallotus villosus) tetranucleotide microsatellites.
Mol. Ecol. Notes, 5, 220-222. doi:10.1111/j.1471-8286.2005.00882.x
83. McLean J.E. & Taylor E.B. (2001). Resolution of population structure in a
species with high gene flow: microsatellite variation in the Eulachon
(Osmeridae: Thaleichthys pacificus). Mar. Biol., 139, 411-420.
doi:10.1007/s002270100483
84. Præbel K., Westgaard J.I., Fevolden S.-E. & Christiansen J.S. (2008).
Circumpolar genetic population structure of Capelin Mallotus villosus. Mar.
Ecol. Prog. Ser., 360, 189-199. doi:10.3354/meps07363
85. Røed K.H., Fevolden S.-E., Christiansen J.S. & Midthjell L. (2003). Isolation
and characterization of DNA microsatellites for Capelin Mallotus villosus
population genetic studies. Mar. Ecol. Prog. Ser., 262, 299-303.
86. Lage C.R. & Kornfield I. (1999). Isolation and characterization of
microsatellite loci in Atlantic Haddock (Melanogrammus aeglefinus). Mol.
Ecol., 8, 1355-1357.
![Page 173: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/173.jpg)
157
87. Lage C.R., Purcell M., Fogarty M. & Kornfield I. (2001). Microsatellite
evaluation of Haddock (Melanogrammus aeglefinus) stocks in the northwest
Atlantic Ocean. Can. J. Fish. Aquat. Sci., 58, 982-990. doi:10.1139/cjfas-58-5-
982
88. O'Reilly P.T., Mcpherson A.A., Kenchington E., Taggart C.T., Jones M.W. &
Bentzen P. (2002). Isolation and characterization of tetranucleotide
microsatellites from Atlantic Haddock (Melanogrammus aeglefinus). Mar.
Biotechnol., 4, 418-422. doi:10.1007/s10126-002-0010-4
89. Charrier G., Coombs S.H., McQuinn I.H. & Laroche J. (2007). Genetic
structure of Whiting Merlangius merlangus in the northeast Atlantic and
adjacent waters. Mar. Ecol. Prog. Ser., 330, 201-211.
90. Rico C., Ibrahim K.M., Rico I. & Hewitt G.M. (1997). Stock composition in
North Atlantic populations of Whiting using microsatellite markers. J. Fish
Biol., 51, 462-475.
91. Castillo A.G.F., Martínez J.L. & García-Vázquez E. (2003). Identification and
Atlantic hake species by a simple PCR-based methodology employing
microsatellite loci. J. Food Prot., 66, 2130-2134.
92. Castillo A.G.F., Alvarez P. & Garcia-Vazquez E. (2005). Population structure
of Merluccius merluccius along the Iberian Peninsula coast. ICES J. Mar. Sci.,
62, 1699-1704. doi:10.1016/j.icesjms.2005.06.001
93. Lundy C.J., Moran P., Rico C., Milner R.S. & Hewitt G.M. (1999).
Macrogeographical population differentiation in oceanic environments: a case
study of European Hake (Merluccius merluccius), a commercially important
fish. Mol. Ecol., 8, 1889 -1898.
94. Lundy C.J., Rico C. & Hewitt G.M. (2000). Temporal and spatial genetic
variation in spawning grounds of European Hake (Merluccius merluccius) in
the Bay of Biscay. Mol. Ecol., 9, 2067 - 2079.
95. Machado-Schiaffino G. & Garcia-Vazquez E. (2009). Isolation and
characterization of microsatellite loci in Merluccius australis and cross-species
![Page 174: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/174.jpg)
158
amplification. Molecular Ecology Resources, 9, 585-587. doi:10.1111/j.1755-
0998.2008.02442.x
96. Moran P., Ryan A.W., Rico C. & Hewitt G.M. (1999). Four microsatellite loci
in the gadoid fish, Blue Whiting Micromesistius poutassou (Riso 1826). Anim.
Genet., 30, 463-464.
97. Ryan A.W., Mattiangeli V. & Mork J. (2005). Genetic differentiation of Blue
Whiting (Micromesistius poutassou Risso) populations at the extremes of the
species range and at the Hebrides-Porcupine Bank spawning grounds. ICES J.
Mar. Sci., 62, 948-955. doi:10.1016/j.icesjms.2005.03.006
98. Was A., Gosling E., McCrann K. & Mork J. (2008). Evidence for population
structuring of Blue Whiting (Micromesistius poutassou) in the Northeast
Atlantic. ICES J. Mar. Sci., 65, 216-225.
99. Chapman R.W., Sedberry G.R., Koenig C.C. & Eleby B.M. (1999). Stock
identification of Gag, Mycteroperca microlepis, along the southeast coast of
the United States. Mar. Biotechnol., 1, 137-146.
100. Cushman E.L., Jue N.K., Strand A.E. & Sotka E.E. (2009). Evaluating the
demographic significance of genetic homogeneity using a coalescent-based
simulation: a case study with Gag (Mycteroperca microlepis). Can. J. Fish.
Aquat. Sci., 66, 1821-1830. doi:10.1139/F09-140
101. Jue N.K. (2010). The role of larval dispersal in the population genetics and
ecology of Gag, Mycteroperca microlepis, in the Gulf of Mexico. Doctor of
Philosophy. Florida State University.
102. Zatcoff M.S., Ball A.O. & Chapman R.W. (2002). Characterization of
polymorphic microsatellite loci from Black Grouper, Mycteroperca bonaci
(Teleostei: Serranidae). Mol. Ecol. Notes, 2, 217-219.
103. Zatcoff M.S., Ball A.O. & Sedberry G.R. (2004). Population genetic analysis
of Red Grouper, Epinephelus morio, and Scamp, Mycteroperca phenax, from
the southeastern U.S. Atlantic and Gulf of Mexico. Mar. Biol., 144, 769-777.
doi:10.1007/s00227-003-1236-z
![Page 175: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/175.jpg)
159
104. Alarcón J.A., Magoulas A., Georgakopoulos T., Zouros E. & Alvarez M.C.
(2004). Genetic comparison of wild and cultivated European populations of the
Gilthead Sea Bream (Sparus aurata). Aquaculture, 230, 65-80.
105. An H.S., Hong S.W., Lee J.U., Park J.Y. & Kim K.-K. (2010). Genetic
diversity of wild and farmed Black Sea Bream populations in Jeju. Animal
Cells and Systems, 14, 37-44. doi:10.1080/19768351003765020
106. Bernal-Ramírez J.H., Adcock G.J., Hauser L., Carvalho G.R. & Smith P.J.
(2003). Temporal stability of genetic population structure in the New Zealand
Snapper, Pagrus auratus, and relationship to coastal currents. Mar. Biol., 142,
567-574. doi:10.1007/s00227-002-0972-9
107. Brown R.C., Tsalavouta M., Terzoglou V., Magoulas A. & Mcandrew B.J.
(2005). Additional microsatellites for Sparus aurata and cross-species
amplification within the Sparidae family. Mol. Ecol. Notes, 5, 605-607.
doi:10.1111/j.1471-8286.2005.01007.x
108. de Innocentiis S., Lesti A., Livi S., Rossi A.R., Crosetti D. & Sola L. (2004).
Microsatellite markers reveal population structure in Gilthead Sea Bream
Sparus auratus from the Atlantic Ocean and Mediterranean Sea. Fish. Sci., 70,
852-859.
109. Hauser L., Adcock G.J., Smith P.J., Ramírez J.H.B. & Carvalho G.R. (2002).
Loss of microsatellite diversity and low effective population size in an
overexploited population of New Zealand Snapper (Pagrus auratus). P Natl
Acad Sci USA, 99, 11742-11747.
110. Jeong D.-S., Umino T., Kuroda K., Hayashi M., Nakagawa H., Kang J.-C., et
al. (2003). Genetic divergence and population structure of Black Sea Bream
Acanthopagrus schlegeli inferred from microsatellite analysis. Fish. Sci., 69,
896-902.
111. Karaiskou N., Triantafyllidis A., Katsares V., Abatzopoulos T.J. &
Triantaphyllidis C. (2009). Microsatellite variability of wild and farmed
populations of Sparus aurata. J. Fish Biol., 74, 1816-1825.
doi:10.1111/j.1095-8649.2009.02186.x
![Page 176: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/176.jpg)
160
112. Molecular Ecology Resources Primer Development Consortium, An J., Bechet
A., Berggren Å., Brown S.K., Bruford M.W., et al. (2010). Permanent genetic
resources added to Molecular Ecology Resources Database 1 October 2009 –
30 November 2009. Molecular Ecology Resources, 10, 404-408.
doi:10.1111/j.1755-0998.2009.02827.x
113. Palma J., Alarcón J.A., Alvarez C., Zouros E., Magoulas A. & Andrade J.P.
(2001). Developmental stability and genetic heterozygosity in wild and
cultured stocks of Gilthead Sea Bream (Sparus aurata). J. Mar. Biol. Assoc.
U.K., 81, 283-288.
114. Piñera J.A., Bernardo D., Blanco G., Vázquez E. & Sánchez J.A. (2007).
Usefulness of microsatellite markers developed from Pagellus bogaraveo to
genetically study five different species of Sparidae. Mar. Ecol., 28, 184-187.
115. Ramšak A., Garoia F., Guarniero I., Mannini P. & Tinti F. (2003). Novel
polymorphic microsatellite markers for the Common Pandora (Pagellus
erythrinus). Mol. Ecol. Notes, 3, 553 - 555. doi:10.1046/j.1471-
8286.2003.00509.x
116. Sala-Bozano M., Ketmaier V. & Mariani S. (2009). Contrasting signals from
multiple markers illuminate population connectivity in a marine fish. Mol.
Ecol., 18, 4811-4826. doi:10.1111/j.1365-294X.2009.04404.x
117. Sala-Bozano M., Tsalavouta M. & Mariani S. (2009). Isolation and
characterisation of new polymorphic microsatellite markers for the Striped Sea
Bream (Lithognathus mormyrus). Conserv. Genet., 10, 1507-1509.
doi:10.1007/s10592-008-9770-3
118. Ball A.O., Beal M.G., Chapman R.W. & Sedberry G.R. (2007). Population
structure of Red Porgy, Pagrus pagrus, in the Atlantic Ocean. Mar. Biol., 150,
1321-1332. doi:10.1007/s00227-006-0425-y
119. Hemmer-Hansen J., Nielsen E.E., Grønkjær P. & Loeschcke V. (2007).
Evolutionary mechanisms shaping the genetic population structure of marine
fishes; lessons from the European Flounder (Platichthys flesus L.). Mol. Ecol.,
16, 3104- 3118. doi:10.1111/j.1365-294X.2007.03367.x
![Page 177: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/177.jpg)
161
120. Kim S.G., Morishima K. & Arai K. (2007). Isolation and characterization of
polymorphic microsatellite DNA markers in the Brown Sole, Pleuronectes
herzensteini. Mol. Ecol. Notes, 7, 79- 81. doi:10.1111/j.1471-
8286.2006.01535.x
121. Miao G., Shao C., Ma H., Liao X. & Chen S. (2009). Isolation and
characterization of polymorphic microsatellite loci from a dinucleotide-
enriched genomic library of Starry Flounder (Platichthys stellatus) and cross-
species amplification. Conserv. Genet., 10, 631-633. doi:10.1007/s10592-008-
9594-1
122. Tysklind N., Neuparth T., Ashcroft G.R., Taylor M.I., Lyonds B.P., McCarthy
I.D., et al. (2009). Isolation and characterization of 28 new microsatellite
markers for European Flounder (Platichthys flesus L.). Mol. Ecol., 9, 1065-
1068. doi:10.1111/j.1755-0998.2009.02552.x
123. Hoarau G., Cook D., Stam W.T. & Olsen J.L. (2002). New microsatellites
primers for Plaice, Pleuronectes platessa L. (Teleostei: Pleuronectidae). Mol.
Ecol. Notes, 2, 60-61.
124. Hoarau G., Rijnsdorp A.D., Van Der Veer H.W., Stam W.T. & Olsen J.L.
(2002). Population structure of Plaice (Pleuronectes platessa L.) in northern
Europe: microsatellites revealed large-scale spatial and temporal homogeneity.
Mol. Ecol., 11, 1165 -1176.
125. Was A., Gosling E. & Hoarau G. (2010). Microsatellite analysis of Plaice
(Pleuronectes platessa L.) in the NE Atlantic: weak genetic structuring in a
milieu of high gene flow. Mar. Biol., 157, 447-462. doi:10.1007/s00227-009-
1331-x
126. Watts P.C., Nash R.D.M., George S.G. & Kemp S.J. (1999). Isolation and
characterization of microsatellite loci in the European Plaice, Pleuronectes
platessa L. (Teleostei: Pleuronectidae). Mol. Ecol., 8, 2151-2152.
127. Watts P.C., Nash R.D.M. & Kemp S.J. (2001). Polymorphic microsatellite loci
in the European Plaice, Pleuronectes platessa, and their utility in Flounder,
Lemon Sole and Dover Sole. J. Mar. Biol. Assoc. U.K., 81, 367-368.
![Page 178: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/178.jpg)
162
128. Watts P.C., Nash R.D.M. & Kemp S.J. (2004). Genetic structure of juvenile
Plaice Pleuronectes platessa on nursery grounds within the Irish Sea. J. Sea
Res., 51, 191 - 197. doi:10.1016/j.seares.2003.09.003
129. Watts P.C., Kay S.M., Wolfenden D., Fox C.J., Geffen A.J., Kemp S.J., et al.
(2010). Temporal patterns of spatial genetic structure and effective population
size in European Plaice (Pleuronectes platessa) along the west coast of
Scotland and in the Irish Sea. ICES J. Mar. Sci., 67, 607-616.
130. Buckley L., Collie J., Kaplan L.A.E. & Crivello J.F. (2008). Winter Flounder
larval genetic population structure in Narragansett Bay, RI: recruitment to
juvenile young-of-the-year. Estuaries and Coasts, 31, 745-754.
doi:10.1007/s12237-008-9065-4
131. Crivello J.F., Danila D.J., Lorda E., Keser M. & Roseman E.F. (2004). The
genetic stock structure of larval and juvenile Winter Flounder larvae in
Connecticut waters of eastern Long Island Sound and estimations of larval
entrainment. J. Fish Biol., 65, 62-76. doi:10.1111/j.1095-8649.2004.00424.x
132. McClelland G., Melendy J., Osborne J., Reid D. & Douglas S. (2005). Use of
parasite and genetic markers in delineating populations of Winter Flounder
from the central and south-west Scotian Shelf and north-east Gulf of Maine. J.
Fish Biol., 66, 1082-1100. doi:10.1111/j.1095-8649.2005.00659.x
133. Pereyra R.T., Saillant E., Pruett C.L., Rexroad III C.E., Rocha-Olivares A. &
Gold J.R. (2004). Characterization of polymorphic microsatellites in the
Pacific Sardine Sardinops sagax sagax (Clupeidae). Mol. Ecol. Notes, 4, 739-
741. doi:10.1111/j.1471-8286.2004.00801.x
134. Appleyard S.A., Grewe P.M., Innes B.H. & Ward R.D. (2001). Population
structure of Yellowfin Tuna (Thunnus albacares) in the western Pacific Ocean,
inferred from microsatellite loci. Mar. Biol., 139, 383-393.
doi:10.1007/s002270100578
135. Appleyard S.A., Ward R.D. & Grewe P.M. (2002). Genetic stock structure of
Bigeye Tuna in the Indian Ocean using mitochondrial DNA and
microsatellites. J. Fish Biol., 60, 767-770. doi:10.1006/jfbi.2002.1866
![Page 179: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/179.jpg)
163
136. Broughton R.E., Stewart L.B. & Gold J.R. (2002). Microsatellite variation
suggests substantial gene flow between King Mackerel (Scomberomorus
cavalla) in the western Atlantic Ocean and Gulf of Mexico. Fisheries
Research, 54, 305-316.
137. Catanese G., Infante C., Crespo A., Zuasti E., Ponce M., Funes V., et al.
(2007). Development and characterization of eight microsatellite markers in
Bullet Tuna (Auxis rochei). Mol. Ecol. Notes, 7, 842-844. doi:10.1111/j.1471-
8286.2007.01723.x
138. Cha H.K., An H.S., Choi J.H., Kang S., Park J.Y. & Kim K.K. (2010).
Isolation and characterization of polymorphic microsatellite markers for
genetic analysis of Chub Mackerel (Scomber japonicus). Conservation
Genetics Resources, 2, 7-9. doi:10.1007/s12686-009-9123-7
139. Clark T.B., Ma L., Saillant E. & Gold J.R. (2004). Microsatellite DNA
markers for population-genetic studies of Atlantic Bluefin Tuna (Thunnus
thynnus thynnus) and other species of genus Thunnus. Mol. Ecol. Notes, 4, 70-
73. doi:10.1046/j.1471-8286.2003.00572.x
140. Dammannagoda S.T. (2007). Genetic stock structure and inferred migratory
patterns of Skipjack Tuna (Katsuwonus pelamis) and Yellowfin Tuna
(Thunnus albacares) in Sri Lankan waters. Doctor of Philosophy. Queensland
University of Technology, Brisbane.
141. Dammannagoda S.T., Hurwood D.A. & Mather P.B. (2008). Evidence for fine
geographical scale heterogeneity in gene frequencies in Yellowfin Tuna
(Thunnus albacares) from the north Indian Ocean around Sri Lanka. Fisheries
Research, 90, 147-157. doi:10.1016/j.fishres.2007.10.006
142. Díaz-Jaimes P. & Uribe-Alcocer M. (2006). Spatial differentiation in the
eastern Pacific Yellowfin Tuna revealed by microsatellite variation. Fish. Sci.,
72, 590-596.
143. Durand J.-D., Collet A., Chow S.L., Guinand B. & Borsa P. (2005). Nuclear
and mitochondrial DNA markers indicate unidirectional gene flow of Indo-
Pacific to Atlantic Bigeye Tuna (Thunnus obesus) populations, and their
![Page 180: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/180.jpg)
164
admixture off southern Africa. Mar. Biol., 147, 313-322. doi:10.1007/s00227-
005-1564-2
144. Farnham T.T. (2003). Genetic variation in Atlantic Yellowfin Tuna (Thunnus
albacares) to assess stock structure and reproductive variance. Master of
Science. Texas A&M University.
145. Gold J.R., Pak E. & DeVries D.A. (2002). Population structure of King
Mackerel (Scomberomorus cavalla) around peninsular Florida, as revealed by
microsatellite DNA. Fish. Bull., 100, 491-509.
146. Gold J.R., Jobity A.M.C., Saillant E. & Renshaw M.A. (2010). Population
structure of Carite (Scomberomorus brasiliensis) in waters offshore of Trinidad
and northern Venezuela. Fisheries Research, 103, 30-39.
doi:10.1016/j.fishres.2010.01.009
147. Gonzalez E.G., Beerli P. & Zardoya R. (2008). Genetic structuring and
migration patterns of Atlantic Bigeye Tuna, Thunnus obesus (Lowe, 1839).
BMC Evol. Biol., 8, 1-14. doi:10.1186/1471-2148-8-252
148. Menezes M.R., Noguchi D., Nakajima M. & Taniguchi N.K. (2008).
Microsatellite development and survey of genetic variation in Skipjack Tuna
Katsuwonus pelamis. J. Fish Biol., 73, 463-473. doi:10.1111/j.1095-
8649.2008.01912.x
149. Morishima K., Yamamoto H., Sawada Y., Miyashita S. & Kato K. (2009).
Developing 23 new polymorphic microsatellite markers and simulating
parentage assignment in the Pacific Bluefin Tuna, Thunnus orientalis.
Molecular Ecology Resources, 9, 790-792.
150. Renshaw M.A., Douglas K.C., Rexroad III C.E., Jobity A.M.C. & Gold J.R.
(2009). Isolation and characterization of microsatellite markers in the Serra
Spanish Mackerel, Scomberomorus brasiliensis. Molecular Ecology
Resources, 9, 835-838. doi:10.1111/j.1755-0998.2008.02284.x
151. Saxton B.L. (2009). Historical demography and genetic population structure of
the Blackfin Tuna (Thunnus atlanticus) from the northwest Atlantic Ocean and
the Gulf of Mexico. Master of Science. Texas A&M University.
![Page 181: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/181.jpg)
165
152. Takagi M., Okamura T., Chow S.L. & Taniguchi N.K. (2001). Preliminary
study of Albacore (Thunnus alalunga) stock differentiation inferred from
microsatellite DNA analysis. Fish. Bull., 99, 697-701.
153. Takagi M., Okamura T., Chow S.L. & Taniguchi N.K. (1999). PCR primers
for microsatellite loci in tuna species of the genus Thunnus and its application
for population genetic study. Fish. Sci., 65, 571-576.
154. Tang C.Y., Tzeng C.-H., Chen C.S. & Chiu T.S. (2009). Microsatellite DNA
markers for population-genetic studies of Blue Mackerel (Scomber
australasicus) and cross-specific amplification in S. japonicus. Molecular
Ecology Resources, 9, 824-827. doi:10.1111/j.1755-0998.2008.02276.x
155. Tzeng C.-H., Chen C.-S., Tang P.-C. & Chiu T.-S. (2009). Microsatellite and
mitochondrial haplotype differentiation in Blue Mackerel (Scomber
australasicus) from the western North Pacific. ICES J. Mar. Sci., 66, 816-825.
156. van Herwerden L., McIlwain J., Al-Oufi H., Al-Amry W. & Reyes A. (2006).
Development and application of microsatellite markers for Scomberomorus
commerson (Perciformes; Teleostei) to a population genetic study of Arabian
Peninsula stocks. Fisheries Research, 79, 258-266.
doi:10.1016/j.fishres.2006.04.004
157. Xing S.-C., Xu G.-B., Liao X.-L., Yang G.-P. & Chen S.-L. (2009). Twelve
polymorphic microsatellite loci from a dinucleotide-enriched genomic library
of Japanese Spanish Mackerel (Scomberomorus niphonius). Conserv. Genet.,
10, 1167-1169. doi:10.1007/s10592-008-9735-6
158. Yagishita N. & Kobayashi T. (2008). Isolation and characterization of nine
microsatellite loci from the Chub Mackerel, Scomber japonicus (Perciformes,
Scombridae). Molecular Ecology Resources, 8, 302-304. doi:10.1111/j.1471-
8286.2007.01935.x
159. Yokoyama E., Sakamoto T., Sugaya T. & Kitada S. (2006). Six polymorphic
microsatellite loci in the Japanese Spanish Mackerel, Scomberomorus
niphonius. Mol. Ecol. Notes, 6, 323-324. doi:10.1111/j.1471-
8286.2005.01217.x
![Page 182: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/182.jpg)
166
160. Gharrett A.J. (2004). Distribution of two species of Rougheye Rockfish
(Sebastes aleutianus) in the northeastern Gulf of Alaska. North Pacific
Research Board, Anchorage, AK.
161. Miller K.M., Schulze A.D. & Withler R.E. (2000). Characterization of
microsatellite loci in Sebastes alutus and their conservation in congeneric
rockfish species. Mol. Ecol., 9, 237-244.
162. Miller J.A., Banks M.A., Gomez-Uchida D. & Shanks A.L. (2005). A
comparison of population structure in Black Rockfish (Sebastes melanops) as
determined with otolith microchemistry and microsatellite DNA. Can. J. Fish.
Aquat. Sci., 62, 2189-2198. doi:10.1139/F05-133
163. Narum S.R., Buonaccorsi V.P., Kimbrell C.A. & Vetter R.D. (2004). Genetic
divergence between Gopher Rockfish (Sebastes carnatus) and Black and
Yellow Rockfish (Sebastes chrysomelas). Copeia, 2004, 926-931.
164. Pearse D.E., Wooninck L., Dean C.A. & Garza J.C. (2007). Identification of
northeastern Pacific rockfish using multilocus nuclear DNA genotypes. Trans.
Am. Fish. Soc., 136, 272-280. doi:10.1577/T06-051.1
165. Seeb L.W. (2007). Genetic markers distinguish populations of Black Rockfish
in the Gulf of Alaska. In: Conservation of North Pacific rockfishes: Ecological
genetics and stock structure. Proceedings of the workshop March 2-3, 2004,
Seattle, Washington (eds. Berntson EA, Levin PS & Moran PC). U.S. Dept.
Commer., NOAA Tech. Memo. NMFS-NWFSC-80 Seattle, WA, pp. 57-60.
166. Sivasundar A. & Palumbi S.R. (2010). Life history, ecology and the
biogeography of strong genetic breaks among 15 species of Pacific rockfish,
Sebastes. Mar. Biol., 157, 1433-1452. doi:10.1007/s00227-010-1419-3
167. Westerman M.E., Buonaccorsi V.P., Stannard J.A., Galver L., Taylor C., Lynn
E.A., et al. (2005). Cloning and characterization of novel microsatellite DNA
markers for the Grass Rockfish, Sebastes rastrelliger, and cross-species
amplification in 10 related Sebastes spp. Mol. Ecol. Notes, 5, 74-76.
doi:10.1111/j.1471-8286.2004.00837.x
![Page 183: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/183.jpg)
167
168. Withler R.E., Beacham T.D., Schulze A.D., Richards L.J. & Miller K.M.
(2001). Co-existing populations of Pacific Ocean Perch, Sebastes alutus, in
Queen Charlotte Sound, British Columbia. Mar. Biol., 139, 1-12.
doi:10.1007/s002270100560
169. Gomez-Uchida D. & Banks M.A. (2005). Microsatellite analyses of spatial
genetic structure in Darkblotched Rockfish (Sebastes crameri): is pooling
samples safe? Can. J. Fish. Aquat. Sci., 62, 1874-1886. doi:10.1139/F05-084
170. Pampoulie C. & Daníelsdóttir A.K. (2008). Resolving species identification
problems in the genus Sebastes using nuclear genetic markers. Fisheries
Research, 93, 54-63. doi:10.1016/j.fishres.2008.02.007
171. Roques S., Pallotta D., Sévigny J.-M. & Bernatchez L. (1999). Isolation and
characterization of polymorphic microsatellite markers in the North Atlantic
redfish (Teleostei: Scorpaenidae, genus Sebastes). Mol. Ecol., 8, 655-702.
172. Roques S., Duchesne P. & Bernatchez L. (1999). Potential of microsatellites
for individual assignment: the North Atlantic redfish (genus Sebastes) species
complex as a case study. Mol. Ecol., 8, 1703 -1717.
173. Roques S., Sévigny J.-M. & Bernatchez L. (2001). Evidence for broadscale
introgressive hybridization between two redfish (genus Sebastes) in the North-
west Atlantic: a rare marine example. Mol. Ecol., 10, 149-165.
174. Schmidt C. (2005). Molecular genetic studies on species and population
structure of North Atlantic redfish (Genus Sebastes; Cuvier 1829). Doctor of
Philosophy. University of Hamburg.
175. Roques S., Sévigny J.-M. & Bernatchez L. (2002). Genetic structure of Deep-
water Redfish, Sebastes mentella, populations across the North Atlantic. Mar.
Biol., 140, 297-307. doi:10.1007/s002270100705
176. Stefánsson M.Ö., Reinert J., Sigurðsson o., Kristinsson K. & Nedreaas K.
(2009). Depth as a potential driver of genetic structure of Sebastes mentella
across the North Atlantic Ocean. ICES J. Mar. Sci., 66, 680-690.
177. Stefánsson M.Ö., Sigurdsson T., Pampoulie C., Daníelsdóttir A.K.,
Thorgilsson B., Ragnardóttir A., et al. (2009). Pleistocene genetic legacy
![Page 184: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/184.jpg)
168
suggests incipient species of Sebastes mentella in the Irminger Sea. Heredity,
102, 514-524. doi:10.1038/hdy.2009.10
178. Burford M.O. & Larson R.J. (2007). Genetic heterogeneity in a single year-
class from a panmictic population of adult Blue Rockfish (Sebastes mystinus).
Mar. Biol., 151, 451-465. doi:10.1007/s00227-006-0475-1
179. Burford M.O. & Bernardi G. (2008). Incipient speciation within a subgenus of
rockfish (Sebastosomus) provides evidence of recent radiations within an
ancient species flock. Mar. Biol., 154, 701-717. doi:10.1007/s00227-008-0963-
6
180. Burford M.O. (2009). Demographic history, geographical distribution and
reproductive isolation of distinct lineages of Blue Rockfish (Sebastes
mystinus), a marine fish with a high dispersal potential. J. Evol. Biol., 22,
1471-1486. doi:10.1111/j.1420-9101.2009.01760.x
181. Matala A.P., Gray A.K. & Gharrett A.J. (2004). Microsatellite variation
indicates population genetic structure of Bocaccio. N. Am. J. Fish. Manage.,
24, 1189-1202.
182. Gomez-Uchida D., Hoffman A., Ardren W.R. & Banks M.A. (2003).
Microsatellite markers for the heavily exploited Canary (Sebastes pinniger)
and other rockfish species. Mol. Ecol. Notes, 3, 387- 389. doi:10.1046/j.1471-
8286.2003.00458.x
183. Hyde J.R., Kimbrell C.A., Budrick J.E., Lynn E.A. & Vetter R.D. (2008).
Cryptic speciation in the Vermilion Rockfish (Sebastes miniatus) and the role
of bathymetry in the speciation process. Mol. Ecol., 17, 1122-1136.
doi:10.1111/j.1365-294X.2007.03653.x
184. Yamanaka K.L., Withler R.E. & Miller K.M. (2000). Structure of Yelloweye
Rockfish (Sebastes ruberrimus) populations in British Columbia. Canadian
Stock Assessment Secretariat Research Document 2000/172. Fisheries and
Oceans Canada, Nanaimo, BC.
185. Dailianis T., Limborg M.T., Hanel R., Bekkevold D., Lagnel J., Magoulas A.,
et al. (2008). Characterization of nine polymorphic microsatellite markers in
![Page 185: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/185.jpg)
169
Sprat (Sprattus sprattus L.). Molecular Ecology Resources, 8, 861-863.
doi:10.1111/j.1755-0998.2008.02091.x
186. Limborg M.T., Pedersen J.S., Hemmer-Hansen J., Tomkiewicz J. & Bekkevold
D. (2009). Genetic population structure of European Sprat Sprattus sprattus:
differentiation across a steep environmental gradient in a small pelagic fish.
Mar. Ecol. Prog. Ser., 379, 213-224. doi:10.3354/meps07889
187. O'Reilly P.T., Canino M.F., Bailey K.M. & Bentzen P. (2000). Isolation of
twenty low stutter di- and tetranucleotide microsatellites for population
analyses of Walleye Pollock and other gadoids. J. Fish Biol., 56, 1074-1086.
doi:10.1006/jfbi.2000.1230
188. O'Reilly P.T., Canino M.F., Bailey K.M. & Bentzen P. (2004). Inverse
relationship between FST and microsatellite polymorphism in the marine fish,
Walleye Pollock (Theragra chalcogramma): implications for resolving weak
population structure. Mol. Ecol., 13, 1799-1814. doi:10.1111/j.1365-
294X.2004.02214.x
189. Shubina E.A., Mel'nikova M.N., Glubokov A.I. & Mednikov B.M. (2004).
Analysis of the genetic structure of northwestern Bering Sea Walleye Pollock,
Theragra chalcogramma. Environ. Biol. Fishes, 69, 177-185.
190. Shubina E.A., Ponomareva E.V. & Glubokov A.I. (2009). Population genetic
structure of Walleye Pollock Theragra chalcogramma (Gadidae, Pisces) from
the Bering Sea and Sea of Okhotsk. Mol. Biol., 43, 855-866.
doi:10.1134/S0026893309050161
191. Carlsson J., McDowell J.R., Díaz-Jaimes P., Carlsson J.E.L., Boles S.B., Gold
J.R., et al. (2004). Microsatellite and mitochondrial DNA analyses of Atlantic
Bluefin Tuna (Thunnus thynnus thynnus) population structure in the
Mediterranean Sea. Mol. Ecol., 13, 3345-3356. doi:10.1111/j.1365-
294X.2004.02336.x
192. McDowell J.R., Díaz-Jaimes P. & Graves J.E. (2002). Isolation and
characterization of seven tetranucleotide microsatellite loci from Atlantic
![Page 186: DISPERSAL, FISHING, AND THE CONSERVATION OF ...fk096nf3828/...v Abstract A central goal of ecology is to understand the forces driving the distribution and abundance of organisms](https://reader034.vdocuments.mx/reader034/viewer/2022052104/603e9fb78e0e243e887b863e/html5/thumbnails/186.jpg)
170
Northern Bluefin Tuna Thunnus thynnus thynnus. Mol. Ecol. Notes, 2, 214-
216. doi:10.1046/j.1471-8286
193. Riccioni G., Landi M., Ferrara G., Milano I., Cariani A., Zane L., et al. (2010).
Spatio-temporal population structuring and genetic diversity retention in
depleted Atlantic Bluefin Tuna of the Mediterranean Sea. P Natl Acad Sci
USA, 107, 2102-7. doi:10.1073/pnas.0908281107
194. Canales-Aguirre C., Ferrada S. & Galleguillos R. (2010). Isolation and
characterization of microsatellite loci for the Jack Mackerel (Trachurus
murphyi Nichols, 1920). Conserv. Genet., 11, 1235-1237. doi:10.1007/s10592-
009-9932-y
195. Cárdenas L., Silva A.X., Magoulas A., Cabezas J., Poulin E. & Ojeda F.P.
(2009). Genetic population structure in the Chilean Jack Mackerel, Trachurus
murphyi (Nichols) across the South-eastern Pacific Ocean. Fisheries Research,
100, 109-115. doi:10.1016/j.fishres.2009.06.013
196. Chang D.S., An H.S., Oh T.Y., Lee J.B., Park J.Y. & Kim K.K. (2009). Eleven
new microsatellite markers in Jack Mackerel (Trachurus japonicus) derived
from an enriched genomic library. Genes & Genomics, 31, 397-402.
197. Kasapidis P. & Magoulas A. (2008). Development and application of
microsatellite markers to address the population structure of the Horse
Mackerel Trachurus trachurus. Fisheries Research, 89, 132-135.
doi:10.1016/j.fishres.2007.09.015