Research

noio

ei

ogy,jian

6; a

form adenosine phosphosulfate. Similarly, the reduction of sel-enate is proposed to be rate-limiting for the selenate assimila-tion pathway [5,24]. When plants of several species, includingIndian mustard, were supplied with selenate, they accumulated

tion polymerase chain reaction; RACE, rapid amplification of cDNA ends.* The research reported in this paper was supported by Anhui Nature Sci-

ence Foundation, China (grant No. 050410102).

* Corresponding author. Tel./fax: 86 551 515 6265.E-mail address: jiangcj@ahau.edu.cn (C.-J. Jiang).

Available online at www.sciencedirect.com

Plant Physiology and Biochemis1. Introduction

Plants and microorganisms assimilate inorganic sulfate forthe biosynthesis of various sulfur-containing compounds. ATPsulfurylase (ATP: sulfate adenylyl transferase, EC 2.7.7.4)plays a key role in sulfate metabolism by catalyzing the forma-tion of adenosine phosphosulfate (APS) from ATP and sulfate[14]. The phosphate-sulfate anhydride bond in APS activatessulfate for subsequent reactions. For example, sulfate can befurther reduced to sulfide, the substrate for Cys biosynthesis.

The sulfate in APS can also be transferred to a hydroxyl groupto form a sulfate ester. Some proteins, peptides, oligosaccha-rides, and flavonoid compounds are sulfated on hydroxylgroups [22]. Activated sulfate can also be transferred to a car-bon group to form sulfonic acid, as occurs in the biosynthesisof sulfolipids [22]. Sulfation of various molecules may alsoplay important regulatory functions. One example is that a sul-fated oligosaccharide produced by the nitrogen-fixing symbi-ont Rhizobium meliloti, which elicits root nodule formationin some leguminous plants [13].

The uptake and assimilation of selenate and sulfate are gen-erally assumed to follow the same pathway [1,11,18,20,25].For reduction, sulfate is activated by ATP sulfurylase toAbbreviations: APS, adenosine phosphosulfate; RT-PCR, reverse transcrip-Available online 5 April 2007

Abstract

ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of plants, catalyzes the formation of adenosine phosphosulfate fromATP and sulfate. Here we report the cloning of two cDNAs encoding ATP sulfurylase (APS1 and APS2) from Camellia sinensis. They wereisolated by RT-PCR and RACE-PCR reactions. The expression of APS1 and APS2 are correlated with the presence of ATP sulfurylase enzymeactivity in cell extracts. APS1 is a 1415-bp cDNA with an open reading frame predicted to encode a 360-amino acid, 40.5 kD protein; APS2 isa 1706-bp cDNA with an open reading frame to encode a 465-amino acid, 51.8 kD protein. The predicted amino acid sequences of APS1 andAPS2 have high similarity to ATP sulfurylases of Medicago truncatula and Solanum tuberosum, with 86% and 84% identity respectively. How-ever, they share only 59.6% identity with each other. The enzyme extracts prepared from recombinant Escherichia coli containing Camelliasinensis APS genes had significant enzyme activity. 2008 Elsevier Masson SAS. All rights reserved.

Keyword: Cloning; cDNA; ATP sulfurylase; Camellia sinensis; ExpressionCloning of two cDNAs encodifrom Camellia sinensis related t

and functional express

Lin Zhu, Wei-Wei Deng, Ai- Hua Ye, M

Key Laboratory of Tea Biochemistry and BiotechnolAnhui Agricultural University of China, Chang

Received 1 October 2000981-9428/$ - see front matter 2008 Elsevier Masson SAS. All rights reserved.doi:10.1016/j.plaphy.2007.03.029article

g a family of ATP sulfurylaseselenium or sulfur metabolismn in Escherichia coli*

Yu, Zhao-Xia Wang, Chang-Jun Jiang*

Ministry of Education and Ministry of Agriculture,g West Road 130, Hefei, Anhui 230036, China

ccepted 29 March 2007

try 46 (2008) 731e738www.elsevier.com/locate/plaphy

selenate; whereas when they were supplied with selenite, theyMet.

Thus, ATP sulfurylase is considered to be a rate-limiting en-

due to its dual roles for human beings. It is an essential nutri-con-

centrations. In most areas of China, Se is present in the

sinensis cDNA encoding ATP sulfurylase related to seleniumation

by RT-PCR and RACE-PCR reaction of a cDNA encoding

after purification, to pMD-18T easy vector and sequenced.

nd BATP sulfurylase (APS1 and APS2) from Camellia sinensis,which grow in soil abundant in Selenium, and their functionalexpression in Escherichia coli.

2. Materials and methods

2.1. Strains of bacteria and media

An Escherichia coli strain DH5a (Life Technologies, Inc.)was used for general cloning purposes and as a source of chro-mosomal DNA for amplification of the ATP sulfurylase gene.ATP sulfurylase were overproduced in Escherichia coli strainBL21 (DE3) [2]. Clone vector pMD-18T and expression vectorpET-32a () were purchased from TaKaRa Inc and Novagenrespectively. Plasmids were prepared in E. coli DH5a on LuriaBroth medium with ampicillin (100 pg/mL).

2.2. Enzyme and biochemical reagents

BamHI, HindIII, Pfu polymerase, Taq DNA Polymeraseand DNA Fragment Purification Kit were purchased from Ta-KaRa Inc. T4 DNA ligase was purchased from Promega Inc.DNA and protein markers were purchased from MBI Inc. 30/50RACE System for Rapid Amplification of cDNA Ends Kitwas purchased from GIBCO. DNA sequences were completedby Invitrogen. All other chemicals were from commercialsources.

2.3. Plant materialand sulfur metabolism. In this paper, we report the isolenvironment at levels which are too low, whereas in someparts of China, such as Shitai County, Anhui Province, Se ispresent in high concentrations. There Shale-derived soil typi-cally contain high concentrations of Se. Camellia sinensis L.,a woody perennial plant, growing in soil abundant in Seleniumhas a high rate of Se accumulation. Organic species of Se canaccount for up to 82.4% of the total Se in the tea plant leaves(data not shown). Thus it is possible to clone from Camelliaent at low concentrations, but a toxic substance at higherzyme in some species for Se assimilation, and overexpressionof this enzyme may increase the flux of the pathway [20].

An ATP sulfurylase gene was first cloned from Saccharo-myces cerevisiae (yeast) by Cherest in 1987 [4]. The homologshave subsequently been cloned from prokaryotes and otherlower eukaryote, and several cDNAs have been cloned fromplants and animals [12,15].

Selenium is an interesting element in the ground ecosystemaccumulated an organic Se compound resembling Se732 L. Zhu et al. / Plant Physiology aYoung and most recently emerged developing leaves fromfresh shoots of tea (Camellia sinensis) plants growing in soil30RACE-PCR reaction of APS2was conducted using the pairof primers: UPM and 2#30race (GTCGTCGGCTTCTTGAGATGGGTTA) at first, and then performed by nestedPCR using NUP and 2#30raceqt (CCCTTAGTTGGCGAATGAAGCAGCA) The PCR product (0.79 kb) was ligated,after purification, to pMD-18T easy vector and sequenced.abundant in Selenium were collected from Shitai County, An-hui Province, the Peoples Republic of China. Also, tea leavespicked at Ahui Agriculture University were as a control tocompare the difference of ATP sulfurylase activity. The leaveswere frozen in liquid N2 and stored at 70 C until extractionof RNA and enzymes.

2.4. cDNA cloning

2.4.1. Special DNA fragments amplificationby RT-PCR reaction

The leaves of Camellia sinensis, were used as the startingmaterial for RNA isolation according to the manufacturers in-structions (TRIzol Reagent, Invitrogen, Carlsbad, CA). TotalRNA was extracted from the leaves of Camellia sinensis,and was reverse-transcribed to the first cDNA strand. The firstamplification was performed using a pair of degeneratedprimers PL1 (50 GAYGCNGNTTYGCNTTYCA 30) and PL2(50 GGRTCNCKNCCNACDATRTA 30), and the second am-plification was performed by nested PCR using PL3 (50

CCNGTNCAYAAYGGNCAYGC 30) and primer PL2, simul-taneously, performed by another nested PCR using PL1andPL4 (50 TGCCAYTGNACYTCNGTNGG 30). PCR products(306 bp and 382 bp) were sub cloned into the pMD18- T vec-tor, then transformed into E. coli DH5a and sequenced so thattwo Special DNA fragments, defined as APS1 and APS2, wereobtained. Plasmids were propagated in E. coli DH5a in LBmedia, and then selected with ampicillin [2].

2.4.2. Two full length cDNAs encoding ATP sulfurylaseacquired by RACE-PCR

Approximately 120 ng of RNA was used as the template inthe RACE PCR reaction for the cloning of the APS1 and APS2using the protocol described by the manufacturer (RACEcDNA Amplification Kit, Clontech Lab. Inc., USA). 30RACE-PCR reaction of APS1 was conducted using the pair of primers:UPM (50 CTACTAATACGACTCACTATAGGGC 30) and1#30race (50 CGATACACGCAGGAGACTTTTGGAA 30) atfirst, and then performed by nested PCR using NUP (50 AAGCAGTGGTATCAACGCAGAGT 30) and 1#30raceqt (50 CTGTCGTGGCGATATTCCCATCACC 30). The PCR product(0. 779 kb) was ligated, after purification, to pMD-18T easyvector and sequenced. Then, 50RACE-PCR amplification wascarried out to amplify the 50end of theAPS1 gene by firstly usingprimers UPM and 1#50race (50 CCATTGTACTTCTGTAGGACCAGCA 30) followed by using the following pair of nestedprimers: NUP and1#50raceqt179 (50 CCATTTCCAAAAGTCTCCTGCGTGT 30). The PCR product (0.553 kb) was ligated,

iochemistry 46 (2008) 731e738Then, 50RACE-PCR amplification was carried out to amplifythe 50end of APS2 by firstly using primers UPM and 2#50race

The full sequence of APS1 was amplified by PCR using the

and 8 h.

2.6. Database searches and sequence alignments

Sequence alignments were performed using DNAMAN 6.0.40lated

by the neighbor-joiningmethod [23] applied to amatrix of differ-

2 SB containing 100 mM dithiothreitol, 2% SDS, 80 mMglyc-

erol. The prepared samples were sonicated with a Cell Disrup-

rated by SDSPAGE and visualized by Coomassie staining.

2.9. ATP sulfurylase assay

nd Bprimers designed according to open reading frame. The PCRproduct which respectively had BamHI/HindIII site at bothends was transferred into E. coli BL21 (DE3) through plasmidpET-32 [19]. The pET-32 series is designed for cloning andhigh-level expression of peptide sequences fused with the109aa Trx $ Tag thioredoxin protein. Cloning sites are avail-able for producing fusion proteins also containing cleavableHis $ Tag and S $ Tag sequences for detection and purifica-tion. The T7 expression region is reversed on the circle map.The cloning/expression region of the coding strand was tran-scribed by T7 RNA polymerase. The f1origin is oriented so(50GGCCAGCATAATGCATAGGTGATGG30) followed by us-ing the following pair of primers: NUP and2#50raceqt (50

TAACCCATCTCAAGAAGCCGACGAC 30)By comparing and aligning the sequences 30,50and special

DNA fragment of APS, the full length cDNA sequences ofCamellia sinensis APS1 (1.415 kb)and APS2 (1.706 kb) genewere obtained through RT-PCR reaction using primer R1 (50

CAGTGGTATCAACGCAGAGTA 30)and R2 (50 CTATTAGGTGACGGTGGAATT 30); R3 (50 GTGGTATCAACGCAGAGTACG 30) and R4 (50 TCTCCCAAACAGATGTCAATG30) respectively.

2.5. Functional expression in E. coli strain BL21

2.5.1. Construction of overexpression plasmidsPlasmids for the overproduction of APS were constructed

from plasmid vector pET-32a (); the open reading frameswere amplified by PCR with Pfu polymerase (primers:ATP1#-ORF up 50 GATGGATCCATGAGAGAGGATGAGTATTTG 30 and ATP1#-ORF down 50 GCGAAGCTTTTATGTCTGTGTGGATAAAAC 30 for APS1; ATP2#-ORFup 50 GATAAGCTTATGGCGTCCATGGCCCTCCTT 30 andATP2#-ORF down 50 GCAGGATCCTTAAGCTGGCACAGGTTCAGG 30 for APS2) and cDNA from Camellia sinen-sis for APS1 and APS2, respectively. Amplified DNA frag-ments were ligated into PMT-18T vector and transferred toE. coli DH5a. The vector containing the APS gene fromCamellia sinensis was named pTAPS1 and that carrying APS2was designated pTAPS2. Plasmids from pTAPS1, pTAPS2and pET-32a () were all cleaved with BamHI/HindIII. Theopen reading frame fragments of APS1 and APS2 gene were in-serted into pET-32a () by ligation which were respectivelydesignated as pAPS1 and pAPS2.

2.5.2. Construction of vectors for constitutiveexpression in E. coli

Plasmid pET-APS1 and pET-APS2 were transferred intoE. coli strain BL21 (DE3) so that the corresponding genes couldbe expressed constitutively via the tetracycline promoter.

2.5.3. Overproduction of the APS1 and APS2 gene productfrom E. coli

L. Zhu et al. / Plant Physiology athat infection with helper phage will produce virions contain-ing single-stranded DNA that corresponds to the codingATP sulfurylase activity measurements were carried out oncrude cell extraction by molybdolysis [9,15]. Escherichia colicells were grown at 37 C in appropriate culture solutions toan absorbance of 1.0 measured at 650 nm. Recombinant cellswere collected by centrifugation at 4000 rpm for 30 s in 20 mlLB to get pellets. It was resuspended by 2 ml extraction bufferwhich consisted of, 80 mM TriseHCl, pH 8.0, 0.2 mM EDTA,1 mM phenylmethylsulfonyl fluoride, 10% (w/v) glycerol.

The molybdate-dependent formation of PPi was used tofollow enzyme activity. Procedures were slightly modified astor 350 (Branson, Danbury, CT) on ice. Proteins weredenatured at 70 C for 3 min and these crude extracts werestored at 20 C.

2.8. SDS-polyacrylamide gel electrophoresis procedures

SDS-PAGE was performed according to Laemmli [10].Crude extracts from bacteria cells was centrifuged. The super-natant was used for gel electrophoresis. Proteins were sepa-TriseHCl, (pH 6.8), 0.006% bromophenol blue and 10%ence distances derived from the structurally accurate APSalignments (Megalign program, DNAMAN 6.0.40, LynnonBiosoft Co.).

2.7. Preparation of a crude extract

Above bacteria cells were collected by centrifugation at4000 rpm for 30 s. The supernatant was discarded. Cell pelletswere resuspended by 2 ml PBS buffer and then added 2 ml(http://www.lynnon.com/). The phylogenetic treewas calcuBlast searches in the sequences of cDNAs and proteins ofCamellia sinensis were performed using the BLAST programon the NCBI web site (http://www.ncbi.nlm.nih.gov:/BLAST/).strand. Therefore, single-stranded sequencing should be per-formed using theT7 terminator primer.

ATP sulfurylase proteins were overproduced in E. coliBL21 (DE3) containing the plasmid pET-APS1 and pET-APS2.

Cells were grown in 20 milliliters of overproduction me-dium containing 50 mg/ml ampicillin and 15 mg/ml kanamycinat 37 C and maximal aeration. At an A600 of 0.5, overpro-duction was started by the addition of isopropylthiogalactosideto a final concentration of 1 mM. Incubation were continuedand 2 milliliters medium were collected at 0 h, 2 h, 4 h, 6 h

733iochemistry 46 (2008) 731e738below. The reaction was started by adding 0.10 ml of appropri-ately diluted enzyme to 0.50 ml of standard reaction mixture.

The latter contained 2 mm Na2ATP, 7 mM MgC12, 5 mm Na2-MoO4, and 0.33 units/ml of inorganic pyrophosphatase(Sigma; sulfate-free) in 0.08 M TriseHCl (pH 8.0). After10 min incubation at 30 C, the reaction was stopped by add-ing 1.0 ml of 0.5 M sodium acetate buffer (pH 4.0) and0.20 ml of freshly prepared developer solution. The developersolution contained 1% (NH4)6Mo7O24, 0.05%K (SbO)-C4H4O6, 1.5% L-ascorbic acid (sodium salt), and 11 MH2SO4. After 10 min, the absorbance of the blue color wasread at 660 nm against a TriseHCl blank. Under these condi-tions, a standard of 0.1 mol PPi or 0.2 mol Pi gave an uncor-rected A600of 0.55.

Plant ATP sulfurylase assaydsoluble protein extracts wereobtained from 2.0 g fresh weight of Camellia sinensis leavesessentially as described except for initial extraction [8]. Crudeextracts were obtained by grinding the organs to a fine powderin liquid N2 under the condition of adding 1 g insoluble poly-vinylpolypyrrolidone per gram fresh leaf, then adding 4 ml ofice-cold extraction buffer per g fresh weight of tissue, 100 mMTriseHCl, pH 8.0, 10 mM EDTA, 2 mM DTT followed bycentrifugation at 4 C for 10 min at 15,000 g. ATP sulfury-lase activity measurements were carried out by molybdolysisthe same as before.

Oryza sativa (japonica cultivar-group) (85% identity), APS1 ofopsiscineSim-

ilarly, the deduced amino acid sequence of APS2 has also high

734 L. Zhu et al. / Plant Physiology and BVector pMD18-T was used for cloning of the cDNA se-quence coding for the APS from Camellia sinensis. The

Fig. 1. Electrophoresis identification of amplified cDNA open reading frames

of APS1 and APS2 gene in Camellia sinensis. M, DNA marker ; 1, amplifica-3.1. Isolation of two cDNAs coding for the ATPsulfurylase from Camellia sinensis3. Resultstion by ATP1#-ORF up and down primers; 2, amplification by ATP2#-ORF up

and down primers.homology with the ones in some species such as Solanum tu-berosum (84% identity), Glycine max (80% identity), APS1 ofArabidopsis thaliana (80% identity), Brassica juncea (80%identity). However, it shares only 59.6% identity between de-duced amino acid sequences of Camellia sinensis APS1 andAPS2.

The deduced amino acid sequences of the Camellia sinensisAPS1 and APS2 gene are given below (Fig. 2A). Amino acidresidues of APS1 consisted of 43 strongly basic () aminoacids, 48 strongly acidic () amino acids, 124 hydrophobicamino acids and 70 polar amino acids, Whereas amino acidresidues of APS2 consisted of 58 strongly basic () aminoacids, 54 strongly acidic () amino acids, 159 hydrophobicamino acids and 94 polar amino acids. Sequence analysis ofdeduced amino acid sequences indicated the presence ofa 107-residue amino-terminal sequence in APS1 is not foundin APS2 of Camellia sinensis (underlined in Fig. 2A).

Since higher plants are known to contain multiple forms ofATP sulfurylase [13], we studied two cDNA open readingframes that may encode these isoenzymes (Fig. 2A). The first50 amino acids of the APS2 gene open reading frame ofArabidopsis thaliana (79% identity), APS2 of Arabidthaliana (85% identity) than other species, for example, ymax (soybean) 79%, Allium cepa (onion) (76% identity).cDNA containing APS1 open reading frame and another con-taining APS2 one were cloned by PCR in several steps (seeSection 2.4.1).

Using degenerated primer designed by conservative aminoacid sequences from other plants, two Special DNA fragments(GenBank accession numbers: DQ480335 and DQ480336)amplified by RT-PCR reaction were gained. Their lengthswere respectively 306 and 282 bp (Fig. 1).

Two complete cDNA sequences of APS genes were obtainedby analysis of cDNA 3-end and cDNA 5-end sequences (Gen-Bank accession numbers: EF218618 and EF218619). The de-duced amino acid sequences of APS1 and APS2 are shown inFig. 2A. APS1 is a 1415-bp cDNAwith a 1083-bp open readingframe predicted to encode a 360-amino acid, 40,544-D protein,whereas APS2 is a 1706-bp cDNAwith a 1398-bp open readingframe predicted to encode a 465-amino acid, 51,783-D protein.To identify genes that encode possible ATP sulfurylase, we per-formed database searches. Blast searches in TheNational Centerfor Biotechnology Information (http://www.ncbi.nlm.nih.gov)databases revealed the presence of two possible APS genes inCamellia sinensis.

3.2. Comparison of deduced amino acid sequences intwo cDNAs (APS1 and APS2) of Camellia sinensis withother ATP sulfurylases

The deduced amino acid sequence of APS1 of shows higherhomology with the ones in some species such as Brassica oler-acea var. (85% identity), Medicago truncatula (86% identity),

iochemistry 46 (2008) 731e738Camellia sinensis have features which correspond to a transitpeptide, also suggested for APS1 and APS2 of Arabidopsis

Fig. 2. Alignment of Camellia sinensis APS1 and APS2 amino acid sequences with other eukaryotic ATP sulfurylase. A, The amino acids of the open reading frame

encoded by theCamellia sinensis APS1 and APS2 cDNA are compared to the ATP sulfurylase sequences ofMtr,Medicago truncatula; Ath, Arabidopsis thaliana; Bol,

Brassica oleracea; Osa,Oryza sativa (japonica cultivar-group); Zma, Zea mays; Gma,Glycine max (soybean); Ace, Allium cepa (onion); Stu, Solanum tuberosum (po-tato). Csi,Camellia sinensis; the alignments were obtained using the DNAMANprogram. The full sequences are shown. Roman numerals refer to blocks of homology

discussed in the text. Numbers at the ends of lines indicate the position of the most 30 amino acid relative the start of the protein. * indicates the position of putativetyrosine phosphorylation andY indicates theCamellia sinensis APS2 putative transit peptide cleavage site.Dashes indicate gaps in the sequence to yield the best align-ment. B, Phylogenetic tree (Megalign program, DNAMAN 6.0.40, Lynnon Biosoft Co.) of ATP sulfurylase proteins encoded by genes of APS.

a phosphate-binding loop motif and may be an ATP-bindingregion [11] (Fig. 2A, block III). In addition to these blocks,the APS1 and APS2 of Camellia sinensis coding region con-tains a putative tyrosine phosphorylation site at amino acid167 and 274, asterisked in Fig. 2A, block II. This site con-forms to the consensus motif (R/K) XXX (D/E) XXY (prositeaccession number PS00007) and is also present in the otherhigher eukaryote ATP sulfurylase sequences (Fig. 2A, blockII) to form part of the catalytic site [6]. APS proteins can bedivided into two classes based on sequence similarity. TheCamellia sinensis APS2 protein is a typical class 1 protein,whereas the Camellia sinensis APS1 protein belongs to class2. Interestingly, the alignment in Fig. 2A and a grouping basedon sequence similarity of various APS sequences (Fig. 2B) in-dicate that Camellia sinensis APS2 is much more related in se-quence to class 1 APS proteins such as the putative chloroplastAPS1 from Arabidopsis thaliana than it is to class 2 APS pro-teins [14].

geneitself

Figure 2. (continued)

736 L. Zhu et al. / Plant Physiology and Biochemistry 46 (2008) 731e738thaliana [14,15,17], as this region is rich in hydroxylatedamino acids, contains no acidic amino acids, and has a hydro-phobic Ile residue at position 48 in agreement with the chloro-plast transit peptide cleavage-site motif [7,9]. Additionally, theN-terminal sequence of a chloroplast ATP sulfurylase isoformpurified from spinach (SLIDPDGGSLIDLIVPENER) [21] isidentical for the first 7 amino acids to APS2 amino acids52e58 (underlined in Fig. 2A). Homology of the proposedmature APS2 protein to N-terminal sequence of a spinachchloroplast isozyme suggests its chloroplastic location. How-ever there was no transit peptide structure among APS1 ofCamellia sinensis. Three blocks of homology with functionalfeatures have been proposed for both ATP sulfurylase se-quences. Two conserved blocks (Fig. 2A, blocks I and IV)could be involved in sulfate binding [6]. The third block con-

tains part of the sequence GXXKXG which corresponds to

Fig. 3. SDS-PAGE analysis of expressed proteins derived from APS1 and Aacid sequence of APS2 (51.8 kD derived from thesequence and 19.7 kD expression of pET-32a ()contained).3.3. Properties of pAPS1 and pAPS2 expressingin E. coli

Overexpression in E. coli BL21 (DE3) containing APS1 re-combinant plasmid led to a soluble gene product comprisingabout 30% of the total cellular proteins (Fig. 3A). With timeprolonged, the amount of determinate protein (MW:61.1 kD) expression increased. Its molecular mass was61.1 kD as judged by SDS-PAGE, which is basically in agree-ment with an expected size of 61.4 kD (40.5 kD derived fromthe gene sequence and 20.9 kD expression of pET-32a ()itself contained). A full-length APS2 polypeptide was synthe-sized in E. coli to generate a translation product estimatedto be 70.2 kD (Fig. 3B), close to that of the predicted aminoPS2 cDNA thereof (A and B, respectively) at different inducing time.

tent with extracts of tea leaves. These results indicated that

APS2 genes, therefore, indicates that their molecular masses

s ex

acts

ainin

mbin

3

nd Brecombinants respectively contained cDNAs of ATPsulfurylase.

4. Discussion

ATP sulfurylase, the first enzyme in the sulfate assimilationpathway of plants, catalyzes the formation of adenosine phos-phosulfate from ATP and sulfate. The assimilation of selenateby plants appeared to be limited by its reduction, a step that isthought to be mediated by ATP sulfurylase. Over-expressionof ATP sulfurylase in Indian mustard facilitated the increasedreduction of supplied selenate, showing that ATP sulfurylasemediates selenate reduction and that this enzyme is rate limit-ing for the assimilation of selenate [20].

In this paper we present evidence that the cDNAs APS1 andAPS2 encode ATP sulfurylase in Camellia sinensis. The clon-ing strategy employed to isolate APS1 and APS2 fragments bymaking use of the conservative amino acid sequences of ATPsulfurylase genes to design degenerated primers. Furthermore,the two full length cDNA gene sequences APS1 and APS2were gained through RACE technology. They have respec-The ATP sulfurylase activity assay is linear with time andenzyme concentration up to an A600 of about 0.6. Linearitycan be extended by increasing the development time. The mo-lybdolysis reaction is convenient for crude extracts. The majorobstacles are ATPase activity and, to a greater extent, the tur-bidity that forms when the acidified developer solution isadded. So the crude extracts should be centrifuged beforeassay.

ATP sulfurylase activity was measured in extracts of E. coliBL21 (DE3) clone carrying two cDNAs grown in liquid me-dium and Camellia sinensis leaves (Table 1). ATP sulfurylaseactivity of extracts from E. coli BL21 containing APS1 andAPS2 recombinant plasmid respectively reached 0.453 and0.628 mmol ppi min1 mg1 protein. Yet ATP sulfurylase ac-tivity was lowered to a nearly undetectable level in E. coliBL21 which had no recombinant plasmid. Crude extracts ofleaves also had high the enzyme activity. The expression prod-uct of both recombinant cDNAs posed enzyme activity consis-

Table 1

ATP sulfurylase activity of expression in E. coli BL21 (DE3) and crude leave

ATP sulfurylase activity Extracts from E. coli BL21 Extr

cont

reco

mmol ppi min1 mg1 protein 0.0036 0.45

L. Zhu et al. / Plant Physiology atively 1415 and 1706 bp.Our analysis of APS1 and APS2 of Camellia sinensis re-

vealed that APS2 likely encodes the chloroplast form of ATPsulfurylase based on the similarity of its predicted amino-ter-minal sequence with chloroplast transit peptides [14]. Chloro-plast ATP sulfurylase is known to be the predominant form ofthe enzyme in leaves of several higher plants [22]; for exampleit constitutes 84% of the total ATP sulfurylase enzyme activityin leaves of spinach [16]. ATP sulfurylase is also present in thewere respectively 61.1 and 70.2 kD as judged by SDS-PAGE,both of which were basically in agreement with the expectedsizes. The APS1 and APS1 genes were successfully expressedin E. coli, which provided a means to explore characteristicsof the enzymes.

The recombinant Camellia sinensis ATP sulfurylase ex-tracts prepared from E. coli contained significantly higher en-zyme activity than those of crude extracts from the planttissues. This suggested that two cDNAs isolated from Camel-lia sinensis, coding for the APS enzyme, can be efficiently ex-pressed, and they possessed high activity. Thus, the datademonstrated that the isolated APS1 and APS2 of Camellia si-nensis encoded ATP sulfurylase. Simultaneously, the expres-sion of them in E. coli provided a means to exploreselenium assimilation in vitro in the future (this aspect ofthe work needs to be studied further).

References

[1] J.W. Anderson, Selenium interactions in sulfur metabolism, in: L.J. de

Kok (Ed.), Sulfur Nutrition and Assimilation in Higher Plants: Regula-

tory, Agricultural and Environmental Aspects, SPB Academic Publish-

ing, The Hague, The Netherlands, 1993, pp. 49e60.

[2] F. Ausubel, R. Brent, R.E. Kingstone, D.D. Moore, J.A. Smith,

J.G. Seidman, K. Struhl (Eds.), Current Protocols in Molecular Biology,

Greene Publishing Associates and Wiley Interscience, New York

Laemmli, UK, 1993.

[3] C. Brunold, M. Suter, Localization of enzymes of assimilatory sulfate re-

duction in pea roots, Planta 179 (1989) 228e234.

[4] H. Cherest, P. Kerjan, Y. Surdin-Kerjan, The Saccharomyces cerevisiaecytosol of leaves [16] and in roots, where a single form of ATPsulfurylase is localized exclusively in proplastids [3]. Leusteket al. (1994) classified ATP sulfurylase proteins in two groupsbased on sequence similarity [14]. APS2 of Camellia sinensisis grouped in class 1 (Fig. 2B). It shares 80% sequence simi-larity with a close homolog, APS1 of Arabidopsis thalianathought to be a chloroplast ATP sulfurylase. However APS1is short of a chloroplast transit peptide sequence. PerhapsATP sulfurylase encoded by it is present in the cytosol oftea plant leaves.

Analysis of expressed proteins derived from the APS1 and

tracts of Camellia sinensis

from E. coli BL21

g APS1

ant plasmid

Extracts from E. coli BL21

containing APS2

recombinant plasmid

Crude extracts

of leaves

0.628 0.354

737iochemistry 46 (2008) 731e738MET3 gene: nucleotide sequence and relationship of the 50 non-codingregion to that of MET25, Mol. Gen. Genet. Mol. 210 (1987) 307e313.

[5] M.P. de Souza, E.A.H. Pilon-Smits, C.M. Lytle, S. Hwang, J. Tai,

T.S.U. Honma, L. Yeh, N. Terry, Rate limiting steps in Se assimilation

and volatilization by Indian mustard, Plant Physiol. 117 (1998) 1487e

1494.

[6] B.A. Foster, S.M. Thomas, J.A. Mahr, F. Renosto, H.C. Patel, I.H. Segel,

Cloning and sequencing of ATP sulfurylase from Penicillium chrysoge-

num. Identification of a likely allosteric domain, J. Biol. Chem. 269(1994) 19777e19786.

[7] Y. Gavel, G. von Heijne, A conserved cleavage-site motif in chloroplast

transit peptides, FEBS Lett. 261 (1990) 455e458.

[8] M. Kato, K. Mizuno, T. Fujimura, M. Lrie, A. Crozier, H. Ashihare, Pu-

rification and characterization of caffeine synthase from tea leaves, Plant

Physiol. 120 (1999) 579e586.[9] K. Keegstra, L.J. Olsen, S.M. Theg, Chloroplastic precursors and their

transport across the envelope membranes, Annu. Rev. Plant Physiol.

Mol. Biol. 40 (1989) 471e501.[10] U.K. Laemmli, Cleavage of structural proteins during the assembly of the

head of bacteriophage T4, Nature 277 (1970) 680e685.

[11] A. Lauchli, Selenium in plants: uptake, functions, and environmental tox-

icity, Bot. Acta. 106 (1993) 455e468.[12] B.E. Laue, D.C. Nelson, Characterization of the gene encoding the auto-

trophic ATP sulfurylase from the bacterial endosymbiont of the hydro-

thermal vent tubeworm Riftia pachyptila, J. Bacteriol. 176 (1994)

3723e3729.[13] P. Lerouge, P. Roche, C. Faucher, F. Maillet, G. Truchet, J.C. Prome,

J. Denarie, Symbiotic host-specificity of Rhizobium meliloti is deter-

mined by a sulfated and acylated glucosamine oligosaccharide signal,

Nature 344 (1990) 781e784.

[14] T. Leustek, M. Murillo, M. Cervantes, Cloning of a cDNA encoding ATP

sulfurylase from Arabidopsis thaliana by functional expression in Sac-

charomyces cerevisiae, Plant Physiol. 105 (1994) 897e902.[15] H.M. Logan, N. Cathala, C. Grignon, J.C. Davidiang, Cloning of a cDNA

encoded by a member of the Arabidopsis thaliana ATP sulfurylase multi-

gene family, J. Biol. Chem. 271 (1996) 12227e12233.

[16] J.E. Lunn, M. Droux, J. Martin, R. Douce, Localization of ATP sulfury-

laise and O-acetylserine (thio) lyase in spinach leaves, Plant Physiol. 94

(1990) 1345e1352.

[17] M. Murillo, L.T. Michael Murillo, T. Leustek, Adenosine-50-triphos-phate-sulfurylase from Arabidopsis thaliana and Escherichia coli are

functionally equivalent but structurally and kinetically divergent: nucle-

otide sequence of two adenosine-50-triphosphate-sulfurylase cDNAsfrom Arabidopsis thaliana and analysis of a recombinant enzyme,Arch. Biochem. Biophys. 323 (1995) 195e204.

[18] B.H. Ng, J.W. Anderson, Light-dependent incorporation of selenite and

sulphite into selenocysteine and cysteine by isolated pea chloroplasts,

Phytochemistry 18 (1979) 573e580.

[19] T. Osslund, C. Chandler, I.H. Segel, ATP sulfurylase from high plant,

Plant Physiol. 70 (1982) 39e45.

[20] E.A.H. Pilon-Smits, S. Hwang, C.M. Lytle, Y.L. Zhu, J.C. Tai,

R.C. Bravo, Y.C. Chen, T. Leustek, N. Terry, Overexpression of ATP sul-

furylase in Indian mustard leads to increased selenate uptake, reduction,

and tolerance1, Plant Physiol. 119 (1999) 123e132.

[21] F. Renosto, H.C. Patel, R.L. Martin, C. Thomassian, G. Zimmerman,

I.H. Segel, ATP sulfurylase from higher plants: kinetic and structural

characterization of the chloroplast and cytosol enzymes from spinach

leaf, Arch. Biochem. Biophys. 307 (1993) 272e285.[22] A. Schmidt, K. Jager, Open questions about sulfur metabolism in plants,

Annu. Rev. Plant Physiol. Plant Mol. Biol. 43 (1992) 325e349.

[23] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTALW: improving the

sensitivity of progressive multiple sequence alignment through sequence

weighting, position-specific gap penalties and weight matrix choice, Nu-

cleic Acids Res. 22 (1994) 4673e4680.

[24] A.M. Zayed, C.M. Lytle, N. Terry, Accumulation and volatilization of dif-

ferent chemical species of seleniumby plants, Planta 206 (1998) 284e292.[25] A.M. Zayed, N. Terry, Selenium volatilization in broccoli as influenced

by sulfate supply, J. Plant Physiol. 140 (1992) 646e652.

738 L. Zhu et al. / Plant Physiology and Biochemistry 46 (2008) 731e738

Cloning of two cDNAs encoding a family of ATP sulfurylase from Camellia sinensis related to selenium or sulfur metabolism and functional expression in Escherichia coliIntroductionMaterials and methodsStrains of bacteria and mediaEnzyme and biochemical reagentsPlant materialcDNA cloningSpecial DNA fragments amplification by RT-PCR reactionTwo full length cDNAs encoding ATP sulfurylase acquired by RACE-PCR

Functional expression in E. coli strain BL21Construction of overexpression plasmidsConstruction of vectors for constitutive expression in E. coliOverproduction of the APS1 and APS2 gene product from E. coli

Database searches and sequence alignmentsPreparation of a crude extractSDS-polyacrylamide gel electrophoresis proceduresATP sulfurylase assay

ResultsIsolation of two cDNAs coding for the ATP sulfurylase from Camellia sinensisComparison of deduced amino acid sequences in two cDNAs (APS1 and APS2) of Camellia sinensis with other ATP sulfurylasesProperties of pAPS1 and pAPS2 expressing in E. coli

DiscussionReferences