Deciphering the Role of Multiple Betaine-Carnitine-CholineTransporters in the Halophile Vibrio parahaemolyticus

Serge Y. Ongagna-Yhombi, Nathan D. McDonald, E. Fidelma Boyd

Department of Biological Sciences, University of Delaware, Newark, Delaware, USA

Vibrio parahaemolyticus is a halophile that is the predominant cause of bacterial seafood-related gastroenteritis worldwide. Tosurvive in the marine environment, V. parahaemolyticus must have adaptive strategies to cope with salinity changes. Six putativecompatible solute (CS) transport systems were previously predicted from the genome sequence of V. parahaemolyticusRIMD2210633. In this study, we determined the role of the four putative betaine-carnitine-choline transporter (BCCT) homo-logues VP1456, VP1723, VP1905, and VPA0356 in the NaCl stress response. Expression analysis of the four BCCTs subjected toNaCl upshock showed that VP1456, VP1905, and VPA0356, but not VP1723, were induced. We constructed in-frame single-dele-tion mutant strains for all four BCCTs, all of which behaved similarly to the wild-type strain, demonstrating a redundancy of thesystems. Growth analysis of a quadruple mutant and four BCCT triple mutants demonstrated the requirement for at least oneBCCT for efficient CS uptake. We complemented Escherichia coli MHK13, a CS synthesis- and transporter-negative strain, witheach BCCT and examined CS uptake by growth analysis and 1H nuclear magnetic resonance (NMR) spectroscopy analyses. Thesedata demonstrated that VP1456 had the most diverse substrate transport ability, taking up glycine betaine (GB), proline, cho-line, and ectoine. VP1456 was the sole ectoine transporter. In addition, the data demonstrated that VP1723 can transport GB,proline, and choline, whereas VP1905 and VPA0356 transported only GB. Overall, the data showed that the BCCTs are func-tional and that there is redundancy among them.

Vibrio parahaemolyticus is a Gram-negative halophile inhabit-ing a wide range of aquatic ecosystems and causes bacterium-

related seafood gastroenteritis in humans. Recent years have seenan increase in the incidence of infections worldwide, mostly dur-ing the warmer summer months (1–3). Vibrio parahaemolyticus isfound in estuarine and marine environments as free-living organ-isms or in associations with fish and other marine species (4–7).Human infections occur usually through consumption of con-taminated shellfish such as oysters. Vibrio parahaemolyticus is gen-erally faced with salt concentrations of 3.5% salinity (35 ppt), butin estuarine systems and in shallow oyster beds during the sum-mer months, this concentration can be much lower or higher.Salinity shifts in the environment pose tremendous osmotic chal-lenges to bacteria that must respond swiftly by equating their in-tracellular osmotic potential with that of the external environ-ment in order to maintain the positive turgor pressure requiredfor normal growth (8–10). This is typically achieved via two strat-egies: the accumulation of inorganic ions, such as potassium ions(K�), and the accumulation of low-molecular-weight organiccompounds, termed compatible solutes (CSs), which can beamassed in high concentrations without disturbing vital cellularfunction (8–10). The accumulation of CSs such as trehalose; freeamino acids such as glutamate, glutamine, and proline; and theirderivatives glycine betaine (GB) and ectoine is achieved either byde novo synthesis or via uptake from the surrounding environ-ment by specific transporters (8–13). The transport of CSs is astrategy that is widespread among distinct evolutionary taxa ofbacteria and has a lower energetic cost to the cell than de novosynthesis (8–13).

We previously described the presence of six putative CS trans-porter systems and two CS biosynthesis systems within the ge-nome of Vibrio parahaemolyticus (14–17). The biosynthesis clus-ter ectABC-aspK, required for ectoine synthesis from an asparticacid precursor, is present on chromosome I, and the betIBA clus-

ter, required for GB synthesis from choline, is present on chromo-some II (16, 17). A previous study by Naughton and colleaguesusing one-dimension proton nuclear magnetic resonance (1HNMR) demonstrated that at high salinity, V. parahaemolyticus wascapable of de novo synthesis of ectoine, whereas an �ectB knock-out strain was not (16). In V. parahaemolyticus, both ectoine andGB are bona fide CSs (that is, they cannot be used as carbonsources), and the most effective CSs or precursors for this bacte-rium are betaine � choline � proline � glutamate � ectoine (17).Expression analysis showed that the ectA and betA biosynthesisgenes were more highly induced in log-phase cells and were alsoinduced by NaCl upshock (17).

Four of the six CS transport systems identified in V. parahae-molyticus belong to the betaine-carnitine-choline transporter(BCCT) family, and two are members of the ATP-binding cassette(ABC) family, also known as ProU (ProU1, contained in chromo-some I, and ProU2, contained in chromosome II) (16). Three outof four BCCTs (VP1456, VP1723, and VP1905) are located inchromosome I, while VPA0356 is found in chromosome II (16).Members of the BCCT family use proton/sodium-motive force totranslocate substrates across the membrane and display certaindistinguishing features: they transport quaternary ammonium

Received 22 July 2014 Accepted 20 October 2014

Accepted manuscript posted online 24 October 2014

Citation Ongagna-Yhombi SY, McDonald ND, Boyd EF. 2015. Deciphering the role ofmultiple betaine-carnitine-choline transporters in the halophile Vibrioparahaemolyticus. Appl Environ Microbiol 81:351–363. doi:10.1128/AEM.02402-14.

Editor: M. J. Pettinari

Address correspondence to E. Fidelma Boyd, fboyd@udel.edu.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.02402-14

January 2015 Volume 81 Number 1 aem.asm.org 351Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

compounds and encode a protein of 500 amino acid residues onaverage, organized into 12 putative transmembrane domains (13).Furthermore, they possess a conserved stretch of tryptophan res-idues in their eighth transmembrane domain (TM8), which isbelieved to be involved in the binding of substrates (18). Studies ofthe roles of individual BCCTs in osmotolerance in a number ofbacteria have been performed (13, 19–23). For example, in Co-rynebacterium glutamicum and Bacillus subtilis, the BCCTs BetPand OpuD were shown to be osmotically induced and had a highaffinity for GB (19, 20). Previous studies with Escherichia colishowed that BetT mediated high-affinity uptake of choline (24).In Vibrio cholerae, OpuD (VC1279), the only BCCT present in thisspecies, was found to play a role in the uptake of GB under con-ditions of high osmolarity (21). In Pseudomonas aeruginosa,among the three BCCTs present in this organism, BetT3 wasshown to function as the major choline transporter under hyper-osmolar conditions (22). This species can also utilize choline andGB as carbon sources, which has been proposed to be an impor-tant phenotype for murine lung infection (25–27).

The function of each of the four BCCTs in V. parahaemolyticusis unknown. To address this, we first investigated the role ofVP1456, VP1723, VP1905, and VPA0356 in the osmotic stressresponse by examination of the expression patterns of each of thetransporters after high-salt upshock. Next, using deletion mutantanalyses of each of the systems, we determined whether all or anyof these transporters are essential for the osmotic shock response.Finally, by heterologous expression analysis of E. coli MKH13 and1H NMR spectroscopy, we examined individual BCCTs for theuptake of GB, proline, choline, and ectoine.

MATERIALS AND METHODSBacterial strains and plasmids. Bacterial strains and plasmids used in thisstudy are listed in Table 1. A streptomycin-resistant (Smr) clinical isolateof V. parahaemolyticus, RIMD2210633, was used as the wild type (WT)(28, 29). This strain was used to construct several mutant strains harbor-ing either a single or multiple in-frame deletions in their BCCT genes.Unless otherwise stated, all strains were routinely cultured aerobically(250 rpm) at 37°C in either lysogeny broth (LB) medium (Fisher Scien-tific, Fair Lawn, NJ) or defined M9 salts base minimal medium (47.8 mMNa2HPO4, 22 mM KH2PO4, 18.7 mM NH4Cl, 8.6 mM NaCl) (Sigma)supplemented with 2 mM MgSO4, 0.1 mM CaCl2, and 0.4% (wt/vol)glucose (final concentration) as the sole carbon source (designated M9Gmedium). Genetic manipulations were done by using E. coli strainsMKH13 and DH5�-�pir and the diaminopimelic acid (DAP) auxotro-phic strain �2155-�pir. The E. coli �2155 DAP auxotroph was grown onmedium supplemented with 0.3 mM DAP (Sigma-Aldrich). The follow-ing antibiotics were used: ampicillin (100 �g/ml), chloramphenicol (Cm)(25 �g/ml), and streptomycin (Sm) (200 �g/ml). The CSs betaine, cho-line, ectoine, proline, and L-carnitine were sterilized by filtration with a0.2-�m filter (Corning, NY) and added to the growth medium at a con-centration of 500 �M.

Bacterial growth analysis. A single bacterial colony was used toinoculate M9G medium containing 1% (wt/vol) NaCl (M9G–1%NaCl) and grown overnight at 37°C. A 2% inoculum of the culturegrown overnight was subsequently used to inoculate M9G–1% NaClmedium and grown at 37°C to log phase for 5 h. A 0.1% aliquot of the5-h culture was used to inoculate 200 �l of M9G– 6% NaCl in theabsence or presence of CSs. Growth analysis was carried out at 37°Cwith intermittent shaking for 24 h by using a Tecan Sunrise microplatereader (Tecan US Inc., Durham, NC). Samples were analyzed in trip-licate, and at least two biological replicates were performed. The opti-cal densities at 595 nm (OD595) of bacterial cultures were plotted by

using Prism 5 (graphing and data analysis software) as averages ofmeans of data from two biological replicates.

Mutant construction. Vibrio parahaemolyticus RIMD2210633 strainsharboring a single or multiple in-frame, nonpolar deletions in the BCCTgenes were constructed by splicing by overlap extension (SOE) PCR andhomologous recombination (30). SOE PCR primers were designed tocreate deletions in VP1456, VP1723, VP1905, and VPA0356 (Table 2) (16,17). Briefly, by using V. parahaemolyticus RIMD2210633 genomic DNAas a template, two PCR products (AB and CD) of the BCCT gene ofinterest were generated by using primer pairs SOE A and SOE B and SOEC and SOE D in the first PCR. In the second PCR, using primer pair SOEA and SOE D, the fragments generated from the first round of PCR werespliced together to create a truncated version of the gene via theiroverlapping complementary tag sequences. The resultant truncatedfragment was ligated into the suicide vector pDS132 and transformedinto E. coli �2155, a DAP auxotroph strain. Recombinant plasmidpDS132 containing the truncated fragment was then introduced into V.parahaemolyticus RIMD2210633 by conjugation on an LB–1% NaCl–DAP agar plate. Transconjugant colonies were streaked onto LB–3% NaClagar plates supplemented with Sm and Cm. Colony PCR was performedwith SOE A and SOE D and flanking primer pairs (SOE FL-F and SOEFL-R). A single bacterial colony was subsequently selected and culturedaerobically at 37°C for 8 h in LB–3% NaCl containing Sm and Cm. A 0.1%aliquot of this culture was used to inoculate LB–3% NaCl broth lackingantibiotics and grown overnight. The culture grown overnight was seriallydiluted and plated onto LB–3% NaCl agar plates supplemented with Smand sucrose. Colonies resulting from homologous recombination thatreplaced the wild-type gene with a truncated version were passaged ontoselective sucrose agar plates. The recombinant clones that had undergonea double crossover were confirmed by colony PCR using primers SOEFL-F and SOE FL-R and DNA sequencing. The protocol described abovewas repeated to create all the BCCT mutants (Table 1). To create doubleand triple BCCT mutants, a single or double BCCT mutant was used as thebackground, and the process was repeated at the conjugation stage tointroduce the desired deletion combinations. For the construction of theBCCT quadruple mutant, a triple mutant was used as the background,and the selection of the double-crossover colonies was carried out on agarplates in the presence of NaCl and sucrose concentration gradients.

Functional complementation of E. coli strain MKH13 with VP1456,VP1723, VP1905, and VPA0356. To clone each BCCT gene, V. parahae-molyticus RIMD2210633 genomic DNA was used as a template for PCRamplification of each BCCT gene with gene-specific primer pairs by usinga Hot Start high-fidelity polymerase kit (Qiagen) (Table 2). The generatedPCR product (1,500 bp in length, which included the endogenous pro-moters) was subcloned into pJET1.2 by using the CloneJET PCR cloningkit (Fermentas/Thermo Scientific), transformed into E. coli strain DH5�,and plated onto LB–1% NaCl–ampicillin agar. Colonies were screened byPCR, plasmid DNA was extracted and digested, and the purified fragmentwas ligated into pBBR1MCS in the case of VP1456 and pBAD33 in thecases of VP1723, VP1905, and VPA0356, each also digested with the sameenzymes. The recombinant plasmids were transformed into E. coliMKH13 and grown on LB–1% NaCl supplemented with Cm. Colonieswere screened by colony PCR and confirmed by DNA sequencing. The E.coli MKH13 strain is a derivative of MC4100 [F araD139 �(argF-lac)U169 rpsL150 relA1 deoC1 ptsF25 rbsR flbB5301] (31). The large argF-lac deletion �(argF-lac)169 includes the betTIBA locus; thus, this straincannot convert choline to GB or transport choline (31–33). The E. coliMKH13 genome contains additional deletions of genes encoding thePutP, ProP, and ProU transport systems; is unable to transport proline,GB, or choline; and cannot grow at 4% NaCl (31). Functional comple-mentation experiments with E. coli MKH13 were first performed by grow-ing cells overnight in M9G–1% NaCl supplemented with Cm. A 2.5%inoculum of this culture was used to inoculate 200 �l of M9G– 4%NaCl–Cm containing 500 �M CS with and without arabinose. Bacterialcultivations were performed at 37°C, and the OD595 was measured hourly

Ongagna-Yhombi et al.

352 aem.asm.org January 2015 Volume 81 Number 1Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

for a period of 24 h in a Tecan Sunrise microplate reader. For each con-dition tested, the sample was assayed in triplicate, with at least two bio-logical replicates.

Determination of the affinity of the BCCTs for GB. To determine theaffinity of each BCCT for GB, growth analyses of E. coli MKH13 recom-binant strains were performed in the presence of limiting GB concentra-tions of 0, 5, 25, 50, 75, 100, 125, and 150 �M. A 2.5% inoculum ofcultures of E. coli MKH13 strains grown overnight in M9G–1% NaCl to anOD595 of 1.0 was used to inoculate M9G– 4% NaCl medium containing0.05% arabinose and GB. Cultures were incubated for 24 h, and the spe-

cific growth rates of the recombinant E. coli MKH13 strains for a given GBconcentration were calculated.

Extraction and identification of intracellular organic solutes by 1HNMR. 1H NMR spectroscopy analysis was performed on cellular extractsof E. coli MKH13(pBCCT). For 1H NMR experiments examining ectoineand choline uptake in E. coli MKH13(pBCCT), a single colony was used toinoculate M9G–1% NaCl and grown aerobically at 37°C to an OD595 of0.5. The cells were pelleted by centrifugation, washed with M9G–1%NaCl medium, and subjected to 1 h of osmotic upshock in M9G– 4%NaCl supplemented with 500 �M ectoine or choline. Cells were centri-

TABLE 1 Bacterial strains and plasmids used in this study

Strain or plasmid Relevant genotype(s) and/or description Reference

StrainsV. parahaemolyticus

RIMD 2210633 WT O3:K6 clinical isolate; Smr 29SOY1456 (�VP1456) WT with a VP1456 deletion This studySOY1723 (�VP1723) WT with a VP1723 deletion This studySOY1905 (�VP1905) WT with a VP1905 deletion This studySOYA0356 (�VPA0356) WT with a VPA0356 deletion This studySOYBCCT12 WT with �VP1456 �VP1723 This studySOYBCCT124 WT with �VP1456 �VP1723 �VPA0356 This studySOYBCCT123 WT with �VP1456 �VP1723 �VP1905 This studySOYBCCT13 WT with �VP1456 �VP1905 This studySOYBCCT34 WT with �VP1905 �VPA0356 This studySOYBCCT134 WT with �VP1456 �VP1905 �VPA0356 This studySOYBCCT234 WT with �VP1723 �VP1905 �VPA0356 This studySOYBCCT1342 WT with �VP1456 �VP1723 �VP1905 �VPA0356 This study

Escherichia coliDH5�-�pir �pir �80dlacZ�M15 �(lacZYA-argF)U169 recA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1DH5�-�pir(pJET�VP1456) pJET-�VP1456 transformed into E. coli DH5�-�pir This studyDH5�-�pir(pJET�VP1723) pJET-�VP1723 transformed into E. coli DH5�-�pir This studyDH5�-�pir(pJET�VP1905) pJET-�VP1905 transformed into E. coli DH5�-�pir This studyDH5�-�pir(pJET�VPA0356) pJET-�VPA0356 transformed into E. coli DH5�-�pir This study�2155 DAP auxotroph Donor for bacterial conjugation; thr1004 pro thi strA hsdS lacZ�M15 (F= lacZ�M15

lacTRQJ�36 proA� proB�) �dapA Ermr pirRP4 (Kmr from SM10)�2155(pDS�VP1456) pDS�VP1456 transformed into E. coli �2155 This study�2155(pDS�VP1723) pDS�VP1723 transformed into E. coli �2155 This study�2155(pDS�VP1905) pDS�VP1905 transformed into E. coli �2155 This study�2155(pDS�VPA0356) pDS�VPA0356 transformed into E. coli �2155 This studyMKH13 MC4100 (�betTIBA) �(putPA)101 �(proP)2 �(proU); Spr 31MKH13(pBBVP1456) pBBVP1456 transformed into MKH13 This studyMKH13(pBAVP1723) pBAVP1723 transformed into MKH13 This studyMKH13(pBAVP1905) pBAVP1905 transformed into MKH13 This studyMKH13(pBAVPA0356) pBAVPA0356 transformed into MKH13 This study

PlasmidspDS132 R6K �ori mobRP4 sacB Cmr; suicide vector 38pDS�VP1456 �VP1456 cloned into pDS132 suicide vector This studypDS�VP1723 �VP1723 cloned into pDS132 suicide vector This studypDS�V1905 �V1905 cloned into pDS132 suicide vector This studypDS�VPA0356 �VPA0356 cloned into pDS132 suicide vector This studypJET1.2 General cloning vector (Fermentas); Ampr

pJET�VP1456 �VP1456 cloned into pJET1.2 vector This studypJET�VP1723 �VP1723 cloned into pJET1.2 vector This studypJET�VP1905 �VP1905 cloned into pJET1.2 vector This studypJET�VPA0356 �VPA0356 cloned into pJET1.2 vector This studypBBR1MCS Broad-host-range cloning vector; Cmr 39pBBVP1456 VP1456 cloned into pBBR1MCS This studypBAD33 Expression vector; AraC Cmr

pBAVP1723 VP1723 cloned into pBAD33 This studypBAVP1905 VP1905 cloned into pBAD33 This studypBAVPA0356 VPA0356 cloned into pBAD33 This study

BCCTs in Vibrio parahaemolyticus

January 2015 Volume 81 Number 1 aem.asm.org 353Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

fuged, and the pellet was washed once with M9G– 4% NaCl medium. Thepelleted cells were lysed by a series of freeze-thaw cycles (three times) indry ice, and cellular extracts were solubilized in 750 �l of 99.99% ethanol(Sigma-Aldrich). After a 10-min centrifugation at 4,000 g, ethanol frac-tions containing organic, soluble compounds free of cellular debris weretransferred into clean tubes. Ethanol was removed via evaporation in arotary evaporator. Organic materials were subsequently dissolved in 500�l of deuterium oxide (D2O) solvent (Cambridge Isotope LaboratoriesInc.), and insoluble materials were removed by centrifugation. Compati-ble solutes (soluble organic compounds) dissolved in D2O were trans-ferred into a 5-mm NMR tube (Wilmad Lab Glass), and 1H NMR spectraldata were recorded with a Bruker Avance AVIII 400-MHz NMR spec-trometer equipped with a Bruker broadband fluorine observation (BBFO)probe. The spectrometer was run with Bruker Topspin software. NMR

spectra were processed by using ACD/Lab processing software, academicedition (Advanced Chemistry Development Inc., Canada).

Isolation of RNA and gene expression analysis. RNA isolation andVP1456, VP1723, VP1905, and VPA0356 gene expression analyseswere performed on cells grown in LB–3% NaCl and under NaCl up-shock growth conditions by using either log- or stationary-phase cells.Analyses and assays were carried out in accordance with MinimumInformation for Publication of Quantitative Real-Time PCR Experi-ments (MIQE) guidelines (34). A single bacterial colony was used toinoculate LB–3% NaCl and grown aerobically overnight at 37°C. Theresultant culture was diluted 1:50 in fresh LB–3% NaCl medium andgrown at 37°C to log (4 h) or stationary (10 h) phase. Osmotic upshockexperiments were performed on cultures harvested by centrifugationat 1,000 g for 10 min and transferred into LB– 6% NaCl or LB–9%

TABLE 2 Primers used in this studya

Target Primer Sequence (5=¡3=)Cloning

VP1456 (BCCT1) VP1456F (XbaI) TCTAGATCTTGTGAGTTGAAGACACTTGVP1456R (HindIII) AAGCTTAAAAATGCCGAGCAATGAAT

VP1723 (BCCT2) VP1723F (XbaI) TCTAGAAACTTGTGCTTGGTGATGTGVP1723R (SacI) GAGCTCACGGCACACTTTCGCATG

VP1905 (BCCT3) VP1905F (KpnI) GAGAGGTACCGATCTTCCGCTTTCACVP1905R (PstI) GAGACTGCAGAGCAGGGTGCTGGCTTC

VPA0356 (BCCT4) VPA0356F (XbaI) TCTAGAAGCGGCTTTTTGAACATCCTVPA0356R (HindIII) AAGCTTCCAATTAAGGGCTCTTTGCAT

SOE PCRVP1456 VP1456A (XbaI) TCTAGAATCAATGGGGACAGCGATAA

VP1456B cagctgagatctggtaccCGAAGCGAATTTTATCACCAAVP1456C ggtaccagatctcagctgCGTACCGAACTTTCCGCTTAVP1456D (SacI) GAGCTCCAACCATTTTCGCGTTTGTTCVP1456FL-F GTCGATTACAATGGCGGATTVP1456FL-R GTGGCACATTGTGAATGCTC

VP1723 VP1723A (XbaI) TCTAGAACGATATGGTCTGCCAGCTTVP1723B cagctgagatctggtaccGGGACGTTTAATCCCACCATVP1723C ggtaccagatctcagctgGGTCTAATGGATGAACCTCGTCVP1723D (SacI) GAGCTCCCAATTTCTGGATAAAGCACCCVP1273FL-F TGCGCTTTTAAACACCATTGVP11723FL-R ATGTCCAACGGAGGACAATC

VP1905 VP1905A (XbaI) TCTAGAGAGGAACGATGACAAAGGGTAVP1905B cagctgagatctggtaccCGAGCCAAGACATGAATGAAVP1905C ggtaccagatctcagctgATGTTTGATGTGCTGCCATTTVP1905D (SacI) GAGCTCTTGATCGATTATTGACGCTCTGVP1905FL-F AATAGCGCGGATGATCTGACVP1905FL-R TTGAATGCGCTTGCAATATC

VPA0356 VPA0356A (XbaI) TCTAGACTTGATGTGAGGGGAAATGCVPA0356B cagctgagatctggtaccTGTGTCGATGTCTGGTTTCGVP0356C ggtaccagatctcagctgATCATTTCGGTGCTGTTCTTGVP0356D (SacI) GAGCTCTTTGCATTTTATGGGGTTGGVPA0356FL-F GCCCACTTCAAACTGTCGTTVPA0356FL-R CTCGATTCGATGTCATTCCA

VP1456 VP1456RT-F GTTCGGTCTTGCGACTTCTCVP1456RT-R CCCATCGCAGTATCAAAGGT

VP1723 VP1723RT-F AACAAAGGGTTGCCACTGACVP1723RT-R TTCAAACCTGTTGCTGCTTG

VP1905 VP1905RT-F TGGACGGTATTCTACTGGGCVP1905RT-R CGCCTAACTCGCCTACTTTG

VPA0356 VPA0356RT-F CAAGGCGTAGGCCGCATGGTVPA0356RT-R ACCGCCCACGATGCTGAACC

VPr001 (16S rRNA) VPr001RT-F ACCGCCTGGGGAGTACGGTCVPr001RT-R TTGCGCTCGTTGCGGGACTT

a Underlining indicates restriction enzyme sites; nucleotides in lowercase type indicate complementary overlaps. Abbreviations: F, forward; R, reverse; RT, reverse transcriptase; FL,flanking.

Ongagna-Yhombi et al.

354 aem.asm.org January 2015 Volume 81 Number 1Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

NaCl medium for 30 min at 37°C with shaking. Total RNA was subse-quently isolated by using the RNAprotect Bacteria reagent and RNeasyminikit (Qiagen) according to protocols recommended by the manu-facturer. RNA was subjected to DNase treatment for 30 min at 37°C toremove DNA, followed by heat inactivation and subsequent DNaseremoval by centrifugation. Isolated RNA was quantified by using aNanodrop spectrophotometer (Thermo Scientific) and examined bygel electrophoresis on 0.8% agarose to assess quality. In addition, aPCR assay was performed to check that no DNA was present. Next,first-strand cDNA synthesis was carried out by using 500 ng of totalRNA as the template in a reaction primed with 200 ng of randomhexamers (Invitrogen), using Superscript II reverse transcriptase (In-vitrogen). Expression analysis of BCCT genes was performed withcDNA as the template by using fluorescence-based quantitative real-time PCR (qPCR), utilizing Hot Start-IT SYBR green qPCR mastermix reagent (USB, Santa Clara, CA) and gene-specific primer pairs(Table 2). qPCR analysis was carried out with a 20-�l volume on anApplied Biosystems 7500 Fast real-time PCR system (Applied Biosys-tems, Foster City, CA) under the following cycling conditions: 95°Cfor 2 min for one cycle and 95°C for 10 s and 60°C for 30 s for 40 cycles.The quantitative cycle (Cq) values were determined, and the relativequantification of gene expression was calculated by the 2��Cq

method with normalization across samples by using the 16S rRNAgene as a control (35). qPCR was performed with two technical repli-cates and at least two biological replicates.

Statistical analysis. An unpaired Student t test was used to comparethe means between two treatments (treated and untreated). One-wayanalysis of variance (ANOVA), followed by Bonferroni’s multiple-com-parison posttest, was used to analyze multiple groups. The significances ofthe data were computed as P values and are represented by asterisks in thefigure legends. Graphing and statistical analyses of the data were per-formed by using Prism 5.

RESULTSFour BCCT homologues present in V. parahaemolyticus. Previ-ously, we demonstrated by 1H NMR analysis that V. parahaemo-lyticus can accumulate GB, proline, choline, ectoine, and gluta-mate, but we did not examine the transporters involved (17).Bioinformatics analysis identified four single-component BCCTsin V. parahaemolyticus RIMD2210633, the open reading frames(ORFs) VP1456, VP1723, VP1905, and VPA0356 (16, 17). All fourtransporters are present in all sequenced V. parahaemolyticus ge-nomes. Three of the four BCCTs, VP1456, VP1723, and VP1905,shared between 50 and 80% amino acid identities to each other.VP1456 and VP1905 shared the highest (80%) sequence identity,whereas VPA0356 shared the lowest sequence identity (30%)with the other three. VP1456 had the highest amino acid identityto the E. coli BCCT ProP protein, at 44%. VP1905 shared thehighest amino acid identity with VC1279, the sole V. choleraeBCCT, at 82% identity, with VP1456 next at 68%, then VP1723 at49%, and, finally, VPA0356 at 29%.

VP1456, VP1905, and VPA0356 are upregulated in LB me-dium upon NaCl upshock. To address the question of whetherthe four putative BCCT genes in V. parahaemolyticus are inducedby NaCl upshock, qPCR analysis was performed on culturesgrown to log or stationary phase in LB–3% NaCl and subjected to6% and 9% NaCl upshocks. It was found that under these condi-tions, VP1456, VP1905, and VPA0356 were induced upon NaClupshock, while VP1723 was either unchanged or slightly down-regulated (Fig. 1A and B). For instance, log-phase expression anal-yses upon upshock in 6% NaCl gave log2-fold induction increasesof 5.2, 4.9, and 8.0 for VP1456, VP1905, and VPA0356, respec-tively (Fig. 1A). Log-phase expression analyses with a 9% NaCl

upshock gave log2-fold change increases of 4.5 for VP1456 and 2.9for VP1905 and VPA0356, and VP1723 was unchanged (Fig. 1A).Expression analysis of stationary-phase cells subjected to 6% and9% NaCl upshocks yielded similar expression trends as those de-scribed above for VP1456, VP1905, and VPA0356, with 6.5-, 5.5-,and 7-log2-fold increases, respectively (Fig. 1B). The VP1723 genewas unchanged after 6% NaCl upshock but showed a 2.5-log2-folddecrease after a 9% NaCl upshock (Fig. 1B). Overall, these datademonstrated the induction of the VP1456, VP1905, andVPA0356 genes from log- and stationary-phase cells after NaClupshock.

BCCTs are redundant in V. parahaemolyticus. To determinewhether each the four BCCTs present in V. parahaemolyticus isessential, in-frame, nonpolar, single deletions of each of the geneswere constructed. Analysis of the growth of each mutant inM9G– 6% NaCl medium was examined in the absence or presenceof CSs or their precursors. No difference in growth between thewild-type and mutant strains was observed under these condi-tions, indicating redundancy (data not shown). We next con-structed double mutants to serve as backgrounds for the construc-tion of BCCT triple and quadruple mutants. A double mutant wasconstructed in the �VP1456 (SOYBCCT1) single mutant back-ground to create a �VP1456 �VP1723 strain (SOYBCCT12). V.parahaemolyticus triple mutant strains were constructed by usingthis double mutant to create the �VP1456 �VP1723 �VP1905(BCCT123) and �VP1456 �VP1723 �VPA0356 (BCCT124)strains. A quadruple mutant could not be constructed by usingeither of these triple mutants. Therefore, we constructed two ad-ditional triple mutants, one in the BCCT13 and another in theBCCT23 double mutant backgrounds, creating the �VP1456�VP1905 �VPA0356 (BCCT134) and �VP1723 �VP1905�VPA0356 (BCCT234) strains, respectively. By using BCCT134as a background strain, we were able to create a quadruple BCCTmutant, BCCT1342, by using a modified mutant constructionprotocol that included additional selection steps using NaCl andsucrose gradients. All mutants were tested with LB–3% NaCl andM9G–3% NaCl, and all mutants grew similarly to the wild type(data not shown).

First, we performed growth curve analysis of the BCCT1342quadruple mutant in M9G– 6% NaCl in the absence or presence ofGB, proline, choline, ectoine, or L-carnitine. In M9G– 6% NaClmedium with no CS added, we obtained similar growth patternsfor both the mutant and wild-type strains, with an extended lagphase of 6 to 7 h, indicating no overall defect in the mutant (Fig.2A to D). In M9G– 6% NaCl supplemented with GB, the lag timefor the wild type was reduced from 6 h to 1 h, whereas for thequadruple mutant strain, the lag time was reduced marginally to5 h. This result indicates that GB is not transported efficientlyinto the cell, suggesting that at least one of the BCCTs is requiredfor its uptake (Fig. 2A). Growth curve analyses of the mutant inM9G– 6% NaCl medium supplemented with choline, proline, orectoine also yielded a slight reduction in the lag time but not towild-type levels, indicating that these CSs are being transportedbut that a BCCT is required for efficient transport (Fig. 2B to D).Taken together, the growth curve analysis demonstrates that ad-ditional transporters are available for CS uptake but that a BCCTis required for the efficient transport of CS. We found that V.parahaemolyticus does not use L-carnitine as a CS (data notshown).

The construction of four different triple mutants allowed us to

BCCTs in Vibrio parahaemolyticus

January 2015 Volume 81 Number 1 aem.asm.org 355Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

examine a single BCCT in the V. parahaemolyticus background.Growth curve analyses using M9G– 6% NaCl medium with no CSyielded similar growth patterns, with an extended lag phase of 7 hfor each strain, indicating no overall defect in the mutants com-pared to the wild type under these conditions (Fig. 3A to H and 4Ato H). However, in M9G– 6% NaCl supplemented with GB, the lagtime for the wild type was reduced from 7 h to 1 h, whereas forBCCT124, which has only BCCT3 (VP1905) present, the lag timewas reduced from 7 h to 4 h. This result indicates that GB is stillbeing transported into the cell but not at the same level as in thewild type, suggesting that at least one additional transporter isrequired for maximum uptake (Fig. 3A). Since the reduction ofthe lag phase was greater than that of the quadruple mutant, thissuggests that VP1905 is a transporter of GB. For triple mutantstrain BCCT123, which has only BCCT4 (VPA0356) present, onlya slight reduction in the lag time occurred with growth on GB,which indicates that VPA0356 transports this substrate with verylow efficiency (Fig. 3E). In medium supplemented with proline or

choline, a slight reduction in the lag time for both mutant strainswas noted but again not to the same extent as for the wild type.However, the lag-phase shift in these mutants was similar to theshift in the quadruple mutant, suggesting that these BCCTs do nottransport these CSs (Fig. 3B, C, F, and G). The addition of ectoineto the medium yielded no reduction of the lag time for either of thetriple mutants, indicating that VP1905 and VPA0356 are not in-volved in ectoine uptake (Fig. 3D and H).

In the growth curve analysis of BCCT134, which containsBCCT2 (VP1723), in the presence of GB, the triple mutantshowed a reduction in lag-phase growth. The shift in the lag phasewas not to the wild-type level but was greater than that seen for thequadruple mutant, suggesting that VP1723 is a GB transporterand that an additional BCCT is required for efficient GB uptake(Fig. 4A). This mutant showed a nearly identical reduction in thelag phase in the presence of proline and choline, indicating thatVP1723 is an important transporter of these compounds (Fig. 4Band C). No change in the lag phase was seen with the addition of

FIG 1 Expression analysis of the BCCT genes in V. parahaemolyticus RIMD2210633 following NaCl upshock in LB medium. Cultures were grown in LBmedium–3% NaCl to log phase (A) or stationary phase (B) and then subjected to 6% and 9% NaCl upshocks. These experiments were performed in duplicate,with two biological replicates. Changes in expression levels are relative to expression levels observed in either log-phase (A) or stationary-phase (B) cultures notsubjected to osmotic upshock. The data were statistically analyzed by using an unpaired Student t test with a 95% confidence interval. The P values obtained areshown as asterisks, which denote the significant differences between upshocked samples and untreated controls. The error bars indicate means � standard errors.�, P � 0.05; ��, P � 0.01; ���, P � 0.001.

Ongagna-Yhombi et al.

356 aem.asm.org January 2015 Volume 81 Number 1Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

ectoine (Fig. 4D). For triple mutant strain BCCT234, which con-tains an intact copy of VP1456, the addition of GB, proline, cho-line, or ectoine showed a reduction in the lag phase to the sameextent as for the wild type (Fig. 4E to H), suggesting that VP1456 isalso an important and efficient transporter of these CSs and hasbroad substrate specificity.

The BCCTs VP1456, VP1723, VP1905, and VPA0356 are CStransporters. To further examine the transport abilities of eachBCCT in relation to a given CS, functional complementation anal-yses of E. coli MKH13 were performed (Fig. 5). E. coli strainMKH13 is a �putPA �proP �proU mutant in an MC4100 back-ground and is thus unable to transport proline, GB, and choline orconvert choline to GB (31–33). Escherichia coli MKH13 grew inM9G–1% NaCl but not in 4% NaCl (data not shown). All com-plemented E. coli MKH13 strains, except for the negative empty-vector control, grew in the presence of GB (Fig. 5A). In the pres-ence of proline, E. coli MKH13(pVP1456) or MKH13(pVP1723)grew significantly better than the control, indicating that theseBCCTs can transport proline (Fig. 5B). Neither E. coli MKH13(pVP1905) nor MKH13(pVPA0356) grew in the presence of pro-line, suggesting that they cannot transport proline. Only E. coliMKH13(pVP1456) grew significantly better than the negativecontrol in the presence of ectoine (Fig. 5C).

To determine whether any of the BCCTs take up choline, weperformed 1H NMR analysis since choline accumulation is toxic

to E. coli MKH13, as it cannot convert choline to GB. To performthese experiments, E. coli MKH13 cells transformed with individ-ual BCCTs were grown in M9G–1% NaCl to early exponentialphase and switched to M9G– 4% NaCl supplemented with cholinefor 1 h, and 1H NMR analysis was then performed, which demon-strated that E. coli MKH13 cells transformed with VP1456 (butnot VP1723, VP1905, or VPA0356) accumulated choline intracel-lularly (Fig. 6A). 1H NMR uptake analyses of recombinant E. coliMKH13 cells containing individual BCCTs in M9G– 4% NaClsupplemented with ectoine also demonstrated accumulation ofectoine only in VP1456-transformed cells (Fig. 6B). These dataconfirm that VP1456 is the sole ectoine BCCT and that VP1456has a broad substrate range in both V. parahaemolyticus and E. coli.The failure to show choline uptake for VP1723 in E. coli by 1HNMR analysis is likely the result of experimental differences inthese assays. In the E. coli assay, only a 1-h time point was exam-ined, which may be too short to show uptake for a low-affinitytransporter, and functional differences between species may alsoplay a part in the different outcomes.

VP1456, VP1723, and VP1905 transport GB with high effi-ciency. GB is one of the most commonly used CSs among bac-teria. To examine whether the BCCTs take up GB with high orlow efficiency, growth analyses of individual BCCTs in E. coliMKH13 in the presence of limiting concentrations of GB wereperformed. Using Monod’s nonlinear regression and Eadie Hof-

FIG 2 Growth analyses of V. parahaemolyticus RIMD2210633 and quadruple mutant strain BCCT1342 (�VP1456 �VP1905 �VPA0356 �VP1723). Strains weregrown in M9G–1% NaCl for 5 h and then inoculated into M9G– 6% NaCl medium in the absence and presence of exogenously supplied CS. Data for growthanalyses carried out for 24 h are shown in the graphs. Each assay was performed in triplicate, and data are shown as pooled data from two biological replicates.The error bars indicate means � standard errors.

BCCTs in Vibrio parahaemolyticus

January 2015 Volume 81 Number 1 aem.asm.org 357Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

FIG 3 Growth analyses of triple mutant strains BCCT124 and BCCT123. Strains were grown in M9G–1% NaCl for 5 h and then inoculated into M9G– 6% NaClmedium in the absence and presence of exogenously supplied CS. Data for growth analyses carried out for 24 h are shown in the graphs. Each assay was performedin triplicate, and data are shown as the pooled data from two biological replicates. The error bars indicate means � standard errors.

Ongagna-Yhombi et al.

358 aem.asm.org January 2015 Volume 81 Number 1Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

FIG 4 Growth analyses of triple mutant strains BCCT134 and BCCT234. Strains were grown in M9G–1% NaCl for 5 h and then inoculated into M9G– 6% NaClmedium in the absence and presence of exogenously supplied CS. Data for growth analyses carried out for 24 h are shown in the graphs. Each assay was performedin triplicate, and data are shown as the pooled data from two biological replicates. The error bars indicate means � standard errors.

BCCTs in Vibrio parahaemolyticus

January 2015 Volume 81 Number 1 aem.asm.org 359Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

stee linear plots, the parameters of bacterial growth kinetics atlimiting GB concentrations were empirically determined, and thebinding affinity of each BCCT was inferred (Fig. 7). It was foundthat VP1456 transported GB with high affinity, at a Ks of 5.9 � 1.8�M; VP1723 transported GB at a Ks of 14.0 � 5.0 �M; andVP1905 transported GB at a Ks of 8.4 � 0.9 �M (Fig. 7). Thus, theBCCT binding affinities for GB were in the descending order

VP1456 � VP1905 � VP1723. VPA0356 showed very low affinityfor GB relative to the three BCCTs mentioned above (data notshown).

DISCUSSION

The uptake and/or synthesis of CSs is paramount to the growthand survival of bacteria under high-salinity conditions (8, 9, 16,

FIG 5 Functional complementation of E. coli MKH13 harboring individual BCCT genes. E. coli MKH13 strains were grown in M9G–1% NaCl mediumovernight and transferred into M9G– 4% NaCl medium in the absence and presence of exogenously supplied CS. Data for growth analyses carried out for 24 hare shown in the graphs. For each condition tested, the sample was assayed in triplicate, with at least two biological replicates. (A) M9G– 4% NaCl plus GB; (B)M9G– 4% NaCl plus proline; (C) M9G– 4% NaCl plus ectoine. The error bars represent means � standard errors. ���, P � 0.001.

FIG 6 1H NMR spectroscopy of choline and ectoine transport in complemented E. coli MKH13 strains. 1H NMR spectra were acquired with a Bruker AvanceIII 400-MHz NMR spectrometer. The chemical shifts (�) are expressed in ppm. The spectral peaks corresponding to the detected compounds of interest arelabeled with the initials of the compound name on the top. 1H NMR experiments were performed at least twice, with two biological replicates. E, ectoine peaks;Ch, choline peaks.

Ongagna-Yhombi et al.

360 aem.asm.org January 2015 Volume 81 Number 1Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

17, 21, 36). Vibrio parahaemolyticus inhabits a wide range of eco-systems subjected to constant shifts in salinity. In this study, weinvestigated the specific role of four BCCTs in the osmotic stresstolerance response. We showed that three out of four BCCTs,VP1456, VP1905, and VPA0356, were induced by NaCl upshockbut that VP1723 showed no change or reduced expression at highsalinity. This suggests that salinity alone is not a trigger for theexpression of VP1723 and that other factors are involved. For P.aeruginosa, it was shown that certain BCCTs are not induced at thelevel of transcription but at the level of transport activity, whichmay also be the case for VP1723 (22).

To investigate the function of the four BCCTs in the uptakeof CS, single in-frame deletion mutants were created, but nodifferences in growth patterns were observed under the condi-tions examined. Therefore, we constructed a BCCT quadruplemutant that lacked all four BCCTs and four different triplemutants that each contained a single BCCT. Comparisons ofthe shifts in lag phases between the quadruple and triple mu-tants demonstrated that VP1456 transports GB, proline, andcholine and is the sole transporter of ectoine. These data alsodemonstrated that VP1723 is an important transporter of GB,choline, and proline, whereas VP1905 and VPA0356 trans-ported only GB, and VP1905 did so much more efficiently thanVPA0356. The ability of the V. parahaemolyticus BCCT-negativestrain to survive at high salinity similarly to the wild type mayreflect the fact that two functional CS synthesis systems and twoadditional CS transporters are present in the genome (17). Heter-ologous gene expression analysis of E. coli MKH13 also demon-strated that all four BCCTs could transport GB. Thus, the ability ofall four BCCTs to take up GB is not too surprising given that GB isthe most abundant CS present in the environment and is one ofthe most effective CSs. Complementation of E. coli MKH13 withpVP1456 confirmed that this transporter had the broadest sub-strate range. Our triple mutant data indicate that VP1723 couldtake up choline; however, this was not shown in the E. coli MKH13NMR studies. This difference probably reflects the different con-ditions under which the experiments were performed; the NMRcholine uptake assay with E. coli was a 1-h assay, compared to a24-h assay for the V. parahaemolyticus mutant strains. Our datashowed that not all BCCTs are equal and that VP1456 and VP1905had the highest affinities for GB, with affinity constants in therange of what was previously described for other bacterial species(8, 9, 36). The lower energetic cost associated with the uptake thanwith the synthesis of CSs provides a rationale for the evolutionaryacquisition and retention of the multiple transport systems in V.parahaemolyticus. Having the ability to take up CS at low and highconcentrations by using different transporters could be an impor-tant adaptive strategy to grow at different salt concentrations, suchas those encountered in marine environments and in host species.Having multiple CS transporters may also be critical for the or-ganism to adapt to other environmental stresses, such as temper-ature fluctuations and, perhaps, acid stress conditions. For exam-ple, we have previously shown that growth at high salinity

FIG 7 Determination of the affinity of BCCTs for GB. The affinity of eachBCCT for GB was determined by growth analysis of recombinant E. coliMKH13 strains in the presence of limiting GB concentrations. Bacterialgrowth was monitored for 24 h, and the specific growth rates of the recombi-nant E. coli MKH13 strains for a given GB concentration were calculated.

BCCTs in Vibrio parahaemolyticus

January 2015 Volume 81 Number 1 aem.asm.org 361Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

preadapts V. parahaemolyticus to additional osmotic and acidstresses; we found that a short preadaptation to high salt concen-trations increased the survival of the wild-type strain under lethalacid conditions (37). It will be of interest to determine whetherthese BCCT systems are required under other stress conditions.

ACKNOWLEDGMENTS

We thank Megan R. Carpenter, Brandy Haines-Menges, Sai SiddarthKalburge, J. B. Lubin, and Abish Regmi for their careful review andhelpful discussion of the manuscript. We thank Steve Bai at the Nu-clear Magnetic Resonance Core Facility, Department of Chemistry andBiochemistry, University of Delaware, for help and assistance withNMR analysis and the Center of Biomedical Research Excellence(COBRE) in Membrane Protein Production and Characterization atthe University of Delaware.

Research on Vibrio stress response mechanisms was supported by Na-tional Science Foundation grant IOS-0918429 to E.F.B.

REFERENCES1. DePaola A, Nordstrom JL, Bowers JC, Wells JG, Cook DW. 2003.

Seasonal abundance of total and pathogenic Vibrio parahaemolyticus inAlabama oysters. Appl Environ Microbiol 69:1521–1526. http://dx.doi.org/10.1128/AEM.69.3.1521-1526.2003.

2. Daniels NA, MacKinnon L, Bishop R, Altekruse S, Ray B, HammondRM, Thompson S, Wilson S, Bean NH, Griffin PM, Slutsker L. 2000.Vibrio parahaemolyticus infections in the United States, 1973–1998. J In-fect Dis 181:1661–1666. http://dx.doi.org/10.1086/315459.

3. Cabanillas-Beltran H, Llausas-Magana E, Romero R, Espinoza A, Gar-cia-Gasca A, Nishibuchi M, Ishibashi M, Gomez-Gil B. 2006. Outbreakof gastroenteritis caused by the pandemic Vibrio parahaemolyticus O3:K6in Mexico. FEMS Microbiol Lett 265:76 – 80. http://dx.doi.org/10.1111/j.1574-6968.2006.00475.x.

4. Colwell RR, Kaper J, Joseph SW. 1977. Vibrio cholerae, Vibrio parahae-molyticus, and other vibrios: occurrence and distribution in ChesapeakeBay. Science 198:394 –396. http://dx.doi.org/10.1126/science.910135.

5. Kaneko T, Colwell RR. 1973. Ecology of Vibrio parahaemolyticus in Ches-apeake Bay. J Bacteriol 113:24 –32.

6. Kaneko T, Colwell RR. 1975. Incidence of Vibrio parahaemolyticus inChesapeake Bay. Appl Microbiol 30:251–257.

7. Krantz GE, Colwell RR, Lovelace E. 1969. Vibrio parahaemolyticus fromthe blue crab Callinectes sapidus in Chesapeake Bay. Science 164:1286 –1287. http://dx.doi.org/10.1126/science.164.3885.1286.

8. Csonka LN. 1989. Physiological and genetic responses of bacteria to os-motic stress. Microbiol Rev 53:121–147.

9. Galinski EA. 1995. Osmoadaptation in bacteria. Adv Microb Physiol 37:272–328.

10. Oren A. 2008. Microbial life at high salt concentrations: phylogenetic andmetabolic diversity. Saline Syst 4:2. http://dx.doi.org/10.1186/1746-1448-4-2.

11. Ventosa A, Nieto JJ, Oren A. 1998. Biology of moderately halophilicaerobic bacteria. Microbiol Mol Biol Rev 62:504 –544.

12. Pflüger K, Müller V. 2004. Transport of compatible solutes in extremo-philes. J Bioenerg Biomembr 36:17–24. http://dx.doi.org/10.1023/B:JOBB.0000019594.43450.c5.

13. Ziegler C, Bremer E, Kramer R. 2010. The BCCT family of carriers: fromphysiology to crystal structure. Mol Microbiol 78:13–34. http://dx.doi.org/10.1111/j.1365-2958.2010.07332.x.

14. Reen FJ, Almagro-Moreno S, Ussery D, Boyd EF. 2006. The genomiccode: inferring Vibrionaceae niche specialization. Nat Rev Microbiol4:697–704. http://dx.doi.org/10.1038/nrmicro1476.

15. Boyd EF, Cohen AL, Naughton LM, Ussery DW, Binnewies TT, StineOC, Parent MA. 2008. Molecular analysis of the emergence of pandemicVibrio parahaemolyticus. BMC Microbiol 8:110. http://dx.doi.org/10.1186/1471-2180-8-110.

16. Naughton LM, Blumerman SL, Carlberg M, Boyd EF. 2009. Osmoad-aptation among Vibrio species and unique genomic features and physio-logical responses of Vibrio parahaemolyticus. Appl Environ Microbiol 75:2802–2810. http://dx.doi.org/10.1128/AEM.01698-08.

17. Ongagna-Yhombi SY, Boyd EF. 2013. Biosynthesis of the osmopro-tectant ectoine, but not glycine betaine, is critical for survival of osmoti-

cally stressed Vibrio parahaemolyticus cells. Appl Environ Microbiol 79:5038 –5049. http://dx.doi.org/10.1128/AEM.01008-13.

18. Ressl S, Terwisscha van Scheltinga AC, Vonrhein C, Ott V, Ziegler C.2009. Molecular basis of transport and regulation in the Na�/betaine sym-porter BetP. Nature 458:47–52. http://dx.doi.org/10.1038/nature07819.

19. Kappes RM, Kempf B, Bremer E. 1996. Three transport systems for theosmoprotectant glycine betaine operate in Bacillus subtilis: characteriza-tion of OpuD. J Bacteriol 178:5071–5079.

20. Peter H, Burkovski A, Kramer R. 1996. Isolation, characterization, andexpression of the Corynebacterium glutamicum betP gene, encoding thetransport system for the compatible solute glycine betaine. J Bacteriol178:5229 –5234.

21. Kapfhammer D, Karatan E, Pflughoeft KJ, Watnick PI. 2005. Role forglycine betaine transport in Vibrio cholerae osmoadaptation and biofilmformation within microbial communities. Appl Environ Microbiol 71:3840 –3847. http://dx.doi.org/10.1128/AEM.71.7.3840-3847.2005.

22. Malek AA, Chen C, Wargo MJ, Beattie GA, Hogan DA. 2011. Roles ofthree transporters, CbcXWV, BetT1, and BetT3, in Pseudomonas aerugi-nosa choline uptake for catabolism. J Bacteriol 193:3033–3041. http://dx.doi.org/10.1128/JB.00160-11.

23. Chen C, Beattie GA. 2008. Pseudomonas syringae BetT is a low-affinitycholine transporter that is responsible for superior osmoprotection bycholine over glycine betaine. J Bacteriol 190:2717–2725. http://dx.doi.org/10.1128/JB.01585-07.

24. Lamark T, Kaasen I, Eshoo MW, Falkenberg P, McDougall J, StromAR. 1991. DNA sequence and analysis of the bet genes encoding theosmoregulatory choline-glycine betaine pathway of Escherichia coli.Mol Microbiol 5:1049 –1064. http://dx.doi.org/10.1111/j.1365-2958.1991.tb01877.x.

25. Wargo MJ. 2013. Choline catabolism to glycine betaine contributes toPseudomonas aeruginosa survival during murine lung infection. PLoS One8:e56850. http://dx.doi.org/10.1371/journal.pone.0056850.

26. Wargo MJ. 2013. Homeostasis and catabolism of choline and glycinebetaine: lessons from Pseudomonas aeruginosa. Appl Environ Microbiol79:2112–2120. http://dx.doi.org/10.1128/AEM.03565-12.

27. Wargo MJ, Szwergold BS, Hogan DA. 2008. Identification of two geneclusters and a transcriptional regulator required for Pseudomonas aerugi-nosa glycine betaine catabolism. J Bacteriol 190:2690 –2699. http://dx.doi.org/10.1128/JB.01393-07.

28. Whitaker WB, Parent MA, Naughton LM, Richards GP, BlumermanSL, Boyd EF. 2010. Modulation of responses of Vibrio parahaemolyticusO3:K6 to pH and temperature stresses by growth at different salt concen-trations. Appl Environ Microbiol 76:4720 – 4729. http://dx.doi.org/10.1128/AEM.00474-10.

29. Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, Tagomori K,Iijima Y, Najima M, Nakano M, Yamashita A, Kubota Y, Kimura S,Yasunaga T, Honda T, Shinagawa H, Hattori M, Iida T. 2003. Genomesequence of Vibrio parahaemolyticus: a pathogenic mechanism distinctfrom that of V. cholerae. Lancet 361:743–749. http://dx.doi.org/10.1016/S0140-6736(03)12659-1.

30. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR. 1989. Engineeringhybrid genes without the use of restriction enzymes: gene splicing by over-lap extension. Gene 77:61– 68. http://dx.doi.org/10.1016/0378-1119(89)90359-4.

31. Haardt M, Kempf B, Faatz E, Bremer E. 1995. The osmoprotectantproline betaine is a major substrate for the binding-protein-dependenttransport system ProU of Escherichia coli K-12. Mol Gen Genet 246:783–786. http://dx.doi.org/10.1007/BF00290728.

32. Peters JE, Thate TE, Craig NL. 2003. Definition of the Escherichia coliMC4100 genome by use of a DNA array. J Bacteriol 185:2017–2021. http://dx.doi.org/10.1128/JB.185.6.2017-2021.2003.

33. Casadaban MJ. 1976. Transposition and fusion of the lac genes toselected promoters in Escherichia coli using bacteriophage lambda andMu. J Mol Biol 104:541–555. http://dx.doi.org/10.1016/0022-2836(76)90119-4.

34. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M,Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, WittwerCT. 2009. The MIQE guidelines: minimum information for publication ofquantitative real-time PCR experiments. Clin Chem 55:611– 622. http://dx.doi.org/10.1373/clinchem.2008.112797.

35. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2��CT method. Methods 25:402– 408. http://dx.doi.org/10.1006/meth.2001.1262.

Ongagna-Yhombi et al.

362 aem.asm.org January 2015 Volume 81 Number 1Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from

36. Kempf B, Bremer E. 1998. Uptake and synthesis of compatible solutes asmicrobial stress responses to high-osmolality environments. Arch Micro-biol 170:319 –330. http://dx.doi.org/10.1007/s002030050649.

37. Kalburge SS, Whitaker WB, Boyd EF. 2014. Salinity adaptation of thehuman pathogen Vibrio parahaemolyticus to lethal environmental condi-tions. J Food Prot 77:246 –253. http://dx.doi.org/10.4315/0362-028X.JFP-13-241.

38. Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D. 2004.Improvement of pCVD442, a suicide plasmid for gene allele exchange inbacteria. Plasmid 51:246 –255. http://dx.doi.org/10.1016/j.plasmid.2004.02.003.

39. Kovach ME, Phillips RW, Elzer PH, Roop RM, II, Peterson KM. 1994.pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16:800 –802.

BCCTs in Vibrio parahaemolyticus

January 2015 Volume 81 Number 1 aem.asm.org 363Applied and Environmental Microbiology

on May 23, 2019 by guest

http://aem.asm

.org/D

ownloaded from