Compound Astragalus and Salvia miltiorrhiza extract suppresseshepatocellular carcinoma progression by inhibiting fibrosis andPAI-1 mRNA transcription

Wenjuan Rui a,1, Lei Xie a,b,1, Xin Liu c, Shufang He a, Chao Wu a, Xiaoxiang Zhang d,Linjie Zhang e,n, Yan Yang a,nn

a Department of Pharmacology and Institute of Natural Medicine, Anhui Medical University, Hefei 230032, Chinab Department of Anesthesiology, Maternal and Child Care Hospital of Anhui Province, Hefei 230001, Chinac Therapeutics Research Centre, University of Queensland, Princess Alexandra Hospital, Brisbane, Qld 4102, Australiad Department of Pharmaceutical Engineering, Hefei University of Technology, Hefei, Anhui 230009, Chinae Department of immunology, Anhui Medical University, Hefei 230032, China

a r t i c l e i n f o

Article history:Received 14 February 2013Received in revised form26 September 2013Accepted 5 October 2013Available online 15 November 2013

Keywords:Compound Astragalus and Salviamiltiorrhiza extractDiethylnitrosamineHepatic fibrosisHepatocellular carcinomaPlasminogen activator inhibitor

a b s t r a c t

Ethnopharmacological relevance: Astragalus membranaceus and Salvia miltiorrhiza have been used forcenturies in China to treat liver diseases. Previous studies have shown that these herbs and their extractsinhibit the development of liver fibrosis and the proliferation and invasion of human hepatoma HepG2cells. Further study of their pharmacological effects on hepatocellular carcinoma (HCC) is needed. Toinvestigate the effects of Compound Astragalus and Salvia miltiorrhiza Extract (CASE) on diethylinitro-samine (DEN)-induced hepatocarcinogenesis in rats.Materials and methods: Male rats were divided into five groups, with the first group serving as normalcontrol, the second group receiving 0.2% DEN solution five times a week for 14 weeks, and the third tofifth group receiving the same DEN as in the second group together with CASE at the doses of 60, 120, and240 mg/kg per day for 16 weeks, respectively. Hepatoma incidence, serum enzymes levels, degree offibrosis and hydroxyproline content were evaluated and compared across the five groups to determineCASE's suppression of fibrosis and HCC progression. In addition, an in vitro experiment using HepG2cells was conduct to verify CASE's effect on the transcription of plasminogen activator inhibitor-1(PAI-1) mRNA.Results: CASE treatment significantly reduced the incidence and multiplicity of DEN-induced HCCdevelopment in a dose-dependent manner. It significantly suppressed the elevation of alaninetransaminase, aspartate aminotransferase, gamma-glutamyl transferase, alkaline phosphatase, hyaluro-nic acid, direct bilirubin and total bilirubin, and significantly lessened the depression of serum totalprotein in DEN-induced HCC rats. CASE treatment also significantly suppressed the elevated expressionof GST-P and α-SMA. The in vitro experiment confirmed that CASE inhibits the transcription of PAI-1mRNA in HepG2 cells induced by TGF-β1 in a dose-dependent manner.Conclusions: CASE suppresses DEN-induced hepatocarcinogenesis by inhibiting fibrosis and PAI-1 mRNAtranscription, suggesting its potential clinical application in preventing and treating human HCC.

& 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Astragalus membranaceus and Salvia miltiorrhiza (AM/SM) havebeen used for centuries in China to treat liver diseases (Lin et al.,2000; Kang et al., 2004; Brush et al., 2006; Lin et al., 2006;

Hu et al., 2007). Clinical studies indicate that AM/SM protect liverfunction and inhibit the progression of fibrosis and cirrhosis(Tan et al., 2001; Du et al., 2008; Peng and Wang, 2010; Chenet al., 2013; see Appendix 1), and their toxicities are well toleratedin human subjects (Han et al., 2004; Liu et al., 2004; Xu et al.,2013; see Appendix 2). Since fibrosis and cirrhosis are recognizedas precursors to liver cancer (Yang et al., 2003; Okuda, 2007; Gaoand Bataller, 2011), AM/SM hold great potential in preventing and,an adjuvant therapy, treating liver cancer.

Several pharmacological studies have shown that AM inhibits thegrowth of hepatocellular carcinoma (HCC) cells (Cho and Leung, 2007;

Contents lists available at ScienceDirect

journal homepage: www.elsevier.com/locate/jep

Journal of Ethnopharmacology

0378-8741/$ - see front matter & 2013 Elsevier Ireland Ltd. All rights reserved.http://dx.doi.org/10.1016/j.jep.2013.10.022

n Corresponding author.nn Corresponding author. Tel: þ86 13655690381.E-mail addresses: zlj33@ahmu.edu.cn (L. Zhang),

yangyan@ahmu.edu.cn (Y. Yang).1 Wenjuan Rui and Lei Xie contributed equally to this work.

Journal of Ethnopharmacology 151 (2014) 198–209

Auyeung et al., 2009; Huang et al., 2012; Hu et al., 2007; Li et al., 2012;You et al., 2012; see Appendix 3); and Lin et al. (2006) discovered thatsalvianolic acid B, extract from SM, reduces α-smooth muscle actin (a-SMA) and collagen synthesis and deposition in Hepatic stellate cells(HSC). Upon reviewing the available evidence and consulting Chinesemedicine specialists, our research team developed for formula fromextracts of Astragalus membranaceus Bunge (Leguminosae) and Salviamiltiorrhiza Bunge (Lamiaceae), named Compound Astragalus andSalvia miltiorrhiza extract (CASE), and we have so far conducted twopharmacological studies using CASE (Yang et al., 2008; Liu et al., 2010).Our 2008 study showed that CASE has protective effects against liverfibrosis in rats generated by CCl4, and CASE inhibits Smad2 phosphor-ylation at C-terminal region and expression of (α-SMA). Our 2010study discovered that CASE inhibits HepG2 cell proliferation andinvasion triggered by TGF-β.

However, these studies, including our two previous studies,are limited to the effects of AM/SM on fibrosis or hepatic cancercell lines. In this current study, we investigated the effects of

CASE on the development of hepatic fibrosis-carcinoma initiatedby diethylnitrosamine (DEN) in rats. Since DEN induced chronicliver injury and liver fibrosis mimic progression of HCC inhuman (Chen et al., 2012), our investigation would providefurther evidence on the effects of CASE in preventing HCCdevelopment in human and offer insights into the mechanismsof such effects.

In a separate previous study, we found that the amount andintensity of positive plasminogen activator inhibitor (PAI)-1expression significantly increased when hepatocellular carcinomaoccurred in DEN treated rats (Rui et al., 2012). Given that PAI-1plays a direct role in the pathophysiology of cancer (Gramling andChurch, 2010; Van De Craen et al., 2012), we suspected that CASEmight modify on PAI-1 expression in its actions on fibrosis andHCC development. In order to gain a fuller understanding ofCASE's anti-HCC mechanisms, we supplemented our primaryin vivo study with an in vitro experiment to investigate the effectof CASE on PAI-1 mRNA transcription in HepG2 cells.

Table 1Effect of CASE on incidence and multiplicity of DEN-induced hepatoma rats at16th week.

Group Dose (mg/kg/d) Incidence (%) Multiplicity

Control – 0/1070 070DEN – 21/21(100%)a 3.6272.13a

CASE 60 20/21(95%) 2.7671.70120 13/17(76%)b 2.2472.61b

240 14/20(70%)c 1.6071.43c

Data are presented as mean7SD.a Po0.01 vs. Control.b Po0.05 vs. DEN group.c Po0.01 vs. DEN group.

Fig. 1. Effects of CASE on serum enzymes levels in rats treated with DEN for 12 weeks. The error bar represents SD (n¼8). ##Po0.01 vs. control; nPo0.05 vs. DEN group;nnPo0.01 vs. DEN group. (alanine transaminase, ALT; aspartate aminotransferase, AST; gamma-glutamyl transferase, GGT; alkaline phosphatase, ALP; hyaluronic acid, HA).

Fig. 2. Effect of CASE on liver hydroxyproline content in rats treated with DEN for12 week. The error bar represents SD (n¼8), ##Po0.01 vs. control.

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209 199

2. Method

2.1. Preparation of compound Astragalus and Salviamiltiorrhiza extract

The herbs Astragalus membranaceus Bunge (Leguminosae)and Salvia miltiorrhiza Bunge (Lamiaceae) were purchased fromBozhou Crude Drug Market (Anhui, China), and astragalosides,Astragalus polysaccharide and salvianolic acids were made intopowers and dissolved in 1% sodium carboxymethylcellulose (CMC-Na) with a standard ratio (70:1:1.85) in weight of crude herbs. Theprocesses of extracting and preparing the three CASE componentsare described in more detail previously (Yang et al., 2008; Liu et al.,2010).

2.2. Chemicals

DEN, was purchased from Sigma-Aldrich (Mainland, China).Commercial kits used to determine hydroxyproline content of livertissue were obtained from the Jianchen Institute of Biotechnology(Nanjing, China). Trizols reagents used for extracting total RNAwere purchased from Invitrogen Life Technologies (CA, USA).PrimeScripts RT reagent Kit used for synthesizing cDNA werepurchased from Takara Biotechnology Co., Ltd (Dalian, China).Other chemicals used were of analytical grade from commercialsources.

2.3. Animals model of HCC and CASE treatment

Male Sprague-Dawley rats with body weight of 180 to 200 gwere purchased from Xipuer-bikai Company (Shanghai, China).These rats were housed in conventional cages at 20–22 1C,supplied with laboratory chow and water ad libitum, and observedwith a 12-h light/dark cycle. The rats were maintained under theseconditions for at least 1 week before the experiment. This studyhas been carried out in accordance with the guidelines for thehumane treatment of animals set by the Association of LaboratoryAnimal Sciences and the Center for Laboratory Animal Sciences atAnhui Medical University.

The rats were randomly divided into five groups: control group,DEN alone group, and three CASE treatment groups. The rats incontrol group were administered with 0.5% CMC-Na for 16 weeks,while the rats in the other four groups were treated with 0.2%

DEN in 0.5% CMC-Na by gavage 5 times a week for 14 weeks toinduce hepatocarcinogenesis. The rats in the three CASE groupswere concomitantly administered CASE at the doses of 60, 120,or 240 mg/kg per day respectively for 16 weeks. The rats weresacrificed at 12th week or 16th week after the start of DENadministration. One lobe from each rat liver was fixed in 3%formalin for 3 days, and the liver tissues were dehydrated throughgraded alcohol series, embedded in paraffin, and sectioned at athickness of 4 mm for further histological analysis.

2.4. HCC incidence and multiplicity

The incidence and multiplicity of hepatocellular neoplasmswere determined when the rats were sacrificed at the end of thestudy. The malignant nodules in each rat were counted at macro-scopic examination of the liver by two independent investigators

Fig. 3. Effects of CASE on bilirubin and serum enzymes levels in rats treated with DEN for 16 weeks. The error bar represents SD (n¼8). ##Po0.01 vs. control; nPo0.05 vs.DEN group; nnPo0.01 vs. DEN group. (direct bilirubin, DBIL; total bilirubin, TBIL; hyaluronic acid, HA; alkaline phosphatase, ALP).

Fig. 4. Effects of CASE on serum albumin and total protein levels of the rats treatedwith DEN for 16 weeks. The error bar represents SD (n¼8). ##Po0.01 vs. control;nPo0.05 vs. DEN group; nnPo0.01 vs. DEN group. (albumin, ALB; total protein,TPR).

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209200

based on the following criteria: nodules with a diameter of 2 mmor more. The incidence was expressed as percentage of rats withtumors and the multiplicity as average hepatocellular neoplasmnumbers per rat in each group (Chuang et al., 2000; Kagawa et al.,2004).

2.5. Serum biochemistry and hepatic hydroxyproline content

Blood samples were collected from all rats at 12th week and 16thweek for determination of serum enzymes levels. Alanine transami-nase (ALT), aspartate aminotransferase (AST), alkaline phosphatase(ALP), direct bilirubin (DBIL), total bilirubin (TBIL), albumin (ALB),total protein (TPR), and gamma-glutamyl transferase (GGT) in serumwere measured with an automatic biochemical analyzer. Hyaluronicacid (HA) in serum was measured by gamma radioimmunoassaycounter. Hepatic hydroxyproline (Hyp) content was determinedusing previously reported method (Thirunavukkarasu et al., 2004):briefly, dried liver tissue after hydrolysis was oxidized by H2O2

and colored by p-dimethylaminobenzaldehyde, the absorbancewas measured at 540 nm, and the amount of Hyp was expressedas mg/g liver.

2.6. Pathological analysis

Van Gieson's (VG) method was used to demonstrate collagenfibers. HPIAS-1000 Auto Medical Image Analyzing System wasused for quantitative assessment of collagen fibers in the liver. Tenmiddle power fields were randomly selected to count for the totalarea occupied by collagen fibers.

2.7. Immunohistochemical analyses

Paraffin sections were deparaffinized in xylene and rehydrated.Nonenzymatic antigen retrieval was done by heating the sectionsto 121 1C in 0.01 M sodium citrate buffer (pH 6.0) for 10 min. Aftercooling down, the sections were rinsed in Tris-buffered salinecontaining 0.1% Tween 20 (TBST) and incubated in methanol–3%H2O2 for 30 min to quench endogenous peroxidase activity. Afterrinsed with TBST, the sections were incubated with primaryantibodies (Abs) for 1 h at room temperature in a humid chamber.Primary Abs used in this study included mouse monoclonal anti-α-SMA Ab (α,α-SMA, Abcam) and anti-GST P1 (Sigma, USA). Thesections were rinsed in TBST again and were incubated withperoxidase-labeled polymer conjugated to goat anti-mouse/rabbit

Fig. 5. Effect of CASE on DEN induced liver fibrosis. Liver was fixed in 3% formalin and stained with VG staining. Representative liver sections are from normal control rat (A),rat treated with DEN for 12 weeks (B), rat treated with DEN and CASE for 12 weeks (60, 120 or 240 mg/kg/day) ((C), (D), (E)). Magnification is 100� . The bar chart is based onmean value of each group and the error bar represents the SD values (n¼8). ##Po0.01 vs. control; nPo0.05 vs. DEN group; nnPo0.01 vs. DEN group.

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209 201

immunoglobulin (DAKO, Glostrup, Denmark) for 1 h at roomtemperature. Finally, the sections were developed with 3,3′-diaminobenzidine counterstained with hematoxylin, and mountedunder cover slips. The results were evaluated by the semi-quantitative technique, relating the score of 0–1 to the percentageof stained cells (score 0, 0% stained cells; 0.1, less than 10% cells;0.2, 10–20% cells; 0.3, 20–30%,…; 0.7, 60–70%; 0.8, 70–80%; and 1,more than 80% positive cells).

2.8. HepG2 cell culture with CASE treatment and real-time reversetranscriptase-polymerase chain reaction

The human hepatocellular carcinoma HepG2 cell line waspurchased from The Chinese Academy of Sciences Cell Bank(Shanghai, China). HepG2 cells were grown as sub-confluentmonolayer cultures in Dulbecco's modified Eagle's medium(DMEM) supplemented with 10% fetal bovine serum (FBS). Thesecells were kept in 95% air and 5% CO2 at 37 1C. The experiment wasperformed at the log phase of growth after the cells had beenplated for 24 h.

The HepG2 cells were seeded at 1�106 cells/10-cm dish. Thecells were incubated for 30 h in DMEM supplemented with 10%FBS, followed by washing with DMEM to avoid the co-intervention

of other factors in serum. The cells were incubated in the absenceor presence of CASE (20, 40 or 80 mg/ml) for 14 h, and subse-quently in the absence or presence of TGF-β1 (9 pM) plus CASE for10 h. The experiments were repeated three times.

Total RNA of each group HepG2 cells was extracted respectivelyusing Trizols reagent. The first-strand cDNA was synthesized withTakara Biotechnology Co., Ltd (Dalian, China). Real-time RT-PCRassay for HepG2 cells PAI-1 mRNA transcription was performed onABI Prism 7500 Sequence Detection System Platform (AppliedBiosystems, USA), and β-actin was used as the internal control. Theoligonucleotide primers for HepG2 cells PAI-1 and β-actin weredesigned and synthesized by Takara Biotechnology Co., Ltd asfollows:

β-actin:Forward-5′TGGCACCCAGCACAATGAA-3′,Reverse-5′CTAAGTCATAGTCCGCCTAGAAGCA -3′;PAI-1:Forward-5′TCATCATCAATGACTGGGTGAAGAC 3′,Reverse-5′TTCCACTGGCCGTTGAAGTAGAG -3′.

Real-time RT-PCR analysis was performed in an iCycler iQMulticolor Detection System (Bio-Rad) as described previously(He et al., 2010). Threshold cycles (Ct) at which emission risesabove baseline were automatically calculated by the real-time

Fig. 6. Effect of CASE on α-SMA protein expression in rats treated with DEN for 12 week. Liver sections from control rat (A), rat treated with DEN for 12 weeks (B), and ratswith DEN and CASE treatment (60, 120 or 240 mg/kg/day) ((C), (D), (E)) were stained with anti-α-SMA antibody (brown color) and hematoxylin (blue color). These wererepresentative sections randomly selected from each group. Magnification is 200� . α-SMA was not expressed in hepatocytes in normal liver (A) while it was localized in theimmunoreactive mesenchymal cells adjacent to necrotic or damaged hepatocytes in centrilobular areas in liver from rats treated with DEN alone (B). The bar chart is basedon mean value of each group and the error bar represents the SD values (n¼8). ##Po0.01 vs. control; nnPo0.01 vs. DEN group. (For interpretation of the references to colorin this figure legend, the reader is referred to the web version of this article.)

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209202

RT-PCR System. Each Ct value was normalized to the housekeepinggene β-actin Ct value and a control sample. Relative quantizationwas expressed as fold-induction compared to control conditions.Melting curves were generated after each run to confirm ampli-fication of specific transcripts.

2.9. Statistics

Data were expressed as mean7standard deviation (SD).Statistical analyses were performed by SPSS 11.0 for Windows(SPSS, Inc., Chicago, IL, U.S.A.). Experimental and control groupswere compared by one-way ANOVA. At 16th week, the incidencesof hepatocellular neoplasm were analyzed by χ2 test or Fisher'sexact probability test, while multiplicity of hepatocellular neo-plasm where evaluated with Kruskal–Wallis test (Kagawa et al.,2004). Po0.05 was considered to be statistically significant.

3. Results

3.1. Effects of CASE on DEN-induced hepatomaincidence and multiplicity

As expected, the HCC incidence rates in the control and DENgroups are 0% and 100%, respectively. Table 1 shows that theincidence and multiplicity of development of HCC in DEN treated

rats at 16th week were significantly reduced by the treatment ofCASE at the doses of 120 and 240 mg/kg.

3.2. Effects of CASE on serum biochemistry and hepatic hyp content

Figs. 1 and 2 show that, at 12th week, DEN administrationmarkedly increased the serum levels of ALT, AST, ALP, GGT, HA andliver Hyp content in rats. The elevated serum ALT, AST and ALPlevels were significantly suppressed by the treatment of CASE at alldose levels, while the elevated serum GGT and HA content wereonly suppressed by CASE doses at 120 and 240 mg/kg. AlthoughCASE treatment seemed to decrease the elevated Hyp content, thereduction did not reach statistical significance (Fig. 2).

Fig. 3 shows that, after 16 weeks of DEN administration, the levelsof serum ALP, HA, DBIL, IBIL was significantly increased, and CASEtreatment at all dose levels significantly suppressed these elevations.

Fig. 4 shows that, after 16 weeks of DEN administration, thelevels of serum TRP and ALB decreased significantly, and CASEtreatment did not significantly affect ALB level but significantlyincreased TRP at all dose levels.

3.3. Effect of CASE on DEN induced liver fibrosis

Fig. 5 shows liver sections stained with VG staining. In the liverof normal control rat, the structure of hepatic lobules was integral

Fig. 7. Effects of CASE on α-SMA protein expression in rats treated with DEN for 16 week. Liver sections from control rat (A), rat treated with DEN for 16 weeks (B), and ratswith DEN and CASE treatment (60, 120 or 240 mg/kg/day) ((C), (D), (E)) were stained with anti-α-SMA antibody (brown color) and hematoxylin (blue color). These wererepresentative sections randomly selected from each group. Magnification is 200� . α-SMA was slightly expression in hepatocytes in normal liver while was localized in theimmunoreactive mesenchymal cells adjacent to necrotic or damaged hepatocytes in centrilobular areas. The hepatoma nodules were shown in B2 and in arrow indicatedarea of C. The bar chart is based on mean value of each group and the error bar represents the SD values (n¼8). ##Po0.01 vs. control; nPo0.05 vs. DEN group; nnPo0.01 vs.DEN group. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209 203

with some collagen fibers but without fibrous hyperplasia in theportal areas. In contrast, fibrous hyperplasia and fibrosis extensionin the portal areas with fibroblast proliferation, widened lobularsepta with more fiber deposition, and formation of fibrous septawere found in the DEN group. When treated with CASE, fibroushyperplasia was significantly reduced and the number of fibroblastwas decreased in a dose-dependent manner. In addition, finefibers were observed occasionally and were found to distributemainly in the portal areas. However, there was still a significantincrease in fibrosis and hyperplasia of fibroblasts compared to thenormal control group although the extent of fibrosis was lower inthe CASE treated groups than the DEN group.

3.4. Effect of CASE on α-SMA protein expression

Fig. 6 shows that the number of α–SMA immunoreactivemesenchymal cells was markedly increased in the DEN groupcompared to the control group, and the elevated number of α-SMApositive cells were markedly decreased by CASE treatment in adose-dependent manner. Hepatocytes were constantly α-SMAnegative. As illustrated in the bar chart, the immunohistologicalscores of the DEN group were significantly higher than those of

the control group (Po0.01) and the CASE treatment groups(Po0.01).

After 16 weeks treatment of DEN, hepatoma nodules wereobserved in the liver (Fig. 7 B2 and C). Noticeably, there were noα-SMA positive cells in these hepatoma nodule areas. The immu-nohistological scores analysis indicated that there were moreα-SMA positive cells in the tissues from the HCC model groupcompared to that in the control group (Po0.01). The elevatednumber of α-SMA positive cells was markedly decreased by CASEtreatment at the doses of 120 and 240 mg/kg.

3.5. Effect of CASE on glutathione S-tra ferase placental type (GST-P)expression

Fig. 8 reveals preneoplastic lesions as colonial expansions ofaltered hepatocytes in rats treated with DEN for 12 weeks. Theywere clearly distinguished from surrounding normal hepatocytesby immunoreactivity for GST-P, a marker for preneoplastic cells(Ando et al., 2007). After 16 weeks, widespread malignant cellswere observed in DEN treated rat livers. Numbers and areas ofGST-P-positive foci in DEN treated alone group at 16th week weresignificantly decreased compared with those at 12th week (Fig. 8)

Fig. 8. Effect of CASE on GST protein expression in rats treated with DEN for 12 week. Liver sections from control rat (A), rat treated with DEN for 12 weeks (B), and rats withDEN and CASE treatment (60, 120 or 240 mg/kg/day) ((C), (D), (E)) were stained with anti-GST antibody (brown color) and hematoxylin (blue color). These wererepresentative sections randomly selected from each group. Magnification is 200� . The bar chart is based on mean value of each group and the error bar represents the SDvalues (n¼8). ##Po0.01 vs. control; nPo0.05 vs. DEN group; nnPo0.01 vs. DEN group. (For interpretation of the references to color in this figure legend, the reader isreferred to the web version of this article.)

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209204

although they are higher than those in the normal control group(Fig. 9). The elevated expression of GST-P was significantly reducedin the CASE (120 and 240 mg/kg)-treated groups compared to theDEN group both at 12th week and 16th week.

3.6. Effect of CASE on PAI-1 mRNA transcription in HepG2 cellsinduced by TGF-β1

As illustrated in Fig. 10, TGF-β1 increased the transcriptionallevel of PAI-1 mRNA in HepG2 cells. This up-regulated transcrip-tion was markedly decreased in a dose-dependent manner byCASE treatment.

4. Discussion

In this study, we showed that CASE treatment reduced DEN-induced hepatoma incidence by up to 30% and hepatomamultiplicityby more than half. Our subsequent biochemical and molecularanalyses offer some insights into CASE's anti-HCC mechanisms,discussed in detail below.

Fig. 9. Effect of CASE on GST protein expression in rats treated with DEN for 16 week. Liver sections from control rat (A), rat treated with DEN for 16 weeks (B), and rats withDEN and CASE treatment (60, 120 or 240 mg/kg/day) ((C), (D), (E)) were stained with anti-GST antibody (brown color) and hematoxylin (blue color). These wererepresentative sections randomly selected from each group. Magnification is 200� . The bar chart is based on mean value of each group and the error bar represents the SDvalues (n¼8). ##Po0.01 vs. control; nPo0.05 vs. DEN group; nnPo0.01 vs. DEN group. (For interpretation of the references to color in this figure legend, the reader isreferred to the web version of this article.)

Fig. 10. Effect of CASE on TGF-β1 induced PAI-1 mRNA transcription. Under serum-free conditions, the cells were incubated in the absence or presence of CASE for14 h, and subsequently in the absence or presence of 9 pM TGF-β1 plus CASE for10 h. Cellular RNA was collected to assess the changes of PAI-1 mRNA transcriptionby real-time reverse transcriptase-polymerase chain reaction. Results are expressedas fold increases of PAI-1 mRNA transcription after normalization to β-actin level.The error bar represented SD (n¼3). ##Po0.01 compared with column 1; nPo0.05compared with column 2. (For interpretation of the references to color in this figurelegend, the reader is referred to the web version of this article.)

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209 205

Serum hepato-specific enzymes and bilirubin level increasewhen hepatocellular damage persists, especially in hepatoma(Wills et al., 2006; Sivaramakrishnan et al., 2008; Wu et al.,2009; Lichtenstern et al., 2011; Jayakumar et al., 2012). Suchsignificant increases in serum enzyme activities could be attrib-uted to either breakdown of cell membrane architecture (leadingto spillage of these enzymes into serum), or over-production ofthese enzymes in fibrosis and tumor cells (causing increasedpermeability of cell membrane and resulting in liberation of theseenzymes into serum) (Ramakrishnan et al., 2007; Barone et al.,2009; Takata et al., 2010; Metwally et al., 2011; Rusyn and Corton,2012). In this study, we found that CASE treatment suppressed theelevated serum ALT, AST, ALP and bilirubin levels in rats with DEN-induced HCC. These results suggest that CASE may inhibit theprogression of HCC by intervening in the pathophysiologicalprocesses of fibrosis and hepatocarcinogenesis.

Previous studies indicate that the extent of cirrhosis and fibrosisis directly associated with the progression of HCC (Yang et al., 2003;Okuda, 2007). Hyaluronic acid (HA), a molecule involved in thesynthesis and degradation of the extracellular matrix, has beenincorporated into serum biomarkers for liver fibrosis by the OriginalEuropean Liver Fibrosis panel since 2004 due to its good diagnosticaccuracy for the detection of moderate and severe fibrosis(Kim et al., 2012). The α-SMA expression in the liver is also anindicator of HSC activation, which is recognized as being critical inliver fibrogenesis (Lau et al., 2005; Yang et al., 2008). A decrease in

α-SMA expression is correlated with treatment-related improve-ment in necro-inflammatory lesions (Clément et al., 2010;Okamoto et al., 2010). Our results showed that CASE treatment(120, 240 mg/kg) not only significantly inhibited the elevatedlevels of serous HA and the expression of α-SMA of liver tissuesbut also reduced necrosis collagen accumulation (VG staining)and liver Hyp content in DEN-induced HCC. These results extendour earlier findings (Yang et al., 2008) and confirm that CASEmay prevent tumor formation by ameliorating the extent offibrosis.

The significant elevation of GGT in rat sera may be attributed tothe liberation of this enzyme from the plasma membrane into thecirculation, which indicates the damage of cell membrane as aresult of carcinogenesis (Yao et al., 2004; Wang et al., 2012). Theubiquity of elevated GGT levels in many rodent and human hepaticor extra-hepatic carcinomas have led to the hypothesis that GGTprovides a growth advantage of focal cells during carcinogenesis(Metwally et al., 2011) and, therefore, could be a specific markerenzyme for preneoplastic lesions (Nishimura et al., 2008) ormalignant transformation (Cui et al., 2003; Sakata et al., 2004).Our current study showed that GGT serum level in DEN treatedrats was significantly increased compared to that in control rats,consistent with the findings in previous study (Wills et al., 2006).Our finding that CASE treatment significantly suppressing GGTelevation offers additional proof that CASE could delay HCCdevelopment.

Table A1Clinical studies related to Astragalus and Salvia extract.

Plant/drug Numberof cases

Observed effects Conclusion Reference

Astragalus injection combined withtranscatheter arterialchemoemcombolization (TACE)

56 Survival rate in treatment group weresignificantly higher in control group (32.14% vs. 21.43%after 12 month therapy; 14.29% vs 3.57% after 18 monththerapy)

Astragalus injection combined with TACEcan improves the therapeutic effect ofprimary hepatocellular carcinomatreatments and improves the quality of lifefor patients.

Du et al.,2008

Astragalus and Salvia injection 52 The levels of serum fibrosis indexes(HA, LN, IV-C,PCIII)decreased by the injection

Astragalus and Salvia injection have acertain therapeutic effect on liver fibrosis.

Peng andWang,2010

Salvia miltiorrhiza(SM) and Astragalusmembranaceus(AM)

84 The levels of serum fibrosis indexes(HA, LN, IV-C,PCIII) were improved intreatment group than control group

SM and AM could improve portalhypertensioneffect in liver cirrhosis patients.

Tan et al.,2001

Compoud sophora flavescens injectioncombined with lamivadine

75 The effective rate of treatment group washigher than that of control group

Compoud sophora flavescens injectioncombined with lamivudine is better thanlamivudine alone on chronic hepatitis Bcirrhosis.

Chenet al.,2013

Table A2The tolerance and toxicity studies related to Astragalus and Salvia extract.

Plant/ drug Numberof cases

Observed effects Conclusion Reference

Tolerance of Salvianolic acid Capsule inphase I clinical trial

32 In single administration groups the vital signs andlaboratory results of volunteers in 1,24 and 72 hwere normal; in successive administration groupthe vital signs and 1aboratory results of volunteersin d 4 and d 8 were normal

Healthy volunteers showed good tolerance aftertaking single and multiple dose of Salvianolic acidCapsule. The largest dose of 1000 mg in this clinicaltrial was safe. The clinical dosage recommend was200 mg, t.i.d.

Liuet al.,2004

Acute and chronic toxicity of Astragalusinjection in mice and rats

60 Feeding raised and weight gain of rats werenormal; indices of uric, hematology, serumbiochemistry and organ coefficient were in normalrange; no histological lesion were detected

Astragalus injection was not toxic in mice and rats Hanet al.,2004

Pharmacokinetics and tolerance of toalastragalosides after intravenousinfusion of astragalosides injection inhealthy Chinese volunteers

40 No significant difference was observed betweenthe pharmacokinetic parameters, peak time, t1/2and the corresponding mean values of area underthe plasma concentration, of day 1 and day 7.

The astragalosides injection was safe and welltolerated after a single dose from 200 ml to 600 mland a 7-day multiple-dose at 500 ml in healthyChinese volunteers.

Xu et al.,2013

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209206

PAI-1 may participate in the pathophysiology of a number ofdiseases such as atherosclerosis, restenosis, and cancer. Increasedexpression of PAI-1 has been associated with multiple forms offibrosis including liver fibrosis, pulmonary fibrosis and glomerulo-sclerosis (Gramling and Church, 2010). As one of the mostimportant target genes of TGF-β1/Smad signaling, PAI-1 is themain inhibitor of the urokinase-type and tissue-type plasminogenactivator systems (Yang et al., 2008; He et al., 2012). We found theincreased PAI-1 mRNA transcription after treatment with TGF-β1both in myofibroblasts (Yang et al., 2008) and in HepG2 cells (Liuet al., 2010). Our previous study (Rui et al., 2012) has also shownthat PAI-1 mRNA expression gradually increased during fibrosisprogress and reached maximum when HCC occurred in DENtreated rats. It is well known that the degree of fibrosis is relatedto the progression of HCC. However, it should also be noted thatthe elevated PAI-1 not only decreased fibrin degradation andpromoted fibrosis by inhibiting plasminogen activation but alsomight promote the occurrence of HCC. These were helpful tounderstand the enhancement pathological progression betweenfibrosis and HCC. Our experiment showed that CASE markedlydecreased the PAI-1 mRNA transcription in HepG2 cells induced by

TGF-β1 in a dose-dependent manner, providing further evidenceon CASE's mediation and interference with the TGF-β1/Smadsignaling pathway.

In conclusion, our study suggests that CASE suppresses DEN-induced hepatocarcinogenesis by decreasing expression of pre-neoplastic markers (GGT and GST-P) and mitigating the extent offibrosis. In addition, CASE might ameliorate fibrosis by decreasingthe transcription of PAI-1 mRNA of HCC. Therefore, CASE might bea good candidate for preventing and treating HCC by inhibitingfibrosis.

Acknowledgments

We thank Dr. Zhan, the U.S. Agency for Healthcare Research andQuality, for comments and editorial assistance. This study wasfinancially supported by the National Natural Science Foundationof China (no. 81073098; no. 81374012) and supported by theAcademic and Technique Foregoer Foundation of Anhui province,China (2012381).

Table A3Pharmacological studies related to Astragalus and Salvia extract.

Plant/drug Dose Observed effects Conclusion Ref.

Astragaloside IV 10 Astragaloside IV reduced DHBV levels inthe serum of infected ducks

Astragaloside IV has potent anti-HBV activityfor treating human HBV infection

Wanget al.(2009)

40120 mg/kg

Swainsonine (extractfrom Astragalusmembra naceus)

0.09 cSwainsonine Significantly inhibited thegrowth of HCC cell lines

Swainsonine has possible clinical applicationas a novel anti-HCC agent

You et al.(2012)0.17

0.33 μg/mlAstragaluspolysaccharides (APS)

10 APS inhibited the prevalence and function ofTreg cells in tumor microenvironmentof patients with HCC

APS could enhance the therapeutic effect ofimmunotherapy and increase the survivalof HCC patients

Li et al.(2012)50

100150200 μg/ml

Total Astragalus saponins(AST)

40 Exposure of HepG2 cells to AST resulted inan extensive downregulation of α-fetoprotein,indicating its effect in preventing tumorprogression

AST induces cytotoxicity and promotes apoptosis in HepG2cells, and these effects were mediated throughan ERK-independent NF-κB signaling pathway.

Auyeunget al.(2009)

6080 μg/ml

Astragalus membranaceus 100 Murine macrophage pretreated with A.membranaceus increased in vitro and in vivocytostatic activities towards MBL-2 tumor

Astragalus membranaceus has both in vitro and in vivo anti-tumor effects

Cho andLeung(2007)

200 μg/ml

Paeonia lactiflora andAstragalusmembranaceus (PAE)

40 PAE displayed antifibrotic effects in rats inducedby porcine serum

PAE is a potential agent for the prevention of liver fibrosis Sun et al.(2012)80

160 mg/kgCompound Astragalusand Salvia miltiorrhizaextract (CASE)

20 CASE markedly suppressed cellinvasion triggered by TGF-β

CASE exerts anti-HepG2 cell invasion effect by modulatingTGF-β/Smad signaling

Liu et al.(2010)40

80 μg/mlCompound Astragalusand Salvia miltiorrhizaextract (CASE)

60 CASE in vivo had protective effects against liverfibrosis in rats generated by CCl4, and CASEinhibits Smad2 phosphorylation at C-terminalregion and expression of α-smooth muscle actin(α-SMA)

CASE has a protective effect against liver fibrosis Yanget al.(2008)

120240 mg/kg

Astragaloside II 0.08 mg/ml Astragaloside II showed strong potency to increase5-fluorouracil cytotoxicity toward 5-fluorouracil-resistant human hepatic cancer cells Bel-7402/FU

Astragaloside II is a potent MDR reversal agent and may bea potential adjunctive agent for hepatic cancerchemotherapy

Huanget al.(2012)

Salvianolic acid B (Sal B) 20 Sal B reduced α-SMA and collagen synthesis anddeposition in HSCs

Sal B ameliorates oxidative damage, eliminates ROSaccumulation in hepatocytes, and attenuates HSCactivation, potentially conferring hepatoprotective andanti-fibrogenic effects

Lin et al.(2006)35

70 μM

Astragali Radix (AR) 50 AR selectively altered Th1/Th2 cytokinesecretion patterns

AR has potential clinical applications Kanget al.(2004)

100 μg/ml

Chi-Shen extract (CSE)from the water-solublecompounds of Salviamiltiorrhiza andPaeoniae

0.25 CSE strongly induced HepG2 cell deathin a dose- and time-dependent manner

CSE has anticancer potential Hu et al.(2007)0.5

12 mg/ml

Astragalus membranaceus 1.23 gexpressed asdry herb

Echinacea, Astragalus and Glycyrrhiza herbalTinctures stimulated immune cells as quantified byCD69 expression on CD4 and CD8 T cells

Echinacea, Astragalus and Glycyrrhiza herbaltinctures stimulate activation and proliferationof various immune cells

Brushet al.(2006)

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209 207

Appendix 1

See Table A1.

Appendix 2

See Table A2.

Appendix 3

See Table A3.

References

Ando, N., Shimizu, M., Okuno, M., Matsushima-Nishiwaki, R., Tsurumi, H., Tanaka,T., Moriwaki, H., 2007. Expression of retinoid X receptor alpha is decreased in3′-methyl-4-dimethylaminoazobenzene-induced hepatocellular carcinoma inrats. Oncol. Rep. 18, 879–884.

Auyeung, K., Law, P., Ko, J., 2009. Astragalus saponins induce apoptosis via an ERK-independent NF-κB signaling pathway in the human hepatocellular HepG2 cellline. Int. J. Mol. Med. 23, 189–196.

Barone, M., Maiorano, E., Scavo, MP., Panella, E., Castellaneta, A., Napoli, A.,Francioso, D., Di Leo, A., Francavilla, A., 2009. Effect of gonadectomy on HCCdevelopment in HBV transgenic mice. Dig. Liver Dis. 41, 150–155.

Brush, J., Mendenhall, E., Guggenheim, A., Chan, T., Connelly, E., Soumyanath, A.,Buresh, R., Barrett, R., Zwickey, H., 2006. The effect of Echinacea purpureaAstragalus membranaceus and Glycyrrhiza glabra on CD69 expression andimmune cell activation in humans. Phytother. Res. 20, 687–695.

Chen, G., Dai, Z., Liang, R., Xiao, S., He, S., Zhao, H., Xu, Q., 2012. Characterization ofdiethylnitrosamine-induced liver carcinogenesis in Syrian golden hamsters.Exp. Ther. Med. 3, 285–292.

Chen, G., Mao, J., Jiao, Z., Li, Y., 2013. Efficacy observation of compound sophoraflavescens injection combined with Lamivudine on chronic hepatitis B cirrhosis.Chin. Pharm. 24, 342–344.

Cho, W., Leung, K., 2007. In vitro and in vivo anti-tumor effects of Astragalusmembranaceus. Cancer Lett. 252, 43–54.

Chuang, S., Kuo, M., Hsu, C., Chen, C., Lin, J., Lai, G., Hsieh, C., Cheng, A., 2000.Curcumin-containing diet inhibits diethylnitrosamine-induced murine hepato-carcinogenesis. Carcinogenesis 21, 331–335.

Clément, S., Pascarella, S., Conzelmann, S., Gonelle-Gispert, C., Guilloux, K., Negro, F.,2010. The hepatitis C virus core protein indirectly induces alpha-smoothmuscle actin expression in hepatic stellate cells via interleukin-8. J. Hepatol.52, 635–643.

Cui, R., He, J., Wang, B., Zhang, F., Chen, G., Yin, S., Shen, H., 2003. Suppressive effectof Astragalus membranaceus Bunge on chemical hepatocarcinogenesis in rats.Cancer Chemother. Pharmacol. 51, 75–80.

Du, Y., Wang, L., Guo, J., 2008. The clinic research of huangqi injection combinedwith transcatheter arterial chemoembolization to treat primary hepatocellularcarcinoma. Gansu Med. J. 27, 13–15.

Gao, B., Bataller, R., 2011. Alcoholic liver disease: pathogenesis and new therapeutictargets. Gastroenterology 141, 1572–1585.

Gramling, M., Church, F., 2010. Plasminogen activator inhibitor-1 is an aggregateresponse factor with pleiotropic effects on cell signaling in vascular disease andthe tumor microenvironment. Thromb. Res. 125, 377–381.

Han, R., Zhu, L., Pan, J., Zhang, K., 2004. Acute and chronic toxicity studies ofHuangqi injection in mice and rats. Chin. Wild Plant Resour. 23, 50–53.

He, S., Liu, X., Yang, Y., Huang, W., Xu, S., Yang, S., Zhang, X., Roberts, M., 2010.Mechanisms of transforming growth factorβ1/Smad signalling mediated bymitogen-activated protein kinase pathways in keloid fibroblasts. Br. J. Dermatol.162, 538–546.

He, S., Yang, Y., Liu, X., Huang, W., Zhang, X., Yang, S., Zhang, X., 2012. CompoundAstragalus and Salvia miltiorrhiza extract inhibits cell proliferation, invasion andcollagen synthesis in keloid fibroblasts by mediating TGF-beta/Smad pathway.Br. J. Dermatol. 166, 564–574.

Hu, S., Chen, S., Li, X., Qin, R., Mei, Z., 2007. Antitumor effects of Chi-Shen extractfrom Salvia miltiorrhiza and Paeoniae radix on human hepatocellular carcinomacells. Acta Pharmacol. Sin. 28, 1215–1223.

Huang, C., Xu, D., Xia, Q., Wang, P., Rong, C., Su, Y., 2012. Reversal of p-glycoprotein-mediated multidrug resistance of human hepatic cancer cells by AstragalosideII. J. Pharm. Pharmacol. 64, 1741–1750.

Jayakumar, S., Madankumar, A., Asokkumar, S., 2012. Potential preventive effect ofcarvacrol against diethylnitrosamine-induced hepatocellular carcinoma in rats.Mol. Cell Biochem. 360, 51–60.

Kagawa, M., Sano, T., Ishibashi, N., 2004. An acyclic retinoid, NIK-333, inhibitsN-diethylnitrosamine-induced rat hepatocarcinogenesis through suppressionof TGF-alpha expression and cell proliferation. Carcinogenesis 25, 979–985.

Kang, H., Ahn, K., Cho, C., Bae, H., 2004. Immunomodulatory effect of Astragali Radixextract on murine TH1/TH2 cell lineage development. Biol. Pharm. Bull. 27,1946–1950.

Kim, B., Kim, H., Park, J., Kim do, Y., Ahn, S., Chon, C., Park, Y., Han, K., Kim, S., 2012.Prospective validation of ELF test in comparison with fibroscan and fibrotest topredict liver fibrosis in Asian subjects with chronic hepatitis B. PLoS One 7,e41964, http://dx.doi.org/10.1371/journal.pone.0041964.

Lau, D., Luxon, B., Xiao, S., Beard, M., Lemon, S., 2005. Intrahepatic gene expressionprofiles and alpha-smooth muscle actin patterns in hepatitis C virus inducedfibrosis. Hepatology 42, 273–281.

Li, Q., Bao, J., Li, X., Zhang, T., Shen, X., 2012. Inhibiting effect of Astragalus poly-saccharides on the functions of CD4þCD25 highTreg cells in the tumor micro-environment of human hepatocellular carcinoma. Chin. Med. J. 125, 786–793.

Lichtenstern, C., Hofer, S., Möllers, A., Snyder-Ramos, S., 2011. Lipid peroxidation inacute respiratory distress syndrome and liver failure. J. Surg. Res. 168, 243–252.

Lin, Y., Wu, C., Luo, M., Huang, YJ., Wang, C., Shiao, M., Huang, YT., 2006. In vitroprotective effects of salvianolic acid B on primary hepatocytes and hepaticstellate cells. J. Ethnopharmacol. 105, 215–222.

Liu, J., Shen, H., Ong, C., 2000. Salvia miltiorrhiza inhibits cell growth and inducesapoptosis in human hepatoma HepG2 cells. Cancer Lett. 153, 85–93.

Liu, X., Shen, J., Lin, H., 2004. Research on tolerance of salvianolic acid capsule inphase I clinical trial. Shanghai Med. Pharm. J. 25, 553–556.

Liu, X., Yang, Y., Zhang, X., Xu, S., He, S., Huang, W., Roberts, M., 2010. CompoundAstragalus and Salvia miltiorrhiza extract inhibits cell invasion by modulatingtransforming growth factor-beta/Smad in HepG2 cell. J. Gastroenterol. Hepatol.25, 420–426.

Metwally, N., Kholeif, T., Ghanem, K., Farrag, A., Ammar, N., Abdel-Hamid, A., 2011.The protective effects of fish oil and artichoke on hepatocellular carcinoma inrats. Eur. Rev. Med. Pharmacol. Sci. 15, 1429–1444.

Nishimura, J., Dewa, Y., Okamura, T., Jin, M., Saegusa, Y., Kawai, M., Umemura, T.,Shibutani, M., Mitsumori, K., 2008. Role of Nrf2 and oxidative stress onfenofibrate-induced hepatocarcinogenesis in rats. Toxicol. Sci. 106, 339–349.

Okamoto, K., Tajima, H., Ohta, T., Nakanuma, S., Hayashi, H., Nakagawara, H.,Onishi, I., Takamura, H., Ninomiya, I., Kitagawa, H., Fushida, S., Tani, T., Fujimura,T., Kayahara, M., Harada, S., Wakayama, T., Iseki, S., 2010. Angiotensin II inducestumor progression and fibrosis in intrahepatic cholangiocarcinoma through aninteraction with hepatic stellate cells. Int. J. Oncol. 37, 1251–1259.

Okuda, H., 2007. Hepatocellular carcinoma development in cirrhosis. Best Pract.Res. Clin. Gastroenterol. 21, 161–173.

Peng, A., Wang, Z., 2010. Aut-i hepatic fibrosis ef fect of Huangqi injection andDanshen injection on 52 cases of liver fibrosis. Chin. Hosp. Pharm. J. 30,1131–1133.

Ramakrishnan, G., Augustine, T., Jagan, S., Vinodhkumar, R., Devaki, T., 2007. Effectof silymarin on N-nitrosodiethylamine induced hepatocarcinogenesis in rats.Exp. Oncol. 29, 39–44.

Rui, W., He, S., Huang, X., Fang, Z., Hang, X., Yang, Y., 2012. Expression of pSmad3Land PAI-1 during the process of DEN-induced hepatic fibrosis-carcinoma in rat.Chin. Pharmacol. Bull. (Chin.) 28, 1393–1397.

Rusyn, I., Corton, J., 2012. Mechanistic considerations for human relevance of cancerhazard of di(2-ethylhexyl) phthalate. Mutat. Res. 750, 141–158.

Sakata, K., Hara, A., Hirose, Y., Yamada, Y., Kuno, T., Katayama, M., Yoshida, K., Zheng,Q., Murakami, A., Ohigashi, H., Ikemoto, K., Koshimizu, K., Tanaka, T., Mori, H.,2004. Dietary supplementation of the citrus antioxidant auraptene inhibits N,N-diethylnitrosamineinduced rat hepatocarcinogenesis. Oncology 66, 244–252.

Sivaramakrishnan, V., Shilpa, P., Praveen Kumar, V., Niranjali Devaraj, S., 2008.Attenuation of N-nitrosodiethylamine-induced hepatocellular carcinoma by anovel flavonol-Morin. Chem. Biol. Interact. 171, 79–88.

Sun, W., Wang, L., Liu, H., Li, X., Wei, W., 2012. A standardized extract from Paeonialactiflora and Astragalus membranaceus attenuates liver fibrosis induced byporcine serum in rats. Int. J. Mol. Med. 29, 491–498.

Takata, A., Kuromatsu, R., Ando, E., Iwamoto, H., Fukushima, N., Sumie, S., Torimura,T., Sata, M., 2010. HCC develops even in the early stage of chronic liver diseasein elderly patients with HCV infection. Int. J. Mol. Med. 26, 249–256.

Tan, Y., Yin, Y., Xue, Yu, 2001. Influence of Salvia miltiorrhizand and Astragalusmembranaceus on hemodynamics and liver fibrosis indexes in liver cirrhoticpatients with portal hypertention. Chin. J. Integr. Tradit. West. Med. 21,351–353.

Thirunavukkarasu, C., Yang, Y., Subbotin, V., Harvey, S., Fung, J., Gandhi, C., 2004.Endothelin receptor antagonist TAK-044 arrests and reverses the developmentof carbon tetrachloride induced cirrhosis in rats. Gut 53, 1010–1019.

Van De Craen, B., Declerck, P., Gils, A., 2012. The biochemistry, physiology andpathological roles of PAI-1 and the requirements for PAI-1 inhibition in vivo.Thromb. Res. 130, 576–585.

Wang, S., Li, J., Huang, H., Gao, W., Zhuang, C., Li, B., Zhou, P., Kong, D., 2009. Anti-hepatitis B virus activities of astragaloside IV isolated from Radix Astragali. Biol.Pharm. Bull. 32, 132–135.

Wang, W., Lin, R., Zhang, J., Mao, Y., 2012. Involvement of fatty acid metabolismin the hepatotoxicity induced by divalproex sodium. Hum. Exp. Toxicol. 31,1092–1101.

Wills, P., Suresh, V., Arun, M., Asha, W., 2006. Antiangiogenic effect of lygodiumflexuosum against N-nitrosodiethylamine- induced hepatotoxicity in rats.Chem.-Biol. Interact. 164, 25–38.

Wu, P., Dugoua, J., Eyawo, O., Mills, E., 2009. Traditional Chinese medicines in thetreatment of hepatocellular cancers: a systematic review and meta-analysis.J. Exp. Clin. Cancer Res. 28, 112, http://dx.doi.org/10.1186/1756-9966-28-112.

Xu, M., Yin, J., Xie, L., Gao, W., Zhang, J., Zou, C., Zou, J., Liu, F., Ju, W., Li, P., 2013.Pharmacokinetics and tolerance of toal astragalosides after intravenous infu-sion of astragalosides injection in healthy Chinese volunteers. Phytomedicine ,http://dx.doi.org/10.1016/j.phymed.2013.05.004.

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209208

Yang, C., Zeisberg, M., Lively, J., Nyberg, P., Afdhal, N., Kalluri, R., 2003. Integrinalpha1beta1 and alpha2beta1 are the key regulators of hepatocarcinomacell invasion across the fibrotic matrix microenvironment. Cancer Res. 63,8312–8317.

Yang, Y., Yang, S., Chen, M., Zhang, X., Zou, Y., Zhang, X., 2008. Compound Astragalusand Salvia miltiorrhiza extract exerts anti-fibrosis by mediating TGF-beta/Smadsignaling in myofibroblasts. J. Ethnopharmacol. 118, 264–270.

Yao, D., Dong, Z., Yao, D., Wu, X., Wu, W., Qiu, L., Wang, H., Meng, X., 2004.Abnormal expression of hepatoma- derived gamma-glutamyltransferase sub-typing and its early alteration for carcinogenesis of hepatocytes. HepatobiliaryPancreat. Dis. Int. 3, 564–570.

You, N., Liu, W., Wang, T., Ji, R., Wang, X., Gong, Z., Dou, K., Tao, K., 2012. Swainsonineinhibits growth and potentiates the cytotoxic effect of paclitaxel in hepatocel-lular carcinoma in vitro and in vivo. Oncol. Rep. 28, 2091–2100.

W. Rui et al. / Journal of Ethnopharmacology 151 (2014) 198–209 209