developing a cell culture system for lagoviruses · developing a cell culture system for...

Bachelor of Applied Science (Honours)

Developing a Cell Culture System for Lagoviruses

Name: Roxanne Orford-Dunne

Student ID: 3043514

Supervisors: Dr Michael Frese, Dr Tanja Strive and Dr Markus Matthaei

Research Faculty: CSIRO Ecosystem Sciences

Clunies Ross Street, Black Mountain,

ACT 2601, Australia

Due Date: 21st of March 2012

Acknowledgements

I would like to thank Dr Michael Frese, Dr Tanja Strive and everyone from the CSIRO who

helped people during my studies. I would also like to thank Georg Koch for kindly suppling

me with the pGL3-Mx1P-Luc plasmid and Dr Michelle Gahan and Dr Peter Kerr for marking

my thesis. I would especially like to thank Dr Markus Matthaei for all the hours he put in to

teaching and helping me during my nine months at the CSIRO.

Orford-Dunne, Roxy (CES, Black Mountain)

i

Abstract

Rabbit haemorrhagic disease virus (RHDV) is a positive-stranded RNA virus belonging to the

Caliciviridae family and is used as a biological control agent to contain feral rabbit

populations in Australia. After RHDV’s initial introduction a significant decrease in rabbit

numbers (up to 90%) was observed, which allowed for the regeneration of many

endangered species detrimentally affected by the extreme rabbit infestation in Australia.

Unfortunately, rabbit numbers are steadily increasing, indicating a recently decreasing

effectiveness of the introduced RHDV strain (Czech strain V351). The underlying reasons for

the decreasing effectiveness of RHDV are still a matter of debate, partially due to a

significant lack of knowledge of RHDV biology as a consequence of the absence of a stable

cell culture system. Approaches to generate a stable cell culture system to study RHDV in

vitro have been unsuccessful so far, but recent advancements in calicivirus research indicate

that interferon (IFN)-induced anti-viral defence mechanisms may hinder effective calicivirus

growth.

Hence, we hypothesised that a type I IFN defective cell line may support RHDV propagation

in cell culture. To develop an IFN-defective cell line, we generated plasmids containing a

lethal gene under control of a type I IFN-inducible promoter to select for cells unable to

mount an IFN response from populations of otherwise IFN responsive cells.

To further study the interplay between RHDV and cellular innate immune responses, we

also established real time-PCR (rt-PCR) assays to measure the induction of several type I IFN-

inducible genes. We further developed an immunofluorescence assay to also examine the

expression of type I IFN-induced antiviral proteins. Both assays were shown to specifically

measure either IFN induced gene expression or IFN induced protein expression in RK13 cells.

The generated plasmids will be invaluable tools for future experiments to develop type I IFN

defective cell lines that may support RHDV growth in vitro. Furthermore, the assays

established are a necessity to study the interactions of RHDV and cellular innate immune

responses, which may critically determine virus growth and pathogenicity. While the assays

are rabbit specific, the plasmids can be used to generate IFN-defective cell lines from a wide

variety of mammalian species, potentially complementing attempts to establish cell culture

systems for other viruses as well.


ii

Table of contents

1 Introduction ........................................................................................................................ 1

1.1 The impact of feral rabbit populations in Australia .................................................... 1

1.2 Use of viral biological control agents in Australia ....................................................... 2

1.3 Decreasing effectiveness of RHDV on rabbits in Australia.......................................... 3

1.4 Caliciviridae biology ..................................................................................................... 4

1.4.1 Taxonomy ............................................................................................................. 5

1.5 Rabbit haemorrhagic disease virus ............................................................................. 7

1.5.1 Molecular characteristics ..................................................................................... 7

1.5.2 Pathology ............................................................................................................. 9

1.6 The role of the innate immune system in the prevention of viral replication ......... 10

1.6.1 Important innate immune system receptors .................................................... 11

1.6.2 Interferons ......................................................................................................... 19

1.7 Cell culture systems for caliciviruses ......................................................................... 25

1.7.1 Porcine enteric calicivirus (PECV) ...................................................................... 26

1.7.2 Murine norovirus (MNV) .................................................................................... 28

1.7.3 Feline calicivirus (FCV) ....................................................................................... 29

1.7.4 Tulane calicivirus (TCV) ...................................................................................... 29

1.7.5 Rabbit haemorrhagic disease virus (RHDV) ....................................................... 30

1.8 Development towards a new cell culture systems for RHDV ................................... 31

1.9 Hypothesis and Aims ................................................................................................. 33

1.9.1 Hypothesis.......................................................................................................... 33

2 Material and Methods ...................................................................................................... 35

2.1 Materials ................................................................................................................... 35

2.1.1 Plasmids ............................................................................................................. 35


iii

2.1.2 Oligonucleotides ................................................................................................ 37

2.1.3 Buffers, Solutions and Media ............................................................................. 38

2.1.4 Kits ...................................................................................................................... 39

2.1.5 Enzymes ............................................................................................................. 40

2.1.6 Cell Lines, Bacteria Strains and Viruses ............................................................. 40

2.1.7 Reagents ............................................................................................................. 41

2.1.8 Antibodies .......................................................................................................... 42

2.2 Methods .................................................................................................................... 43

2.2.1 Molecular Biology Methods ............................................................................... 43

2.2.2 Cell culture methods .......................................................................................... 53

3 Results ............................................................................................................................... 57

3.1 Generation of cells with a compromised type I IFN response .................................. 57

3.1.1 Construction of pcDNA3.1 Mx1 Promoter Plasmid ........................................... 57

3.1.2 Construction of TK1 Expression Plasmid ........................................................... 63

3.1.3 Construction of DTA Expression Plasmid ........................................................... 69

3.1.4 Generation of RK-13 clones ............................................................................... 73

3.2 Characterisation of Innate Immune Response ......................................................... 76

3.2.1 Real-Time Polymerase Chain Reaction Analysis ................................................ 76

4 Discussion ......................................................................................................................... 86

5 References ........................................................................................................................ 94


1

1 Introduction

1.1 The impact of feral rabbit populations in Australia

European rabbits (Oryctolagus cuniculus) have caused major environmental and agricultural

damage in Australia since they were introduced with the arrival of the first fleet in the early

1800’s. Rabbits, intentionally released for hunting, spread rapidly throughout mainland

Australia from 1860 to 1930 were the rabbit population also increased in size dramatically

during this period, reaching approximately 3 billon (Fenner 2010). Today, rabbits occupy all

but the northern most regions (Figure 1-1) of the continent and are currently considered a

major national pest (Cooke 2002; Fenner 2010). Feral rabbits have a devastating effect on

Australia’s and New Zealand’s native fauna and flora, and cause major financial losses to the

agricultural industry. Rabbits damage crops, compete for pastures, feed on endangered

native plants, compete with native animals such as the Australian bilby for warrens and

cause soil erosion. Major efforts including trapping, shooting, poisoning, fencing and warren

ripping have been made to control and decrease feral rabbit numbers. While these methods

have the potential to lower local rabbit numbers, they will never solve the national rabbit

problem or be a permanent solution.

Figure 1-1 The distribution of feral European rabbits across the Australian mainland and Tasmania (http://invasive.boabdevelop.info/invasive-animals/rabbits/index.html).

http://invasive.boabdevelop.info/invasive-animals/rabbits/index.html


2

1.2 Use of viral biological control agents in Australia

The rabbit pathogen Myxoma virus, belonging to the family of Poxviridae was released in

response to the growing feral rabbit population in a Australia in the 1950s. The virus was

shown to be non-pathogenic in any host species tested excluding lagomorphs (Spiesschaert,

McFadden et al. 2011). Myxoma virus causes myxomatosis, a serious disease characterised

by the progressive development of conjunctivitis, mucopurulent secretion from the eyes

and mouth and a gradual breakdown of the host’s immune system, resulting in subsequent

supervening bacterial infections in the respiratory tract (Best and Kerr 2000; Jeklova, Leva et

al. 2008). Animals infected with Myxoma virus usually die within 10-14 days post infection

(Robinson, Muller et al. 1999). Myxoma virus has an estimated mortality rate of 99.5% in

rabbits (Spiesschaert, McFadden et al. 2011), which made it an appealing biological control

agent.

Myxoma virus was introduced into four local populations of wild rabbits on the southern

tablelands of New South Wales in the 1950s (Merchant, Kerr et al. 2003). Over the next two

years the virus spread throughout Australia and was identified in most areas occupied by

rabbits (Merchant, Kerr et al. 2003). Myxoma virus killed an estimated 400 million rabbits in

the first year after its introduction and within a decade the rabbit population in Australia

was reduced by 95% (Burnet 1952; Spiesschaert, McFadden et al. 2011). Annual outbreaks

of myxomatosis are observed throughout Australia, which appeared to be dependent on

rainfall and the availability of virus vectors such as mosquitoes and the European rabbit flea

(Fenner 1958; Merchant, Kerr et al. 2003). Unfortunately the high lethality of Myxoma virus

was not maintained, as co-evolutionary selection pressures resulted in a reduction of the

overall mortality caused by Myxoma virus to 30% seven years after release (Spiesschaert,

McFadden et al. 2011). The decrease in the effectiveness of Myxoma virus again brought

forth the need to find new strategies to control rabbit numbers.

Hence, RHDV was imported into Australia in 1995 for testing as a potential biological control

agent for the again growing European rabbit infestation (Mutze, Cooke et al. 1998). A series

of field trials were conducted on Wardang Island, 5 km off the coast of South Australia, to

assess the effectiveness of RHDV (Czech strain V351) (Cooke 2002). During these trials,

RHDV escaped from the island and spread through mainland Australia (Cooke 2002).


3

Blowflies collected immediately outside the quarantine area tested positive for RHDV,

indicating that RHDV may have been transferred from the island via an insect vector (Mutze,

Cooke et al. 1998). The Czech RHDV strain V351 was introduced illegally from Australia into

New Zealand by farmers in 1997 and, similarly to Australia, RHDV rapidly spread through the

rabbit population causing high fatality rates (Forrester, Boag et al. 2003). It was estimated

that a month after the initial spread of RHDV, only 5% of pre-RHDV rabbit numbers

remained in South Australia (Mutze, Cooke et al. 1998). Although RHDV initially reduced the

number of feral rabbits in Australia and New Zealand significantly, rabbit population have

been steadily increasing, indicating the effectiveness of the present strain of RHDV has not

been maintained (Lugton 1999; Forrester, Boag et al. 2003). A consistent decrease in rabbit

numbers in Australia is desperately needed to allow for the regeneration of many

endangered trees, shrubs and animals and to decrease growing costs to the agricultural

industry (Lange and Graham 1983).

1.3 Decreasing effectiveness of RHDV on rabbits in Australia.

The initial impact of RHDV on the rabbit population numbers in Australia has not been

maintained. There has been a steady increase in rabbit numbers over the last 6-7 years to a

density where rabbits are again noticeably reducing Australia’s biodiversity (Saunders,

Cooke et al. 2010). Interestingly, pre-existing antibodies that cross-react to RHDV have been

found in rabbits from other parts of Australia and Europe (Collins, White et al. 1995;

Nagesha, Wang et al. 1995; Chasey, Trout et al. 1997; Moss, Turner et al. 2002; Robinson,

Kirkland et al. 2002). The effectiveness of RHDV was lower in cooler areas such as Victoria

were a higher percentage of rabbits survived infection (Ward, Cooke et al. 2010).

Furthermore antibodies cross reacting with RHDV were found in rabbit sera collected prior

to the release of RHDV (Cooke 2002).This lead to the hypothesis that the rabbits may have

acquired the antibodies after infection by non-lethal viruses, related to RHDV increasing

their survival rate (Cooke 2002; Ward, Cooke et al. 2010). A non-pathogenic virus belonging

to the Lagovirus genus termed ‘Rabbit Calicivirus-Australia 1’ (RCV-A1) was identified in

Australia, which may provide cross-protection against RHDV (Figure 1-2) (Strive, Wright et

al. 2009) and further RCV strains were discovered in Europe (Capucci, Frigoli et al. 1995).


4

To overcome the deceasing effectiveness of originally released RHDV strain (Czech strain

V351), a screen for other strains of RHDV that are able come existing immunity to RHDV

and/or RCV-A1 and further lower rabbit numbers in Australia is currently underway (IA-CRC

2011).

Figure 1-2 Genbank sequences for the isolates were U54983, RHDV-V351 Czech; EU003579, RHDV Italy 90; M67473, RHDV FRG 91 Germany; Z29514, RHDV-SD 95 France; Z49271, RHDV-AST89 Spain; X87607, RHDV-BS89 Italy; EF363035, RHDV pJG Germany; DQ189077, RHDV 2006 Bahrain; EU003582, RHDV UT-01 USA; EU003581, RHDV NY-01 USA; DQ205345, RHDV JX/CHA/97 China; AF258618, RHDV Iowa USA; DQ280493, RHDV WHNRH China; EU003578, RHDV IN-05 USA; AY523410 RHDV CD/China 04; X96868, RCV Italy; AF454050, Ashington Isolate UK; EU871528, RCV-A1 Australia; NC_002615, EBHSV France; U09199, EBHSV pEB-2/4 Germany; U09199, EBHSV pEB-2/4 Germany; X9800, EBHSV BS89 Italy; AJ86699, rabbit Vesivirus. (Ward, Cooke et al. 2010)

The development of cell culture system for RHDV would help increase the knowledge of

RHDV biological aspects, such as molecular pathogencity determinants, which would be

useful information screening for a more favourable RHDV strain to be use in Australia’s

biological control efforts.

1.4 Caliciviridae biology

The name Caliciviridae is derived from the Latin word calix, meaning cup or chalice (Green,

Ando et al. 2000), as viruses belonging to this family have trademark cup-shaped

depressions on the virion surface (Figure 1-3) arranged in icosahedral symmetry (Green,


5

Ando et al. 2000). The Caliciviridae family is comprised of small, non-enveloped positive

stranded RNA viruses, with a diameter of 27 to 35 nm (Clarke and Lambden 1997).

Figure 1-3 Negative-contrast electron micrograph of Norwalk-like virus in human stool specimen (Green, Ando et al.

2000).

1.4.1 Taxonomy

The ability to characterise and classify caliciviruses has been greatly limited by the absence

of effective cell culture systems, since many features commonly used to distinguish

between virus families such as proteins expressed in infected cells, antigenic relationships,

cell tropism and physicochemical properties cannot be easily analysed without it (Green,

Ando et al. 2000). Originally, caliciviruses were grouped into the Picornaviridae family, but

were listed as a distinct virus family in the Third Report of the International Committee on

Taxonomy of Viruses (ICTV) in 1978 (Green et al., 2000). The two virus families were

separated because of major differences in genome organisation. Calicivirus genomes are

organised into two to three major open reading frames, whereas picornaviruses only

contain one long open reading frame. Furthermore, Hepatitis E virus (HEV) was recently

removed from the Caliciviridae family because of the lack of phylogenetic relatedness

(Berke and Matson 2000) and differences in their replicative enzymes (Koonin and Dolja

1993). The decision to remove HEV from this family was not a unanimous by the calicivirus


6

study group because of the apparent structural similarities between caliciviruses and HEV

(Green, Ando et al. 2000).

Figure 1-4 The phylogenetic relationship of among the Caliciviridae and Picornaviridae (Berke, Golding et al. 1997). Abbreviations: MX, Mexico Virus; RDHV, Rabbit hemorrhagic disease virus; EBHSV, European brown hare syndrome virus; FCV, Feline calicivirus; SMSV, San Miguel sea lion virus; Primate Pan-1, Primate calicivirus; VESV, Vesicular exanthema of swine virus; FMDV, foot-and-mouth disease virus; Polio 1, Poliovirus 1; HRV 14, Human rhinovirus 14; EMCV, Encephalomyocarditis virus; HAV, Hepatitis A virus (Picture taken from Cooke, 2002).

The Caliciviridae family is now comprised of four genera, Lagovirus, Norovirus, Sapovirus

and Vesivirus (Figure 1-4, Table 1-1). Caliciviruses affect a wide range of host species

including humans, primates, felines, swine and rabbits and cause a variety of different

diseases and symptoms. Viruses belonging to the Lagovirus genus such as RHDV and

European brown hare syndrome virus (EBHSV) cause serious diseases (rabbit haemorrhagic

disease and European brown hare syndrome respectively) with high mortality rates in

lagomorphs. The Lagovirus genus also includes Rabbit calicivirus (RCV), which infects rabbits

but is non-pathogenic (Capucci, Fusi et al. 1996; Strive, Wright et al. 2009). The Norovirus

and Sapovirus genuses include human pathogens, such Norwalk like viruses which are a

major cause of gastroenteritis in humans.


7

Family Genus Species Strain

Caliciviradae Lagovirus European brown hare syndrome virus (EBHSV) EBHSV-BS89

EBHSV-FRG

EBHSV-GD

EBHSV-UK91

Rabbit hemorrhagic disease virus (RHDV) RHDV-AST89

RHDV-BS89

RHDV-FRG

RHDV-SD

RHDV-V351

Rabbit calicivirus (RCV)

Norovirus Norwalk virus (NV) Desert Shield

Lordsdale

Mexico

Norwalk

Hawaii

Snow Mountain

Southampton

Swine calicivirus

Sapovirus Sapporo virus (SV) Houston/86

Houston/90

London 29845

Manchester virus

Parkville virus

Sapporo virus

Vesivirus Feline calicivirus (FCV) FCV CFI/68

FCV F9

Vesicular exanthema of swine virus (VESV) Bovine

Cetacean s

Primate

Reptile

San Miguel sea lion virus (SMSV) serotype 1

serotype 4

serotype 17

Porcine enteric calicivirus (PEC)

Table 1-1 The Caliciviradae family contains four genera Lagovirus, Norovirus, Sapovirus, Vesivirus a. Also shown are the different virus species and strains.

1.5 Rabbit haemorrhagic disease virus

1.5.1 Molecular characteristics

RHDV is a single-stranded, positive-sense RNA virus, with a 7,437-nucleotide genome

(Wirblich, Thiel et al. 1996). In addition to the genomic RNA, a 2.2-kb subgenomic RNA


8

covering the extreme 3’-third of the genomic RNA, is also produced during replication

(Wirblich, Thiel et al. 1996) and codes for the structural protein VP60 (Meyers, Wirblich et

al. 1991). Both RNA molecules are polyadenylated at the 3’ end, have a protein, named VPg,

covalently attached to the 5’end (Wirblich, Thiel et al. 1996; Goodfellow, Chaudhry et al.

2005) and are tightly packaged into non-enveloped icosahedral viral capsids that consist

largely of VP60 (Meyers, Wirblich et al. 1991).

The genomic RNA codes for two open reading frames, a larger 7 kb-open reading frame

(ORF1) and a 351-nucleotide open reading frame (ORF2) on its extreme 3’ end (Wirblich,

Thiel et al. 1996). The polypeptide transcribed from ORF1 contains seven autoproteolytic

cleavage sites and is cleaved to different degrees in vitro (Figure 1-5) (Wirblich, Thiel et al.

1996). Complete cleavage of the RHDV proprotein results in the production of 8 proteins

(Figure 1-5), including 3 helicases (P1, P2, P3), a cysteine protease (P5), VPg (P6), a

polymerase (P7) and the major capsid protein VP60 (Wirblich, Thiel et al. 1996).

Figure 1-5 Schematic representation of the cleavage products of the ORF1 polyprotein and proposed genetic map of ORF1. (A) The genomic RNA of RHDV is represented below the scale bar. Open reading frames are shown as open or shaded bars. Cleavage sites in the ORF1 polyprotein are indicated by vertical lines and numbered 1 to 7. The nonstructural proteins are designated P1 to P7. The molecular masses of the proteins (in kilodaltons) are shown above the bars, and their established or putative functions are indicated below the bars. (Wirblich, Thiel et al. 1996).


9

1.5.2 Pathology

RHDV is the cause of rabbit haemorrhagic disease (RHD), a highly infectious disease

characterised by high mortality and morbidity in adult rabbits (Xu and Chen 1989). The

typical mortality rate of RHDV is estimated to be between 60-90% (Mocsari, Meder et al.

1991; Ohlinger, Haas et al. 1993). After RHDV infection, viral RNA is first observed in the

liver and spleen and can then be detected in the lung, kidney, bile, thymus, lymph nodes

and white blood cells within 30 hrs post infection (Shien, Shieh et al. 2000). RHDV antigens

have also been detected in the rabbit’s liver, bile and spleen (Shien, Shieh et al. 2000). RHDV

is also found in macrophages and monocytes extracted from a variety of organs after

infection by RHDV (Ramiro-Ibanez, Martin-Alonso et al. 1999). Symptoms associated with

RHDV (Figure 1-6) include hepatic failure, an enlargement and discolouration of the spleen

and haemorrhages in multiple organs, including the liver (Marcato, Benazzi et al. 1991).

RHDV is usually fatal in adult rabbits within 48 to 72 c hrs post infection (Marcato, Benazzi et

al. 1991). Interestingly, rabbits younger than 10 weeks are more likely to survive an RHDV

infection then adult rabbits (Shien, Shieh et al. 2000).


10

Figure 1-6 Pathology of RHD. (A) Typical posture of a rabbit that died from RHDV infection. (B) Bleeding from the nostrils is frequently observed in rabbits that die from acute RHD. (C) Internal organs of a rabbit that died from RHD. The haemorrhagic lungs and the discoloured liver are visible. (D) The internal organs of a healthy rabbit, with normal lungs and dark glossy liver. (E) Enlarged spleen of a rabbit that died from RHD and (F) a normal spleen for comparison (Ward, Cooke et al. 2010).

1.6 The role of the innate immune system in the prevention of viral

replication

The immune system is divided into two main branches, the adaptive immune system and

the innate immune system. The innate immune system is comprised of a variety of different

cells and defense mechanisms that protect the host from invading organisms in a non-

specific manner and is one of the bodies’ first lines of defense against the invasion of foreign

pathogens (Barral, Sarkar et al. 2009).


11

1.6.1 Important innate immune system receptors

Viruses and other pathogens contain unique pathogen-associated molecular patterns

(PAMPs) which are not found naturally in the host (Kumar, Kawai et al.). The innate immune

system recognises these PAMPs via specific pattern-recognition receptors (PRRs), including

Toll-like receptors (TLRs), Nucleotide Oligomerization Domain (Nod)-like receptors (NLRs)

and retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) (Yoneyama and Fujita 2009)

(Table 2). The stimulation of these receptors results in the activation of different elements

of the innate immune system, through the production and release of pro-inflammatory

cytokines and interferons (IFN) (Yoneyama and Fujita 2009).


12

PRRs (structure Adapters (structure) PAMPs/Activators Species

TLR TLR1 - TLR2 (LRR-TIR) MyD88 (TIR-DD), TIRAP (TIR)

Triacyl lipopeptides Bacteria

TLR2 - TLR6 (LRR-TIR) MyD88, TIRAP Diacyl lipopeptides Mycoplasma

LTA Bacteria

Zymosan Fungus

TLR2 (LRR-TIR) MyD88, TIRAP PGN Bacteria

Lipoarabinonmannan Mycobateria

Porins Bacteria (Neisseria)

tGPI-mucin Parasites (Trypanosoma)

HA proteins Virus (Measles virus)

TLR3 (LRR-TIR) TRIF (TIR) dsRNA Virus

TLR4 (LRR-TIR) MyD88, TIRAP, TRIF, TRAM (TIR)

LPS Bacteria

Envelope proteins Virus (RSV, MMTV)

TLR5 (LRR-TIR) MyD88 Flagellin Bacteria

TLR7 (LRR-TIR) MyD88 ssRNA RNA Virus

hTLR8 (LRR-TIR) MyD88 ssRNA RNA Virus

TLR9 MyD88 CpG DNA Bacteria

DNA DNA Virus

Malaria hemozoin Parasites

mTLR11 (LRR-TIR) MyD88 Not determined Bacteria (uropathogenic bacteria)

Profilin-like molecule Parasites (Toxoplasma gondii)

RLR RIG-I (CARDx2-helicase IPS-1 (CARD) RNA (5'-PPP ssRNA, short dsRNA)

Virus

MDA5 (CARDx2-helicase) IPS-1 RNA (poly IC, long dsRNA)

Virus

LGP2 (helicase) RNA Virus

NLR NOD1/NLRC1 (CARD-NBD-LLR) RICK (CARD), CARD9 (CARD)

iE-DAP Bacteria

NOD2/NLRC2 (CARDx2-NBD-LLR)

RICK, CARD9 MDP Bacteria

NALP3/NLRP3 (PYD-NBD-LRR) ASC (PYD-CARD) MDP Bacteria

CARDINAL (PYD-FIND) RNA Bacteria, Virus

ATP Bacteria? Host?

Toxin Bacteria

Uric acid, CPPD, amyloid-β

Host

NALP1/NLRP1 (CARD-FIND-NBD-LRR-PYD)

ASC Anthrax lethal toxin Bacteria

IPAF/NLRC4 (CARD-NBD-LRR) Flagellin Bacteria

NAIP5 (BIRx3-NBD-LRR) Flagellin Bacteria

β-Glucan Fungi

Table 1-2 PRRs are used by the innate immune system to detect PAMPs from a variety of different pathogens (Kawai and Akira 2009).


13

1.6.1.1 Toll-like receptors (TLRs)

A wide range of different pathogens are detected by TLRs (Kawai and Akira 2009) and are

they best characterised group of receptors for the recognition of PAMPs (Kawai and Akira

2008). TLRs are expressed by a wide range of cells to detect invading pathogens including

viruses, bacteria, fungi and parasites (Kawai and Akira 2009). TLRs are comprised of three

major structural domains, a transmembrane domain, an intracellular domain that is

necessary for the activation of downstream signaling pathways (Kawai, 2008) and an

ectodomain, which is comprised of leucine-rich repeats (LRRs) that bind the respective

PAMP (Kawai and Akira 2009).

There are at least 12 known members belonging to the TLR family in mammals, and each

receptor detects a different PAMP (Akira 2009). The TLR family is commonly divided in two

subgroups, intracellular and extracellular TLRs, dependent on the localisation of the

receptor within the cell (Kawai and Akira 2009). TLR3, TLR7, TLR8 and TLR9 are located in

intracellular compartments within the cell, such as endosomes, lysosomes and endoplasmic

reticulum (ER) and detect microbial nucleic acids (e.g. viral RNA and DNA). TLR1, TLR2, TLR4,

TLR5, TLR6 and TLR11 are located on the surface of the cell and recognise pathogen

membrane components such as proteins, lipoproteins and lipids found in the bacterial cell

wall, viral particles and fungi (Kawai and Akira 2009). TLR9 and TLR11 are also found in

cellular compartments and a verity of detect microbes including bacteria and parasites. The

role of TLR10 (also expressed on the cell surface) is not currently known.

The activation of some TLRs triggers an anti-viral innate immune response resulting in the

production of type I IFNs, which play a major role in the cellular defense against viral

infection (Kawai and Akira 2009). The activation of TLRs results in the activation of myeloid

differentiation primary response gene (MyD88) dependent and/or TIR-domain-containing

adapter-inducing IFN-β (TRIF) dependent signaling pathways (Figure 1-7), (Akira 2009).

MyD88 dependent signaling has been shown to be activated by all TLRs except TLR3 (Honda,

Ouyang et al. 2007), whereas TRIF dependent signaling pathway is only activated by TLR3

and TLR4 (Honda, Ouyang et al. 2007). The initiation of the MyD88-dependent TLR signaling

pathway results in the recruitment of MyD88 to the receptor. MyD88 then forms a complex

with interleukin-1 receptor-associated kinases (IRAKs) 1, 2 and 4 (Akira 2009). During the


14

formation of the complex, IRAK4 phosphorylates and activates IRAK1 and IRAK2 and recruits

tumor necrosis receptor-associated factor 6 (TRAF6) to the complex (Akira 2009). The

activation of downstream pathways by IRAK1 occurs within the first hour, after which IRAK1

is rapidly degraded, whereas IRAK2 activity is sustained for a longer period of time (Akira

2009). The IRAKs/TRAF6 complex then interacts with another complex consisting of TGF-β-

activated kinase 1 (TAK1) and TAK1-binding proteins (TAB) 1 and 2, resulting in the

phosphorylation and activation of TAK1. TAK1 subsequently phosphorylates and activates a

variety of different kinases, including IκB kinases (IKKs), Mitogen-activated protein kinases

(MAPK) and c-Jun N-terminal kinases (JNKs) (Akira 2009). The activation of IKK results in the

release of NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) (Akira

2009), a major transcription factor that regulates genes involved in both the innate and

adaptive immune response (Livolsi, Busuttil et al. 2001).

The other signaling pathway initiated by TLR stimulation is the TRIF-dependent signaling

pathway that plays a crucial role in the innate immune response to viral infection through

the induction of type I IFN. TRIF has been shown to associate with TNF receptor-associated

factor 3 (TRAF3), TRAF6 and receptor-interacting protein 1 (RIP1) after stimulation of TLR3

and 4 (Meylan, Burns et al. 2004; Hacker, Redecke et al. 2006). TRAF6 and RIP1 activate NF-

KB, where as TRAF3 is responsible for the induction of type I IFN via IRF3 (Akira 2009). TRAF3

activates two related kinases, inducible IKB kinase (IKKi) and TANK-binding kinase 1 (TBK1),

which are both involved in the activation of IFN regulatory factor 3 (IRF3) and/or IRF7

(Fitzgerald, McWhirter et al. 2003; Hemmi, Takeuchi et al. 2004). IRF3, once phosphorylated

by IKKi or TBK1, translocates from the cytoplasm into the nucleus where it activates the

transcription of the type I IFN genes (Akira 2009).


15

Figure 1-7 MyD88 (myeloid differentiation primary response gene)-dependent and TRIF (TIR-domain-containing adapter-inducing interferon-β)-dependent signalling pathways in TLR signaling. Abbreviations: TLR, Toll-Like

receptor; TRAM, TRIF-related adaptor molecule; IRAK, Interleukin-1 receptor-associated kinase; TRAF, TNF receptor associated factors; RIP1, receptor-interacting protein 1; TAK1, TGF-β-activated kinase 1; MAPK, mitogen-activated protein kinases (MAPK); IκB, kinases (IKK); NF-KB, nuclear factor kappa-light-chain-enhancer of activated B cells; TBK1, TANK-binding kinase 1; IRF, interferon regulatory factor (Akira 2009).

1.6.1.2 Nod-like receptors (NLRs)

The NLR (nucleotide-binding domain leucine-rich repeat containing) family of proteins

consists of cytosolic and membrane associated PRRs that function as regulators of the

innate immune system in response to microbial infection (Barnich, Aguirre et al. 2005;

Shaw, Reimer et al. 2008). The human NLR family currently consists of 23 known proteins

and at least 34 different NLRs have been identified in mice (Shaw, Reimer et al. 2008). NLR

proteins are mainly expressed in immune cells, although some NLRs are also present in non-

immune cells (Shaw, Reimer et al. 2008). Common structural features of NLRs include the

presence of a caspase recruitment domain (CARD), a baculovirus inhibitor domain (BIR) or a

pyrin domain (PYD), a C-terminal leucine-rich repeat (LRR) which is responsible for the


16

detection/binding of PAMPs and a NOD domain that plays a role in self oligomerisation

during activation (Inohara, Koseki et al. 2000; Shaw, Reimer et al. 2008).

The two best characterised proteins belonging to the NLR family are NOD1 and NOD2

(Inohara, Ogura et al. 2001). NOD1 is expressed in most cell types, whereas NOD2 is only

expressed in some immune cells such as macrophages, dendritic cells, monocytes and

intestinal Paneth cells (Inohara, Chamaillard et al. 2005). It has been shown that both, NOD1

and NOD2, are capable of inducing NF-kB activation independent of TLR-signaling (Inohara,

Ogura et al. 2001). After ligand binding NOD1/2 undergoes self oligomerisation and

conformational change, after which a serine threonine kinase (RICK) is recruited and

activated, which is required for the activation of MAPKs and NF-kB (Shaw, Reimer et al.

2008). K63-linked regulatory ubiquitination of RICK then occurs (Shaw, Reimer et al. 2008),

which leads to the subsequent recruitment of TAK1 (Hasegawa, Fujimoto et al. 2008). TAK1

is also necessary for the activation of MAPKs, although the signaling intermediates required

for this process are not well characterised (Shaw, Reimer et al. 2008). NOD1 utilises TRAF6

appears, whereas TRAF2/5 seem to be used in the signaling pathway initiated be NOD2

(Shaw, Reimer et al. 2008). The stimulation of either NOD1 or NOD2 results in the

production of pro-inflammatory mediators via NF-κB (Shaw, Reimer et al. 2008).

1.6.1.3 RIG-I-like receptors (RLRs)

The RLR family consists of three cytosolic RNA helicase PRRs, which specifically detect single

stranded and double stranded viral RNA in immune and non-immune cells (Kawai and Akira

2009). The three receptors belonging to this family are RIG-I, melanoma differentiation

associated gene 5 (MDA5) and laboratory of genetics and physiology gene 2 (LPG2)

(Yoneyama and Fujita 2008). RIG-I contains two CARDs at its N-terminus, a central RNA

helicase domain and a repressor domain at its C-terminus (Johnson and Gale 2006;

Yoneyama and Fujita 2009). The C-terminal domain has been shown to bind to and

recognise non-self RNA (Saito, Owen et al. 2008) in virus infected cells and inhibit RIG-I

activity in the absence of viral RNA (Takahasi, Yoneyama et al. 2008). MDA5 also contains

tandem CARD-like regions and a RNA helicase domain, but unlike RIG-I the C-terminal

portion of MDA5 does not appear to play an inhibitory role (Yoneyama, Kikuchi et al. 2005).

In contrast to MDA5 and RIG-I, LPG2 does not contain any CARDs (Saito, Hirai et al. 2007)


17

and in vitro experiments indicate LPG2 to play an inhibitory role in the MDA5/RIG-I

mediated signalling pathways (Rothenfusser, Goutagny et al. 2005; Komuro and Horvath

2006).

RLRs play a major role in the detection of viral infection and in the initiation of an antiviral

state in cells through the transcriptional activation of type I IFN-stimulated genes

(Yoneyama and Fujita 2007). Studies using RIG-I knockout mice have shown the importance

of RIG-I for the induction of type I IFN in response to viral infection in fibroblast and

dendritic cells (Kato, Takeuchi et al. 2008). RIG-I and MDA5 are capable of detecting foreign

dsRNA and initiating downstream (Figure 1-8) signaling pathways through the CARD-

containing mitochondrial adaptor molecule IFN-β promoter stimulator 1 (IPS-1) (Seth, Sun et

al. 2005). It appears that IPS-1 acts as a support molecule for the propagation of the

signaling cascade resulting in the activation of transcription factors including IRF-3 and NF-

κB (Seth, Sun et al. 2005; Saha, Pietras et al. 2006). Gene-silencing studies have shown that

IPS-1 is essential for the IFN induction after MDA5 and RIG-I stimulation (cite something).

IPS-1 acts upstream of TBK1 and IKKi, which are phosphorylated and activated after RLR

stimulation. The activation TBK1 and IKKi subsequently results in the activation of IRF-3

(Fitzgerald, McWhirter et al. 2003; Sharma, tenOever et al. 2003). NF-κB is also indirectly

activated by IRF-3. IRF-3 and NF-kB are responsible for the transcriptional activation of a

variety of antiviral effectors including type I IFN and inflammatory cytokines, leading to the

induction of an antiviral state in infected cells (Bamming and Horvath 2009).


18

Figure 1-8 Signalling pathways initiated by MDA5 and RIG-I in infected cells. Abbrevations: IPS-1, interferon promoter

stimulator-1; RIP1, receptor-interacting protein 1; FADD, fas-associated protein with death domain; TRAF6, TNF receptor associated factor 6; NF-κB, nuclear factor κ-light-chain-enhancer of activated B cells; IKK, IκB kinases; TBK1, TANK-binding Kinase 1; IRF, Interferon regulatory factors (Johnson and Gale 2006).

Despite the domain structure and amino acid sequence similarities, RIG-I and MDA5 are not

redundant and induce IFN in response to different types of viruses (Bamming and Horvath

2009). RIG-I specifically binds short double stranded RNA molecules and 5’-

triphosphorylated single stranded RNA (Hornung, Ellegast et al. 2006; Kato, Takeuchi et al.

2006; Kato, Takeuchi et al. 2008; Saito, Owen et al. 2008). No specific natural ligand has

been confirmed for MDA5 but it shows a preference for larger double stranded RNA (>2kbp)

and can detect synthetic dsRNA (poly IC) (Gitlin, Barchet et al. 2006; Kato, Takeuchi et al.

2008). RIG-I has been shown to induce type I IFN expression in response to Newcastle


19

disease virus, Sendai virus, Vesicular stomatitis virus and Japanese encephalitis virus,

whereas MDA5 induces type I IFN expression in response to Picornaviridae including Theilers

virus, Encephalomyocarditis and Mengo virus (Kato, Takeuchi et al. 2006). Detection of

Murine norovirus (MNV) and subsequent stimulation of IFN has also been shown to be

MDA5 dependent (McCartney, Thackray et al. 2008).

1.6.2 Interferons

The first line of defence against viral infection in higher eukaryotes is largely dependent on

the rapid activation of transcription factors that result in the production and secretion of a

family of cytokines referred to as IFNs (Johnson and Gale 2006). IFNs are commonly divided

into three subgroups, type I IFNs (including IFN-α, IFN-β and IFN-ω) which are induced by

viral infection and are produced by most cell types; type II IFN (IFN-γ) which is induced by

antigenic stimuli and is only produced by certain immune cells including natural killer cells,

cytotoxic T cells and helper T cells, and finally type III IFNs (IFN-λ1 to λ3) which are also

induced by viruses (Samuel 2001).

Viral infection has been shown to induce the transcriptional activation of a large number of

cellular genes (Zhu, Cong et al. 1998; Chang and Laimins 2000). Type I IFNs signal cells in an

autocrine and paracrine manner (Heim 1999) via binding to a common cell surface receptor

comprised of two subunits, IFN-α/β receptor (IFNAR)-1 and IFNAR-2 (Samuel 2001). The

type II IFN receptor complex also consists of two subunits, the IFN-γ ligand-binding IFN-γ

receptor-1 (IFNGR) subunit and the accessory subunit IFNGR-2 (Heim 1999). The initiation of

IFN signaling involves the IFN-mediated heterodimerisation of the respective cell surface

receptor subunits (Bach, Aguet et al. 1997). The activation of the type I IFN receptor (Figure

1-9) results in the intracellular activation/phosphorylation of the receptor associated Janus

kinase 1 (Jak1) and tyrosine kinase 2 (Tyk2) and the subsequent phosphorylation of the

latent transcription factors signal transducer and activator of transcription 1 (STAT1) and

STAT2 in the cytoplasm (Samuel 2001). After phosphorylation, STAT1 and STAT2 proteins

form a heterodimer and translocate into the nucleus. Once in the nucleus, the STAT

heterodimer forms a complex with IRF9 and binds to IFN-stimulated response elements

(ISREs), located in the promoter regions of IFN-stimulated genes (ISG) (Samuel 2001). In this

way, more than 100 known ISGs are transcriptionally activated and expressed, resulting in


20

the establishment of an antiviral state in the type I IFN-stimulated cell. Since ISGs include a

whole set of directly anti-viral acting proteins, the ability of viruses to propagate in type I/III

interferon stimulated cells is severely reduced. The importance of type I IFNs in the cellular

defense to virus infection has been demonstrated in type I IFN receptor-knockout mice,

which are unable to establish an antiviral state and hence are much more susceptible to a

range of viruses including Poxviridae, Arenaviridae, Rhabdoviridae and Togaviridae (Samuel

1985).

Figure 1-9 Type I IFN induced Jak/STAT signaling pathway. Abbreviations: IFNAR, interferon-α/β receptor-1; IFNGR, interferon-γ receptor-1; Jak1, Janus kinase 1; Tyk2, tyrosine kinase 2; P, phosphate group; STAT, signal transducer and activator of transcription; ISRE, IFN-stimulated response elements (adapted from Windisch et al, 2005).

IFN-α/β also play an important role in the mediation of apoptosis in virus infected cells

(Samuel 2001). Early destruction of virus infected cells can greatly reduce the

production/yield of progeny viruses and slow virus spread. Primary mouse embryonic

fibroblasts (MEF) undergo apoptosis after infection by Encephalomyocarditis virus (EMCV),


21

Vesicular stomatitis virus (VSV) and Herpes simplex virus (HSV) in cell culture, although

infection by these viruses did not induce apoptosis in MEFs treated with anti-IFN-α/β

antibodies or in type I IFN receptor/STAT-1 defective cells (Tanaka, Sato et al. 1998).

Type II IFN plays an important role in the cellular protection against microbial pathogens,

although a decreased resistance to some viruses such as Herpes simplex virus and Vaccinia

virus has been observed in IFN-γ receptor-knockout mice (Huang, Hendriks et al. 1993; Bach,

Aguet et al. 1997; Cantin, Tanamachi et al. 1999; Samuel 2001).

1.6.2.1 IFN-induced antiviral proteins

The production of IFN in response to viral infection inhibits the replication of viruses due to

the expression of IFN-induced proteins, some of which elicit a variety of different antiviral

effects (Samuel 1991; Stark, Kerr et al. 1998). Genes up regulated in response to IFN

stimulation with a well studied antiviral function include protein kinase R (PKR), 2’,5’-

oligoadenylate synthetase (OAS), RNA-specific adenosine deaminase (ADAR1) and the Mx

protein family (Mx GTPases) (Figure 1-10).

Figure 1-10 Antiviral proteins contributing to the establishment of the antiviral state in IFN-stimulated human cells. From left to right: The MxA GTPase inhibits viral replication by missorting and trapping of viral components into large membrane-associated complexes (the role of GTP hydrolysis in this process is not


22

fully understood). The different IFN-induced oglioadenylate synthetases include OAS1, OAS2 and OAS3. Binding to double-stranded RNA (dsRNA) leads to hetero- and/or homo-oligomerisation and subsequently to the production of oligoadenylates with a 2’-5’phosphodiester bond linkage. These 2-5A oligonucleotides activate the latent endo-ribo-nuclease RNase L, which leads to the degradation of viral and cellular RNAs (in some cell types, the expression of RNase L is also regulated by IFNs). ADAR1 binds to double stranded RNA and catalyses the conversion of adenosine to inosine (A to I). Such editing may occur selectively at one or few positions, or more frequently at a large number of sites. Editing of viral RNA may change the coding sequence, activate an inosine-specific RNase and/or destroy RNA secondary structures by distrupting adenosine/uracil base pairing. The double-stranded RNA-activated protein kinase PKR blocks viral protein translation via phosphorylation and thereby inactivation of eukaryotic initiation factor (eIF-)2α. Furthermore, PKR activates intracellular signaling pathways that contribute to the establishment of a robust antiviral response (adapted from Frese and Dazert, 2008).

1.6.2.1.1 Protein kinase R (PKR)

PKR is an IFN inducible, RNA-dependent kinase found predominantly in the cytoplasm of

type I IFN stimulated cells (Thomis, Floyd-Smith et al. 1992; Samuel 2001). It is expressed in

an inactive form and undergoes autophosporylation, dimerisation and activation in

response to dsRNA produced during viral replication (Clemens and Elia 1997; Randall and

Goodbourn 2008). It is also activated in response to a cellular stress-activated protein, the

PKR-activating protein (Ito, Yang et al. 1999). Post activation, PKR phosphorylates six or

more known substrates including inactive PKR (Thomis and Samuel 1993), the α subunit of

the eukaryotic initiation factor 2 (eIF-2α) and transcription inhibitor IKB (Kumar, Haque et al.

1994). The best characterised substrate for PKR is eIF-2α. The phosphorylation of eIF-2α

results in a decrease in mRNA translation in the host cell blocking mRNA synthesis and viral

protein expression (Samuel 1993).

1.6.2.1.2 2’,5’-Oligoadenylate synthetase (OAS) and RNase L

OAS and RNase L are both IFN-inducible antiviral enzymes that aid in the protection of cells

from viral infection by degrading RNA. Similar to PKR, OAS is synthesised in its inactive form

and requires dsRNA as a cofactor for activation (Randall and Goodbourn 2008). After

binding to dsRNA, OAS undergoes oligomerisation and becomes active. Active OAS catalyses

the conversion of ATP into 2’,5’-linked oligomers of adenosine (2-5A oligonucleotides) (Kerr

and Brown 1978). RNase L, which is constitutively present in most cell types is activated

after binding to the 2-5A oligonucleotides (Samuel 2001). The binding of 2-5A

oligonucleotides to RNase L triggers the dimerisation of RNase L monomers, allowing RNase

L to cleave viral RNA and decrease viral protein expression (Samuel 2001). RNase L deficient

cells are more susceptible to viral infection by EMCV, Picornaviruses, West Nile virus and


23

Paramyxoviruses (Dong, Xu et al. 1994). Active RNase L also degrades some self-mRNA,

which results in the production of small RNA molecules that may act as ligands for

intercellular receptors such as RIG-I and MDA-5 thereby amplifying the antiviral innate

immune response (Malathi, Dong et al. 2007).

1.6.2.1.3 RNA-specific adenosine deaminase (ADAR1)

ADAR1 is an IFN inducible RNA-specific adenosine deaminase. The transcription of ADAR1 is

induced by both IFN-α and IFN-γ and up to a fivefold increase in transcripts can be observed

in cells treated with type I IFN (Patterson and Samuel 1995; Patterson, Thomis et al. 1995).

Structural and functional studies of ADAR1 have shown that the nucleic acid binding

domains are located in the N-terminal region and the C-terminal region constitutes the

catalytic domain of the deaminase (Lai, Drakas et al. 1995; Samuel 2001). The central region

of the ADAR1 open reading frame contains three copies of the dsRNA binding motif

(dsRBMI-III) which are highly similar to each other and to the dsRBM identified in PKR

(Green and Mathews 1992; Kim, Wang et al. 1994; Liu, George et al. 1997).

The modification of mRNA by ADAR1 occurs via the site-specific deamination of adenosine

to inosine. The conversion of adenosine to inosine destabilises double stranded RNA by

disrupting base paring. Adenine-uracil base pairs are exchanged with inosine-uracil pairs,

which are considerably less stable and as a result the RNA becomes more single stranded in

character (Bass and Weintraub 1988). Further, such RNA modification has potential to

change the protein-coding capacity of the edited transcript, as polymerases and ribosomes

recognise inosine as guanine, not adenine (Samuel 2001). This can result in a change in the

amino acids that are coded for in the RNA and potentially prevent the synthesis of

functional viral proteins (Samuel 2001).

1.6.2.1.4 Mx protein family

Mx proteins were originally identified in an inbred mouse strain, that showed exceptionally

high levels of resistance to influenza A virus (Horisberger, Staeheli et al. 1983). The protein

responsible for the increased viral resistance seen in mice was later identified as Mx1

(orthomyxovirus resistance gene 1) (Arnheiter, Skuntz et al. 1990). High levels of Mx1

expression at the initial sites of viral replication were shown to significantly decrease virus

spread and greatly increase survival (Arnheiter, Skuntz et al. 1990). Mx proteins now have


24

been identified in most vertebrates including humans (MxA and MxB). Interestingly, Mx

genes are polymorphic in most species (Haller, Staeheli et al. 2007), which may account for

the different anti-viral mechanisms used by different Mx proteins (Samuel 2001).

The Mx proteins comprise a small family of high molecular weight guanosine

triphosphatases (GTPases) that belong to the super-family of dynamin-like GTPases (Haller,

Staeheli et al. 2007). Structural characteristics of Mx proteins include the presence of a

GTPase domain in the N-terminal region, which is highly conserved and an effector domain

in the C-terminal region containing a leucine zipper (LZ) motif (Haller, Staeheli et al. 2007). A

common trait of large dynamin-like GTPases is their ability to self-assemble into highly

ordered oligomers and to cooperatively hydrolyse GTP (Haller, Staeheli et al. 2007). Mx

proteins have been shown to form homo-oligomers and assemble into ring-like structures in

vitro (Figure 1-11), which appears crucial for GTPase activity and viral recognition

(Nakayama, Yazaki et al. 1993). A mutant MxA with an amino acid exchange in the proximal

part of the LZ region failed to self-assemble and prevented the MxA protein from

hydrolysing GTP, indicating self-oligomerisation is vital for the regulation of MxA GTPase

activity (Janzen, Kochs et al. 2000; Haller, Staeheli et al. 2007). It has also been hypothesised

that the self-oligomerisation maybe prevent protein degradation, as the LZ region mutant

MxA was degraded very rapidly compared to wild-type MxA, which has a half life of over 24

hrs (Haller, Staeheli et al. 2007).

Figure 1-11 MxA GTPase self-assembles into highly ordered oligomers. GTP binding causes a change in conformation, leading to self-assembly of MxA in to ring-like structures (Kochs, Haener et al. 2002).


25

Unlike other IFN induced proteins such as OAS and PKR, Mx proteins are not constitutively

expressed in normal cells. Basal levels of Mx are up regulated in response to IFN-α and IFN-β

stimulation, but not to IFN-γ (Arnheiter, Frese et al. 1996). The antiviral activity of Mx

proteins appears to be species and cell-specific and dependent on virus type (Haller,

Staeheli et al. 2007). MxA has been shown to have an antiviral effect on members of several

different virus families including Bunyaviruses, Orthomyxoviruses, Paramyxoviruses,

Rhabdoviruses, Togaviruses and Picornaviruses (Haller, Frese et al. 1998; Janzen, Kochs et al.

2000; Haller, Staeheli et al. 2007). The exact mechanism through which the antiviral action

of Mx proteins is executed is not entirely understood, but it has been shown that Mx

proteins are able to bind important viral components and thereby inhibit their cellular

movements and function (Kochs and Haller 1999).

1.7 Cell culture systems for caliciviruses

Most caliciviruses cannot be propagated in standard cell culture systems, which has

hampered many areas of calicivirus research and there is currently no cell culture system

available that supports RDHV replication. The same is true or the replication of human

Noroviruses, which are the major cause of non-bacterial gastroenteritis worldwide,

accounting for 50,000 hospitalisations and 23 million cases per year (Mead, Slutsker et al.

1999). Most efforts to generate calicivirus cell culture models presumably have been made

to establish a cell culture system to propagate human noroviruses and a wide variety of

different cell lines have been tested in this regard, but without any success (Duizer, Schwab

et al. 2004).

Currently one can only speculate why most Caliciviruses fail to replicate in cell cultures.

Caliciviruses appear to be very species specific, indicating the need to grow RHDV in Rabbit

cell lines. Furthermore, some animal caliciviruses can be propagated in cell culture and their

respective requirements to replicate in vitro may indicate the best way to start the

establishment of a cell culture system for RHDV. For example, Feline calicivirus has been

successfully propagated in feline kidney cortex cells (Slomka and Appleton 1998; Thumfart

and Meyers 2002), Porcine enteric virus can be grown in kidney epithelial cells (Flynn and

Saif 1988; Parwani, Flynn et al. 1991), the newly discovered primate calicivirus Tulane virus

has also been shown to effectively replicate in monkey kidney cells (Farkas, Sestak et al.


26

2008). Murine Norovirus is currently used as a virus models for human norovirus studies, as

MNV can be propagated to some extent in primary macrophages and dendritic cells of mice

(Wobus, Karst et al. 2004). Investigating effective cell culture systems currently used to

propagate caliciviruses may give insight into the requirements needed to propagate and

study RHDV in cell culture (as outlined in the following paragraphs).

1.7.1 Porcine enteric calicivirus (PECV)

Porcine enteric calicivirus (PECV) successfully grows in cell culture and has therefore been

used as a model to study the replication of enteric caliciviruses. It is currently the only

calicivirus that causes a gastrointestinal disease for which a cell culture system is available

(Chang, Sosnovtsev et al. 2004). The Cowden strain of PECV successfully replicates in

primary and continuous porcine kidney epithelial cells (LLC-PK) (Flynn and Saif 1988;

Parwani, Flynn et al. 1991). Interestingly, PEC growth is dependent on the addition of

intestinal content fluid filtrate from uninfected gnotobiotic pigs (pigs in which only certain

known strains of bacteria and other microorganisms are present) (Miniats and Jol 1978;

Chang, Sosnovtsev et al. 2005). In the absence of intestinal content, no viral protein or RNA

synthesis has been observed in cell culture, which suggests that some substance(s) in the

intestinal content may play an essential role in PEC replication (Chang, Sosnovtsev et al.

2004). Bile acids may be the active factors in the IC that allow PECV growth in vitro, as PECV

growth is inhibited by the addition of cholestyramine resin (bile acid-binding resin) to

intestinal content-treated growth medium (Chang, Sosnovtsev et al. 2004).

A G-protein-linked receptor for bile acids was recently identified and it was shown that the

interaction between this receptor and bile acids results in an increase in the concentration

of intracellular cyclic AMP (cAMP) (Kawamata, Fujii et al. 2003). Bile acids have also been

shown to activate protein kinase A (PKA) pathways in cells (Chang, Sosnovtsev et al. 2004). It

has been suggested that the activation of the PKA and the up regulation of cAMP may play a

role in the immunosuppressive actions associated with bile acids (David, Petricoin et al.

1996; Sengupta, Schmitt et al. 1996; Lee and Rikihisa 1998). The addition of bile acids to the

growth medium of LLC-PK cells causes a significant decrease in IFN-α and IFN-γ mediated

STAT1 phosphorylation (by 30-50%) and the addition of intestinal content (1%) inhibits

STAT1 phosphorylation up to 75% (Figure 1-12) (Chang, Sosnovtsev et al. 2004). The

http://en.wikipedia.org/wiki/Bacteria


27

inhibitory role of bile acids on the innate immune system might be essential to allow for the

replication of PECV in cell culture and in vivo.

Figure 1-12 The relative values (as represented by the value of IFN treatment as 100%) of IFN-γ induced luciferase activity after cells (LLC-PK) were transfected with pGAS-TA-luc plasmid and treated with medium only, IFN-γ, IFN-γ + individual bile acids (GCDCA, TCDCA, TCA, TDCA, TUDCA) and IFN-γ + IC (Chang, Sosnovtsev et al. 2004).

An effective reverse genetics system for PECV has also been developed (Chang, Sosnovtsev

et al. 2005). Infectious PECV RNA was produced in LLC-PK cells after being transfected with a

plasmid containing a full-length PECV genome. Viral capsid PECV proteins were detectable

48 hrs post transfection and infective progeny virus was recovered and passaged (Chang,

Sosnovtsev et al. 2005). The production of viral RNA after transfection with PECV genome

encoding plasmids, was also dependent on the addition of bile acids (such as GCDCA) or IC

(Chang, Sosnovtsev et al. 2005). Recovered recombinant PECV from transfected cells was

shown to be infectious for gnotobiotic pigs via oral inoculation, although reduced virulence,

less severe clinical symptoms and delayed virus shedding was observed in comparison to

infections with wild-type PECV (Chang, Sosnovtsev et al. 2005). These results warrant

further investigation if the use of bile acids could help to establish stable cell culture

systems for other caliciviruses, especially those that grow in tissues were bile fluids are

present.


28

1.7.2 Murine norovirus (MNV)

The strongest argument that calicivirus replication is severely inhibited by type I IFNs comes

from experiments using MNV. MNV was originally identified in immune-compromised mice

(Karst, Wobus et al. 2003). MNV is highly virulent and lethal in mice with defective IFN type I

or IFN type II receptors and STAT1 or recombination-activating gene 2 deficient mice (Karst,

Wobus et al. 2003). STAT1 knockout mice suffer a fatal disease after infection with MNV,

which is not observed in wild type mice (Wobus, Karst et al. 2004; Changotra, Jia et al.

2009). Higher levels of MNV RNA were also observed in the knockout mice (Figure 1-13)

indicating suppression of elements of the innate immune system might be a prerequisite for

efficient MNV replication (Karst, Wobus et al. 2003).

Figure 1-13 The level of viral RNA in the tissues of wild-type and STAT1-/- mice (Karst, Wobus et al. 2003).

A cell culture system for MNV was developed shortly after its discovery, making MNV the

only norovirus with a robust cell culture system and a popular model for studying human

noroviruses. MNV propagates successfully in primary bone marrow-derived macrophages

and dendritic cells from wild-type mice (Wobus, Karst et al. 2004). An increase in viral

replication is seen in MDA5-defective dendritic cells when compared to wild-type dendritic

cells (McCartney, Thackray et al. 2008). Interestingly, type I IFN signalling has been shown to

prevent the accumulation of MNV non-structural proteins and a late step in the replication

cycle of MNV in macrophages in cell culture (Changotra, Jia et al. 2009). These studies again


29

highlight that disabling part(s) of the innate immune system such as the type I IFN signalling

may significantly enhance calicivirus replication, as is true for many other viruses.

1.7.3 Feline calicivirus (FCV)

Feline calicivirus (FCV) is one of the best studied members of the Vesivirus genus because it

replicates effectively in Crandel Reese Feline Kidney (CRFK) cells (Slomka and Appleton

1998; Thumfart and Meyers 2002). No specific innate immune defects or no special

additives to the cell growth medium are necessary to enable FCV replication in CRFK cells.

FCV grows in CRFK cells in medium containing non-essential amino-acids and 10% fetal calf

serum (Slomka and Appleton 1998; Thumfart and Meyers 2002). This cell culture system has

already been used in FCV reverse genetic studies, were infectious FCV particles were

successfully recovered after transfection of CRFK cells with cDNA constructs (Thumfart and

Meyers 2002).

1.7.4 Tulane calicivirus (TCV)

Three monkey kidney cell lines (Vero, MA104 and LLC-MK2) and one human colon

carcinoma cell line (Caco-2) were used in an attempt to cultivate the newly discovered

primate Tulane calicivirus (TCV). The cells were inoculated with sterile filtrate collected from

rhesus macaques stool samples that tested positive, by a TCV-specific RT-PCR (Farkas,

Sestak et al. 2008). The cells were grown in Dulbecco’s modified Eagles medium (MA104,

Vero and Caco-2) or in M199 medium (LLC-MK2) supplemented with 10% fetal bovine

serum, penicillin, streptomycin and amphotericin B (Farkas, Sestak et al. 2008). Cells and

medium were collected 5 days post inoculation and LLC-MK2 cells were the only cells in

which TCV was detectable by RT-PCR (Figure 1-14) (Farkas, Sestak et al. 2008).


30

Figure 1-14 Detection of TCV-specific RNA after the sixth passage of CaCo-2, MA-104, Vero and LLC-MK2 cells inoculated with a TCV-positive stool sample. Mock-infected cells were passaged in parallel with stool-inoculated cells for each cell line. RNA was extracted from 100μl of cell-free tissue culture medium from mock/infected cell culture. RNA extracted from 100μl of TCV-positive stool sample that was used to inoculate the cells originally was used as a positive control (+contr) (Farkas, Sestak et al. 2008).

The replication of TCV was then studied by infecting LLC-MK2 cells with plaque-purified TCV.

TCV caused a visible cytopathic effect on the cells within 24 hrs post inoculation and by 36

to 48 hrs, all cells were rounded and starting to detach (Farkas, Sestak et al. 2008). The viral

titers peaked between 36 to 48 hrs (Farkas, Sestak et al. 2008). The results from this study

indicate the replication cycle of TCV is quite rapid and that TCV can be grown in cell culture.

1.7.5 Rabbit haemorrhagic disease virus (RHDV)

1.7.5.1 Current cell culture systems

Various methods have been attempted to create cell culture systems for RHDV, but so far

efforts have been unsuccessful. An effective cell culture system needs to support several

processes including the entry of the virus into the cell, the production of viral proteins,

replication of the viral genome and the assembly and release of infectious progeny virus.

None of the cell cultures used to propagate RHDV so far have resulted in systems that

support all of these processes and lead to the production of infectious progeny virus (Liu,

Zhang et al. 2006; Liu, Ni et al. 2008).


31

Primary hepatocytes have been used to examine RHDV replication and particle structure,

but this method is not ideal as it is very expensive, laborious and has not been shown to

result in the generation of infectious progeny virus (Konig, Thiel et al. 1998). The infection of

primary hepatocytes with RHDV resulted in the production of VP60 in the cytoplasm of

some cells, indicating at least some RHDV transcription may occur (Konig, Thiel et al. 1998).

A considerable amount of cells do not become infected with RHDV using this method and

infected cells show signs of apoptosis including a decrease in size and condensation of the

nuclei after 48 to 72 hrs post infection (Konig, Thiel et al. 1998).

DNA-based reverse genetic systems have also been used in an attempt to characterise RHDV

protein function and structure. Rabbit kidney (RK-13) cells have been transfected with RNA

transcripts generated in vitro from full-length RHDV genome cDNA clones (Liu, Zhang et al.

2006) and with the cDNA clones (Liu, Ni et al. 2008), which resulted in the production of

viral antigens and had a cytopathic effect on the cells. However, consecutive infection and

re-infection of RK-13 cells was not shown.

1.8 Development towards a new cell culture systems for RHDV

Choosing an appropriate cell line for the propagation of RHDV is difficult as very little is

known about many of the biological aspects of RHDV replication, including potential

receptor specificity or cell tropism. Many different factors need to be considered when

developing a new cell culture system for viruses, for example whether virus replication is

species specific or whether the virus shows tissue tropism.

So far there is no evidence to suggest that RHDV replicates in any species other then

Oryctolagus cuniculus (European Rabbit), proven by extensive trials using a wide range of

animals prior to the planned release of RHDV in Australia (Lenghaus, Westbury et al. 1994).

Also most, if not all of the cell culture models that have been developed for caliciviruses use

cell lines derived from the virus’ natural host and propagation of caliciviruses in non-species

specific cells has so far been unsuccessful (Farkas, Sestak et al. 2008). Therefore, using a

rabbit-derived cell line for the development of RHDV may have a greater potential for

success, than the use of cell lines derived from other species.


32

Many caliciviruses that are currently propagated in cell culture replicate in kidney cell lines,

even though they do not appear to necessarily replicate in these tissues in vivo, and animal

studies have detected higher titers of FCV in alveolar cells (Langloss, Hoover et al. 1978) and

PECV in the proximal small intestine (Guo, Hayes et al. 2001). Using a rabbit kidney cell line

may be a good starting point for the development of a successful cell culture system, as a

rabbit kidney continuous cell line (i.e. RK-13) is readily available, whereas rabbit hepatocytes

are not. Immune cells, such as macrophages and dendritic cells may also enable RHDV

propagation. Large quantities of RHDV can been found in macrophages and monocytes in a

variety of organs after intravascular infection by RHDV (Ramiro-Ibanez, Martin-Alonso et al.

1999), indicating the virus may show a tropism for these immune cells.

The innate immune system has been shown to be a strong cellular defense against viral

infections. Thus, Vero cells which do not produce type I IFN, are commonly used to grow a

variety of viruses, such as Vaccinia virus (Benhnia, McCausland et al. 2009). Cells that do not

produce an effective IFN-induced antiviral response may allow for RHDV growth, which so

far has not been observed in vitro. This hypothesis is supported by the fact that MNV growth

in cell culture is dependent on disabling elements of the IFN signalling pathway and PECV

replication may also rely on a down regulation of the type I IFN response by bile acids.

Interestingly, RHDV has been shown to replicate very rapidly and effectively in vivo, in the

face of a functional innate immune system. It is possible that RHDV grows rapidly enough to

outrun the innate immune response. Other viruses such as highly pathogenic influenza

viruses have been shown to be capable of replicating to very high levels before the antiviral

defense of the innate immune system is fully activated (Haller, Staeheli et al. 2007). RHDV

may not be able to replicate as rapidly in cell culture because available continuous cells do

not support such a rapid rate of replication. RHDV does not replicate successfully in primary

cells in vivo either, which could be the result of sub-optimal growth conditions. Hence, IFN

incompetent cells may provide an advantage that counteracts the potential disadvantage of

suboptimal growth conditions/cells.

It is difficult to determine whether continuous or primary cells are more likely to support

RHDV replication. The use of a continuous cell as a potential cell culture system could be

problematic as continuous cells are derived from tumor cells and may lack specific elements


33

that allow for the growth of RHDV in vivo. Primary cells may more accurately represent the

in vivo replication environment and therefore enhance the chance of replication, although

continuous cell culture systems have many advantages over primary systems as they tend to

be more economical, less laborious to use and more readily available. Also using primary

cells will make the selection of immune incompetent cells difficult, if not impossible, as

primary cells are hard to transfect and to manipulate and show a limited number of

population doubling, only. Therefore it is unlikely that primary cells will ever become the

favourite model. Studies using liver tissue cultures to propagate RHDV have also been

unsuccessful, indicating that RHDV growth in vitro is not only limited in continuous cell lines

(Konig, Thiel et al. 1998).

Taking into account the current literature on caliciviruses and the role of the innate immune

system in the prevention of viral replication, the use of a continuous cell line derived from

rabbit kidney cells (RK-13 cells) was used as a starting point for the development of a new

cell culture system for RHDV in this study.

1.9 Hypothesis and Aims

1.9.1 Hypothesis

It has been shown that the type I IFN response effectively inhibits calicivirus growth (e.g.

that of MNV) (Karst, Wobus et al. 2003; Changotra, Jia et al. 2009). Earlier infection studies

in primary hepatocytes and RK-13 cells showed that these can be infected with RHDV in

vitro, but no viral replication was observed (M. Matthaei, personal communication; (Konig,

Thiel et al. 1998). Hence, the hypothesise that RHDV may replicate more effectively in rabbit

cells with a compromised type I IFN response will be examined in this study.

To address this hypothesis, expression plasmids for DTA and TK1 under the control of the

murine Mx1 promoter were constructed. The Mx1 promoter was chosen as it is specifically

and strongly induced by type I IFNs and has a very low base line activity level (Samuel 2001).

The Mx1 promoter-DTA/TK1 plasmid was then transfected into RK-13 cells. Successfully

transfected cells could be selected for using the antibiotic G418, as both plasmids contain a

neomycin resistance gene, allowing cells containing the plasmid to survive G418 treatment.

The surviving cells will then be treated with a hybrid human type I IFN to stimulate a type I


34

IFN response. Any cell that in response to type I IFN stimulation initiates the type I IFN

Jak/STAT signaling pathway is expected to activate the Mx1 promoter, and express DTA or

TK1. Cells that express DTA should die without further treatment, whereas cells that express

TK1 require a substrate (Ganciclovir) for cell death to occur. Cells surviving this selection

process should have a defect in the type I IFN signaling cascade and can then be tested if

they support RHDV replication

Figure 1-15 Flow chart illustrating the process that will be used in this study to select for RK13 cells with a defect in the type I IFN signaling cascade


35

2 Material and Methods

2.1 Materials

2.1.1 Plasmids

Construct Description

pGL3-Mx1P-Luc Expression vector for firefly luc (luciferase) reporter gene, under

the control of the murine Mx1 promoter. Vector also contains

ampicillin resistance gene.

pKO-Scrambler-DTA Expression vector for DTA gene, under the control of the

phosphoglycerate kinase (PGK) promoter. Vector also contains

ampicillin resistance gene.

pcDNA3.1/V5-His Mammalian expression vector, containing a cytomegalovirus

(CMV) promoter, an ampicillin resistance gene and a neomycin

resistance gene (Invitrogen).

pBluescript-TK1 Expression vector for TK1 gene, under the control of the Lac

promoter. Vector also contains ampicillin resistance gene.

peGFP-N1 Encodes a red-shifted variant of wild-type GFP, which has been

optimized for brighter fluorescence and higher expression in

mammalian cells. Also contains a Neomycin resistance gene.

Table 2-1 Plasmids used in this study.


36

Construct Description

pcDNA3.1-Mx1p-9 Vector plasmid containing the Murine Mx1 promoter and an

ampicillin and neomycin resistance gene.

pcDNA3.1-Mx1p-13 Vector plasmid containing the Murine Mx1 promoter and an

ampicillin and neomycin resistance gene.

pcDNA3.1-Mx1p-DTA-8 Expression vector for DTA ‘death’ gene, under the control of the

Murine Mx1 promoter. Vector also contains ampicillin and

neomycin resistance gene.

pcDNA3.1-Mx1p-DTA-24 Expression vector for DTA ‘death’ gene, under the control of the



pcDNA3.1-Mx1p-TK1-1 Expression vector for TK1 ‘death’ gene, under the control of the



pcDNA3.1-Mx1p-TK1-2 Expression vector for TK1 ‘death’ gene, under the control of the



Table 2-2 Plasmids generated in this study.


37

2.1.2 Oligonucleotides

Name Sequence (5’-3’)

rGAPDH1_fw_278 TCGAAGACGATCAGATACCG

rGAPDH1_rev_425 CCCTTCCGTCAATTCCTTTA

rGAPDH2_fw_470 CCACCTAGAGGAGCCTGTTC

rGAPDH2_rev_633 AATGTAGCCCATTGCTCTCC

rIP10_299fw GCCATCAAGAAGTTGCTGAA

rIP10_446rev CTGCAAACTGAGGCCAATTA

rIP10_55fw AACCATGAACCAAAGTGCAA

rIP10_237rev CATTGTGGCAATGATCTCAA

rMx1_522fw TGACTAAAGCCCAGAACGTG

rMx1_720rev GACCAGGTTGATGGTCTCCT

rMx1_51fw TGGTGGAGAAGAGCACACA

rMx1_203rev GCGTACAGGTTGTTCTCAGG

pGL3_4967fw GCAGGTGCCAGAACATTTCTCTATCG

pGL3_123rev GCGGAACTGGGCGGAGTTAGG

pcDNA3.1_98fw GTTGGAGGTCGCTGAGTAGCG

pcDNA3.1_1039rev ACTCAATGGTGATGGTGATGATGACC

DTA_cl_revNot1 AGGTCCTCGCGCGGCCGCCTGATGAGTTGTTGATTCTTCTAAATC

DTA_cl_fwXho1 TTTGCCGAGCTCCGAGGTCGAGCCCCAGCTGGTTC

DTA_cl_fwNot1 CCTTTTGGCGGCCGCCGAGGTCGAGCCCCAGCTGGTTC

DTA_seqfw1 GCCGCCTGATGATGTTGTTGATTC

DTA_seqfw518 CCATATACTCATACATCGCATCTTGG

DTA_seqrev658 TCAGCCTTCCCTTCGCTGAGG

DTA_417rev AGGCTGAGCACTACACGC

DTA_cl_rev2Not CTGACCTGCGGCCGCTCGCCATGGATCCTGATGATG

Mx1P-int_rev CTCTTCTTACCCTGTCATGCGG

Mx1P-int_fw TGTCCTTCCACCATGTGGCC

pBlueSc_seq_fw GTAAAACGACGGCCAGTG

pBlueSc_seq_rev CAGGAACAGCTATGACC

TK1-int194-fw CCACGCAACTGCTGGTGGC

TK1pA-int188-rev GCCTTCACCCGAACTTGGG

DTA_cl_fwNot1-2 CCTTTTGGCGGCCGCCGAGGTCGAGCCCCAGCTGGTTC

DTA_cl_rev2Not-2 CTGACCTGCGGCCGCTCGCCATGGATCCTGATGATG

Table 2-3 Primers used for analytical and cloning procedures during this study.


38

2.1.3 Buffers, Solutions and Media

Buffer/Solution Composition

TAE (50x) 2 M Tris, 5.7% glacial acetic acid, 50 mM EDTA

DNA loading dye (6x) 2.5 mg/ml bromophenol blue, 400 mg/ml

sucrose

PBS 50 mM potassium phosphate, 150 mM NaCl, pH

7.2

Table 2-4 Buffers and solutions used in this study.

Media Composition

Minimum Essential Medium Eagle (MEM) MEM; 10% fetal calf serum (FCS), 7.5% w/v

sodium bicarbonate, 200 mM L-glutamine, 2 mM

glutamax, penicillin 100 units/l, streptomycin

100 µg/l.

Minimum Essential Medium Eagle (MEM)

/minus FCS

as above, without FCS

FCS Invitrogen

Normal Goat Serum (NGS) NGS diluted to 5% in PBS

Luria-Bertani (LB) 5 g/l yeast extract, 10 g/l tryptone, 5 g/l NaCl.

LBA LB; 100 µg/l ampicillin.

LB Agar LB; 15 g/l agar, 100 µg/l ampicillin (added after

autoclaving).

Table 2-5 Culture mediums used for bacterial and cell culture.


39

2.1.4 Kits

Kit Name Company

RNeasy RNA extraction Kit QIAGEN

QIAprep Spin Miniprep Kit QIAGEN

QIAquick Gel Extraction Kit QIAGEN

QIAquick PCR purification Kit QIAGEN

Nucleobond® Plasmid Purification (mini-

midi-maxi) kit

Nucleobond

Table 2-6 Commercial kits used in this study.

Enzyme kits Company

Tetro cDNA synthesis Kit Bioline

iScript One-Step RT-PCR Kit with SYBR

Green

BIO-RAD

Platinum® Taq DNA polymerase Invitrogen

Platinum® Pfx DNA polymerase Invitrogen

Superscript®III reverse transcriptase Invitrogen

RNase-Free DNase Promega

T4 DNA Ligase Promega

LigaFast™ Rapid DNA Ligation System Promega

T4 DNA polymerase Promega

Calf intestinal alkaline phosphatase (CIAP) Promega

QuantiFast SYBR® Green PCR Kit QIAGEN

QuantiTect® Reverse transcription Kit QIAGEN

Table 2-7 Commercial enzymes kit used in this study


40

2.1.5 Enzymes

Restriction endonucleases Use Company

ApaII Analytical Promega

BamHI Analytical Promega

BglII Cloning Promega

BstzI Cloning Promega

DraI Analytical/cloning Neb

EarI Cloning Neb

EcoRI Analytical/cloning Promega

EcoRV Cloning Promega

HindII Analytical/cloning Promega

HindIII Analytical/cloning Promega

NotI Cloning NEB/Promega

MfeI Analytical/cloning NEB

SacI Analytical Promega

XbaI Analytical Promega

XhoI Cloning Promega

Table 2-8 Restriction endonucleases used for analytic restriction and cloning approaches in this study.

2.1.6 Cell Lines, Bacteria Strains and Viruses

Bacteria Genotype Company

One Shot® TOP10

Chemically Competent E. coli

F- mcrA Δ(mrr-hsdRMS-mcrBC),

φ80lacZΔM15 ΔlacX74 recA1

araD139 Δ(araleu) 7697 galU

galK rpsL (StrR) endA1 nupG

Invitrogen

E.coli XL1blue supE44 hsdR17 recA! endA1

gyrA46 thi relA1 lac- F[proAB+ lacI

lacZΔM15 Tn10(tet)]

Stratagene

Table 2-9 Bacterial strains used in this study


41

Cell line Characteristics

RK-13 A continuous rabbit kidney cell line

SIRC A continuous rabbit cornea epithelial cell line

Table 2-10 Cell lines used in this study.

Serum RHDV +/-

Serum 453 RHDV positive

Serum K31 RHDV positive

Serum 305 RHDV negative

Table 2-11 Serum samples collected from rabbits (either positive or negative for RHDV) which were used in this study

2.1.7 Reagents

Reagent Company

Antibiotic G418 Invitrogen

SYBR® Safe DNA Gel Stain Invitrogen

Lipofectamine® 2000 Invitrogen

Poly(I:C)-Low Molecular Weight (Synthetic

analog of dsRNA – TLR3 ligand)

InvivoGen

Ganciclovir InvivoGen

Universal Type I Interferon [Human

Interferon Alpha A/D (BglII)]

PBL InterferonSource

DAPI (kind gift of Michael Frese)

TritonX (0.25%) Sigma

Formaldehyde Polysciences

Table 2-12 Reagents and treatments used in cell culture experiments in this study.


42

2.1.8 Antibodies

Antibody Dilution Source

Mouse monoclonal antibody to Mx1 protein 1:250 (kind gift of Michael Frese)

Table 2-13 Primary antibodies used in this study for immunofluorescence experiments.

Antibody Dilution Source

Goat polyclonal anti-Mouse IgG (Dylight 488) 1:2000 GeneTec

Table 2-14 Secondary antibodies used for immunofluorescence experiments.


43

2.2 Methods

2.2.1 Molecular Biology Methods

2.2.1.1 Restriction Digestions

Restriction digestions were used to verify the identity of original and constructed plasmids

and during cloning produces. Between 200-300ng of DNA was used to determine during

analysis experiments and up to 5 µg of DNA were used during cloning procedures

(preparative restriction digestions). The units of restriction endonuclease required for a

particular reaction was determined using the following equation (Equation 2-1).

Equation 2-1 Equation used to determine the amount of enzyme (with 100% enzyme activity) required to completely digest template DNA within one hour. *Substrate DNA is the DNA used by supplier to define one unit of the enzyme.

DNA was digested using a suitable restriction endonuclease in the presence of BSA (1

mg/ml) and the buffer recommend by the manufacturer following the manufacturer’s

protocol. All digestions were incubated for 1 -16 hrs and enzymes known to posses star

activity were not used in excess or over extended periods.

2.2.1.2 Polymerase Chain Reaction

DNA amplification for analytical and cloning purposes was performed via polymerase chain

reaction (PCR). For analytical purposes Platinum Taq DNA polymerase was used and for

preparative scale PCRs performed during the construction of plasmids Platinum DNA Pfx

polymerase and platinum DNA Taq polymerase was used. The reaction components and PCR

cycles for both polymerases are described below (Table 2-15, Table 2-16).


44

Compents Amt (µl)

10x PCR buffer 1

5 mM dNTP mixture 0.4

50 mM MgCl2 0.3

Platinum® Taq polymerase

(Invitrogen)

0.1

Primer 1 (10 pmol/µl) 0.5

Primer 2 (10 pmol/µl) 0.5

Template DNA (approx 10 ng) 1

RNase free H2O 6.2

Total 10

Table 2-15 PCR reaction components for DNA taq polymerase used for analytical purposes.

DNA Taq polymerase Amt (µl) DNA Pfx polymerase Amt(µl)

10x PCR buffer 5 10x Pfx amplification buffer 5

5 mM dNTP mixture 2 5 mM dNTP mixture 3

50 mM MgCl2 1.5 50 mM MgCl2 1

Platinum® Taq polymerase 0.2 Platinum® Pfx polymerase 0.4

Primer 1 (10 pmol/µl) 1 Primer 1 (10 pmol/µl) 1.5

Primer 2 (10 pmol/µl) 1 Primer 2 (10 pmol/µl) 1.5

Template DNA 1 Template 1

RNase free H2O 38.3 RNase free H2O 39.6

Total 50 Total 53

Table 2-16 PCR reaction components for DNA Taq/Pfx polymerase used for preparative scale PCR.

The above reactions were prepared on ice and PCR reaction was carried out using a PCR

cycler (eppendorf).


45

Taq DNA polymerase PCR cycle:

1. Initial denaturation: 94°C for 2 min

2. Denature: 94°C for 15secs

3. Anneal*: 55-60°C for 30 secs

4. Extend: 72°C for 1 min per 1kb of PCR product

5. Repeat steps 2 – 4 for 35 cycles

6. Final extension: 72°C for 5 min

*Annealing temperature was optimised for each individual primer set.

Pfx DNA polymerase PCR cycle:

1. Initial denaturation: 94°C for 2min

2. Denature: 94°C for 15secs

3. Anneal: 58°C for 30secs

4. Extend: 68°C for 1min per 1kb of PCR product


6. Final extension: 68°C for 5min

All primers were tested before used for any analysis on known samples to ensure their

applicability and occurrence of only neglectable non-specific amplification. Each primer set

was also shown to produce fragments of expected sizes after PCR amplification. The

separation and analysis of PCR products were performed using gel electrophoresis. Agarose

gels between 0.5 – 2% where prepared using TAE buffer and SYBR safe DNA stain (0.01%).

The DNA samples were separated at approx. 80V for 45 min – 2 hrs (depending on the size

of the expected fragments) using a horizontal gel apparatus. DNA fragments were visualised

under UV illumination using a transilluminator (Alpha Innotech, FluorChem).

2.2.1.3 Gel Extraction and DNA Clean up

DNA digest fragments were separated by electrophoresis on agarose gel. The bands of DNA

were visualised using UV light and fragments of interest were excised using a sterile scalpel.

The isolation of DNA from the agarose was then performed using the QIAquick Gel

Extraction Kit (all buffers and columns used were provided with the kit). The manufactures

protocol was followed; firstly the agarose was solubilised at 50°C in solubilisation binding


46

buffer. Isopropanol was added and the solution was transferred to QIAquick column. The

column was then centrifuged at 12,000rpm for 1 min and washed twice using two separate

wash buffers. The column was then placed in a clean 1.5ml microcentrifuge tube and DNA

was eluted using 30-50 µl of RNase free H2O. DNA samples were stored at -20°C until

required.

2.2.1.4 Vector Dephosphorylation

Linear vector plasmids were dephosphorylated before undergoing ligation to minimise the

occurrence of self ligation. The components used for the desphosphorylation reactions are

listed below.

Component Amount

DNA 30-40 µl

CIAP 10X reaction buffer 5 µl

Calf intestinal alkaline phosphatase (CIAP)

(0.01u/µl)

5 µl

RNase free H2O Up to 50 µl

Table 2-17 Components used in dephosphorylation reactions in this study.

The above components were prepared on ice and incubated at 37°C for 30min. After 30min

another 5µl of CIAP was added and the mixture was incubated at 37°C for an additional

30min. The reaction was terminated by performing a gel extraction (2.2.1.3).

2.2.1.5 Converting 5’ and 3’ overhangs to blunt ends

T4 DNA polymerase was used to fill 5’ over hangs and remove 3’ over hangs generated

during restriction digests, which were then used in blunt end ligation reactions. The

reaction components are described below (Table 2-18).

Component Amount

Plasmid DNA 1 µg

T4 DNA polymerase 5 U

10x T4 DNA polymerase buffer 5 µl

5 mM dNTP 5 µl

H2O Up to 45 µl

Table 2-18 Components used into fill 5’ and 3’ over hangs in this study.


47

The reactions components were prepared on ice and incubated at 37°C for 5 min. The

reaction was terminated via incubation at 75°C for 10 min. The product was cleaned up via

agarose gel extraction using the QIAGEN gel extraction kit (2.2.1.3).

2.2.1.6 Plasmid Purification

Plasmid purification was either performed by running DNA on agarose gel using

electrophoresis and extracting the DNA (see 2.2.1.3). The manufactures protocol was

followed (all buffers and columns used were provided in the kit); firstly a membrane binding

buffer was added to the sample, which was then transferred to a QIAquick spin column. The

column was centrifuged at 13,000xg for 1 min to bind DNA and then washed twice using the

wash buffer supplied. The filter column was placed into a clean 1.5ml microcentrifuge tube

and DNA was eluted using 30-50 µl of RNase free H2O. DNA samples were stored at -20°C

until further analysed.

2.2.1.7 Ligation

DNA ligations were performed using T4 DNA ligase (standard ligation) or T4 DNA ligase –

LigaFast Rapid DNA Ligation System (rapid ligation). The amount of vector and insert DNA

differed depending on the size of vector to insert (Equation 2-2).

Equation 2-2 Used to determine the ng of vector required for the ligation reaction. A 3:1 molar ratio of vector:insert was used for ligations reactions using T4 DNA ligase and 1:2 molar ratio was used for rapid ligation.

The ligation reaction components for each system are listed below.

T4 DNA ligase (standard ligation)

Component Amount

Vector DNA ng*

Insert DNA ng*

T4 DNA ligase (3 u/µl) 0.5 µl

Ligase 10x buffer 1 µl


Table 2-19 Reaction components used for T4 DNA ligation (standard ligation) procedures in this study.


48

T4 DNA ligase (LigaFast Rapid DNA Ligation System)

Component Amount

Vector DNA ng*

Insert DNA ng*

T4 DNA ligase (3 u/µl) 1.5

Ligase 2x buffer 5 µl


Table 2-20 Reaction components used for T4 DNA ligation using the LigaFast Rapid DNA Ligation System.

The above components were prepared on ice. The standard ligation components were

incubated at room temperature for 3 hours and the rapid ligation were incubated at room

temperature for 10 – 15 min. The ligations were directly used in the transformation

procedures (2.2.1.8).

2.2.1.8 Transformation of E.coli

The chemical transformation of E.coli was performed in accordance to the manufactures

protocol. 0.2 – 1 µl of plasmid maxi prep or 1 – 5 µl of ligation reaction was combined with

50 µl of bacteria (OD600=0.6). The mixture was incubated on ice for 30 min, after which it

was heated at 42°C for exactly 75 sec (‘heat shock treatment’). 250 µl of pre-warmed SOC

medium (Invitrogen) was then added to the mixture and it was incubated at 37°C for 1 hr.

Vials were centrifuged at 6000rpm for 2 min, after which 100 µl of supernatant was

removed. The pellet was then resuspended in the remaining 200 µl and 50-200 µl were

plated on LB-agar plates containing ampicillin (100µg/L). Plates were incubated over night at

37°C. Obtained colonies were resuspended in 5 ml of LBA and incubated over night at 37°C

for subsequent DNA extraction (mini prep).

2.2.1.9 Sequencing

Sequencing was used to confirm the identity of some of the original plasmids and generated

plasmids. All sequencing was performed by the Australian Genome Research Facility (AGRF)

Brisbane. The sequencing components sent to AGRF are listed below (Table 2-21).


49

Component Amount

Double stranded plasmid 1000-1500 ng

Primer (10 pmol/µl) 1 µl

RNase free H2O up to 12 µl

Table 2-21 Reaction components sent to AGRF for sequencing.

2.2.1.10 Reverse transcription

The reverse transcription of RNA was performed using several different commercially

available reverse transcription kits, Superscript®III reverse transcriptase kit, Tetro cDNA

synthesis Kit and QuantiTect® Reverse transcription Kit. The reaction components and

procedures followed for each kit are listed below (Table 2-22, Table 2-23, Table 2-24).

Superscript®III reverse transcriptase kit

Step 1.

Components Amt (µl)

Oligo(dT) (50 μM) 1

5 mM dNTP mix 2

Template RNA 2

RNase free H2O 8

Step 2.


5X First-Strand Buffer 4

0.1 M DTT 1

RNaseOUT (40 U/μl) 1

SuperscriptIII RT (200 U/µl) 1

Table 2-22 Composition of reverse transcription reactions using the Superscript®III reverse transcriptase kit. All components were provided by the manufacturer.

The components for step 1 were prepared on ice and incubated at 65°C for 5 min before

being chilled on ice for 2 min. The components from step 2 were prepared on ice and added

to step 1 and mixed gently by pipetting. The reaction mixture was then incubated at 50°C


50

for 45 min, after which the reaction was terminated by heating mixture at 70°C for 15 min.

Samples were stored at -20°C for further analysis.

Tetro cDNA synthesis Kit

Step 1.


Random Hexamer primer mix 1

5 mM dNTP 2

Template RNA 2

RNase free H2O 6

Step 2.


5x RT buffer 4

RNase Inhibitor (10 U/μl) 1

Reverse Transcriptase (200 U/µl) 1

RNase free H2O 4

Table 2-23 Components required for reverse transcription reactions using the Tetro cDNA synthesis transcription Kit. All components were provided by the manufacture.

The components from step 1 were prepared on ice, and then incubated at 65°C for 10 min

before being placed on ice for 2 min. The components from step 2 were then prepared on

ice, after which the component from step 1 and step 2 were combined and incubated for a

further 45 min at 4°C. The reaction was then terminated by heating the reaction mixture to

70°C for 15 min. Samples were then stored at -20°C until required.


51

QuantiTect® Reverse transcription Kit components

Step 1.


7x gDNA Wipeout buffer 2

Template RNA 2

RNase free H2O 10

Step 2.


Quantiscript Reverse transcriptase 1

5x Quantiscript RT buffer 4

RT buffer mix 1

Table 2-24 Components required for reverse transcription reactions using the QuantiTect Reverse transcription Kit. All components were provided by the manufacture.

Components from step 1 were prepared on ice and then incubated at 42°C for 2 min. During

this time components from step 2 were prepared on ice. After the 2 min incubation period

components from step 1 and step 2 were combined and incubated for a further 15 min at

42°C. The reverse transcriptase was then inactivated by heating the reaction mixture to 95°C

for 3 min. The samples were diluted using 82µl of RNase free H2O and kept at -20°C until

required.

2.2.1.11 Real-Time Polymerase Chain Reaction

Several commercially available real-time PCR kits were tested during this study. QuantiFast

SYBR® Green PCR Kit and iScript One-Step RT-PCR Kit with SYBR® Green were both trialled

during experiments performed to optimise the real-time PCR reactions and the QuantiFast

SYBR® Green PCR Kit was used in all following experiments (because it was more cost

effective and showed comparable performance). The components required for each kit are

listed below (Table 2-25).


52

QuantiFast SYBR® Green PCR Kit iScript One-Step RT-PCR Kit with SYBR®

Green

Component Amt (µl) Component Amt (µl)

2x QuantiFast SYBR Green PCR

Master Mix

5 2x SYBR Green RT-PCR reaction

mix

5

Primer 1 (10 pmol/µl) 0.5 Primer 1 (10 pmol/µl) 0.5

Primer 2 (10 pmol/µl) 0.5 Primer 2 (10 pmol/µl) 0.5

H2O 3 H2O 3

Table 2-25 RT-PCR reaction components required for RT-PCR reactions using QuantiFast SYBR® Green PCR Kit and iScript One-Step RT-PCR Kit with SYBR® Green.

96 well plates were used for all RT-PCR reactions. 96 well plates were kept on ice while RT-

PCR reactions were being prepared. Master mixes of above reagents (Table 2-25) were

prepared on ice and 9 µl of master mix was used per well. 1 µl of template (c)DNA was

added to each well after the addition of the master mix. The plates were then sealed and

briefly centrifuged, before being analysed using an rt-PCR thermal cycler (model: CFX96

Real–Time System, C1000 Thermal Cycler, Biorad). The absorbance of ROX and SYBR dyes

were measured.

Several experiments were performed to optimise the RT-PCR reaction conditions and to

make sure the primer pairs chosen worked effectively and no non-specific amplification

occurred. A range of different annealing temperatures (55-65°C) were tested for each

primer set to determine at which temperature optimal amplification occurred. The finally

used rt-PCR conditions are given below.

Rt-PCR cycle (for both QuantiFast SYBR® Green PCR Kit and iScript One-Step RT -PCR Kit with

SYBR® Green):

1. Initial denaturation: 95°C for 5 min

2. Denature: 15°C for 15 secs

3. Anneal: 60°C for 30 secs

4. Extend: 76°C for 10 secs


6. Melt curve analysis (65-95°C ) of reaction products


53

2.2.2 Cell culture methods

2.2.2.1 Culturing cell lines

The continuous rabbit kidney cell line (RK-13) and the continuous rabbit cornea epithelial

cell line (SIRC) used were cultured in MEM (Sigma) supplemented with 10% heat-inactivated

foetal calf serum (FCS, Gibco), sodium bicarbonate 7.5% w/v, 200 mM L-glutamine, 2 mM L-

glutamax, penicillin 100 U/ml and streptomycin 100 µg/ml. The cells were cultured in T75

cell culture flasks with 10 ml of MEM, in a humidified incubator (Sanyo CO2 incubator, model

MCO-17AI) at 37°C with 5% CO2 atmosphere. The cell cultures were passaged every 3-4

days. Cells were passaged after being washed once with 10 ml of sterile PBS, after which 1.5

ml of trypsin (0.5%) was applied to cells. The cells were then placed back into the incubator

for 2 min (or until cells detached completely from the bottom of the flask) and were

resuspended and diluted in fresh MEM + FCS. Cells were also passaged and grown in 6 and

12 well plates and 100mm dishes during different experiments

2.2.2.2 Generation of type I IFN defective RK-13 cell line

In an attempt to generate a type I IFN defective RK-13 cell line, RK-13 cells were passaged

and grown in 100 mm cell culture dishes and transfected with the final Mx1 promoter

DTA/TK1 plasmids generated (Table 2-2). G418 was then applied to select for successfully

transfected cells, after which cells were treated with either recombinant IFN-α or

recombinant IFN-α 500 U/ml and 40 mM ganciclovir (1:10,000) in order to trigger the

transcription of DTA or TK1, respectively.

2.2.2.2.1 Transfection of eukaryotic cells

RK-13 cell transfection was performed using lipofectamine 2000 (Table 2-12) following the

manufactures protocol (Invitrogen). RK-13 cells were seeded into 100 mm cell culture dishes

and incubated over night at 37°C in 5% CO2 atmosphere to obtain 50-60% confluent cells for

transfection. 24 µg of either DTA or TK1 expression plasmids were diluted in 1.5 ml of FCS-

free MEM and subsequently combined with 1.5 ml of lipofectamine (diluted in FCS-free

MEM and incubated at room temperature for 5 min). The mixture of lipofectamine and DNA

was incubated at room temperature for 20 min before being applied drop-wise to the cells.

Transfected cells were then incubated for 5–6 hrs, after which the medium was removed,

and fresh MEM was applied. A plasmid from which eGFP is constitutively expressed in


54

transfected cells was used as to approximate transfection experiments to measure the

transfection efficiencies.

2.2.2.2.2 Antibiotic treatment

An antibiotic titration was performed using G418 to determine the amount of antibiotic

required to kill all RK-13/SIRC cells within 1-2 weeks. RK-13 cells were seeded into a 24 well

plate and different concentrations of G418 were applied to the wells in duplicate. The

concentrations of G418 trialled were 0.25 mg/ml, 0.375 mg/ml, 0.5 mg/ml, 0.75 mg/ml, 1

mg/ml, 1.5 mg/ml and 2 mg/ml. The cells were washed every 3 days, after which fresh MEM

and G418 was applied. The cells were monitored for two weeks to determine the G418

concentration that killed all cells between 10-12 days.

2.2.2.3 Infections

RK-13 cells were infected with different rabbit sera which were either positive or negative

for RHDV (Table 2-11). A variety of different dilutions of the K31 serum (1:3, 1:5 and 1:10)

was used during this study as the original concentration of K31 caused cell death in >90% of

cells after transfection.

RK-13 cells were seeded into 6 or 12 well plates one day prior to infection so that they were

approximately 60% confluent (for RNA extraction) or 80% confluent (for

immunofluorescence staining) the following day. Before infection the cell culture medium

was removed and cells were washed once wit PBS (1 ml of PBS for 12 well plates and 2 ml of

PBS for 6 well plates). After cells were washed the sera were applied (RHDV positive and

RHDV negative sera were applied to separate sides of the plates to minimise the chance of

contamination). 200 µl of serum was applied to wells on the 12 well plates and 400 µl of

serum was applied to wells on the 6 well plates. 1:3, 1:5 and 1:10 dilutions of serum K31

were used. After the sera were applied plates were incubated at 37°C in 5% CO2

atmosphere for 45 min – 1 hrs, after which cells were washed once with PBS and new MEM

was applied (FCS 2%). Cells were incubated for additional 16 hrs before being analysed

further (2.2.2.5, 2.2.2.6).


55

2.2.2.4 Cell treatments

A variety of different treatments were applied to RK-13 during this study in an attempt to

generate an immune response. The different cell treatments are listed below.

2.2.2.4.1 dsRNA transfection

During this study 6 and 12 well plates of RK-13 cells were transfected with dsRNA as

described for plasmid transfections.using 2.5 – 5 µl of dsRNA and Lipofectamine2000. The

amount of lipofectamine2000 used is indicated below.

6 well plate 12 well plate

dsRNA (2.5/5µl) + FCS-free MEM (250µl) dsRNA (2.5µl) + FSC free MEM (100µl)

Lipofectamine (10µl) + FSC free MEM (250µl) Lipofectamine (4µl) + FSC free MEM (100µl)

Table 2-26

2.2.2.4.2 Treatment of cells with dsRNA and IFNα

RK-13 cells were treated with dsRNA and IFN in 6 and 12 well plates. 20 µl of dsRNA was

applied in a drop wise fashion directly to the cell medium or IFNα (500 U/ml) of was used

(also applied directly to the cell culture medium). Treated cells were incubated at 37°C in 5%

CO2 atmosphere over night (approx 16 – 20 hrs) before being used in further experiments

(2.2.2.5, 2.2.2.6)

2.2.2.5 Cellular RNA extraction

Cellular RNA was extracted from RK-13 cells that had undergone a variety of different

treatments (2.2.2.3, 2.2.2.4) in 6 well plates. RNeasy RNA extraction Kit (QIAGEN) was used

for all RNA extractions and the manufacturers’ procedure was followed. The cell culture

medium was removed and all cells were washed twice with 2 ml of PBS, prior to application

of 600 µl cell lysis buffer (RLT with β-Mercaptoethanol, 10 μl/ml). Cells were scrapped from

the wells and collected in 1.5ml centrifuge tubes. Cell lysates were homogenised using

QIAshredder spin columns before undergoing RNA extraction. RNA was extracted using the

buffers and columns provided by the manufacturer and following the manufacturer’s

protocol. RNA samples were kept at -20°C until required (2.2.1.10).


56

2.2.2.6 Immunofluorescence staining

Prior to immunofluorescence staining, RK-13 cells were seeded onto cover slips in 12 well

plates and treated with dsRNA or IFNα as described above (2.2.2.3, 2.2.2.4). Cells were

washed with PBS, fixed via incubation using 2,5% formaldehyde in PBS for 10 min at room

temperature and subsequently permeabilised by applying 1 ml of 0.25% Triton-X100 in PBS

for 10 min at room temperature and washed twice with PBS. 0.5 ml FCS (cells being stained

for Vp60) or NGS (cells being stained for Mx1) was then applied to and left on cells for 30

min before being removed. Cells were washed with PBS and glass cover slides were carefully

removed from wells and place face (cell side) down onto 40 µl of primary antibody (Table

2-13) on parafilm. Cells on the cover slides were kept in the dark for 1 hr before being

placed back in the wells and washed 3 times with PBS. 200 µl of secondary antibody (Table

2-14) was then applied directly to wells and plates were wrapped in aluminium foil (to

prevent light from reaching the cells) and placed on a plate shaker (Ratek Instruments,

model no.MPS1) for 45 min. The secondary antibody was then removed and cells were

washed once before 200 µl of DAPI (1:40,000 (w/vol)) was applied to the wells. Cells were

incubated for exactly 1.5 min before the DAPI was removed and cells were washed 5 times

with PBS, leaving PBS on cells for 1 min each wash. H2O was used to wash cells and excess

H2O was blotted using a clean tissue, before the cover slides were mounted cell bearing side

down to glass slides using Fluoromount (Invitrogen). Slides were stored over night at 4°C

over night to allow Fluoromount to solidify.


57

3 Results

3.1 Generation of cells with a compromised type I IFN response

3.1.1 Construction of pcDNA3.1 Mx1 Promoter Plasmid

We chose to generate the pcDNA3.1 Mx1 promoter plasmid (pcDNA3.1-Mx1P) by replacing

the CMV (Cytomegalovirus) promoter in the pcDNA3.1/V5-His-Mx1P plasmid with the

Murine Mx1 promoter from the pGL3-Mx1P-Luc plasmid. To do that, the CMV and Mx1

promoter had to be excised from the plasmids using MfeI/HindIII and EcoRV/HindIII,

respectively. MfeI and EcoRV are producing complementary overhangs allowing site specific

insertion of the Mx1 promoter into the pcDNA3.1/V5-His plasmid. The Mx1 promoter could

then be ligated into the pcDNA3.1/V5-His plasmid as described in section 2.2.1.7and

transformed into E.coli (2.2.1.8).

Figure 3-1 Vector map of pcDNA3.1/V5-His-Mx1P plasmid, an mammalian expression vector, containing a cytomegalovirus (CMV) promoter, an ampicillin resistance gene and a neomycin resistance gene (Invitrogen).


58

3.1.1.1 Verification of plasmids

The pcDNA3.1/V5-His (kind gift from June Liu, Ecosystems Sciences, CSIRO) and the pGL3-

Mx1P-Luc (kind gift from Georg Koch, Freiburg/Germany) were retransformed in E.coli and

appropriate clones were selected after DNA preparation and restriction digestion analysis

(Table 3-1, Figure 3-2).

Plasmid RE Cutting sites (bp) Expected Fragments

(bp)

pcDNA3.1/V5-His SnabI

HindIII

590

902

312, 5188

pGL3-Mx1P plasmid EcoRI

HindIII

60 (approx)

2328

2268, 5000

Table 3-1 Restriction enzymes (RE) used to digest pcDNA3.1/V5-His and pGL3-Mx1P. Cutting sites in the plasmids and expected fragment sizes are also shown.

Figure 3-2 Restriction digest of pcDNA3.1/V5-His and pGL3-Mx1P as described in section 2.2.1.1 with indicated restriction enzymes (Table 3-1). Fragments were separated using a 1% TBE agarose gel (0.01% SYBR safe DNA stain), visualised under UV illumination. 1a – restriction digest of maxi prep of pcDNA3.1/V5-His using SnabI and HindIII, S – GeneRuler 1kb DNA ladder (relative sizes in basepairs (bp) indicated on the right), 1b – 5b restriction digest of E.coli colonies tested for to contain pGL3_Mx1P_Luc.


59

Restriction digest of the prepared pcDNA3.1/V5-His plasmid (QIAGEN Maxi Prep kit) showed

one band at the expect size (300bp) and one band slightly higher than expected (5,500-

8,000), which, presumably, is a result of the high amount of plasmid loaded onto the

agarose gel. Restriction digest of DNA preparations from E.coli transformed with pGL3-

Mx1P-Luc showed one positive clone (4b), with fragments of the expected sizes (Figure 3-2).

These positive clones were further propagated to amplify sufficient amounts of plasmid for

subsequent experiments (Qiagen maxi prep kit).

3.1.1.2 Preparation Mx1 Promoter Fragment/Vector Backbone

The prepared and verified preparations of pGL3-Mx1P plasmid and pcDNA3.1/V5-His

plasmid were digested in a preparative scale to generate the Mx1 promoter insert and to

linearise pcDNA3.1/V5-His vector plasmid and to remove the CMV promoter upstream of

the multiple cloning site. The restriction endonucleases used are listed below.


(bp)

pcDNA3.1/V5-His MfeI

HindII

161 (downstream of CMV

promoter)

902 (upstream of CMV promoter)

741 CMV promoter

4759 plasmid backbone

pGL3-Mx1P plasmid EcoRI

HindIII

60 (approx) (downstream of Mx1

promoter)

2328 (upstream of Mx1 promoter)

2268 Mx1 promoter

5000 plasmid backbone

Table 3-2 Restriction enzymes (RE) used to digest pcDNA3.1/V5-His and pGL3-Mx1P. Cutting sites in the plasmids and expected fragment sizes are also shown.

The digestion products were run on an agarose gel and the Mx1 promoter and the linearised

pcDNA3.1/V5-His (minus CMV promoter) were excised (Figure 3-3). The DNA fragments

were purified using the Qiagen Gel extraction kit, as described (2.2.1.3).


60

Figure 3-3 Restriction digest of pcDNA3.1/V5-His and pGL3-Mx1P as described in section 2.2.1.1 with the indicated restriction enzymes (Table 3-2). 1a – Restriction digest of pcDNA3.1/V5-His to linearise plasmid and remove pCMV, 1b – Restriction digest of pGL3-Mx1P performed to obtain Mx1 promoter from plasmid, S – GeneRuler 1kb DNA ladder (relative sizes in basepairs (bp) indicated on the left). The linearised pcDNA3.1/V5-His plasmid and the Mx1 promoter were extracted from the 1% TBE gel using a sterile scalpel before photograph was taken.

3.1.1.3 Preparation of Mx1 promoter plasmid

After being excised from the agarose gel, the vector plasmid was dephosphorylated (2.2.1.4)

to minimise self ligation. To create the pcDNA3.1-Mx1P plasmid, the Mx1 promoter (150ng)

was inserted into the linear pcDNA3.1/V5-His plasmid (104ng) using the T4 DNA ligase

(2.2.1.7). Chemically competent E.coli were transformed with 5 µl of the ligation reaction

and plated on LB agar containing ampicillin (2.2.1.8). The bacteria were grown up over night

at 37°C and DNA was prepared from 16 of the obtained clones (Qiagen mini prep kit).

Identification of positive pcDNA3.1-Mx1P clones was done via digestion as described

(2.2.1.1) using the restriction endonuclease given in Table 3-3.


61


(correct orientation)

(bp)

pcDNA3.1-Mx1P XbaI Approx 600bp after start of Mx1

promoter

Approx 50bp after end of Mx1

promoter

Approx 1750bp

Approx 5400bp

Table 3-3 Restriction sites and expected fragment sizes of a restriction digest of the pcDNA3.1-Mx1P plasmid with XbaI.

Figure 3-4 Analytical restriction digest (2.2.1.1) of pcDNA3.1-Mx1P clones using the restriction endonuclease XbaI. Fragments were separated using a 1% TAE agarose gel (0.01% SYBR safe DNA stain) and visualised under UV illumination. 1-16 – Analytical Restriction digest of pcDNA3.1-Mx1P clones, all clones showed fragments close to the approximated sizes, S – GeneRuler 1kb DNA ladder (relative fragment sizes are indicated on the left).

All restriction digests of DNA preparations from E.coli transformed with pcDNA3.1-Mx1P

plasmid resulted in fragments of the expected sizes, indicative of pcDNA3.1-Mx1P plasmids

containing the Mx1 promoter in the correct orientation. Plasmid pcDNA3.1-Mx1P was


62

prepared from clones 9 (pcDNA3.1-Mx1P-9) and 13 (pcDNA3.1-Mx1P-13) (chosen randomly)

using the Qiagen maxi prep kit.

PcDNA3.1-Mx1P-9 and pcDNA3.1-Mx1P-13 were then sequenced (AGRF) using the primers

given in Table 3-4 to confirm that the plasmids contained the Mx1 promoter in the correct

orientation. The pGL3-Mx1P was also sequenced to obtain the Mx1 promoter sequence to

verify the absence of point mutations in the pcDNA3.1-Mx1P constructs.

DNA Primer Area sequenced

pcDNA3.1-Mx1P-13 pcDNA3.1_98fw Segment of vector plasmid

before Mx1 promoter and

beginning of Mx1 promoter.

pcDNA3.1-Mx1P-13 pcDNA3.1_1039rev Segment of vector plasmid

after Mx1 promoter and end of

Mx1 promoter.

pcDNA3.1-Mx1P-9 pcDNA3.1_98fw Segment of vector plasmid



pcDNA3.1-Mx1P-9 pcDNA3.1_1039rev Segment of vector plasmid


Mx1 promoter.

pGL3-Mx1P pGL3_4967fw Segment of vector plasmid



pGL3-Mx1P pGL3_123rev Segment of vector plasmid


Mx1 promoter.

Table 3-4 Plasmids and primers sent to agrf for sequencing. Also shows the regions of the DNA plasmids that should be sequenced using the chosen primers.

Analysis of the obtained sequences showed that both pcDNA3.1-Mx1P-9 and pcDNA3.1-

Mx1P-13 contained the Mx1 promoter in the correct ordination.


63

3.1.2 Construction of TK1 Expression Plasmid

The pcDNA3.1-Mx1P-TK1 construct (pcDNA3.1-Mx1P-TK1) (Figure 3-5) was generated by

inserting the TK1 gene from the pBluescript plasmid (kind gift from Michael Frese, University

of Canberra) into the pcDNA3.1-Mx1P-9/13 plasmids downstream from the Mx1 promoter.

The TK1 gene was excised from the pBlusecript plasmid using BglII and DraI/EarI and over

hangs were removed/filled in using T4 DNA polymerase (2.2.1.5). The vector plasmids

pcDNA3.1-Mx1P-9/13 was linearised using EcoRV, which creates blunt ends. The TK1 could

then be ligated into the pcDNA3.1/V5-His plasmid as described section 2.2.1.7 and


Figure 3-5 Vector map of pcDNA3.1/V5-His-Mx1P-TK1 plasmid, an expression vector for TK1 ‘death’ gene, under the control of the Murine Mx1 promoter. Vector also contains ampicillin and neomycin resistance gene


64

3.1.2.1 Preparation TK1 Gene Fragment/Mx1 Promoter Plasmid

The prepared and verified preparations of pcDNA3.1-Mx1P-9, pcDNA3.1-Mx1P-13 and pKO-

Scrambler-TK1 plasmids were digested in a preparative scale to generate the TK1 gene

insert and to linearise pcDNA3.1-Mx1P vector plasmids as described (2.2.1.1) using the

restriction endonucleases given in Table 3-5.

Plasmid RE Cutting sites (bp) Expected size of fragment

containing TK1 gene (bp)

pKO-Scrambler-TK1 BglII 328 before start of TK1

gene

517 after TK1 polyA tail

Approx 2500

pKO-Scrambler-TK1 DraI

EarI

225 before start of TK1

gene

458 after TK1 polyA tail

Approx 2300

pcDNA3.1-Mx1P EcoRV 2753 7150

Table 3-5 Restriction enzymes used to digest pcDNA3.1/V5-His and pGL3-Mx1P. Respective restriction sites in the plasmids and expected fragment sizes are also shown.


65

Figure 3-6 Preparative restriction digest of pBluescript-TK1 as described in section 2.2.1.1 with indicated restriction enzymes (Table 3-5). Fragments were separated using a 1% TBE agarose gel (0.01% SYBR safe DNA stain) and visualised under UV illumination. 1 – Restriction digest of pBluescript_TK1 using BglII, performed to obtain to obtain TK1 gene 2– Restriction digest of pBluescript_TK1 using DraI and EarI, performed to obtain TK1 gene, 4 – Undigested pBluescript_TK1, S – GeneRuler 1kb DNA ladder (relative sizes in basepairs (bp) indicated on the left).

Separation of the pBluescript-TK1 restriction digestion products (TBE agarose gel) indicated

fragments of the expected sizes for both digestion reactions. The TK1 gene fragments were

excised from the gel using a sterile scalpel and DNA was purified using a Qiagen Gel

extraction kit, as described (2.2.1.3).


66

Figure 3-7 Preparative Restriction digest of pcDNA3.1_Mx1_(3/9) as described in section 2.2.1.1 with indicated restriction enzymes (Table 3-5). Fragments were separated using a 1%TBE agarose gel (0.01% SYBR safe DNA stain) and visualised under a UV illumination. 1 – Undigested pcDNA3.1-Mx1P-13, 2– Undigested pcDNA3.1-Mx1P-9, 3 – Restriction digest of pcDNA3.1-Mx1P-13 using EcoRV, to obtain linear vector plasmid, 4 – Restriction digest of pcDNA3.1-Mx1P-9 using EcoRV, to obtain linear vector plasmid, S – GeneRuler 1kb DNA ladder (relative sizes in basepairs (bp) indicated on the left).

The pcDNA3.1-Mx1P clones 3 and 9 were digested using restriction endonuclease EcoRV

(produces blunt ends). The linearised plasmids were separated on a gel and excised using a

sterile scalpel. The DNA was then extracted from the gel and purified using a Qiagen Gel

extraction kit, as described (2.2.1.3).

3.1.2.2 Preparation of TK1 expression plasmid

The overhangs on the TK1 gene fragments were filled prior to ligation using T4 DNA

polymerase as described section 2.2.1.5., to create blunt ends. The vector plasmids

(pcDNA3.1-Mx1P-(3/9)) were also dephosphorylated (2.2.1.4) to minimise the occurrence of

self ligation during ligation. The TK1 gene was then ligated into the vector plasmid using T4

DNA ligase (rapid ligation protocol) as described in section 2.2.1.7. Chemically competent

E.coli were transformed with 5 µl of the ligation reaction and plated on LB agar containing


67

ampicillin (2.2.1.8). The bacteria were grown up over night at 37°C and the following day

clones were selected (Table 3-6) and DNA was prepared using Qiagen mini prep kit.

Vector backbone TK1 fragment

(digest)

Number of clones

obtained

Number of clones

selected

pcDNA3.1-Mx1P-13 BglII 3 1

pcDNA3.1-Mx1P-13 EarI/DarI 6 4

pcDNA3.1-Mx1P-9 BglII Approx 20 - 50 10

pcDNA3.1-Mx1P-9 EarI/DarI Approx 20 - 50 9

Table 3-6 Number of E.coli obtain and selected after transfection with pcDNA3.1-Mx1P constructs.

Identification of pcDNA3.1-Mx1P-TK1 plasmids which contained the TK1 gene in correct

orientation was done via digestion (2.2.1.1) using the restriction endonuclease given in

Table 3-3. A restriction endonuclease that cuts in the vector backbone and in the TK1 gene

was chosen so that the orientation of the inserted TK1 gene could be determined.

Plasmid RE Expected

Fragments (correct

orientation)

Expected Fragments

(incorrect correct

orientation)

Expected Fragments

(empty vector)

pcDNA3.1-Mx1P-

TK1

XbaI 146, 590, 600, 1400,

6630

146, 590, 1400, 2120,

5050

146, 590, 1400, 5140

Table 3-7 Restriction enzyme (RE) used for the analytical digest of pcDNA3.1-Mx1P-TK1. Restriction sites in the plasmid and expected fragment sizes are shown.


68

Figure 3-8 Analytical restriction digest of a selected pcDNA3.1-Mx1P-TK1 clones (2.2.1.1) using restriction endonuclease SacI. Fragments were separated using a 1% TBE agarose gel (0.01% SYBR safe DNA stain), visualised under a UV illumination. 1 – undigested pBluescript_TK1 plasmid, 2 - pcDNA3.1-Mx1P-TK1 clone (vector backbone pcDNA3.1-Mx1P-13, TK1 digested with BglII), 3 - pcDNA3.1-Mx1P-TK1 clone (vector backbone pcDNA3.1-Mx1P-13, TK1 digested with Eari and DraI), 4 - pcDNA3.1-Mx1P-TK1 clone (vector backbone pcDNA3.1-Mx1P-13, TK1 digested with BglII), 5 - pcDNA3.1-Mx1P-TK1 clone (vector backbone pcDNA3.1-Mx1P-9, TK1 digested with BglII), 6 - pcDNA3.1-Mx1P-TK1 clone (vector backbone pcDNA3.1-Mx1P-9, TK1 digested with BglII), 7 - pcDNA3.1-Mx1P-TK1 clone (vector backbone pcDNA3.1-Mx1P-9, TK1 digested with BglII), S – GeneRuler 1kb DNA ladder (relative sizes in basepairs (bp) indicated on the right).

The restriction digests of pcDNA3.1-Mx1P-TK1 rows 4 and 7 (Figure 3-8) showed fragments

of the expected size for positive clones that contained the TK1 in the correct orientation.

One of the positive clones contained pcDNA3.1-Mx1P-13 as the vector backbone and the

TK1 gene was digested using EarI and DraI (pcDNA3.1-Mx1P-TK1-1) and the other contain

pcDNA3.1-Mx1P-9 as the vector backbone and the TK1 gene was digested using BglII

(pcDNA3.1-Mx1P-TK1-2). DNA preparations of these clones were performed using a Qiagen

maxi prep kit.

PcDNA3.1-Mx1P-TK1-1 and pcDNA3.1-Mx1P-TK1-2 were sent to agrf for sequencing using

primers given in Table 3-8, to confirm that the plasmids contained the TK1 gene in the

correct orientation and with the correct sequence.


69

DNA Primer Area sequenced

pcDNA3.1-Mx1P-TK1-1 TK1-int194-fw Internal section of TK1 gene

pcDNA3.1-Mx1P-TK1-1 pcDNA3.1_1039rev Segment of vector plasmid

after the Tk1 gene and end of

the TK1 gene.

pcDNA3.1-Mx1P-TK1-2 TK1-int194-fw Internal section of TK1 gene

pcDNA3.1-Mx1P-TK1-2 pcDNA3.1_1039rev Segment of vector plasmid

after the Tk1 gene and end of

the TK1 gene.

Table 3-8 Plasmids and primers sent to agrf for sequencing. Also shows the regions of the DNA plasmids that should be sequenced using the chosen primers.

The sequencing results obtained from agrf showed that both plasmids contained the TK1

gene and that the gene had been inserted in the correct orientation.

3.1.3 Construction of DTA Expression Plasmid

The construction of the DTA expression plasmid (pcDNA3.1-Mx1P-DTA) took longer than

originally planned and was successfully generated after the TK1 plasmid. The generation of

the Mx1 promoter plasmid used as the backbone plasmid was the same for the DTA and the

TK1 expression plasmids (3.1.1.3).

The pcDNA3.1-Mx1P-DTA construct (pcDNA3.1-Mx1P-DTA) (Figure 3-9) was generated by

inserting the DTA gene from the pKO-scrambler-DTA plasmid (kind gift from Michael Frese,

University of Canberra) into the pcDNA3.1-Mx1P-9/13 plasmid downstream from the

murine Mx1 promoter. Large amounts of the DTA gene were generated from the pKO-

scrambler-DTA plasmids via preparative scale PCR, using the DTA_cl_fwNot1 and

DTA_cl_revNot1 primers. The DTA PCR products were then digested using restriction

endonuclease NotI and over hangs were removed/filled in using T4 DNA polymerase

(2.2.1.5). The vector plasmids pcDNA3.1-Mx1P-9/13 was linearised using EcoRV (same as

outlined in TK1 expression generation approach 3.1.2.1), which creates blunt ends. The DTA

could then be ligated into the pcDNA3.1/V5_His plasmid as described section 2.2.1.7 and



70

Figure 3-9 Vector map of pcDNA3.1-Mx1 promoter-DTA plasmid, expression vector for DTA ‘death’ gene, under the control of the Murine Mx1 promoter. Vector also contains ampicillin and neomycin resistance gene.

3.1.3.1 Preparation DTA Gene Fragment/Mx1 Promoter Plasmid

The Mx1 promoter plasmids (pcDNA3.1-Mx1P-9/13) were prepared in the same manner as

describe in section 3.1.2.1 and will not be described again in this section.

The DTA gene was amplified via preparative PCR, using using the DTA_cl_fwNot1 and

DTA_cl_revNot1 primers. The PCR products were then purified using QIAquick PCR

purification kit (2.2.1.6). The DTA PCR products were the digested to generate the DTA gene

insert as described (2.2.1.1) using the restriction endonuclease given in Table 3-5Table 3-9.

Template DNA RE Expected fragment size (bp)

DTA PCR product NotI Approximately 1000

Table 3-9 Restriction enzymes used to DTA PCR products, generated using DTA_cl_fwNot1 and DTA_cl_revNot1 primers. The expected fragment size is also shown.


71

Figure 3-10 Preparative Restriction digest of DTA PCR products as described in section 2.2.1.1 with indicated restriction enzymes (Table 3-9). Fragments were separated using a 1%TBE agarose gel (0.01% SYBR safe DNA stain) and visualised under a UV illumination. 1-2 – Digested DTA PCR product, to obtain DTA gene, S – GeneRuler 1kb DNA ladder (relative sizes in basepairs (bp) indicated on the left).

The digested DTA products were run on a agarose gel and excised using a sterile scalpel. The

DNA was then extracted from the gel and purified using a Qiagen Gel extraction kit, as

described (2.2.1.3).

3.1.3.2 Preparation of DTA expression plasmid

The overhangs on the DTA gene fragments were filled prior to ligation using T4 DNA

polymerase as described section 2.2.1.5 to create blunt ends. The vector plasmids

(pcDNA3.1-Mx1-(3/9)) were also dephosphorylated (2.2.1.4) to minimise the occurrence of

self ligation during ligation. The DTA gene was then ligated into the vector plasmid using T4

DNA ligase (rapid ligation protocol) as described in section 2.2.1.7. E. coli XL1blue were


72

transformed with 5 µl of the ligation reaction and plated on LB agar containing ampicillin

(2.2.1.8). The bacteria were grown up over night at 37°C and the following day clones were

selected (Table 3-6) and DNA was prepared using Qiagen mini prep kit.

Identification of pcDNA3.1-Mx1P-DTA plasmids which contained the DTA gene in correct

orientation was performed via digestion (2.2.1.1) using the restriction endonuclease given in

Table 3-3. A restriction endonuclease that cuts in the vector backbone and in the TK1 gene

was chosen so that the orientation of the inserted TK1 gene could be determined.

Plasmid RE Expected Fragments (correct orientation)

pcDNA3.1-Mx1P-DTA NocI 735, 2123, 2475, 3035

Table 3-10 Restriction enzyme (RE) used for the analytical digest of pcDNA3.1-Mx1P-DTA. Restriction sites in the plasmid and expected fragment sizes are shown.

Figure 3-11 Analytical restriction digest of a selected pcDNA3.1-Mx1P_DTA clones (2.2.1.1) using restriction endonuclease NocI. Fragments were separated using a 1% TBE agarose gel (0.01% SYBR safe DNA stain), visualised under a UV illumination. 1 – digested pcDNA3.1-Mx1P_DTA (clones 8/24) plasmid (expected fragment sizes on the right), S – GeneRuler 1kb DNA ladder (relative sizes in basepairs (bp) indicated on the left).


73

The restriction digests of pcDNA3.1-Mx1P-DTA clones 8 and 24 (Figure 3-12Figure 3-8)

showed fragments of the expected size for positive clones that contained the DTA in the

correct orientation. DNA preparations of these clones were performed using a Qiagen maxi

prep kit.

3.1.4 Generation of RK-13 clones

The antibiotic G418 was used in this study to select for cells that were successfully

transfected with DTA/TK1 expression plasmids generated during this study (pcDNA3.1-

Mx1P-TK1 and pcDNA3.1-Mx1P-DTA). An antibiotic titration was performed to determine

the concentration of G418 at which all untransfected RK-13 and SIRC cells died within a 7 –

14 day period. To do that, RK-13 and SIRC cells were seeded in 24 well plates (approx 100%

confluent) and treated with different concentrations of G418 (0.25, 0.37, 0.5, 0.75, 1, 1.5

and 2 mg/ml cell culture supernatant). At a concentration of 1 mg/ml, G418 killed both RK-

13 and SIRC after approximately nine days and was used at this concentration in future

experiments.

100mm cell culture dishes of RK-13 cells (approx 60% confluent) were transfected in

duplicate with the final plasmid constructs pcDNA3.1-Mx1P-TK1-1, pcDNA3.1-Mx1P-TK1-2,

pcDNA3.1-Mx1P-DTA-8 and pcDNA3.1-Mx1P-DTA-24. Approximately 24 µg of DNA was used

for the transfection and a non-transfected plate was kept as a control for the antibiotic

selection process. One plate was transfected with peGFP-N1 was used to measure the

transfection efficiency. Fluorescence was noticeable in 20-30% of cells transfected with

peGFP-N1.

The transfected RK-13 cells and the control RK-13 cells were treated with G418 one day post

transfection to select for successfully transfected cells.


74

Days post

G418

treatment

TK1_1 TK1_2 DTA_8 DTA_24 Control

Starting

Confluency

(pre G418

treatment)

90% 100% 100% 100%

2 days 100% confluent 100% confluent 100% confluent 100% confluent 100% confluent



6 days 5-10% confluent 10% confluent 90% confluent

(most cells rounded)

80% confluent


<10% confluent

(all cells rounded)

10 days 10-20% confluent

(growing in

colonies)

10-20% confluent

(growing in

colonies)

70% confluent


60% confluent


All cells dead

11 days 40% growing in

colonies

30% growing in

Colonies

40% confluent

(Over 80% of cells

rounded)

50%

(Over 80% of cells

rounded)

13 days 80% confluent 70-80% confluent 70% confluent 80% confluent

15 days 100% confluent 100% confluent 100% confluent 100% confluent

Table 3-11 Shows confluency of RK13 cells transfected with pcDNA3.1-Mx1P-TK1-1, pcDNA3.1-Mx1P-TK1-2, pcDNA3.1-Mx1P-DTA-8 and pcDNA3.1-Mx1P-DTA-24 plasmids and treated with 1 mg/ml G418 over a 15 day period.


75

Days post G418

treatment

TK1_1 TK1_2 DTA_24

Starting confluency

(pre G418 treatment)

50% 40% 50%


(some rounded cells)

4 days 10-20% confluent <5% confluent 60% confluent

(Most cells rounded)

7 days 10% confluent

(growing in colonies)

<5% confluent


30% confluent




10-20% confluent


30% confluent




20% confluent


20% confluent



15 days 100% confluent 100% confluent 90% confluent

Table 3-12 Shows confluency of RK13 cells transfected with pcDNA3.1-Mx1P-TK1-1, pcDNA3.1-Mx1P-TK1-2, and pcDNA3.1-Mx1P-DTA-8 plasmids and treated with 1 mg/ml G418 over a 15 day period.

All of the RK13 cells in the control plate were killed in approximately 10 days post G418

treatment. After approximately 6-7 days RK-13 cells transformed with TK1 expression

plasmids reached their lowest confluency (<10%) and formed colonies. RK13 transformed

with DTA expression plasmids did not reach confluency lower then approximately 30%.


76

3.2 Characterisation of Innate Immune Response

3.2.1 Real-Time Polymerase Chain Reaction Analysis

3.2.1.1 Optimisation of Real-Time Polymerase Chain Reaction

3.2.1.1.1 Optimisation of Mx1 primer sets

Figure 3-12 a) amplification of dsRNA transfected RK13 cells cDNA using Mx1 primer set rMx1_522fw/rMx1_720rev (0.3µl) over a temperature gradient of 55-65°C b) melt curves for data shown in a), c) amplification of dsRNA transfected RK13 cDNA using Mx1 primer set rMx1_522fw/rMx1_720rev (0.5µl) over a temperature gradient of 55-65°C and d) melt curves for data shown in c).

The temperature that produced optimal amplification for Mx1 primer set 1

(rMx1_522fw/rMx1_720rev) was 61°C and temperatures below 57°C resulted in slightly less

specific amplification (difference in melting peak seen Figure 3-12 b)). Using a primer

concentration of 500 nM resulted in products with a more consistent melt temperature

than reactions using a primer concentration of 300 nM.


77

Figure 3-13 a) amplification of dsRNA transfected RK13 cells cDNA using primer set Mx1 primer set rMx1_51fw / rMx1_203rev (0.3µl) over a temperature gradient of 55-65°C b) melt curves for data shown in a), c) amplification of dsRNA transfected RK13 cDNA using Mx1 primer set rMx1_51fw / rMx1_203rev (0.5µl) over a temperature gradient of 55-65°C and d) melt curves for data shown in c).

No large difference in amplification was observed over the annealing temperature gradient

trialled, for Mx1 primer set 2 (rMx1_51fw / rMx1_203rev) using 300 nM of primer. A slightly

larger difference was observed when using 500 nM of the primers, although this also in the

production of a second product (two melting temperatures were observed Figure 3-13 d)).

Amplification appeared to be slightly better between 59°C and 61.4°C for Mx1 primer set 2.

Mx1 primer set 1 (using 500 nM of primer) was chosen to measure Mx1 expression in all

subsequent RT-PCR experiments.


78

3.2.1.1.1 Optimisation of GAPDH primer sets

Figure 3-14 a) amplification of dsRNA transfected RK13 cells cDNA using GAPDH primer set rGAPDH1_fw_278/rGAPDH1_rev_425 (0.3µl) over a temperature gradient of 55-65°C b) melt curves for data shown in a), c) amplification of dsRNA transfected RK13 cDNA using GAPDH primer set rGAPDH1_fw_278/rGAPDH1_rev_425 (0.5µl) over a temperature gradient of 55-6°C and d) melt curves for data shown in c).

The optimal amplification temperature observed for GAPDH primer set 1

(rGAPDH1_fw_278/rGAPDH1_rev_425) was 61°C for both concentrations of primers trailed

(300 nM and 500 nM). 500 nM of primer produced a more consistent amplification over the

trialled temperature range.


79

Figure 3-15 a) amplification of dsRNA transfected RK13 cells cDNA using GAPDH primer set rGAPDH2_fw_470/ rGAPDH2_rev_633 (0.3µl) over a temperature gradient of 55-65°C b) melt curves for data shown in a), c) amplification of dsRNA transfected RK13 cDNA using GAPDH primer set rGAPDH2_fw_470/ rGAPDH2_rev_633 (0.5µl) over a temperature gradient of 55-65°C and d) melt curves for data shown in c).

The optimal amplification temperature for GAPDH set 2

(rGAPDH2_fw_470/rGAPDH2_rev_633) was also 61°C and more consistent amplification

across the temperature range was obtained by using a higher concentration of the primers

(500 nM).

GAPDH primer set 1 was slightly more sensitive then GAPDH primer set 2 (had lower Cq

values) and was therefore used in all subsequent RT-PCR reactions.


80

3.2.1.1.1 Optimisation of Ip10 primer sets

Figure 3-16 a) amplification of serum 453 transfected RK13 cells cDNA using Ip10 primer set rIP10_299fw / rIP10_446rev (0.3µl) over a temperature gradient of 55-65°C b) melt curves for data shown in a), c) amplification of dsRNA transfected RK13 cDNA using primer set rIP10_299fw/rIP10_446rev (0.5µl) over a temperature gradient of 55-65°C and d) melt curves for data shown in c).

The temperature range for Ip10 primer set 1 (rIP10_299fw / rIP10_446rev) that produced

optimal amplification as 55 - 61°C. Using a lower concentration of the primers (300 nM)

produced a more consistent of amplification across the annealing temperatures trialled.


81

Figure 3-17 a) amplification of serum 453 transfected RK13 cells cDNA using Ip10 primer set rIP10_55fw/rIP10_237rev (0.3µl) over a temperature gradient of 55-65°C and b) melt curves for data shown in a).

Optimal amplification for Ip10 occurred between 59 - 61°C for Ip10 primer set 2

(rIP10_55fw/rIP10_237rev). Annealing temperatures above and below 59 - 61°C resulted in

noticeable decrease amplification.

Ip10 primer set 1 was used for all subsequent RT-PCR experiments because the product

produced by this primer set had a similar melting temperature to the products produced by

the other primer sets.

3.2.1.2 Type-I IFN response in RK-13 cells

To characterise the type I IFN response in RK13 cells, the rt-PCR assays (3.2.1.1) were used

to measure Ip10, Mx1 and GAPDH expression after treatment with different stimuli. RK13

cells were treated with pIC, IFN or with rabbit serum (2.2.2.4) and RNA was extracted

approximately 16 – 24 hours later (2.2.2.5). The RNA was then reverse transcribed using the

QuantiTect® Reverse transcription Kit (2.2.1.10) to obtained cDNA that could be used in the

rt-PCR assays. This process was performed three times.


82

Figure 3-18 Relative increase in Mx1 mRNA observed in RK13 cells treated with dsRNA, IFN and RHDV compared to control samples. The data obtained was analysed using the delta-delta-Cq quantification model.

Figure 3-19 Relative increase in Ip10 mRNA observed in RK13 cells treated with dsRNA, IFN and RHDV compared to control samples. The data obtained was analysed using the delta-delta-Cq quantification model.

The data obtained from the rt-PCR analysis of the RK13 cell line indicated that Mx1 and Ip10

gene expression is up-regulated in response to transfection with dsRNA and that Mx1 gene

-2

0

2

4

6

8

10

12

14

dsRNA(transfected)

IFNa (500IU/ml)

dsRNA applied RHDVcontaining

rabbit serum(K31)

RHDVcontaining

rabbit serum(453)

rela

tive

incr

eas

e in

Mx1

-mR

NA

Treatment

-1

-0.5

0

0.5

1

1.5

2

2.5

3

3.5

4

dsRNA(transfected)

IFNa (500IU/ml)

dsRNA applied RHDVcontaining

rabbit serum(K31)

RHDVcontaining

rabbit serum(453)

rela

tive

incr

eas

e in

Ip1

0-m

RN

A

Treatment


83

expression is also up-regulated in response to IFN stimulation. There were large differences

in the results obtained for the other treatments (shown by the large error bars) making it

difficult to determine whether the treatment actually causes an up regulation in Ip10 and

Mx1 gene expression.

3.2.1.3 Immunofluorescence Analysis

To determine whether Mx1 protein expression was up-regulated in response to a variety of

different stimuli, an immunofluorescence assay was developed using an Mx1 specific

antibody.

Figure 3-20 Light microscope images of untreated RK13 cells stained with Mx1 specific antibody and DAPI. 1 – Image taken using DIC filter, showing DAPI stain, 2 – Image taken using a brightfield filter set, 3 – Image taken using a GFP filter, Mx1 antibody staining shown in green.

Figure 3-21 Light microscope images of pIC treated RK13 cells stained with Mx1 specific antibody and DAPI. 1 – Image taken using DIC filter, showing DAPI stain, 2 – Image taken using a brightfield filter set, 3 – Image taken using a GFP filter, Mx1 antibody staining shown in green.


84

Figure 3-22 Light microscope images of IFN treated RK13 cells stained with Mx1 specific antibody and DAPI. 1 – Image taken using DIC filter, showing DAPI stain, 2 – Image taken using a brightfield filter set, 3 – Image taken using a GFP filter, Mx1 antibody staining shown in green.

Figure 3-23 Light microscope images of untreated (transfected) RK13 cells stained with Mx1 specific antibody and DAPI. 1 – Image taken using DIC filter, showing DAPI stain, 2 – Image taken using a brightfield filter set, 3 – Image taken using a GFP filter, Mx1 antibody staining shown in green.


85

Figure 3-24 Light microscope images of pIC transfected RK13 cells stained with Mx1 specific antibody and DAPI. 1 – Image taken using DIC filter, showing DAPI stain, 2 – Image taken using a brightfield filter set, 3 – Image taken using a GFP filter, Mx1 antibody staining shown in green.

No significant difference in fluoresence was observed between the controls and the

treatments, as all samples stained positive for Mx1 protein expression


86

4 Discussion

Currently, there is no robust cell culture system available for RHDV, which greatly impedes

studies of this virus. As a result the majority of studies involving RHDV have be done using

an in vivo system (rabbits), which is more expensive and laborious than using an in vitro

alternative. Using animals for studies also involves ethical and regulatory problems, which

can be easily avoided by using a cell culture system. Studies in vitro are also easier to

standardise than studies using animals, as differences between animals, including genetic

differences and differences in infection history and immune status can greatly impact

results. Cell culture systems are commonly used for the study of many aspects of virus

biology including replication cycle, gene function and pathogenicity. Gaining a better

understanding of the biological aspects of RHDV, such as genetic markers associated with

high virulence could also help to improve RHDV mediated biological control strategies

currently used in Australia to contain the impact of rabbits on Australias Flora and Fauna.

RHDV is only one of many viruses belonging to the Calicivirdae family for which a working

cell culture system has not yet been established (Radford, Gaskell et al. 2004). There are

currently no cell culture systems available for any of the caliciviruses affecting humans, even

though the calicivirus family contains several important human pathogens, including human

Noro- and Sapporo viruses (Li, Predmore et al. 2012). Human Norovirus is one of the leading

causative agents of food-borne disease worldwide and currently there is no in vitro system

or small animal model available in which the virus can be studied (Li, Predmore et al. 2012).

As a result most of the insights into human calicivirus pathophysiology have been obtained

through extensive studies using healthy human volunteers (Dolin, Blacklow et al. 1971;

Dolin, Blacklow et al. 1972; Atmar, Opekun et al. 2008; Vashist, Bailey et al. 2009). A cell

culture system for human Norovirus would aid in the development of antiviral drugs,

potential vaccines production and would be a useful diagnostic tool. The development of a

cell culture system for RHDV may provide insights into what is required for the propagation

of other caliciviruses in vitro, such as caliciviruses affecting humans.

A few caliciviruses have been successfully cultured in vitro, including PECV, MNV, FCV and

TCV. An interesting recurring feature in the development of cell culture systems for some of

these virus is need to suppress the type I IFN response (Flynn and Saif 1988; Parwani, Flynn


87

et al. 1991; Slomka and Appleton 1998; Farkas, Sestak et al. 2008). Suppression of

components of innate immune responses, namely the type I IFN system has been shown to

result in increased viral propagation for many viruses, including Polio Virus, Herpes Simplex

Virus, Hepatitis B Virus, Human immunodeficiency virus and Murine Norovirus (Pierce,

DeSalvo et al. 2005; Barnes, Kunitomi et al. 2008; McCartney, Thackray et al. 2008; Akhtar,

Qin et al. 2010; Li, Hu et al. 2011; Belloni, Allweiss et al. 2012). The stimulation of type I IFN

is the first line of defence cells have against viral infection and results in expression of many

IFN induced proteins known to inhibit viral replication (Samuel 2001). Type I IFNs were

shown to effectively inhibit the propagation of MNV in vitro and in vivo in macrophages and

dendritic cells (Karst, Wobus et al. 2003; Chang, Sosnovtsev et al. 2004; McCartney,

Thackray et al. 2008). It is also believed that type I IFN induced antiviral proteins prevents

PECV propagation in vitro. PECV replication in cell culture depends on the addition of

intestinal filtrate, which subsequently has been shown to suppress the type I and type II

response and enable efficient viral replication (Chang, Sosnovtsev et al. 2004). Bile acids, are

the active compounds found in intestinal filtrate which suppress the type I IFN response

through the up-regulation of cAMP and the activation PKA, but the downstream effectors

have not been indentified (David, Petricoin et al. 1996; Sengupta, Schmitt et al. 1996; Lee

and Rikihisa 1998). This lead to the hypothesis that RHDV growth, that hasn’t been observed

in vitro so far, may be enhanced significantly in cells with a compermised type I IFN

response.

To test the hypothesis the main aim of this study was to develop a method for selecting type

I IFN defective cells and whether this cell line supported the growth of RHDV. The chosen

approach to generate a cell line with a defect in the type I IFN response was based on the

assumption that due to mutations which occur consistently, even though rarely, such cells

will be present in of cultured cells. To select these few cells we generated expression

plasmid containing a death gene under the control of an IFN inducible promoter. The two

plasmids used carried either DTA or TK1 under the control of the murine Mx1 promoter. A

vector plasmid was chosen for the construction of these plasmids that contained a

neomycin resistance gene so to allow for selection of transfected cells using the antibiotic

G418. The mouse Mx1 promoter from the pGL3-Mx1P reporter plasmid (kindly provided by

Georg Koch, Freiburg/Germany) was used as it has been shown to be strongly activated in


88

IFN stimulated cells (Jorns, Holzinger et al. 2006). Further. the murine Mx1 promoter shows

extremely low basal activity in unstimulated cells, unlike other Mx promoters, such as the

human MxA promoter (Holzinger, Jorns et al. 2007). DTA and TK1 have been extensively

studied in regard to their ability to induce cell death in tumour or Cytomegalovirus infected

cells. (Yamaizumi, Mekada et al. 1978; Fillat, Carrio et al. 2003).

This approach has the advantage of resulting in the generation of cells that are unable to

mount a type I IFN induced antiviral state, due to inability to stimulate type I IFN inducible

promoters (Samuel 2001). Other methods considered to obtain IFN defective cells, including

RNA interference or suppression of the IFN system via chemical inhibitors only disable the

IFN immune response temporally. On the other hand, the more direct approach of targeted

gene knock-out as routinely done in mice, was considered to be too laborious, expensive

and neglected due to the lack of established procedures for rabbit cells.

After transfection of RK13 cells with one of the two constructs and subsequent selection

with G418, IFN or IFN and ganciclovir will be used to treat cells transfected with the DTA and

TK1 expression plasmids, respectively. The DTA gene was originally chosen as the selector

gene for IFN defective cells, as DTA has been shown to have a very efficient cytopathic on

cells, even at concentrations as low as one DTA molecule per cell (Yamaizumi, Mekada et al.

1978; Bell and Eisenberg 1996). A potential problem of using DTA in this approach is that the

bystander effect of DTA may result in cell death of all cells surrounding cells with intact IFN

signalling pathway. If this turned out to be correct the DTA plasmid would be of no use as a

selector for type I IFN defective cells. To address this problem a TK1 (from herpes simplex

virus) expression plasmid was also constructed in addition to the DTA expression plasmid.

TK1 has also been shown to be capable of causing cell death but unlike DTA, TK1 requires

the addition of a specific substrate ganciclovir to initiate a cytopathic effect (Solaroli,

Johansson et al. 2008). The combination of TK1 and ganciclovir has been used to target

cancer cells in several human trials and in a wide variety of animal tumour models (Fillat,

Carrio et al. 2003; Solaroli, Johansson et al. 2008). Unlike DTA the bystander effects of TK1

can be controled to a certain degree by using different concentrations of IFN/ganciclovir,

which is why it was chosen in case the DTA expression plasmid does not produce any clones.


89

TK1 requires the addition of a substrate (ganciclovir) in order to cause cell death, whereas

DTA does not (Fillat, Carrio et al. 2003).

As a result of the work performed during this study an expression plasmids for DTA and TK1

were successfully constructed that can be used for the selection of type I IFN defective cell

lines. RK13 cells were effectively transfected with both constructs and the best conditions to

select successfully transfected cells via G418 were determined during this study. This

approach has the advantage of producing large pools of cells with selectable markers

(DTA/TK1). The next step would be to treat the transfected RK13 cells with IFN and

IFN/Ganciclovir and see if cellular death occurred. Cells surviving the selection could then be

infected with RHDV to examine if viral propagation is improved in the absence of a

functional type I IFN response.

The second aim of our study was to verify our hypothesis that the type I IFN system plays a

role in the suppression of RHDV growth in vitro, by characterising the type I IFN-mediated

innate immune response in RK13 cells. We also wanted to generate data describing the

interplay between RHDV infection in RK13 cells and the innate immune response. One way

of gauging the IFN response in RK13 cells was to develop rt-PCR assays that could be used to

measure the level of mRNA expression of different IFN inducible genes, such as Ip10 and

Mx1 (Samuel 2001) in RK13 cells. Primers were developed for Ip10, Mx1 and GAPDH (Table

2-3) and used in preliminary PCR reactions to determine whether the DNA products

produced were of the expected size (data not shown). GAPDH mRNA levels were used as an

endogenous control during this study, as GAPDH expression is constant and should be not

affected by the experimental manipulation performed during this study (Bustin 2000). The

primers were then used in preliminary rt-PCR experiments to optimise conditions including

annealing temperatures and primer concentrations and to choose the primer sets that

produced specific and sensitive amplification. We were able to successfully detect Mx1, Ip10

and GAPDH mRNA in the cDNA samples and optimise the rt-PCR conditions to increase

sensitivity and decrease non-specific product amplification (see section 3.2.1.1).

The rt-PCR assays were then used to characterise the IFN response in RK13 cells. To

measure the IFN response we treated RK13 cells with two separate stimuli known to induce

type I IFN induction, pIC and hybrid human IFN-α (Baum and Garcia-Sastre 2010). RK13 cells


90

were also infected with two different rabbit sera known to contain RHDV virus and a mock

serum (Table 2-11). RNA was then extracted from the cells. Remarkably, even though a

different stimuli known to induced an IFN response (pIC and IFN) were applied to the cells

(Liu, Sanchez et al. 2012), little induction of IFN-stimulated genes transcription (Mx1, IP10)

was observed, indicating either an intrinsically low ability of RK13 cells to respond to IFN or

a possible contamination of the used cells (viruses, mycoplasma, bacterial).

The rt-PCR assays allowed for the expression of mRNA of type I IFN inducible proteins to be

measured, but do not indicate whether the mRNA is transcribed into proteins. Many viruses

have developed mechanisms that inhibit or suppress various IFN induced antiviral

mechanisms, to allow for increased viral replication. For example Influenza A Virus encodes

a non structural protein NS1, which is capable of blocking posttranscriptional processing of

cellular mRNAs (Kochs, Garcia-Sastre et al. 2007). This decreases the up regulation of IFN

induced antiviral proteins, counteracting the host cells antiviral response and increases viral

replication (Kochs, Garcia-Sastre et al. 2007). The rt-PCR assays do not allow us to determine

whether RHDV was capable of decreasing the antiviral effect of IFN by suppressing antiviral

protein mRNA transcription. To counter act this problem we developed a second assays to

measure the expression of Mx1 proteins in RK13 cells.

An Mx1 specific antibody shown to work previously was used in this study to gauge the level

of Mx1 expression in stimulated RK13 cells. Different concentrations of the Mx1 antibody

and secondary antibodies were trialled to optimise staining conditions before Mx1

characterisation experiments were conducted. An immunofluorescence staining procedure

for Mx1 was successfully established. The Mx1 antibody was shown to specifically stain

Mx1, producing very little background staining. RK13 cells were treated with pIC, IFN and

infected with RHDV containing rabbit serum and mock serum, to determine whether these

treatments caused an up regulation of Mx1.

The results obtained from the Mx1 immunofluorescence were similar to the results

obtained from the rt-PCR experiments. An up regulation of Mx1 protein expression was

observed in the positive controls (pIC and IFN treated cells), the negative controls

(untreated and mock serum infected cells) and the in RHDV infected cells. This again

indicated that either RK13 cells have a low intrinsically response to IFN or that the cell


91

culture was contaminated and that Mx1 expression was being up regulated in response to

the contamination.

Indicative of a cellular contamination was the fact that unstimulated had a comparable

abundance of Mx1 and IP10 mRNA to the treated cells. Also similar expression levels of Mx1

were observed in the control and treatment groups after staining with the Mx1 antibody.

Previous studies using the same Mx1 specific antibody did not show Mx1 staining in

untreated cells, so it was very unusual that the untreated RK13 were positive for Mx1

expression.

It was speculated that the contrasting findings were mostly likely the result of cell culture

contamination, so Bovine Viral Diarrhea Virus was tested for. BVDV was the first possible

contaminant tested for as is it commonly found in a variety of different cell culture lines

from species including, rabbits, deer, sheep, goats and bovine (Bolin, Ridpath et al. 1994).

Non-cytopathic strains of BVDV virus are capable of persistently infecting cells in culture

without inducing apoptosis or showing signs of viral infection (Schweizer and Peterhans

2001). The non-cytopathic strains of BVDV are frequently found in fetal bovine serum (FBS)

(Molander, Boone et al. 1971), which is commonly used in mammalian cell cultures. A

survey was conducted in the early 90s for the presence of BVDV in a variety of cell lines and

showed positive results of BVDV infection in the RK13 cell line tested, indicating RK13 cells

are susceptible BVDV infection (Bolin, Ridpath et al. 1994). BVDV studies have also shown

that BVDV infection decreases the expression of IFN and suppresses apoptosis in response

to pIC in bovine macrophages (Schweizer and Peterhans 2001).

The RK13 cell line used during this study was tested for BVDV by Andrew Read, Elizabeth

MacArthur Agricultural Institute, NSW and results showed the RK13 cells were positive for

BVDV. This could explain why no signification up regulation of the IFN-stimulated genes

(Mx1 and Ip10) for was observed in the stimulated RK13 cells. To accurately characterise the

type I IFN response in RK13 cells and determine whether they are a good cell choice for the

develop of a RHDV cell culture system a non contaminated batch of RK13 cells would need

to be obtained and tested.

Unfortunately because of time constraints the designed approach to develop a cell culture

system for RHDV could not be completed during this study, we are therefore unable to say


92

whether or not it would have been successful. If the approached out lined in this study

proved to be unsuccessful, several other approaches could be used as alternatives or in

addition our approach to develop a cell culture system for RHDV.

Several other rabbit cell lines are readily available (such as SIRC cell line) and could be

trialled as an alternative if the RK13 cell line proved to be a poor choice of cell lines. Rabbit

hepatocytes or macrophages may support RHDV growth, as large quantities of the virus are

found in the liver tissue after in vivo infection and macrophages were used to successfully

propagate related MNV in cell culture. Potential cell lines could be screened for factors

other than defectives in the type I IFN response that may enhance the chance of viral

replication occurring. For example Sialic acids (SA) have recently have been identified as

attachment factors for RHDV and MNV (Nystrom et al, 2011, Taube et al., 2009). In the case

of RHDV these SAs are histo blood group antigen associated. Potential cell lines could be

screened in advance to determine whether or not they express the respective Glykosides, in

addition to characterising there type I IFN response. This could increase the likelyhood of

cell types supporting RHDV growth.

Different cell treatments that suppress the IFN mediated antiviral response could also be

trialled if our approach proved to be unsuccessful. Bile acids were shown to be curial for the

growth of PECV in cell culture and are believed to play a role in the down regulation of the

IFN response (ref). In this regard, pre-treatment of virus inoculum with bile extracts should

be tried as well. Cells could be treated with bile acids and then infected with RHDV to see if

this increases virus propagation. Another alternative is the use of siRNAs, which are double

stranded, sequence-specific inhibitors of gene expression, which can be used to down

regulate the type I IFN response (Rossi 2009).

Although the original aims of this study were not met due to time constraints, the

constructs and methods developed will be very helpfully in future attempts to develop a cell

culture system for RHDV and other viruses which do not have a working cell culture system.

As a result of the BVDV contamination the information on the RK13 cell IFN response could

not be obtained, but the methods developed to measure IFN response in cells will help

future efforts to characterise the innate immune response in RK13. The assays developed

can be used to screen for other cell lines if RK13 cells are shown to be a poor choice. Time


93

constraints prevented us from using the DTA and TK1 expression plasmids to select for IFN

defective cells in this study, but they will be a useful tool to screen for IFN defective cells in a

range of different cell types in future studies. As a result of this study, there is a good

foundation to try to generate the type I IFN defective cells and study the involvement of

innate immune responses in rabbit cells in regard to RHDV/RCV infection, in any cell line

deemed promising


94

5 References

Akhtar, L. N., H. Qin, et al. (2010). "Suppressor of cytokine signaling 3 inhibits antiviral IFN-beta signaling to enhance HIV-1 replication in macrophages." Journal of Immunology 185(4): 2393-2404.

Akira, S. (2009). "Pathogen recognition by innate immunity and its signaling." Proceedings of

the Japanese Academy, Series B, Physical and Biological Sciences 85(4): 143-156. Arnheiter, H., M. Frese, et al. (1996). "Mx transgenic mice--animal models of health."

Current Topics in Microbiology and Immunology 206: 119-147. Arnheiter, H., S. Skuntz, et al. (1990). "Transgenic mice with intracellular immunity to

influenza virus." Cell 62(1): 51-61. Atmar, R. L., A. R. Opekun, et al. (2008). "Norwalk virus shedding after experimental human

infection." Emerging Infectious Diseases 14(10): 1553-1557. Bach, E. A., M. Aguet, et al. (1997). "The IFN gamma receptor: a paradigm for cytokine

receptor signaling." Annual Review of Immunology 15: 563-591. Bamming, D. and C. M. Horvath (2009). "Regulation of signal transduction by enzymatically

inactive antiviral RNA helicase proteins MDA5, RIG-I, and LGP2." Journal of Biological Chemistry 284(15): 9700-9712.

Barnes, D., M. Kunitomi, et al. (2008). "Harnessing endogenous miRNAs to control virus

tissue tropism as a strategy for developing attenuated virus vaccines." Cell Host Microbe 4(3): 239-248.

Barnich, N., J. E. Aguirre, et al. (2005). "Membrane recruitment of NOD2 in intestinal

epithelial cells is essential for nuclear factor-{kappa}B activation in muramyl dipeptide recognition." Journal of Cell Biology 170(1): 21-26.

Barral, P. M., D. Sarkar, et al. (2009). "Functions of the cytoplasmic RNA sensors RIG-I and

MDA-5: key regulators of innate immunity." Pharmacology & Therapeutics 124(2): 219-234.

Bass, B. L. and H. Weintraub (1988). "An unwinding activity that covalently modifies its

double-stranded RNA substrate." Cell 55(6): 1089-1098. Baum, A. and A. Garcia-Sastre (2010). "Induction of type I interferon by RNA viruses: cellular

receptors and their substrates." Amino Acids 38(5): 1283-1299. Bell, C. E. and D. Eisenberg (1996). "Crystal structure of diphtheria toxin bound to

nicotinamide adenine dinucleotide." Biochemistry 35(4): 1137-1149.


95

Belloni, L., L. Allweiss, et al. (2012). "IFN-alpha inhibits HBV transcription and replication in cell culture and in humanized mice by targeting the epigenetic regulation of the nuclear cccDNA minichromosome." Journal of Clinical Investigation 122(2): 529-537.

Benhnia, M. R., M. M. McCausland, et al. (2009). "Vaccinia virus extracellular enveloped

virion neutralization in vitro and protection in vivo depend on complement." Journal of Virology 83(3): 1201-1215.

Berke, T., B. Golding, et al. (1997). "Phylogenetic analysis of the Caliciviruses." Journal of

Medical Virology 52(4): 419-424. Berke, T. and D. O. Matson (2000). "Reclassification of the Caliciviridae into distinct genera

and exclusion of hepatitis E virus from the family on the basis of comparative phylogenetic analysis." Archives of Virology145(7): 1421-1436.

Best, S. M. and P. J. Kerr (2000). "Coevolution of host and virus: the pathogenesis of virulent

and attenuated strains of myxoma virus in resistant and susceptible European rabbits." Virology 267(1): 36-48.

Bolin, S. R., J. F. Ridpath, et al. (1994). "Survey of cell lines in the American Type Culture

Collection for bovine viral diarrhea virus." Journal of Virology Methods 48(2-3): 211-221.

Burnet, F. M. (1952). "Myxomatosis as a method of biological control against the Australian

rabbit." American Journal of Public Health and the Nation's Health 42(12): 1522-1526.

Bustin, S. A. (2000). "Absolute quantification of mRNA using real-time reverse transcription

polymerase chain reaction assays." Journal of Molecular Endocrinology 25(2): 169-193.

Cantin, E., B. Tanamachi, et al. (1999). "Role for gamma interferon in control of herpes

simplex virus type 1 reactivation." Journal of Virology 73(4): 3418-3423. Capucci, L., G. Frigoli, et al. (1995). "Antigenicity of the rabbit hemorrhagic disease virus

studied by its reactivity with monoclonal antibodies." Virus Research 37(3): 221-238. Capucci, L., P. Fusi, et al. (1996). "Detection and preliminary characterization of a new rabbit

calicivirus related to rabbit hemorrhagic disease virus but nonpathogenic." Journal of Virology 70(12): 8614-8623.

Chang, K. O., S. S. Sosnovtsev, et al. (2005). "Reverse genetics system for porcine enteric

calicivirus, a prototype sapovirus in the Caliciviridae." Journal of Virology 79(3): 1409-1416.

Chang, K. O., S. V. Sosnovtsev, et al. (2004). "Bile acids are essential for porcine enteric

calicivirus replication in association with down-regulation of signal transducer and


96

activator of transcription 1." Proceedings of the National Academy of Sciences of the United States of America 101(23): 8733-8738.

Chang, Y. E. and L. A. Laimins (2000). "Microarray analysis identifies interferon-inducible

genes and Stat-1 as major transcriptional targets of human papillomavirus type 31." Journal of Virology 74(9): 4174-4182.

Changotra, H., Y. Jia, et al. (2009). "Type I and type II interferons inhibit the translation of

murine norovirus proteins." Journal of Virology 83(11): 5683-5692. Chasey, D., R. C. Trout, et al. (1997). "Susceptibility of wild rabbits (Oryctolagus cuniculus) in

the United Kingdom to rabbit haemorrhagic disease (RHD)." Veterinary Research 28(3): 271-276.

Clarke, I. N. and P. R. Lambden (1997). "The molecular biology of caliciviruses." Journal of

General Virology 78 ( Pt 2): 291-301. Clemens, M. J. and A. Elia (1997). "The double-stranded RNA-dependent protein kinase PKR:

structure and function." Journal of Interferon Cytokine Research 17(9): 503-524. Collins, B. J., J. R. White, et al. (1995). "A competition ELISA for the detection of antibodies

to rabbit haemorrhagic disease virus." Veterinary Microbiology 43(1): 85-96. Cooke, B. D. (2002). "Rabbit haemorrhagic disease: field epidemiology and the management

of wild rabbit populations." Revue Scientific Technique 21(2): 347-358. David, M., E. Petricoin, 3rd, et al. (1996). "Activation of protein kinase A inhibits interferon

induction of the Jak/Stat pathway in U266 cells." Journal of Biological Chemistry 271(9): 4585-4588.

Dolin, R., N. R. Blacklow, et al. (1972). "Biological properties of Norwalk agent of acute

infectious nonbacterial gastroenteritis." Proceedings of the Society for Experimental Biology and Medicine 140(2): 578-583.

Dolin, R., N. R. Blacklow, et al. (1971). "Transmission of acute infectious nonbacterial

gastroenteritis to volunteers by oral administration of stool filtrates." The Journal of Infectious Diseases 123(3): 307-312.

Dong, B., L. Xu, et al. (1994). "Intrinsic molecular activities of the interferon-induced 2-5A-

dependent RNase." Journal of Biological Chemistry 269(19): 14153-14158. Duizer, E., K. J. Schwab, et al. (2004). "Laboratory efforts to cultivate noroviruses." Journal of

General Virology 85(Pt 1): 79-87. Farkas, T., K. Sestak, et al. (2008). "Characterization of a rhesus monkey calicivirus

representing a new genus of Caliciviridae." Journal of Virology 82(11): 5408-5416.


97

Fenner, F. (1958). "Myxomatosis in Australian Wild Rabbits - Evolutionary Changes in an Infectious Disease." Harvey Lectures (53): 25-55.

Fenner, F. (2010). "Deliberate introduction of the European rabbit, Oryctolagus cuniculus,

into Australia." Revue Scientific Technique 29(1): 103-111. Fillat, C., M. Carrio, et al. (2003). "Suicide gene therapy mediated by the Herpes Simplex

virus thymidine kinase gene/Ganciclovir system: fifteen years of application." Current Gene Therapy 3(1): 13-26.

Fitzgerald, K. A., S. M. McWhirter, et al. (2003). "IKKepsilon and TBK1 are essential

components of the IRF3 signaling pathway." Nature Immunology4(5): 491-496. Flynn, W. T. and L. J. Saif (1988). "Serial propagation of porcine enteric calicivirus-like virus

in primary porcine kidney cell cultures." Journal of Clinical Microbiology 26(2): 206-212.

Forrester, N. L., B. Boag, et al. (2003). "Long-term survival of New Zealand rabbit

haemorrhagic disease virus RNA in wild rabbits, revealed by RT-PCR and phylogenetic analysis." Journal of General Virology 84(Pt 11): 3079-3086.

Gitlin, L., W. Barchet, et al. (2006). "Essential role of mda-5 in type I IFN responses to

polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus." Proceedings of the National Academy of Sciences of the United States of America 103(22): 8459-8464.

Goodfellow, I., Y. Chaudhry, et al. (2005). "Calicivirus translation initiation requires an

interaction between VPg and eIF 4 E." EMBO Rep 6(10): 968-972. Green, K. Y., T. Ando, et al. (2000). "Taxonomy of the caliciviruses." The Journal of Infectious

Diseases 181 Suppl 2: S322-330. Green, S. R. and M. B. Mathews (1992). "Two RNA-binding motifs in the double-stranded

RNA-activated protein kinase, DAI." Genes & Development 6(12B): 2478-2490. Guo, M., J. Hayes, et al. (2001). "Comparative pathogenesis of tissue culture-adapted and

wild-type Cowden porcine enteric calicivirus (PEC) in gnotobiotic pigs and induction of diarrhea by intravenous inoculation of wild-type PEC." Journal of Virology 75(19): 9239-9251.

Hacker, H., V. Redecke, et al. (2006). "Specificity in Toll-like receptor signalling through

distinct effector functions of TRAF3 and TRAF6." Nature 439(7073): 204-207. Haller, O., M. Frese, et al. (1998). "Mx proteins: mediators of innate resistance to RNA

viruses." Revue Scientific Technique 17(1): 220-230.


98

Haller, O., P. Staeheli, et al. (2007). "Interferon-induced Mx proteins in antiviral host defense." Biochimie 89(6-7): 812-818.

Hasegawa, M., Y. Fujimoto, et al. (2008). "A critical role of RICK/RIP2 polyubiquitination in

Nod-induced NF-kappaB activation." EMBO Journal 27(2): 373-383. Heim, M. H. (1999). "The Jak-STAT pathway: cytokine signalling from the receptor to the

nucleus." Journal of Receptors and Signal Transduction Research 19(1-4): 75-120. Hemmi, H., O. Takeuchi, et al. (2004). "The roles of two IkappaB kinase-related kinases in

lipopolysaccharide and double stranded RNA signaling and viral infection." Journal of Experimental Medicine 199(12): 1641-1650.

Holzinger, D., C. Jorns, et al. (2007). "Induction of MxA gene expression by influenza A virus

requires type I or type III interferon signaling." Journal of Virology 81(14): 7776-7785. Honda, K., X. S. Ouyang, et al. (2007). "Cooperation between MyD88 and TRIF pathways in

TLR synergy via IRF5 activation." Biochemical and Biophysical Research Communications 354(4): 1045-1051.

Horisberger, M. A., P. Staeheli, et al. (1983). "Interferon induces a unique protein in mouse

cells bearing a gene for resistance to influenza virus." Proceedings of the National Academy of Sciences of the United States of America 80(7): 1910-1914.

Hornung, V., J. Ellegast, et al. (2006). "5'-Triphosphate RNA is the ligand for RIG-I." Science

314(5801): 994-997. Huang, S., W. Hendriks, et al. (1993). "Immune response in mice that lack the interferon-

gamma receptor." Science 259(5102): 1742-1745. IA-CRC (2011). "IA CRC Research Portfolio Summary 2011."

http://www.invasiveanimals.com/wp-content/uploads/2011/11/Research-Portfolio-2010-11-Compressed.pdf.

Inohara, Chamaillard, et al. (2005). "NOD-LRR proteins: role in host-microbial interactions

and inflammatory disease." Annual Review of Biochemistry 74: 355-383. Inohara, N., T. Koseki, et al. (2000). "An induced proximity model for NF-kappa B activation

in the Nod1/RICK and RIP signaling pathways." Journal of Biological Chemistry 275(36): 27823-27831.

Inohara, N., Y. Ogura, et al. (2001). "Human Nod1 confers responsiveness to bacterial

lipopolysaccharides." Journal of Biological Chemistry 276(4): 2551-2554. Ito, T., M. Yang, et al. (1999). "RAX, a cellular activator for double-stranded RNA-dependent

protein kinase during stress signaling." Journal of Biological Chemistry 274(22): 15427-15432.

http://www.invasiveanimals.com/wp-content/uploads/2011/11/Research-Portfolio-2010-11-Compressed.pdf

http://www.invasiveanimals.com/wp-content/uploads/2011/11/Research-Portfolio-2010-11-Compressed.pdf


99

Janzen, C., G. Kochs, et al. (2000). "A monomeric GTPase-negative MxA mutant with antiviral

activity." Journal of Virology 74(17): 8202-8206. Jeklova, E., L. Leva, et al. (2008). "Characterisation of immunosuppression in rabbits after

infection with myxoma virus." Veterinary Microbiology 129(1-2): 117-130. Johnson, C. L. and M. Gale, Jr. (2006). "CARD games between virus and host get a new

player." Trends in Immunology 27(1): 1-4. Jorns, C., D. Holzinger, et al. (2006). "Rapid and simple detection of IFN-neutralizing

antibodies in chronic hepatitis C non-responsive to IFN-alpha." Journal of Medical Virology78(1): 74-82.

Karst, S. M., C. E. Wobus, et al. (2003). "STAT1-dependent innate immunity to a Norwalk-like

virus." Science 299(5612): 1575-1578. Kato, H., O. Takeuchi, et al. (2006). "[Cell type specific involvement of RIG-I in antiviral

responses]." Nihon Rinsho 64(7): 1244-1247. Kato, H., O. Takeuchi, et al. (2008). "Length-dependent recognition of double-stranded

ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5." Journal of Experimental Medicine 205(7): 1601-1610.

Kawai, T. and S. Akira (2008). "Toll-like receptor and RIG-I-like receptor signaling." Ann N Y

National Academy of Sciences 1143: 1-20. Kawai, T. and S. Akira (2009). "The roles of TLRs, RLRs and NLRs in pathogen recognition."

International Immunology 21(4): 317-337. Kawamata, Y., R. Fujii, et al. (2003). "A G protein-coupled receptor responsive to bile acids."

Journal of Biological Chemistry 278(11): 9435-9440. Kerr, I. M. and R. E. Brown (1978). "pppA2'p5'A2'p5'A: an inhibitor of protein synthesis

synthesized with an enzyme fraction from interferon-treated cells." Proceedings of the National Academy of Sciences of the United States of America 75(1): 256-260.

Kim, U., Y. Wang, et al. (1994). "Molecular cloning of cDNA for double-stranded RNA

adenosine deaminase, a candidate enzyme for nuclear RNA editing." Proceedings of the National Academy of Sciences of the United States of America 91(24): 11457-11461.

Kochs, G., A. Garcia-Sastre, et al. (2007). "Multiple anti-interferon actions of the influenza A

virus NS1 protein." Journal of Virology 81(13): 7011-7021. Kochs, G., M. Haener, et al. (2002). "Self-assembly of human MxA GTPase into highly

ordered dynamin-like oligomers." Journal of Biological Chemistry 277(16): 14172-14176.


100

Kochs, G. and O. Haller (1999). "GTP-bound human MxA protein interacts with the nucleocapsids of Thogoto virus (Orthomyxoviridae)." Journal of Biological Chemistry 274(7): 4370-4376.

Komuro, A. and C. M. Horvath (2006). "RNA- and virus-independent inhibition of antiviral

signaling by RNA helicase LGP2." Journal of Virology 80(24): 12332-12342. Konig, M., H. J. Thiel, et al. (1998). "Detection of viral proteins after infection of cultured

hepatocytes with rabbit hemorrhagic disease virus." Journal of Virology 72(5): 4492-4497.

Koonin, E. V. and V. V. Dolja (1993). "Evolution and taxonomy of positive-strand RNA

viruses: implications of comparative analysis of amino acid sequences." Crit Rev Journal of Biochemistry and Molecular Biology 28(5): 375-430.

Kumar, A., J. Haque, et al. (1994). "Double-stranded RNA-dependent protein kinase

activates transcription factor NF-kappa B by phosphorylating I kappa B." Proceedings of the National Academy of Sciences of the United States of America 91(14): 6288-6292.

Kumar, H., T. Kawai, et al. "Pathogen recognition by the innate immune system."

International Reviews of Immunology 30(1): 16-34. Lai, F., R. Drakas, et al. (1995). "Mutagenic analysis of double-stranded RNA adenosine

deaminase, a candidate enzyme for RNA editing of glutamate-gated ion channel transcripts." Journal of Biological Chemistry 270(29): 17098-17105.

Lange, R. T. and C. R. Graham (1983). "Rabbits and the Failure of Regeneration in Australian

Arid Zone Acacia." Australian Journal of Ecology 8(4): 377-381. Langloss, J. M., E. A. Hoover, et al. (1978). "In vitro interaction of alveolar macrophages and

pneumocytes with feline respiratory viruses." International Reviews of Immunology 20(3): 836-841.

Lee, E. H. and Y. Rikihisa (1998). "Protein kinase A-mediated inhibition of gamma interferon-

induced tyrosine phosphorylation of Janus kinases and latent cytoplasmic transcription factors in human monocytes by Ehrlichia chaffeensis." International Reviews of Immunology 66(6): 2514-2520.

Lenghaus, C., H. Westbury, et al. (1994). Overview of the RHD project in Australia. Rabbit

haemorrhagic disease: Issues for assessment for biological control. R. T. Munro and R. T. Williams. Canberra, Australia, Australian Goverment Printing Service: 104-129.

Li, J., S. Hu, et al. (2011). "Interferon lambda inhibits herpes simplex virus type I infection of

human astrocytes and neurons." Glia 59(1): 58-67.


101

Li, J., A. Predmore, et al. (2012). "New interventions against human norovirus: progress, opportunities, and challenges." Annual Review of Food Science and Technology 3: 331-352.

Liu, G., Z. Ni, et al. (2008). "A DNA-launched reverse genetics system for rabbit hemorrhagic

disease virus reveals that the VP2 protein is not essential for virus infectivity." Journal of General Virology 89(Pt 12): 3080-3085.

Liu, G., Y. Zhang, et al. (2006). "Recovery of infectious rabbit hemorrhagic disease virus from

rabbits after direct inoculation with in vitro-transcribed RNA." Journal of Virology 80(13): 6597-6602.

Liu, S. Y., D. J. Sanchez, et al. (2012). "Systematic identification of type I and type II

interferon-induced antiviral factors." Proceedings of the National Academy of Sciences of the United States of America.

Liu, Y., C. X. George, et al. (1997). "Functionally distinct double-stranded RNA-binding

domains associated with alternative splice site variants of the interferon-inducible double-stranded RNA-specific adenosine deaminase." Journal of Biological Chemistry 272(7): 4419-4428.

Livolsi, A., V. Busuttil, et al. (2001). "Tyrosine phosphorylation-dependent activation of NF-

kappa B. Requirement for p56 LCK and ZAP-70 protein tyrosine kinases." European Journal of Biochemistry 268(5): 1508-1515.

Lugton, I. W. (1999). "A cross-sectional study of risk factors affecting the outcome of rabbit

haemorrhagic disease virus releases in New South Wales." Australian Veterinary Association 77(5): 322-328.

Malathi, K., B. Dong, et al. (2007). "Small self-RNA generated by RNase L amplifies antiviral

innate immunity." Nature 448(7155): 816-819. Marcato, P. S., C. Benazzi, et al. (1991). "Clinical and pathological features of viral

haemorrhagic disease of rabbits and the European brown hare syndrome." Revue Scientific Technique 10(2): 371-392.

McCartney, S. A., L. B. Thackray, et al. (2008). "MDA-5 recognition of a murine norovirus."

PLoS Pathogens 4(7): e1000108. Mead, P. S., L. Slutsker, et al. (1999). "Food-related illness and death in the United States."

Emerging Infectious Diseases 5(5): 607-625. Merchant, J. C., P. J. Kerr, et al. (2003). "Monitoring the spread of myxoma virus in rabbit

Oryctolagus cuniculus populations on the southern tablelands of New South Wales, Australia. III. Release, persistence and rate of spread of an identifiable strain of myxoma virus." Epidemiology & Infection 130(1): 135-147.


102

Meyers, G., C. Wirblich, et al. (1991). "Genomic and subgenomic RNAs of rabbit hemorrhagic disease virus are both protein-linked and packaged into particles." Virology 184(2): 677-686.

Meylan, E., K. Burns, et al. (2004). "RIP1 is an essential mediator of Toll-like receptor 3-

induced NF-kappa B activation." Nature Immunology 5(5): 503-507. Miniats, O. P. and D. Jol (1978). "Gnotobiotic pigs-derivation and rearing." Canadian Journal

of Comparative Medicine42(4): 428-437. Mocsari, E., M. Meder, et al. (1991). "Rabbit Viral Hemorrhagic-Disease .2. Study on the

Susceptibility According to the Age." Magyar Allatorvosok Lapja 46(6): 351-355. Molander, C. W., C. W. Boone, et al. (1971). "Isolation and Characterization of Viruses from

Fetal Calf Serum." In Vitro-Journal of the Tissue Culture Association 7(3): 168-&. Moss, S. R., S. L. Turner, et al. (2002). "Molecular epidemiology of Rabbit haemorrhagic

disease virus." Journal of General Virology83(Pt 10): 2461-2467. Mutze, G., B. Cooke, et al. (1998). "The initial impact of rabbit hemorrhagic disease on

European rabbit populations in South Australia." Journal of Wildlife Diseases 34(2): 221-227.

Nagesha, H. S., L. F. Wang, et al. (1995). "Self-assembly, antigenicity, and immunogenicity of

the rabbit haemorrhagic disease virus (Czechoslovakian strain V-351) capsid protein expressed in baculovirus." Archives of Virology 140(6): 1095-1108.

Nakayama, M., K. Yazaki, et al. (1993). "Structure of mouse Mx1 protein. Molecular

assembly and GTP-dependent conformational change." Journal of Biological Chemistry 268(20): 15033-15038.

Ohlinger, V. F., B. Haas, et al. (1993). "Rabbit Hemorrhagic-Disease (Rhd) - Characterization

of the Causative Calicivirus." Veterinary Research 24(2): 103-116. Parwani, A. V., W. T. Flynn, et al. (1991). "Serial propagation of porcine enteric calicivirus in

a continuous cell line. Effect of medium supplementation with intestinal contents or enzymes." Archives of Virology 120(1-2): 115-122.

Patterson, J. B. and C. E. Samuel (1995). "Expression and regulation by interferon of a

double-stranded-RNA-specific adenosine deaminase from human cells: evidence for two forms of the deaminase." 15(10): 5376-5388.

Patterson, J. B., D. C. Thomis, et al. (1995). "Mechanism of interferon action: double-

stranded RNA-specific adenosine deaminase from human cells is inducible by alpha and gamma interferons." Virology 210(2): 508-511.


103

Pierce, A. T., J. DeSalvo, et al. (2005). "Beta interferon and gamma interferon synergize to block viral DNA and virion synthesis in herpes simplex virus-infected cells." Journal of General Virology 86(Pt 9): 2421-2432.

Radford, A. D., R. M. Gaskell, et al. (2004). "Human norovirus infection and the lessons from

animal caliciviruses." Current Opinion in Infectious Diseases 17(5): 471-478. Ramiro-Ibanez, F., J. M. Martin-Alonso, et al. (1999). "Macrophage tropism of rabbit

hemorrhagic disease virus is associated with vascular pathology." Virus Research 60(1): 21-28.

Randall, R. E. and S. Goodbourn (2008). "Interferons and viruses: an interplay between

induction, signalling, antiviral responses and virus countermeasures." Journal of General Virology 89(Pt 1): 1-47.

Robinson, A. J., P. D. Kirkland, et al. (2002). "Serological evidence for the presence of a

calicivirus in Australian wild rabbits, Oryctolagus cuniculus, before the introduction of rabbit haemorrhagic disease virus (RHDV): its potential influence on the specificity of a competitive ELISA for RHDV." Wildlife Research 29(6): 655-662.

Robinson, A. J., W. J. Muller, et al. (1999). "The effect of buprenorphine on the course of

disease in laboratory rabbits infected with myxoma virus." The International Journal of Laboratory Animal 33(3): 252-257.

Rossi, J. J. (2009). "Innate Immunity confounds the clinical efficacy of small interfering RNAs (siRNAs)." Gene Therapy 16(5): 579-580.

Rothenfusser, S., N. Goutagny, et al. (2005). "The RNA helicase Lgp2 inhibits TLR-

independent sensing of viral replication by retinoic acid-inducible gene-I." Journal of Immunology 175(8): 5260-5268.

Saha, S. K., E. M. Pietras, et al. (2006). "Regulation of antiviral responses by a direct and

specific interaction between TRAF3 and Cardif." EMBO Journal 25(14): 3257-3263. Saito, T., R. Hirai, et al. (2007). "Regulation of innate antiviral defenses through a shared

repressor domain in RIG-I and LGP2." Proceedings of the National Academy of Sciences of the United States of America 104(2): 582-587.

Saito, T., D. M. Owen, et al. (2008). "Innate immunity induced by composition-dependent

RIG-I recognition of hepatitis C virus RNA." Nature 454(7203): 523-527. Samuel, C. E. (1985). "Characterization of the interferon-induced double-stranded RNA-

dependent protein kinase and its possible role in the antiviral action of interferon." Progress in Clinical Biological Research 202: 247-254.

Samuel, C. E. (1991). "Antiviral actions of interferon. Interferon-regulated cellular proteins

and their surprisingly selective antiviral activities." Virology 183(1): 1-11.


104

Samuel, C. E. (1993). "The eIF-2 alpha protein kinases, regulators of translation in eukaryotes from yeasts to humans." Journal of Biological Chemistry 268(11): 7603-7606.

Samuel, C. E. (2001). "Antiviral actions of interferons." Clinical Microbiology Reviews 14(4):

778-809. Saunders, G., B. Cooke, et al. (2010). "Modern approaches for the biological control of

vertebrate pests: An Australian perspective." Biological Control 52(3): 288-295. Schweizer, M. and E. Peterhans (2001). "Noncytopathic bovine viral diarrhea virus inhibits

double-stranded RNA-induced apoptosis and interferon synthesis." Journal of Virology 75(10): 4692-4698.

Sengupta, T. K., E. M. Schmitt, et al. (1996). "Inhibition of cytokines and JAK-STAT activation

by distinct signaling pathways." Proceedings of the National Academy of Sciences of the United States of America 93(18): 9499-9504.

Seth, R. B., L. Sun, et al. (2005). "Identification and characterization of MAVS, a

mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3." Cell 122(5): 669-682.

Sharma, S., B. R. tenOever, et al. (2003). "Triggering the interferon antiviral response

through an IKK-related pathway." Science 300(5622): 1148-1151. Shaw, M. H., T. Reimer, et al. (2008). "NOD-like receptors (NLRs): bona fide intracellular

microbial sensors." Current Opinion in Immunology 20(4): 377-382. Shien, J. H., H. K. Shieh, et al. (2000). "Experimental infections of rabbits with rabbit

haemorrhagic disease virus monitored by polymerase chain reaction." Research in Veterinary Science 68(3): 255-259.

Slomka, M. J. and H. Appleton (1998). "Feline calicivirus as a model system for heat inactivation studies of small round structured viruses in shellfish." Epidemiology & Infection 121(2): 401-407.

Solaroli, N., M. Johansson, et al. (2008). "Substrate specificity of feline and canine

herpesvirus thymidine kinase." Antiviral Research 79(2): 128-132. Spiesschaert, B., G. McFadden, et al. (2011). "The current status and future directions of

myxoma virus, a master in immune evasion." Veterinary Research 42(1): 76. Stark, G. R., I. M. Kerr, et al. (1998). "How cells respond to interferons." Annual Review of

Biochemistry 67: 227-264. Strive, T., J. D. Wright, et al. (2009). "Identification and partial characterisation of a new

Lagovirus in Australian wild rabbits." Virology 384(1): 97-105.


105

Takahasi, K., M. Yoneyama, et al. (2008). "Nonself RNA-sensing mechanism of RIG-I helicase and activation of antiviral immune responses." Molecular Cell 29(4): 428-440.

Tanaka, N., M. Sato, et al. (1998). "Type I interferons are essential mediators of apoptotic

death in virally infected cells." Genes Cells 3(1): 29-37. Thomis, D. C., G. Floyd-Smith, et al. (1992). "Mechanism of interferon action. cDNA structure

and regulation of a novel splice-site variant of the catalytic subunit of human protein kinase A from interferon-treated human cells." Journal of Biological Chemistry 267(15): 10723-10728.

Thomis, D. C. and C. E. Samuel (1993). "Mechanism of interferon action: evidence for

intermolecular autophosphorylation and autoactivation of the interferon-induced, RNA-dependent protein kinase PKR." Journal of Virology 67(12): 7695-7700.

Thumfart, J. O. and G. Meyers (2002). "Feline calicivirus: recovery of wild-type and

recombinant viruses after transfection of cRNA or cDNA constructs." Journal of Virology 76(12): 6398-6407.

Vashist, S., D. Bailey, et al. (2009). "Model systems for the study of human norovirus

Biology." Future Virol 4(4): 353-367. Ward, V. K., B. D. Cooke, et al. (2010). Rabbit Haemorrhagic Disease Virus and Other

Lagoviruses. Caliciviruses Molecular and Cellular Virology. G. S. Hansman, X. J. Jiang and K. Y. Grenn. Norfolk, UK, Caister Academic Press: 223-245.

Wirblich, C., H. J. Thiel, et al. (1996). "Genetic map of the calicivirus rabbit hemorrhagic

disease virus as deduced from in vitro translation studies." Journal of Virology 70(11): 7974-7983.

Wobus, C. E., S. M. Karst, et al. (2004). "Replication of Norovirus in cell culture reveals a

tropism for dendritic cells and macrophages." PLoS Biol 2(12): e432. Xu, Z. J. and W. X. Chen (1989). "Viral Hemorrhagic-Disease in Rabbits - a Review."

Veterinary Research Communications 13(3): 205-212. Yamaizumi, M., E. Mekada, et al. (1978). "One molecule of diphtheria toxin fragment A

introduced into a cell can kill the cell." Cell 15(1): 245-250. Yoneyama, M. and T. Fujita (2007). "Function of RIG-I-like receptors in antiviral innate

immunity." Journal of Biological Chemistry 282(21): 15315-15318. Yoneyama, M. and T. Fujita (2008). "Structural mechanism of RNA recognition by the RIG-I-

like receptors." Immunity 29(2): 178-181. Yoneyama, M. and T. Fujita (2009). "RNA recognition and signal transduction by RIG-I-like

receptors." Immunology Review 227(1): 54-65.


106

Yoneyama, M., M. Kikuchi, et al. (2005). "Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity." Journal of Immunology 175(5): 2851-2858.

Zhu, H., J. P. Cong, et al. (1998). "Cellular gene expression altered by human

cytomegalovirus: global monitoring with oligonucleotide arrays." Proceedings of the National Academy of Sciences of the United States of America 95(24): 14470-14475.


107

developing a cell culture system for lagoviruses · developing a cell culture system for...

Documents