cyr61 suppresses growth of human endometrial cancer cells

Cyr61 suppresses growth of human endometrial cancer cells Wenwen Chien, Takashi Kumagai, Carl W. Miller, Julian C. Desmond, Jonathan M.Frank, Jonathan W. Said, and H. Phillip Koeffler

Department of Hematology/Oncology, Cedars-Sinai Research Institute, UCLA School ofMedicine, Los Angeles, CA 90048

Running Title: The role of Cyr61 in endometrial tumorigenesis

Key Words: Cyr61, CCN, endometrial cancer, apoptosis, Bax, myc

AcknowledgementsThis research is supported in parts by grants from NIH, Women’s Cancer ResearchInstitute at Cedars-Sinai Medical Center, The Sid and Ann Schwartz Family Funds aswell as Tom Collier Cancer Fund. H. P. Koeffler holds the Mark Goodson Chair inOncology Research and is a member of the Molecular Biology Institute and JonssonCancer Center of UCLA.

Corresponding author: Wenwen Chien, Ph.D.

Department of Hematology/Oncology

Cedars-Sinai Medical Center

110 George Burns Road, D5065

Los Angeles, CA 90048

Tel: 310-423-7759 Fax: 310-423-0225

Email: [email protected]

JBC Papers in Press. Published on October 7, 2004 as Manuscript M410254200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on February 15, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

ABSTRACT

Cyr61 (CCN1) is a member of the CCN protein family; these secreted proteins are

involved in diverse biological processes such as cell adhesion, angiogenesis, apoptosis,

and either growth arrest or growth stimulation depending on the cellular context. We

studied the role of Cyr61 in endometrial tumorigenesis. Levels of Cyr61 were decreased

in endometrial tumors compared to normal endometrium. Knock-down of Cyr61

expression by RNA interference in a well-differentiated endometrial adenocarcinoma

cell line (Ishikawa) stimulated its cellular growth. Conversely, overexpression of the

protein in the undifferentiated AN3CA endometrial cancer cell line decreased their

growth concurrently with increased apoptosis in liquid culture. These same cells had

decreased clonogenic capacity and a nearly complete loss of tumorigenicity in vivo.

Furthermore, partially purified Cyr61 suppressed growth of endometrial cancer cells. The

increased apoptosis in these endometrial cancer cells with forced overexpression of

Cyr61 was associated with elevated expression of the pro-apoptotic proteins Bax, Bad

and TRAIL (tumor necrosis factor receptor-associated ligand). Cyr61 induced caspase-3

activation and depolarization of mitochondrial membrane. In summary, endometrial

cancer cells have decreased expression of Cyr61 compared to normal endometrium, and

this lowered expression may provide the transformed cells a growth advantage over their

normal counterpart.

2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

INTRODUCTION

Cyr61 belongs to the CCN protein family, which includes Cyr61 (Cysteine-rich

61), CTGF (connective tissue growth factor), NOV (Nephroblastoma-overexpressed),

WISP-1, -2, and -3 (Wnt-1-induced secreted proteins) (1-4). Each member of this

family shares several modules that have homology to other proteins: IGFBP (insulin-like

growth factor binding protein), VWC (von Willibrand type C domain), TSP-1

(thrombospondin-1), and CT (cystine knot). The CCN family of proteins have been

implicated in diverse biological processes such as cell adhesion, migration, angiogenesis,

wound healing, and tumorigenesis (5-7). Cyr61 can be rapidly induced in quiescent

fibroblasts by a variety of stimuli such as serum and platelet-derived growth factor (1,8).

It is secreted and becomes associated with the extracellular matrix and cell surface. It can

behave as a novel ligand for integrins, and thus, is involved in the integrin signaling

pathway (9,10).

Expression of the Cyr61 protein can be regulated by estrogen, and it is often

highly expressed in human breast cancers (11,12). The high levels of expression of Cyr61

are associated with a more advanced stage of breast cancer (13). Furthermore,

overexpression of Cyr61 in MCF-7 breast cancer cells substantially increased their

ability to form large tumors when grown in nude mice (12). Paradoxically, Cyr61

functions as a tumor suppressor in non-small cell lung cancers by up-regulation of p53

and p21 and decreased activity of cyclin-dependent kinase 2 (14, 15). Levels of Cyr61

3


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

are decreased in prostate cancers compared to the neighboring epithelium of the normal

prostate; and Cyr61 probably plays a role in aberrant cell-cell interaction between the

epithelial and stromal cells in prostate carcinoma (16). Using cDNA expression arrays

and immunohistochemistry, Cyr61 was found to be down-regulated in papillary thyroid

carcinoma compared to normal thyroid samples (17). High levels of Cyr61 expression

were detected in uterine smooth muscle cells, while leiomyomas expressed significantly

lower protein levels (18).

Endometrial adenocarcinoma is the most common gynecologic malignancy.

Development of these cancers arises from a series of genetic alterations that transform the

normal endometrium through the stages of hyperplasia, dysplasia, and finally overt

carcinoma. In this study, we found that expression levels of Cyr61 were decreased in

endometrial tumors and cancer cell lines compared to the normal endometrium. Forced

expression of Cyr61 in undifferentiated AN3CA endometrial cancer cells inhibited

cellular growth both in liquid culture and in clonogenic assays, decreased tumor forming

potential in nude mice, and promoted endometrial cancer cell apoptosis associated with

elevated levels of Bax, Bad, and TRAIL. Also, addition of partially purified Cyr61 to

endometrial cancer cells inhibited their growth, increased caspase-3 activity and

decreased mitochondrial membrane potential. On the other hand, suppression of

endogenous Cyr61 mRNA in the well-differentiated Ishikawa endometrial

adenocarcinoma cells increased their cell numbers. In summary, decreased expression of

4


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Cyr61 in transformed endometrial cells may represent a mechanism to provide these cells

with a growth advantage over their normal counterpart.

5


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

EXPERIMENTAL PROCEDURES

RNA analysis by real-time PCR: Total RNA was extracted by Trizol (Invitrogen) from a

series of endometrial cancer cell lines as well as matched endometrial cancers and normal

endometrium from the same patients after their informed consent. Quantitative real-time

PCR was performed using TaqMan reagents (PE Biosystems) as described previously

(12). The oligonucleotide primers and probe sequences used: Cyr61:

5’ACTTCATGGTCCCAGTGCTC, 5’AAATCCGGGTTTCTTTCACA, and

5’TTACCAATGACAACCCTGAGTGCCG; CTGF: 5’AGTATGGCACAGTGCAAG,

5’ATGTCTTCATGCTGGTGCAG and 5’TGCGAAGCTGACCTGGAAGAGAACA;

NOV: 5’GATCATTGCTCCTCCTGAGC, 5’GGTGTGCCACTTACCTGTCC, and

5’TTGCCTGACCTTCCTGCTTCTCCA; WISP1: 5’AGCATGCAGAGTGTGCAGAG,

5’GTGTGTGTAGGCAGGGAGTG, and 5’TAACTCACTGCCTAGGAGGCTGGCC;

WISP2: 5’ATTAACACGCTGCCTGGTCT, 5’AGAGATGGGACAAGCAGTCC, and

5’GCTGGCCAAGGTGTCCAGGG; WISP3: 5’CCCACACAAAGGGCTGTATT,

5’GTTCAGCTGCCTCTGTGTGA, and 5’CATAATGGCCAAGTGTTTCAGCCCA;

Bax: 5’TTTGCTTCAGGGTTTCATCC, 5’CAGTTGAAGTTGCCGTCAGA, and 5’GGGGACGAACTGGA

TRAIL: 5’TTCACAGTGCTCCTGCAGTC, 5’ACGGAGTTGCCACTTGACTT, and

5’CCAACGAGCTGAAGCAGATGCA. For normalization, β-actin probe was used. The

sequence for the β-actin probe was 5CTCGCTGTCCACCTTCCAGCAGAT, the β-

actin-specific primers were 5GATCATTGCTCCTCCTGAGC and

6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

5ACTCCTGCTTGCTGATCCAC.

Cell culture and transfection: Endometrial cancer cell lines AN3CA, HEC1A, HEC1B,

KLE, and RL95-2 were purchased from American Type Culture Collection. Ishikawa

was kindly provided by Dr. Bruce A. Lessey, University of North Carolina at Chapel Hill

and HEC59 by Dr. Timothy J. Kinsella, Case Western Reserve University. AN3CA,

Ishikawa, HEC59, HEC1A and HEC1B were maintained in Minimum essential medium

with 2 mM L-glutamine and Earle’s BSS adjusted to contain 1.5 g/L sodium bicarbonate,

0.1 mM non-essential amino acids, and 1.0 mM sodium pyruvate plus 10% fetal bovine

serum (FBS). Ishikawa and KLE were cultured in a 1:1 mixture of Dulbecco’s modified

Eagle’s medium (DMEM) and Ham’s F12 medium. RL95-2 was cultured in a 1:1

mixture of DMEM and Ham’s F12 medium with 10 mM HEPES and 2.0 g/L sodium

bicarbonate supplemented with 0.005 mg/ml insulin and 10% fetal bovine serum. MDA-

MB-231, H460, Cos-1, and Rat1 cells were grown in DMEM with 10% FBS. Cyr61

cDNA was previously cloned into the pcDNA3.1 vector in our laboratory (12).

Lipofectamine 2000 (Invitrogen) and either 5 µg of Cyr61 expression vector or empty

vector pcDNA3.1 were used in cell transfection. Forty-eight hours after transfection, the

cells were replated in 600 µg/ml of G418 and isolated stable clones were selected for

assay after two weeks. One G418 resistant clone selected from empty vector pcDNA3.1

transfection was designated as AN3CA-neo. Several G418-resistant stable clones after

Cyr61 transfection were screened for Cyr61 expression with real-time PCR and western

7


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

blot analysis. Only the two clones with the most prominent Cyr61 expression are shown

and used for this study.

Western blot analysis: Cell lysates were prepared from cells harvested by lysis buffer

containing 50 mM Tris, pH 7.6, 5 mM EDTA, 300 mM NaCl, 0.1% NP-40, 0.2 mM

PMSF, 1 mM DTT, plus protease inhibitor mixture (Roche Molecular Biochemicals).

Equal amounts of lysates were separated by SDS-polyacrylamide gel electrophoresis

followed by transfer to PVDF membranes. Anti-Cyr61 polyclonal rabbit antisera were

prepared in this laboratory (12). Antibodies to GAPDH, Bad, Bax, Bcl-2 and Bcl-xL

were purchased from Santa Cruz Biotechnology.

Cell proliferation and colony formation assay: For cell growth analysis, cells (3x103

cells/well) were seeded in 96-well plates and cultured for various durations. Cell

numbers were measured by MTT assay according to the manufacturers protocol (Roche

Diagnostics). For colony formation, equal number of transfected cells were seeded in 24-

well plastic plates and cultured under G418 selection (600 µg/ml). After two weeks, the

colonies were stained with 0.1% crystal violet in 50% methanol and photographed with

an inverted phase contrast microscope.

Tumorigenicity analysis: AN3CA-neo and AN3CA-Cyr61#1 cells (1 x 107 cells) were

subcutaneously injected on different sides of the same mouse. A total of 5 nude mice

were used for this study. Size of the ten tumors was measured every week for 4 weeks;

8


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

and euthanasia was performed at week 4. The tumors were dissected and measured.

RNA interference: Hairpin expressing clones were made using primers designed by using

the web-based siRNA hairpin engine at Cold Spring Harbor Laboratories

(http://katahdin.cshl.org:9331/RNAi/). A 17-nucleotide homology with a U6 promoter

was placed at the 3’ end of the primer, a Pol III termination codon was incorporated at the

5’ end, the center encompasses the stem and loop structure. For mapping convenience,

the loop includes a Hind III site. For PCR reaction, a SP6 promoter was used as the

second primer and a cloned U6 promoter, pCGU6, as template. The reaction was set up

using Hot Master Taq, with 0.3 mM dNTPs, 3 nM oligonucleotides and 10 ng template in

the buffer provided by the manufacturer (Qiagen). After the reaction, the resulting 600

basepair fragment with the U6 promoter and the hairpin, was cloned into pCR2.1 using a

TOPO TA cloning kit and confirmed by DNA sequencing. One mutant fragment that

lacks the hairpin sequence producing a non-functional RNAi, and was used as control

RNAi. Ishikawa cells were co-transfected with pcDNA3.1 and either Cyr61 RNAi or

control RNAi, and stable clones were selected with G418 (600 µg/ml). One stable clone

from empty vector containing only the neo gene, was designated Ishikawa-neo. Several

stable clones from Cyr61 RNAi transfection were screened for Cyr61 protein knockdown

by western blot analysis. The sequence for Cyr61 RNAi was

5’GGCACCATCAATACACGTACACTGATGCTCAAGCTTCAACATCAGTGCACT

GTATTGATGGCGC and the sequence for the control RNAi was

9


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

GGCACCATCAATACACGTACACTGATGCTCAAGCTTCAGCACATGTATTGAG

GCGC.

Conditioned media preparation: Cyr61-pcDNA3.1 or pcDNA3.1 transfected cells were

grown to around 80% confluency and replaced with serum-free media for another 48 hr.

The conditioned media were centrifuged at 3,000 g for 10 min, and the supernatant was

aliquot and stored at -80°C. Heparin agarose beads (Sigma) were prewashed,

equilibrated with serum-free medium, and incubated with conditioned media at 40C

overnight to remove Cyr61 from the conditioned media.

Cell cycle and apoptosis analyses: Cells were trypsinized, washed in PBS and fixed in

50% ice-cold methanol for 30 min. The distribution of the cells in G1, S, and G2/M cell

cycle phases was determined by flow cytometry after staining with propidium iodide.

Annexin V-FITC apoptosis detection kit I (BD PharMingen) was used to identify the

apoptotic and viable cells following the manufacturer’s instructions. The percentage of

early apoptotic (FITC-positive and PI-negative) cells was calculated from the data

originated from flow cytometry.

Reporter assay: Cells were plated at a subconfluent density and co-transfected with 1 µg

of the reporter plasmid and the appropriate expression vectors. TOPFLASH construct

contains 4 copies of TCF binding sites upstream of thymidine kinase minimal promoter

10


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

in front of luciferase cDNA (Upstate). Negative control FOPFLASH contains mutated

TCF binding sites. Fifty ng of Renilla luciferase pRL-TK was co-transfected as an

internal control for transfection efficiency. Lipofectamine 2000 and Opti-MEM were

used for transfections following the Manufacturer’s instructions (Invitrogen). Cell lysates

were prepared 48 h after transfection, and the reporter activity was measured using the

Dual-Luciferase Reporter Assay System (Promega).

Measurement of caspase-3 activity and mitochondrial membrane potential: Ishikawa

cells were incubated with conditioned medium for 24 or 48 hr and caspase-3 activity was

measured using Caspase-Glo3/7 Assay (Promega) following Manufacturer’s protocol.

Basically, cells were lysed and incubated with proluminescent substrate containing the

caspase-3 recognition site DEVD. The resulting cleavage of the substrate by caspase-3

generates luminescent signal which then is detected by a luminometer. Mitochondrial

membrane potential was measured by using JC-1 (Molecular Probes) fluorescent dye.

JC-1 aggregates in mitochondrial and emits at a wavelength of 590 nm; upon

depolarization of the membrane, JC-1 forms monomer and emits at 530 nm. The

normalized JC-1 is the ratio between the fluorescence at 590 nm and 530 nm and

normalized to a starting value of 1.

11


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

RESULTS

Cyr61 expression was down-regulated in endometrial tumors compared to matched

normal tissues: The expression of CCN genes (Cyr61, CTGF, NOV, WISP1, WISP2, and

WISP3) in endometrial tissues was assessed by quantitative real-time RT-PCR. In a

collection of randomly selected 8 pairs of matched samples from patients, statistically

significant differences were found in the expressions of Cyr61, NOV, and WISP2 (Fig.

1A, p ≤ 0.05). Elevated levels of NOV and WISP2 were expressed in endometrial tumors,

while Cyr61 expression was down-regulated. The expression of Cyr61 was quantified

further in endometrial cancer cell lines and paired tissue samples. Human mammary

adenocarcinoma cell line MDA-MB-231 was used as a positive control, which we

previously have shown, had high levels of Cyr61 expression (12). In seven out of the 8

paired tissue samples, the expression of Cyr61 was higher in the normal endometrial

tissue compared to the matched tumors (Fig. 1B, p=0.012, t-test, one-tail, two-sample

assuming unequal variances). In a series of endometrial cancer cell lines, the level of

Cyr61 varied (Fig. 1B). The lowest Cyr61 expression was found in AN3CA cells, an

undifferentiated endometrial adenocarcinoma (Fig. 1B). Compared to the AN3CA cells, a

well-differentiated endometrial cell line Ishikawa showed higher expression of Cyr61

(Fig. 1B).

Overexpression of Cyr61 in AN3CA endometrial cancer cells suppressed colony

formation, cell growth in liquid culture, and tumor growth in nude mice: Since Cyr61

12


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

transcripts were expressed at a higher level in the normal endometrium compared to

matched tumors, we hypothesized that Cyr61 may be important in the regulation of cell

growth of normal endometrium. AN3CA cells, which endogenously expressed low levels

of Cyr61, were transiently transfected with empty vector (pcDNA3.1) and formed

numerous colonies, while the number of colonies were dramatically reduced when these

cells were transiently transfected with Cyr61-pcDNA3.1 (Fig. 2A). Furthermore,

AN3CA cells were stably transfected with either a Cyr61 expression vector (Cyr61-

pcDNA3.1) or an empty vector pcDNA3.1. Several G418 resistant clones were isolated

from Cyr61-pcDNA3.1 transfection and screened for Cyr61 expression levels by both

real-time RT-PCR and western blot analysis. The protein levels of two stable clones

overexpresssing Cyr61 (AN3CA-Cyr61#1 and #2) are shown in Fig. 2B; and these two

clones were used for further study. The effect of Cyr61 expression on cell growth in vitro

was evaluated by MTT assay. Compared to AN3CA-neo control cells, the 2 stable clones

(AN3CA-Cyr61#1 and #2) showed significant reduction in cell numbers (p = 0.011, Fig.

2C). Next, the effect of Cyr61 on tumor formation in vivo was examined. Cyr61

overexpressing cells (AN3CA-Cyr61#1) and vector control cells (AN3CA-neo) were

injected on opposite flanks of nude mice, and tumor growth was monitored weekly. After

4 weeks, the tumors were removed and measured. In all five mice injected with tumor

cells, the Cyr61 overexpressing cells (AN3CA-Cyr61#1) developed markedly smaller

tumors than the control endometrial cancer cells (AN3CA-neo) in the nude mice

13


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(p=0.0088, one-tail t-test, Fig. 2D).

Cell growth was increased after Cyr61 gene silencing in Ishikawa cells: To determine if

endogenous Cyr61 plays a role in cell growth, we used a U6 promoter-driven RNA

interference (RNAi) method to silence the Cyr61 gene in the Ishikawa endometrial cancer

cells which constitutively express easily detectable amounts of endogenous Cyr61. These

cells were co-transfected with pcDNA3.1 and either a Cyr61-specific RNAi or a control

RNAi expression vector. Stable clones were selected with G418 and were screened for

Cyr61 protein knock-down. Western blotting showed that a dramatic decrease in Cyr61

protein expression occurred in 2 clones from Cyr61-specific RNAi (Ishikawa-i1 and i2)

compared to those transfected with vector only (Ishikawa-neo) or 2 control RNAi clones

(Ishikawa-∆1 and -∆2) (Fig. 3A). MTT assays were used to evaluate the effect of Cyr61

knock-down on cell growth. The two cyr61-knockdown sublines (Ishikawa-i1 and i2)

exhibited an increased cell numbers compared to the control cell lines (Ishikawa-neo, -

∆1, and -∆2) (Fig. 3B).

Inhibition of endometrial cancer cell growth by Cyr61 conditioned medium: To elucidate

directly the effect of Cyr61 on endometrial cancer cell growth, we used the conditioned

media collected from AN3CA-Cyr61#1 transfected cells in the MTT assay. The presence

of Cyr61 in the conditioned medium was confirmed by Western blot analysis (Fig. 4A).

The conditioned medium collected from the Cyr61-pcDNA3.1 transfected cells had

inhibitory effects on the growth of Ishikawa cells after 2 days of incubation, compared

14


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

with that from pcDNA3.1 empty vector (V) transfected cells (Fig. 4C). Cyr61 binds

heparin and heparin affinity chromatography has been used in Cyr61 purification (19).

We used heparin agarose beads to deplete Cyr61 from the conditioned medium (Fig. 4B)

which resulted in the loss of the growth inhibitory activity (Fig. 4C).

Cyr61 inhibits growth of endometrial cancer cells at least in part by promoting apoptosis:

To explore the mechanism of growth suppression in Cyr61 overexpressing cells

(AN3CA-Cyr61#1 and #2), cell cycle analysis was performed. The number of cells in S-

phase was 45% and 42% for the AN3CA-neo and AN3CA-Cyr61#1 cells, respectively.

In contrast, expression of Cyr61 caused a remarkable increase (from 7% to 28%) in the

subdiploid DNA (sub-G0/G1) content in AN3CA-Cyr61#1 suggesting an increased cell

death (Fig. 5A). Apoptosis was also assessed by Annexin V-FITC staining to detect

phosphatidylserine on the cell surface in conjunction with propidium iodide staining. As

shown in Fig. 5B, Cyr61 expressing cells (AN3CA-Cyr61#1) showed an increase in

Annexin V-positive and PI-negative cells (26%) when compared to AN3CA-neo

control cells (6%) indicating increased cell death via apoptosis. These results indicated

the anti-growth activity of Cyr61 was associated at least in part with induction of cellular

apoptosis.

Given that the relative expression of the Bcl-2 family of proteins is important in

the regulation of apoptosis (20), the levels of several pro- and anti-apoptopic proteins

15


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

were examined. Compared to control AN3CA-neo cells, a slight decrease in the levels of

the anti-apoptotic protein Bcl-2 was observed, and no significant change in either Bcl-

xL or the inactive phosphorylated Bad, was found in the Cyr61 overexpressing cells

(AN3CA-Cyr61#1 and #2, Fig. 5C). In contrast, the levels of the pro-apoptotic proteins

Bax and Bad were prominently increased in the AN3CA-Cyr61#1 and #2 cells (Fig. 5C).

Furthermore, the expression of the tumor necrosis factor-related apoptosis-inducing

ligand (TRAIL) was significantly increased in the AN3CA-Cyr61 cells compared to

AN3CA-neo control cells as measured by quantitative real-time PCR (Fig. 5D).

Since we observed increased levels of Bax in endometrial cancer cells

overexpressing Cyr61, we next examined the downstream targets of the Bax-mediated

apoptosis pathway. We first measured the caspase-3 activity in endometrial cancer cells

treated with Cyr61 conditioned medium. A substantial increase of caspase-3 activity

occurred in the Ishikawa cells treated with Cyr61 conditioned medium compared to

control (V) medium treated cells (Fig 6A). Furthermore, we examined the mitochondrial

potential in these cells. We found that Cyr61 conditioned medium treated cells exhibited

a time-dependent decrease in their mitochondrial potential, while control (V)-

conditioned medium treated cells had a minimal drop in potential (Fig. 6B).

During apoptosis, c-myc has been reported to enhance activation of Bax (21). We

examined expression of c-myc in our stably transfected endometrial cancer cells. Levels

were increased in Cyr61 overexpressing cells, AN3CA-Cyr61#1; conversely, expression

16


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

was decreased in the Cyr61-knockdown, Ishikawa-i1 cells (Fig. 7A). C-myc is a known

target gene of LEF/TCF transactivation. Therefore, we investigated the ability of Cyr61

to enhance TCF-dependent transcriptional activity as measured by reporter assays.

TOPFLASH was co-transfected with either Cyr61-pcDNA3.1 or pcDNA3.1 empty

vector in AN3CA cells. Stimulation of TCF reporter activity was found only in AN3CA

cells co-transfected with the Cyr61 expression vector (Fig. 7B). No activity was

observed in the negative control FOPFLASH reporter transfected with the same Cyr61

expression vector.

17


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

DISCUSSION

Cyr61 is involved in a wide range of biological activities including angiogenesis and

tumorigenesis (5-7). Elevated levels of Cyr61 are associated with a more advanced stage

of breast cancer and its overexpression in normal human breast cells promotes their cell

proliferation and tumor formation in immunodeficient mice (13,22). In human breast

cancer cells MCF-7, overexpression of Cyr61 confers resistance to apoptosis by a

mechanism involving NF-κB-dependent activation of the anti-apoptosis gene XIAP

(23). Cells from glioblastoma multiforme expressed higher levels of Cyr61; and these

brain tumors with high levels of Cyr61 had a worse prognosis than those with lower

levels of Cyr61 (24). Paradoxically, Cyr61 acts as a tumor suppressor in non-small cell

lung cancers and is associated with enhanced expression of p53 and p21 and decreased

levels of cdk2 kinase activity (14,15). Induction of Cyr61 has recently been shown to be

important for neuronal cell death through c-Jun N-terminal kinase activation (25). Taken

together, Cy61 has disparate functions depending on the tissue of origin. This appears

also to be the case for other members of the CCN family of proteins. Their biological

properties are dependent upon their interacting molecules, be they either positive or

negative effectors (5,6). Connective tissue growth factor (CTGF) stimulates proliferation

of fibroblasts and endothelial cells (7,26), but induces apoptosis in human aortic smooth

muscle cells (27). WISP-1 increases cell proliferation of rat kidney fibroblasts (28) but

suppresses cell invasion and motility of lung cancer cells (29).

18


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

We initially examined the gene expression levels of all 6 CCN members (Cyr61,

CTGF, NOV, WISP1, WISP2, and WISP3) in 8 pairs of matched normal and endometrial

cancer samples from the same individuals. By quantitative real-time PCR, expression of

Cyr61 was lower in tumors compared to normal samples. A similar decreased Cyr61

expression has been noted between matched normal tissue and leiomyomas (18), prostate

cancers (16), embryonal-rhabdomyosarcomas (30), and non-small cell lung cancers (14).

We found no significant change in the expression levels of CTGF, WISP1, and WISP3;

while NOV and WISP2 were overexpressed in endometrial tumors compared to the

normal endometrium. We further compared the levels of Cyr61 in several endometrial

cancer cell lines as well. Ishikawa and KLE cells are well-differentiated; RL95-2,

HEC1A, HEC1B, and HEC59 are modestly well-differentiated;; and AN3CA cells are

undifferentiated. No correlation was noted between the levels of expression of Cyr61 and

cell differentiation in the endometrial cancer cell lines that we examined.

Based on two independent approaches, we demonstrated that Cyr61 is a negative

regulator of endometrial cell growth. Using RNAi, we showed that reduction of Cyr61

expression in Ishikawa cells was associated with an increase in cell numbers and the

forced expression of Cyr61 in AN3CA endometrial cancer cells resulted in their

decreased cell growth. Colony formation assays in vitro and ability to form tumors in

immunodeficient mice both showed decreased growth compared to wild type cells. These

results demonstrate the growth inhibitory effect of Cyr61 in endometrial cancer cells.

19


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Cyr61 is a secreted protein and can function as a novel ligand for cell surface integrin

receptors. Conditioned-medium collected from Cyr61-transfected cells inhibited cellular

accumulation of Ishikawa endometrial cancer cells and also in control H460 non-small

cell lung cancer cells, in which Cyr61 overexpression has previously been shown to cause

growth suppression (14). After incubation with heparin-coated beads to deplete Cyr61

from the conditioned medium, the inhibitory effect was reversed. These results are

consistent with growth inhibition of endometrial cancer cells potentially occurring by

Cyr61 interacting with a cell surface protein, such as integrins.

Approximately 25% of both AN3CA-Cyr61#1 and #2 cells had a subdiploid

DNA content compared to 7% of the control AN3CA-neo cells as observed by cell cycle

analysis. These findings indicate degradation of DNA in Cyr61 expressing cells. Annexin

V assays verified that these cells were undergoing apoptosis. The tumor suppressor gene

p53 plays an important role in apoptosis, and its mutational inactivation is common in

human cancers including 15-25% of endometrial carcinomas (31). Forced expression of

Cyr61 in the AN3CA endometrial cancer cells is sufficient to promote apoptosis. These

cells have mutant p53, showing that Cyr61 can cause apoptosis independent of wild-type

p53 activity.

To maintain equilibrium between proliferation and death of cells is vital for many

biological processes, especially in reproductive tissues such as the mammary gland,

ovary, and uterus (32,33). Defects in this process predispose the tissue to a variety of

20


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

disorders including cancer. The family of Bcl-2 proteins is involved in the regulation of

programmed cell death and the relative ratio between pro- (Bax and Bad) and anti-

apoptotic proteins (Bcl-2 and Bcl-xL) dictates the fate of the cells (34). In normal

endometrium, the main site of apoptosis is the glandular epithelial cells. Both Bcl-2 and

Bax are present in these cells in the proliferative phase. During the secretory phase, levels

of Bax protein increase (35) and/or Bcl-2 decrease (36) resulting in apoptosis and

shedding of the endometrial lining. Our results showed that overexpression of Cyr61 in

AN3CA cells increased the levels of Bax. Activation of Bax can cause the change of

mitochondrial membrane potential and release of cytochrome C resulting in apoptosis

(37,38). Our results showed that Cyr61 induced depolarization of the mitochondrial

membrane. Our data also found an increased level of Bad in AN3CA cells overexpressing

Cyr61. Upregulation of unphosphorylated Bad in AN3CA-Cyr61#1 cells enhances its

ability to interact with Bcl-2 and Bcl-xL and to inhibit their anti-apoptotic activity (39).

A second pathway involved in mediating apoptosis is through the tumor necrosis factor

(TNF) family of proteins (40). Apoptosis is mediated by the interaction between TNF

receptors and their ligands, which leads to a cascade of activation of caspases. Using

real-time PCR, we found that AN3CA cells transfected with Cyr61 showed increase in

TRAIL mRNA. TRAIL interacts with the TNF receptors know as DR-4 and –5 to

activate caspase 8 (41,42). In apoptosis, both the membrane-dependent extrinsic pathway

involving TNF receptors and the intrinsic pathway involving the mitochondrial, converge

21


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

on the downstream effector caspase-3 (43). Our data suggest that Cyr61 induced

activation of caspase-3 through both signaling pathways.

C-myc is implicated in a wide range of biological processes including oncogenic

transformation and apoptosis (44). Cyr61-dependent inhibition of cell growth is

associated with c-myc induction in non-small cell lung cancer (NSCLC) cell lines H460

and H520 (14,15). Our results showed that in endometrial cancer cell lines AN3CA and

Ishikawa, the expression levels of Cyr61 correlated with levels of c-myc. C-myc can

induce apoptosis, possibly through activation of the pro-apoptotic Bax (45), which was

induced in our Cyr61-transfected cells. C-myc is a target gene of the LEF/TCF

transcriptional factor (15,46). Our TCF reporter assays showed that AN3CA cells co-

transfected with the Cyr61 expression vector can activate the TCF reporter. Further

studies are needed to determine how forced expression of Cyr61 activates the LEF/TCF

transcriptional factor. In both glioma cells and non-small cell lung cancer cells, we found

that Cyr61 triggered nuclear translocation of β-catenin and activated the β-catenin/TCF

signaling which upregulated expression of c-myc (15,24). In the lung cancers, this was

associated with increased expression of p53 and p21 (15).

We have not studied the mechanisms causing the decrease in Cyr61 expression in

endometrial cancer. Our data show that Cyr61 transcripts are decreased; and Cyr61

mRNA expression was not inducible by either 17 β-estradiol or tamoxifen treatment in

endometrial cancer cell lines (data not shown). The lower levels of Cyr61 could occur by

22


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

decreased stability of the transcript or decreased transcription of the gene, perhaps by

methylation of the promoter region or aberrant expression levels of the necessary

transcription factors. During carcinogenesis of endometrial adenocarcinomas, multiple

molecular alterations have been identified including microsatellite instability (20-30%),

frequent mutations of PTEN (30-60%), K-ras (10-30%), as well as β-catenin (28-35%)

(47). One or several of these alterations may affect levels of Cyr61. In this study, we

provide evidence that Cyr61 is able to suppress endometrial cancer cell growth. Cyr61

promotes apoptosis of endometrial carcinoma cells probably by activation of the pro-

apoptotic proteins Bax and Bad, depolarization of mitochondrial membrane potential, and

caspase-3 activation, which results in the inhibition of clonogenic growth and loss of

tumorigenicity of the endometrial cells. Endometrial cancer cells probably obtain a

growth advantage by silencing expression of Cyr61.

23


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FIGURE LEGENDS

Figure 1. CCN gene expression in matched human normal endometrium and tumors, as

well as, endometrial cancer cell lines as measured by quantitative real-time PCR. A.

Relative RNA expression levels of Cyr61, CTGF, NOVH, WISP1, WISP2 and WISP3 in

8 pairs of matched normal and tumor samples. The relative RNA expression level of each

gene in each sample was normalized to that of β-actin, and the mean ± SE (standard

error) was calculated. P value was calculated from one-tail, 95% confidence t- test. B.

Relative Cyr61 RNA expression levels. Matched patient samples from normal

endometrium (N) and tumors (T) were used. Endometrial cancer cell lines: HEC59,

HEC1A, Ishikawa, KLE, RL95-2, HEC1B, and AN3CA. Human mammary

adenocarcinoma cell line MDA-MB-231 was used as a highly expressing positive

control. The relative gene expression levels were calculated by normalization to β-actin.

Data were obtained from triplicate measurements.

Figure 2. Growth suppression of AN3CA endometrial cancer cells by Cyr61

overexpression. A. Colony formation assay. AN3CA cells were transfected with either

Cyr61 expression vector (Cyr61-pcDNA3.1) or empty vector pcDNA3.1, and grown in

G418 for neo-resistant colonies for 2 weeks. Colonies were fixed, stained, and

photographed with an inverted phase contrast microscope. B. Western blot analyses.

Stably transfected subclones were selected with G418 and screened for Cyr61 expression

by Western blot analysis. Two stable clones AN3CA-Cyr61#1 and #2 had prominent

24


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

expression of Cyr61. GAPDH was used as loading control. C. MTT assay was used to

assess the effect of Cyr61 expression on growth of AN3CA cells in vitro. Results

represented mean of 3 independent experiments performed in triplicates. D. AN3CA-neo

and AN3CA-Cyr61 #1 (1x107) human endometrial cancer cells were implanted

subcutaneouly into opposite flanks of the same immunodeficient mice. Tumors were

removed and measured after four weeks, their sizes were calculated by the formula: A

(length) x B (width) x C (height) x 0.5236. Five mice were used.

Figure 3. Enhanced cell growth of Ishikawa endometrial cancer cells by Cyr61 knock-

down. Ishikawa cells were cotransfected with either Cyr61 RNAi, control RNAi or the

pcDNA3.1 containing neo gene alone, stable clones were selected with G418. A Western

blot analysis showed that two stable clones of the Cyr61-specific RNAi transfection

(Ishikwa-i1 and –i2) had a dramatic decrease in their Cyr61 protein expression compared

to a clone that contained pcDNA3.1-neo alone (Ishikawa-neo) or two control clones

(Ishikawa-∆1 and -∆2) that contained a mutated RNAi. B. MTT assay shows the effect

of Cyr61 gene silencing on cell growth of Ishikawa cells. Results represent the mean of 2

independent experiments with triplicate wells per experimental point.

Figure 4. Effect of Cyr61 conditioned medium on cell growth as measured by MTT

assay. A. Western blot analysis of Cyr61 expression in conditioned media. Conditioned

media were collected from either pcDNA3.1 (V) or Cyr61-pcDNA3.1 (Cyr61)

25


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

transfected AN3CA cells after they were grown in serum-free media for 48 hr. B. Cyr61

depletion from conditioned media by heparin agarose beads. Conditioned media were

incubated with heparin beads overnight, and heparin-bound and unbound material was

analyzed for Cyr61 expression. C. Ishikawa-i1 (endometrial cancer cells) and H460

(non-small cell lung cancer cells) were incubated with either control medium (V), Cyr61

conditioned medium (Cyr61), or Cyr61-depleted conditioned medium. Data are

expressed as mean MTT activity ± S.E. from triplicate wells in 2 separate experiments.

Figure 5. Increase in apoptosis and expression of the pro-apoptotic proteins Bax, Bad

and TRAIL in Cyr61 overexpressing AN3CA endometrial cancer cells. A. Cell cycle

analysis. FACS histogram shows the DNA content of cells after propidium iodide

staining of methanol fixed cells. To the right of the dotted line is normal diploid DNA

and to the left is sub-G0/G1 DNA content (degraded DNA originated from apoptotic

cells). B. Apoptosis analysis. Cells were stained with Annexin-V-FITC and PI to

differentiate apoptosis and necrosis. Viable cells are FITC-negative/PI-negative; late

apoptosis or cell death is FITC-positive/PI-positive; and early apoptotic cells are FITC-

positive/PI-negative (lower right box with % of population). Profiles show one

experiment which was similar to 2 additional independent experiments. Also, another

clone (AN3CA-Cyr61#2) showed a similar profile as AN3CA-Cyr61#1 in both cell

cycle analysis and Annexin-V assays (data not shown). C. Western blot analysis.

26


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Expression levels of Bcl-2 family members including Bcl-2, Bcl-xL, Bad, and Bax. The

anti-Bad antibody recognizes both phosphorylated and unphosphorylated Bad. GAPDH

was used as a loading control. D. Real-time PCR for relative TRAIL mRNA levels in

AN3CA-neo and AN3CA-Cyr61#1 cells. The relative gene expression levels were

calculated by normalization to β-actin. Data represent the mean of triplicate

measurements.

Figure 6. Effect of Cyr61 conditioned medium on caspase-3 activity and mitochondrial

membrane potential. Ishikawa cells were treated with control medium (V) or Cyr61

conditioned medium (Cyr61) for 24 and 48 hr. A. Caspase-3 activity was detected by

incubation with luminescent substrate and quantified by relative light units (RLU). B.

Mitochondrial membrane potential was measured by normalization of the 590 nm:530 nm

JC-1 emission ratio and then normalized to untreated cells. Data represent the mean ±

S.E. from 3 independent experiments.

Figure 7. TCF-dependent transcription stimulated by expression of Cyr61. A.

Immunoblotting for c-myc expression. Equal amounts of proteins for AN3CA-neo

control cells, Cyr61 overexpressing (AN3CA-Cyr61#1) cells, as well as, for Ishikawa-

neo control cells and Cyr61 knock-down Ishikawa-i1 cells were used in Western blot

analysis and probed with c-myc antibody. B. TOPFLASH reporter activity in AN3CA

cells. Cells were cotransfected with TOPFLASH or FOPFLASH reporter plasmid and

Cyr61-pcDNA3.1 or pcDNA3.1. TCF/LEF-1-mediated transcription was determined by

27


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

the TOPFLASH luciferase activity. FOPFLASH contained mutant TCF/LEF-1 binding

sites and was used as control. Reporter activities were normalized to internal control

Renilla. Data represent results from triplicate dishes in 2 separate experiments. TOP:

TOPFLASH; FOP: FOPFLASH; Cyr61: Cyr61-pcDNA3.1.

28


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

REFERENCES

1. O’Brien, T. P., Yang. G. P., Sanders, L., Lau, L. F. (1990) Mol. Cell Biol.10,

3569-3577

2. Perbal, B. (2001) Mol. Pathol. 54, 57-79

3. Brigstock, D. R. (1999) Endocr. Rev. 20, 189-206

4. Pennica, D., Swanson, T. A., Welsh, J. W., Roy, M. A., Lawrence, D. A., Lee, J.,

Brush, J., Taneyhill, L. A., Deuel, B., Lew, M., Watanabe, C., Cohen, R. L.,

Melhem, M. F., Finley, G. G., Quirke, P., Goddard, A. D., Hillan, K. J., Gurney,

A. L., Botstein, D., and Levine, A. J. (1998) Proc. Natl. Acad. Sci. U S A 95,

14717-14722

5. Planque, N. and Perbal, B. (2003) Cancer Cell Int. 3, 15

6. Brigstock, D. R. (2003) J. Endocrinol. 178, 169-175

7. Brigstock, D. R. (2002) Angiogenesis 5, 153-165

8. Latinkic, B. V., Mo, F. E., Greenspan, J. A., Copeland, N. G., Gilbert, D. J.,

Jenkins, N. A., Ross, S. R., and Lau L. F. (2001) Endocrinology 142, 2549-5257.

9. Kireeva, M. L., Lam, S. C., and Lau, L. F. J. Biol. Chem. (1998) 273, 3090-3096.

10. Chen, N., Leu, S. J., Todorovic, V., Lam, S. C., and Lau, L. F. J. Biol. Chem.

(2004) Aug 10 [Epub ahead of print]

29


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

11. Sampath, D., Winneker, R. C., and Zhang, Z. (2001) Endocrinology 142, 2540-

2548

12. Xie, D., Miller, C. W., O’Kelly, J., Nakachi, K., Sakashita, A., Said, J. W,

Gornbein, J., and Koeffler, H. P. (2001) J. Biol. Chem. 276, 14187-14194

13. Xie, D., Nakachi, K., Wang, H., Elashoff, R., and Koeffler, H. P. (2001) Cancer

Res. 61, 8917-8923

14. Tong, X., Xie, D., O’Kelly, J., Miller, C. W., Muller-Tidow, C., and Koeffler, H.

P. (2001) J. Biol. Chem. 276, 47709-47714

15. Tong, X., O’Kelly, J., Xie, D., Mori, A., Lemp, N., McKenna, R., Miller, C. W.,

and Koeffler, H. P. Oncogene (2004) 23, 4847-4855

16. Pilarsky, C. P., Schmidt, U., Eissrich, C., Stade, J., Froschermaier, S. E., Haase,

M., Faller, G., Kirchner, T. W., and Wirth, M. P. (1998) Prostate, 36, 85-91

17. Wasenius, V. M., Hemmer, S., Kettunen, E., Knuutila, S., Franssila, K., and

Joensuu, H. (2003) Clin. Cancer Res. 9, 68-75

18. Sampath, D., Zhu, Y., Winneker, R. C., and Zhang, Z. (2001) J. Clin. Endocrinol.

Metab. 86, 1707-1715

19. Muramatsu, Y., Tsujie, M., Kohda, Y., Pham, B., Perantoni, A. O., Zhao, H., Jo,

S. K., Yuen, P. S., Craig, L., Hu, X., and Star, R. A. Kidney Int. (2002) 62, 1601-

1610

20. Lea, R. G., Riley, S. C., Antipatis, C., Hannah, L., Ashworth, C. J., Clark, D. A.,

30


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

and Critchley, H. O. (1999) Am. J. Reprod. Immuno. 42, 100-109

21. Juin, P., Hunt, A., Littlewood, T., Griffiths, B., Swigart, L. B., Korsmeyer, S., and

Evan, G. Mol. Cell Biol. (2002) 22, 6158-6169

22. Tsai, M. S., Bogart, D. F., Castaneda, J. M., Li, P. and Lupu, R. (2002) Oncogene

21, 8178-8185

23. Lin, M. T., Chang, C. C., Chen, S. T., Chang, H. L., Su, J. L., Chau, Y. P., and

Kuo. M. L. J Biol Chem. (2004) 279, 24015-24023

24. Xie, D., Yin, D., Tong, X., O’Kelly, J., Mori, A., Miller, C., Black, K., Gui, D.,

Said, J. W., and Koeffler HP. Cancer Res. (2004) 64, 1987-1996

25. Kim, K. H., Min, Y. K., Baik, J.-H., Lau, L. F., Chaqoure, B. and Chung, K. W.

J. Biol. Chem. (2003) 278, 13847-13854

26. Ahmed, M. S., Oie, E., Vinge, L. E., Yndestad, A., Oystein Andersen G.,

Andersson, Y., Attramadal, T., and Attramadal, H. J. Mol. Cell Cardiol. (2004)

36, 393-404

27. Hishikawa, K., Nakaki, T., and Fujii, T. (2000) Eur. J. Pharmacol. 392, 19-22

28. Xu, L., Corcoran, R. B., Welsh, J. W., Pennica, D., and Levine, A. J. (2000)

Genes Dev. 14, 585-596

29. Soon, L. L., Yie, T. A., Shvarts, A., Levine, A. J., Su, F., and Tchou-Wong, K.

M. (2003) J. Biol.Chem. 278, 11465-11470

30. Genini, M., Schwalbe P., Scholl, F. A., and Schafer, B. W. (1996) Int. J. Cancer

31


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

66, 571-577

31. Kihana, T., Hamada, K., Inoue, Y., Yano, N., Iketani, H., Murao, S., Ukita, M.,

and Matsuura, S. (1995) Cancer 76, 72–78

32. Spencer, S. J. Spencer, S. J., Cataldo, N. A., and Jaffe, R. B. Obstet. Gynecol.

Surv. (1996) 51, 314-323

33. Sheets, E. E., and Yeh, J. Ann Med. (1997) 29, 121-126

34. Danial, N. N., and Korsmeyer, S. J. Cell (2004) 116, 205-219

35. Tao, X. J., Tilly, K. I., Maravei, D. V., Shifren, J. L., Krajewski, S., Reed, J. C.,

Tilly, J. L., and Isaacson, K. B. (1997) J. Clin. Endocrinol. Metab. 82, 2738-2746

36. McLaren, J., Prentice, A., Charnock-Jones, D. S., Sharkey, A. M., and Smith, S.

K. (1997) Hum. Reprod. 12, 146-152

37. Tsujimoto, Y., and Shimizu, S. FEBS Lett. (2000) 466, 6-10

38. Scorrano, L., and Korsmeyer, S. J. Biochem Biophys Res Commun. (2003) 304,

437-444

39. Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B., and Korsmeyer, S. J.

(1995) Cell 80, 285-291

40. Ashkenazi, A. Nat. Rev. Cancer (2002) 2, 420-430

41. Pan, G., O’Rourke, K., Chinnaiyan, A. M., Gentz, R., Ebner, R., Ni, J., and Dixit,

V. M. Science (1997) 276, 111-113

42. Wu, G. S., Burns, T. F., McDonald, E. R. 3rd., Jiang, W., Meng, R., Krantz, I. D.,

32


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kao, G., Gan, D. D., Zhou, J. Y., Muschel, R., Hamilton, S. R., Spinner, N. B.,

Markowitz, S., Wu, G., and el-Deiry,W. S. Nat. Genet. (1997) 17, 141-143

43. Green, D. R. Cell (1998) 94, 695-698

44. Secombe, J., Pierce, S. B., and Eisenman, R. N. Cell (2004) 117, 153-6

45. Brunelle, J. K., Santore, M. T., Budinger, G. R., Tang, Y., Barrett, T. A., Zong,

W. X., Kandel, E., Keith, B., Simon, M. C., Thompson, C. B., Hay, N., and

Chandel, N. S. J. Biol. Chem. (2004) 279, 4305-4312

46. Sasaki, T., Suzuki, H., Yagi, K., Furuhashi, M., Yao, R., Susa, S., Noda, T., Arai,

Y., Miyazono, K., and Kato, M. Cancer Res. (2003) 63, 801-806

47. Matias-Guiu, X., Catasus, L., Bussaglia, E., Lagarda, H., Garcia, A., Pons, C.,

Munoz, J., Arguelles, R., Machin, P., and Prat, J. (2001) Hum. Pathol. 32, 569-

577

33


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Jonathan W. Said and H. Phillip KoefflerWenwen Chien, Takashi Kumagai, Carl W. Miller, Julian C. Desmond, Jonathan M. Frank,

Cyr61 suppresses growth of human endometrial cancer cells

published online October 7, 2004J. Biol. Chem.

10.1074/jbc.M410254200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M410254200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M410254200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/10/07/jbc.M410254200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/10/07/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/10/07/jbc.M410254200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

cyr61 suppresses growth of human endometrial cancer cells

Documents