ICANCERRESEARCH55. 748-752.February15,19951

Advances in Brief

Characterization of the Functional Specificity of a Cloned T-Cell ReceptorHeterodimer Recognizing the MART-i Melanoma Antigen

David J- Cole,' Daniel P. Weil, JoelShilyansky,Mary Custer,Yutaka Kawakami, StevenA. Rosenberg,andMichael I. Nishimura

Surger@'Branch, National Cancer Institute. NIH, Bethesda. Maryland 20892

because it is specifically recognized on melanoma cells by the largemajority of IlL cultures (15). Additionally, the MART-i antigenpresenton normal melanocytesis recognizedby T cells (12). Identification of the immunodominantMART-i peptide presentedin thecontext of the MHC class I now makes it possible to isolate T-cell

clonesand their ICR specificitiesfor this MART-i epitope(15—17).The isolation and expansion of tumor reactive T-cell clones can be

difficult, with the majority having a limited life in culture. As a result,

their use in vitro, or therapeutic applications in vivo, are restricted.This study was undertakento develop a tumor-reactivereagentbyidentifying and cloning a functional melanoma-reactiveTCR thefunctionof which couldbe transferredto alternatecell lines.JurkatTcells were transfected with the cDNAs encoding for the full-length aand @3TCR chainsderivedfrom a previouslycharacterizedHLA-A2-restricted, melanoma-reactive T-cell clone, clone 5 (18). Cells subse

quently expressingclone 5 TCR on the cell surface were able torecognize MART-i peptide in a pattern and sensitivity equivalent to

native MART-i-reactive T-cells when presentedby T2 cells. Thisreport is the first successfulreconstitutionand characterizationof afunctional TAA specific T-cell receptor heterodimer in an alternate

cell line. The cloning of functional TCR genes which are capable ofspecificallyrecognizingMART-i antigencan provide reagentswithwhich to study the mechanismsof T-cell/tumor antigen interaction,facilitate studiesrequiring detection of the MART-i antigen, andcouldleadtonovelimmunotherapeuticstrategiesfor treatingpatientswith melanoma.

Materials and Methods

Cell Lines. Melanomacell lines397 mel, 501 mel, 624 mel, 888 mel(established in the Surgery Branch, NC!) as described by Topalian et a!. (6)andT2 cells(15) weremaintainedin RPMI with 10% F@S.624 mel wasclonedin limitingdilutionandscreenedvia FACSanalysisusingHLA-A2-specific mAb BB7.2 (ATCC, Rockville, MD) for high (624 mel@)and MHCclassI antigen-negative(624 mel) clones.3The JurkatT-cell line (ATCC)was maintained in DMEM with 10% FCS. Three CD8@ ilL lines weregeneratedfrom tumor biopsiesof patientswith metastaticmelanomaasdescribed previously (2). Melanoma antigen specificity for ilL 1235 (MART-i)andilL 1200(gplOO)havebeendescribedpreviously(12, iS).

PeptideSynthesis.Peptides(kindlyprovidedbyDrs.K. SakaguchiandE.Appella,NIH) weresynthesizedby a solidphasemethodusinga multiplepeptidesynthesizer(GilsonCo.,mc,Worthington,OH) andpurifiedby HPLCon a C4 column(VYDAC, Hesperia,CA) with 0.05% trifluoroaceticacid/water-acetonitrile. The MART-i series peptides are located in a hydrophobicputative transmembranedomain in MART-I (15). The sequence of theMART-i peptides used in this study are as follows: MART-i(@.@) (TFAEEAAGI); MART-i(27.35) (AAGIGILTV); MART-1(32.@) (ILTVILGVL);MART-1(@..35) (EAAGIGILTV); and MART-i(27..@) (AAGIGILTVI). The10-amino acid peptides MART-1(@_3s)and MART.1(27.@)contain the9-aminoacidminimal determinantMART-i(27_35),with MART-1(26_35)haying an additional glutamic acid at its NH2 terminus and MART-i(27_se) having

3 L. Rivoltini, unpublished data.

Abstract

T cellscanplaya centralrole In the immuneresponseto cancer,withtumor-specific T-lymphocyte reactivity provided by the T-cell receptor(TCR) a and fi chainheterodimer.This studyis the first reportof thedefinitive identification and characterization of a functional tumor-associated, antigen-specificTCR by reconstitution in an alternate cell line.Jurkat T cells were transfected with the cDNAs encoding the full-length aand @3T-cell receptor chains from the HLA-A2 restricted, melanomareactive T-cell clone, clone 5. Expression of the transfected TCR wasevaluated by immunofluorescence after down-modulation of the endogenous receptor with Jurkat T-cell receptor fJ chain-specific mAb. Jurkatclone5 TCR@cellsrecognizedMART-I peptidespresentedbyT2 cellsina pattern and sensitivity equivalent to native MART-i-reactive T.cells.RecognitionofRLA.A2+ melanomacell linesby theJurkat clone5 TCR@cells, however, did not occur without the addition of exogenous MART-ipeptide. The cloning and expressionof functional TCR geneswhich arecapable of specifically recognizing MART-i antigen provides reagentswhichcouldbe usedfor the studyof the mechanismsof T-ceWtumorantigen interactions and creates Immortalized reagents which can factOtate studies requiring detection of the MART-i antigen. The tumor reactivity provided by thesegenescould alsohaveapplication in novel immunotherapeutic strategies for treating patients with melanoma, includingredirection of tamor-infiltrating lymphocyte specificity and bone marrowstem cell therapy.

Introduction

The adoptive transfer of TIL2 with IL-2 can mediate tumor regression in select patients with metastatic melanoma (1—3).ilL arecapableof MHC-restricted recognitionof autologousand allogeneicmelanoma cells in vitro (4—6),thus suggestingthe recognitionofcommonlyexpressedTAA. Therefore, it is clear that T lymphocytesare capableof playing a significantrole in the immune responsetomelanoma, although the clinical application of TAA is still beingdefined.

Antigen specific T-lymphocyte reactivity is provided by the TCR aand @3chainheterodimerandoccursvia bindingof theTCR to a shortpeptide fragment, derived from an antigenic protein, presented in thecontext of an MHC molecule (7, 8). Recently, several commonmelanoma antigens recognized by T lymphocytes havebeen identified(9—14).Theseantigensarepresentinthemajorityofmelanomacelllines and are also expressed in normal melanocytes (tyrosinase,gplOO, and MART-i) or testes (MAGE-1 and MAGE-3). Amongthese, the MART-i antigen appears to be one of the most prevalent

Received10/24/94;accepted1/9/95.The costsof publicationof this articleweredefrayedin partby thepaymentof page

charges.This articlemustthereforebe herebymarkedadvertisementin accordancewith18U.S.C.Section1734solely to indicatethis fact.

I To whom requests for reprints should be addressed, at Medical University of South

Carolina,Departmentof Surgery,Room420 tSB, 171Ashley Ave., Charleston,SouthCarolina29425-2270.

2 The abbreviations used are: ilL, tumor-infiltrating lymphocytes; IL, interleukin;

TAA, tumor-associatedantigens;ICR, 1-cell receptor;ATCC, AmericanType CultureCollection.

748

Research. on October 12, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

RECONSTITUTIONOF MART-I-SPECIFICTCR

an extra isoleucine at its COOH-terminus. Peptide gpi00(457_4(@5)(LLDGTATLRL) and @100(@5(J@58)(YLEPGPVTA) were derived from gplOO asdescribed (13, 14).

DNA Constructs. Full-lengthTCR a and @3genes were amplifiedby PCRfrom a A phageilL clone 5 cDNA library (18). Val 5' (C1'CGAGGTTCAGCCATGCTCCTGG), Ca 3' (GATGGCGGAOGCAGTCfCFG) (19),V@7 5' (CTCGAGAGCATGGGCTGCAGGCFG), and Cf32 3' (AAAGGAT

@ primers were used for the amplifi

cationasdescribed(18). ResultantPCR DNA fragmentswere thenclonedintotheT/A vectorPCRH (Invitrogen,SanDiego,CA). The Va! genewasthenligated into the pCDNA3 expression vector (Invitrogen, San Diego CA)containing the neomycin resistance gene and a cytomegalovirus eukaryoticpromoter, and the Vf37 gene was ligated into a modified pCDL expressionvectorcontainingtheSRa promoter(courtesyof R. Klausner,NIH, Bethesda,MD; Ref. 20). Resultantcloneswerescreenedby PCR usingTCR-speciflccloning primersand sequencedusingthe dideoxynucleotidechain-terminationmethodwith 17 DNA polymerase(Sequenase2.0; USB, Cleveland,OH) asdescribed (21).

FACSAnalysis.JurkatTCR V/38-specificmAbC305.2(Ref.22;courtesyof A. Weiss,HowardHughesMedicalInstitute,Universityof California-SanFrancisco, San Franscisco, CA), goat-anti-mouse IgGi (Becton Dickinson, SanJose, CA), goat anti-mouse IgG-FITC (Becton Dickinson), anti-Leu-4 (CD3;Becton Dickinson), W6/32 (anti-HLA-A, -B, and -C) (Sera-Lab,Sussex,England),and anti-TCR-1(BectonDickinson) were usedfor comodulationexperimentsasdescribedpreviously(23). Briefly, 1 X 106Jurkattransfectantswere incubatedfor 12 h at 37°Cwith or without 100 @lof C305.2mAbsupernatant.Subsequently,the cell lines were washedthree times with FACSbuffer (PBS containing5% FCS and 0.05% sodium azide) and restainedwithC305.2 to verify the down-modulation of autologous TCR. Subsequent staining was performed with anti-CD3 or anti-TCR antibody to demonstratethepresenceof transfectedTCR heterodimerson the cell surface.HLA-A2-specificmAb BB7.2 (ATCC, Rockville MD) was usedto identify high and lowclassI-expressingtumorclonesasdescribed.

Transfections. Jurkat cells were transfectedvia electroporation(250 V.800 mF) using20 @tgof plasmidDNA (2 @tgof pCDNA3 TCRa neomycinselectableplasmid and 18 @gof pCDL TCR @3plasmid) and 1 X iO@cells ina totalvolumeof 250 ,.d PBS.The cellswerethenincubatedat 37°Cinsix-well plates containing 5 ml DMEM and 10% FCS. After 12 h, G418(GIBCO-BRL, Grand Island, NY) was added at a concentration of 1 mg/ml.Four days later, viable cells were isolatedover a Ficoll gradient(OrganonTeknika,Durham,NC) andculturedin T-75 flasks(Nunc, Inc., Napierville,IL). The media was then changed weekly until neomycin-resistant cells grewto adequate numbers for testing (approximately 1 X i0@ cells at 3 weeks).Followinginitialselection,theconcentrationof G418 wasloweredto 400

@Wml.Jurkattransfectantswereclonedby limitingdilutionat 1 cell/wellandscreenedfor IL-2 productionby ELISA asdescribed.

AntigenRecognitionAssays.T2 cellspreincubatedfor 2 h withpeptidewere washedtwo times with PBSand then addedto effector cells at a 1:1ratio for a total of 1 X 106cells/ml in a 48-well plate. Phorbol myristateacetate(5 ng/ml; SigmaChemicalCo., St. Louis, Mo.) wasaddedto wellscontaining Jurkat effector cells. The ability of the peptide-pulsedT2 cellsto stimulate cytokine releasefrom Jurkat transfectantsor ilL was thenassessedby ELISA (RD systems, Minneapolis, MN). Jurkat transfectantswere assessedfor recognitionof melanomatumor lines by incubatingwithHLA-A2-positive (501 mel and624 mel@)or HLA-A2-negative (397 mel,624 mel, and 888 mel) tumor cells in a 48-well plate for 12 h at a 1:1 ratiofor a totalof 1 X 106cellsin 1 ml of media.TIL lines1235and1200wereusedundersimilar conditionsaspositive controls.The ability of the tumorto stimulate cytokine release from Jurkat transfectants or TIL was thenassessedby ELISA (RD Systems).

Results

Cell Surface Expression of Clone 5 TCR. Since Jurkat cellsexpressendogenousTCR and no subfamily-specific antibodies areavailable which specifically stain either the a or f3 chains of theclone 5 TCR (Val and Vf37), a more involved method wasrequired to measurethe surfaceexpressionof the transfectedTCR.Jurkat clone 5 TCR bulk transfectant cell lines and transfected

Jurkat clones 13 and 22 were incubated overnight with or withoutJurkatTCR f3chain-specific mAb C305.2 (V@8) to down-modulatethe expression of endogenousTCR. The resultant cultures werethen washed at 4°Cin FACS buffer containing 0.05% azide, toprevent reexpression of the endogenousTCR, and stained withpan-specific anti-TCR-1, anti-HLA-A2, or anti-CD3 mAbs. All ofthe cultures incubated with C305.2 showed down-modulation ofthe endogenousreceptor, as indicated by the lack of staining withC305.2 (Fig. 1C). Comparison of the transfected to nontransfected

Jurkat cell lines, after down-modulation of endogenousreceptoronthe cell surface, demonstrateda persistentexpressionof both CD3and TCR in the clone 5 TCR-transfected cell lines (Fig. 1, A andB). Pretreatment with C305 mAb had no effect on the level ofMHC class I expression on any of the Jurkat lines tested (data notshown). Chimeric receptorsconsistingof endogenousa chain andclone 5 fJ chain must, however, be considered in the postcappingTCR population expressedon the cell surface. The actual expression on the cell surface of complete clone 5 TCR receptor, therefore, is probably lower than the TCR surface expression demonstrated by this technique. These results demonstrated the surfaceexpression of the transfected TCR @3chain in Jurkat cell linestransfectedwith clone 5 TCR genes.

Clone 5 TCR Recognition of MART-i Peptide. ilL clone5 hadbeenshownpreviouslyto be capableof recognizingHLA-A2@ melanoma (18). Unfortunately, the cells no longer exist and, therefore,werenot availablefor testingto definethespecificmelanomaantigenwhich clone 5 recognizes. To date, however, every melanoma ilLculture testedhas recognizedeither MART-i or gplOO antigens(orboth; Ref. 15). Additionally, we have previously reporteda MART1-reactive T-cell clone, A42, derived from the same parental TIL lineasclone 5, which sharesthe same V(37 subfamily as the clone 5 TCR.It was reasonableto anticipatethat the ICR would be eitherMART-ior gplOO specific. Initial screening was performed to determinewhether the clone 5 TCR complex expressedon the cell surface wasa functional heterodimerand to elucidatewhich melanomaTAA itwas capableof recognizing.Jurkatbulk transfectantswere stimulatedwith T2 cells preincubatedwith different MART-i [MART-i(22_30),MART-i(27_35), MART-1(32_40), MART-1(26_35), or MART-i(27_36)]or gplOO [gplOO(457_465)]peptides.ilL 1235 and ilL 1200 wereused as positive controls. ilL 1235 recognized MART-1(27_35),MART-1(26_35), and MART-1(27_36), and ilL 1200 recognizedgniOO(457465). The ability of peptide-pulsed T2 cells to stimulate

IL-2 release from Jurkat cells or granulocyte/macrophage-colonystimulating factor release from ilL was then assessedby ELISA.Jurkat bulk transfectantcells were cloned by limiting dilution toisolate a pure population of Jurkat TCR@ cells with 8 of 28 clonesscreening positive for IL-2 production. The clones with the highestlevel of stimulatedIL-2 production(clones 13 and 22) were chosenfor use in further assays.

Jurkat clone 5 TCR transfectantsspecifically recognizedT2 cellspulsed with the MART-1(27_35)peptide, as shown in Table 1. Jurkatclone 5 TCR@ cell line recognition patterns of MART-1(27_35)peptides were similar to several MART-i-specific ilL lines, including ilL 1235, which showed recognitionof MART-i peptidesMART-i(27_35), MART-1(26...35), and MART-i(27_36) (Table 1; Ref.14). By contrast, ilL A42 (derived from the sameparental TIL cultureas clone 5) and ilL 1E2 were capable of recognizing MART-ipeptidesMART-i(27_35) and MART-1(26...35)but not MART-i(27_36)(which contains the MART-1(27_35)sequencehaving an extra isoleucine at its COOH-terminus; Ref. 17). Characterization of the sensi

tivity of peptiderecognitionby theJurkatclone5 TCR@ cell lineswasperformed using T2 cells preincubated with a MART-i peptide

dilutedover a rangeof 50 mr@ito 640 pM.The concentrationof peptide749

Research. on October 12, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

Table1 Humanclone5 TCRepitopemapTheabilityofpeptide-pulsedT2cellstomediatecytokinereleasefromnontransfected(JRTNEO),bulkICR clone5-transfected(JRTBULK),andclone5transfectantTCR+clonal(clone13andclone22)JurkatcellswasassessedviaELISA.Priorto theassay,T2cellswereincubatedfor 2 h withMART-i [MART-l(@se@,MART1@@ MART1(@,@,

MART-1(@3@, or MART-1(@se)] or gplOO [gp100(457@)J peptides at a concentration of2.5 @i.As positive controls, HLA-A2-restricted i'lL 1235 and ilL 1200, whichrecognizeMART-iepitopesMART-1(27..35),MART-1(@35@,MART-1(nse)orgplOOepitopegp100(4574455@,respectively,wereassayedbygranulocyte/macrophage-colony-atimulatingfactorrelease

for recognition.Responder

cellsIL-2

(pg/mi) GM-cSP°(pg/mi)Stimulator

cell line Peptide(2.5 @mol) None JRTNEO JRTBULK Clone13 aone 22 ‘IlL1235 ilL1200None

None <10 <10 <10 <10 <10 <10<10NoneMART4(fl.31J) <10 <10 <10 <10 <10 15<10NoneMART-1(27_35) <10 <10 <10 <10 <10 <10 22

None MART-1(3@) <10 <10 <10 <10 <10 <10 <10None MART-1(@.35) <10 <10 <10 <10 <10 <1021None

MART-1(27_se) <10 <10 <10 <10 <10 <10<10Nonegp1O0(457..@ <10 <10 <10 <10 <10 <10 <10

‘1@2 None <10 <10 <10 <10 <10 <1021T2

MART-1(@@) <10 <10 <10 <10 <10 21 <10T2 MART-1(27_3$) <10 <10 944 1511 4760 11900 19T2 MART-1(3@) <10 <10 <10 <10 <10 <10 <10T2 MART1(55,..35) <10 <10 695 1150 4060 6710 23T2 MART-1(27_@) <10 <10 11 84 469 614 19‘1@2 gp100(4s7.@) <10 <10 <10 <10 <10 27240a

GM-cSF, granulocyte/macrophage-colony-stimulating factor.

RECONSTITUTIONOF MART-1.SPECIFICICR

A. Neo BULK CLONE13 CLONE22

B.

ANTI.TCRmAbC.

lol 1O2 iO@ 1Ô4 iO@ iO@ 1O2 iO' i@

C305.2 mM

Fig. 1.Immunofluorescentanalysisofclone 5 TCR-transfected(bulk,clone13,andclone22)andnontransfected(neo)Jurkatcell lines.Jurkattransfectants(1 X 10@)wereincubatedfor 12h at37°Cwith(representedbysolid-linehistograms)orwithout(representedbydotted-linehistograms)100p.1of JurkatICR@ chain-specificmAbQ305.2supernatant.Allfourcelllineswerethenrestainedwith:(A) anti-CD3mAb;(B) pan-specificanti-ICR-imAb;and(C) C305.2mAb(toverifythedown-modulationof autologousTCR).

requiredto provide50% of maximal IL-2 stimulationwasin therangeof 50—200nM(Fig. 2). As would be expected,bothcloneswere moresensitive to peptide that the bulk cell line alone.

Clone 5 TCR Recognition of Melanoma Cell Lines. Havingdefinedthe MART-i specificity of clone 5 TCR, we next evaluatedthe ability of Jurkat clone 5 TCR@cell lines to recognize MART-i-positive melanoma tumor cells. Monoclonal Jurkat clone 5 TCR@cells were, therefore,testedfor their ability to recognizeHLA-A2@melanomacell linesusingthe sameconditionsfor cytokinereleaseasthe T2 cell assay. However, recognition of tumor by the Jurkat celllines did not occur(Table 2). Sincethe level of HLA-A2 expressionand amountof MART-i peptideavailable on the tumor cell surface

are factors which could affect the ability of Jurkat clone 5 TCR@cellsto recognizetumor,we alteredthe assayconditionsto improve theseparameters. A 10-fold increase in the number of tumor cells/well orup-regulation of tumor class I expression using a 48-h preincubation

with IFN--y(verified by FA@.Sanalysis; data not shown) did not resultin stimulationof Jurkatsignaling.Only after loading the tumor cellswith relevant peptide by preincubating them for 2 h withMART-i(27_35) did a modest level of recognition by the Jurkat TCR@clonesoccur (Table 2). Thus, in contrastto ilL, monoclonalJurkatclone5 TCR@cell linesareunableto recognizeendogenousMART-iantigenon HLA A2@tumorcellsaswell aswhenit is pulsedontoT2 cells.

750

Research. on October 12, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

Table2 JurkatTCRrecognitionoftumorTheabilityofpeptide-pulsedT2cellstomediatecytokinereleasefromnontransfected(JRTNEO),bulkTCRclone5-transfected(JRTBULK),andclone5transfectantTCR+clonal(Clone13andClone22) Jurkatcellswasassessedvia ELISA. Prior to theassay,tumoror T2 cellswereincubatedfor 2 h with MART-1(27.35)peptideat a concentrationof 2.5@.tM.As

a positivecontrol,H1.A-A2-restrictedilL 1235,which recognizesMART-1(27_35),was assayedby GM-CSFrelease.Responder

cellsIL-2

(pg/mi) GM-CSF―(pg/ml)

Stimulatorcell line Peptide(2.5 @.nnoI) HLA A-2.1 None JRT NEO JRT BULK Clone22 ilL1235None

None <10 <10 23 49<10NoneMART-1(fl_35) <10 <10 <10 66<10T2None + <10 31 <10 4966T2MART-1(27_35) + <10 17 1997 13502 1497

397 None — 12 21 <10 48<10888None — 16 <10 <10 <10<10624—None — <10 <10 <10 41<10624+None + <10 <10 13 62557501None + 13 <10 <10 61486397MART-1(27_35) — <10 <10 <10 99 <10

888 MART-1(27_35) 20 <10 <10 75 35624— MART-1(27_35) <10 <10 <10 14 24624+ MART-1(27_35) + <10 <10 <10 428 448501 MART-1(27_35) + <10 <10 <10 540635751

REcONSTITUTIONOF MARl-i-SPECIFICICR

the reconstitutionand characterizationof a functional tumor antigenreactiveTCR heterodimerin an alternatecell line. The transferof theTCRfroma melanoma-reactiveclone(clone5) toJurkatcellshasenabledus to immortalize the reactivity of clone 5 and to determinewhich TAA it recognized.Jurkattransfectantsexpressingthe clone5TCRrecognizedthesameMART-i peptidesasthebulkilL (Table1). Even thoughclones5 andA42 were derivedfrom thesamepatient,usedthe same V@3subfamily gene (V@37),and recognizedthe sameMART-i 9-mer (MART-1(27_35);Ref. 17), they had slightly differentfine specificity. Although both clones recognized the MART-i 10-mer, MART-i(26_35), only clone 5 recognizedMART-1(27_36)(bothiO-merscontain the core MART-i(27_35)minimal determinant,withMART-1(26_35)having an extra glutamic acid at its NH2 terminus andMART-1(27_36) having an extra isoleucine at its COOH-terminus).These Jurkat transfectantswere sensitiveenoughto discernthe fineepitopespecificityof thesetwo relatedTCR. Given thelimited abilityto expand tumor-reactiveT-cell clones, transfer of TCR genes intoJurkat cells may provide a useful method to immortalize tumorreactive T-cell clones in order to identify and characterizethe finespecificityof theseclones.

Stimulation of clone 5 Jurkat cells by MART-i(27_35)-pulsed T2cells, but not by melanoma cells, suggeststhat there is more toactivationof theJurkatTCR transfectantsthantheTCR-peptide-MHCinteraction. Cell surface TCR density may be a critical factor in theability of the cell to recognizemultiple HLA plus peptidecomplexeson the target cell simultaneously. Although there is approximately a10-fold difference(Fig. 1) in surfaceexpressionof endogenousversustransfected TCR in the Jurkat clones, the actual level of expression offunctionalclone5 TCR heterodimersis unknownandprobablylowerthanindicatedby the FACS analysis.It is possiblethat the expressionof high levels of homogeneousMHC-peptide complexesby T2 cellsallows for recognitionandactivationby a T cell with fewer receptorsbut not with a more complex array of MHC-peptide presentationrepresentedby the tumor cell. This premise is supportedby theobservationthatHLA-A2@ melanomacellswere able to stimulatetheclone5 Jurkatcells after preincubationwith the MART-i(27_35) peptide (Table 2), presumably due to an increasednumber of TCRspecificMHC-peptide complexesexpressedon the tumorcell surfacepostincubation.

A low level of TCR receptorsurfaceexpressionitself, however,cannot completely account for the inability of tumor cells to stimulatethe Jurkat transfectants.12 cells pulsedwith MART-i(27.35)at concentrationsas low as 5—10nM can stimulate the Jurkat clones to

I@1 —..-— Jurkat bulk

10000100000

—.--- Jurkat clone 13

—.-— Jurkat clone 22

Fig.2. Graphicrepresentationof IL-2 productionby clone5 TCR transfected(bulk,clone13,andclone22)Jurkatcelllinesatvaryinglevelsof peptideconcentration.Thesensitivityof JurkatICR transfectantresponseto antigenstimulationwas assessedbyperforminga seriesof5X serialdilutionsofthe immunodominantM9—2peptide(startingwith a maximumconcentrationof 50 mM)pulsedonT2 cellsandsubsequentlyevaluatingtheabilityoftheT2cellstomediateIL-2releasefromtheJurkatcells.Relativesensitivitywasdeterminedfromdeterminingtheconcentrationofpeptiderequiredtoattain50%ofmaximalcytokineresponse.

Discussion

The recentcloningof severalmelanomaTAA hasmade it possibleto identify the epitopes being recognizedby ilL from melanomapatients (9—14). Since ilL are a heterogeneous population of T-cells,

it hasbeendifficult to identify theT-cell clonotypeswithin a bulk ilLculture which recognize tumor antigen and mediate the antitumorresponsesobserved in vivo (24). The only current way to determinewhich T cellscontributeto the recognitionof tumorcells in vitro andin vivo would be through the study of T-cell clones (17, 18, 24, 25).

Although it has been possible to isolate melanoma-reactive T-cell

clonesfor TCR V geneusage(17, 18, 24, 25) and in vitro specificitystudies (17), we have been unable to expandany of theseclonessufficiently for in vivo studies. It has been impossible, therefore, todetermine which T-cell subpopulation(s) in a bulk ilL culture wasresponsiblefor the tumor regressionsobservedin vivo or to possiblygeneratenew therapiesbasedon theseT cells.

We have recently reported the identification of the TCR V-J andV-D-J sequences from several melanoma-reactive T-cell clones(17, 18). However, many of these T-cell clones were no longeravailable to determine their specificity. This study is the first report of

Peptide molarity (nM)

Research. on October 12, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

RECONSTITUTION OF MARI-1-SPECIFJC ICR

9. VanderBruggen,P.,Traversari,P.C.,Cbomez,P.,Lurquin,C.,DePlaen,E.,VandenEynde,B., Knuth,A., andBoon,T. A geneencodingan antigenrecognizedbycytolytic T lymphocyteson a humanmelanoma.Science(WashingtonDC), 254:1643—1647,1991.

10. Brichard,V., Van Pd, W., Wolfel, I., DePlaen,E., Lethe,B., Coulie,P.,andBoon,T. 1993.ThetyrosinasegenecodesforanantigenrecognizedbyautologouscytolyticI lymphocytes on HI.A-A2 melanomas. J. Exp. Med., 178: 489—495,1993.

11. GauglerB., VandenEynde,B., VanderBruggen,P.,Romero,P.,Gaforio,J.J.,DcPlaen,E., Lethe,B., Brasseur,F., andBoon,T. HumangeneMAGE-3codesfor anantigenrecognizedona melanomaby autologouscytolyticT lymphocytes.J. Exp.Med.,179:921—930,1994.

12. Kawakami,Y., Eliyahu,S.,Delgado,C. H., Robbins,P. R., Rivoltini, L., Topalian,S. L., Mild,T., andRosenberg,S.A. Cloningof thegenecodingfora sharedhumanmelanoma antigen recognized by autologous T cells infiltrating into tumor. Proc.Natl. Acad.Sci. USA, 91: 3515-3519,1994.

13. Kawakami, Y., Eliyahu, S., Delgado, C. H., Robbins,P. F., Sakaguchi,K., Appella,E., Yannelli,J. R., Adema,G. J., Miki, T., andRosenberg,S. A. Identificationof ahumanmelanomaantigenrecognizedby tumor-infiltrating lymphocytesassociatedwith in vivo tumor rejection.Proc. Natl. Acad. Set. USA, 91: 6458—6462,1994.

14. Cox, A. L., Skipper,J., Chen,Y., andHenderson,R. A. Identificationof a peptiderecognizedby five melanoma-specifichuman cytotoxic T cell lines. Science(Washington DC), 264: 716-719, 1994.

15. Kawakami, Y., Eliyahu, S., Sakaguchi,K., Robbins, P. F., Rivoltini, L, Yannelli,J. R., Appella, E., and Rosenberg, S. A. Identificationof the immunodominantpeptidesof theMART-i humanmelanomaantigenrecognizedby themajorityofI@ILA-A2restrictedtumorinfiltratinglymphocytes.J.Exp.Med.,180:347—352,1994.

16. Traversari,C., Van der Bruggen,P., Luescher,I. F., Lurquin, C., Chomez,P., VanPd, A., Dc Plaen,E., Amar-Costesec,A., andBoon,T. A nonapeptideencodedbyhumangeneMAGE-1is recognizedon HLA-A1cytolyticlymphocytesdirectedagainsttumorantigenMZ2-E. J. Exp. Med., 176: 1453—1456,1994.

17. Cole, D. J., Weil, D. P., Shamamian,P., Rivoltini, L., Kawakami, Y., Topalian, S.,Jennings,C., Eliyahu,S., Rosenberg,S. A., andNishimura,M. I. IdentificationofMART-i specificT-cell receptors:T-cells utilizing distinctT-cell receptorvariableandjoining regionsrecognizethesametumorepitope.CancerRes.,54: 5265—5268,1994.

18. Shilyansky,J., Nishimura,M. I., Yannelli, J. R., Kawakami,Y., Jacknin,L S.,Charmley,P., and Rosenberg,S. A. T-cell receptorusageby melanoma-specificclonalandhighly oligoclonaltumor-infiltratinglymphocytelines.Proc.Natl. Acad.Sci. USA, 91: 2829—2833,1994.

19. Hall, B. L., andFinn,0. J. PCR-basedanalysisof theI-cell receptorVf3multigenefamily: experimentalparametersaffecting its validity. Biotechniques,13: 248—257,1992.

20. Engel, I., Ottenhoff, I. H. M., and Kiausner,R. D. High-efficiency expressionandsolubilization of functional I cell antigen receptor heterodimers. Science(WashingtonDC),256:1318—1321,1992.

21. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencingwith chain terminatinginhibitors.Proc. Nati. Acad. Sci. USA, 74: 5463—5467,1977.

22. Weiss, A., and Stobo,J. D. Requirementfor the coexpressionof T3 and the I cellantigenreceptoron a malignanthumanI-cell line. J. Exp. Med., 160: 1284—1288,1984.

23. Geisler,C., Scholler,J., Wahi, M. A., Rubin,B., andWeiss,A. Associationof thehumanCD3-Cchainwiththe&@ T cellreceptor/CD3complex:cluesfromaI cellvariantwith a mutatedT cell receptor-achain.J. Immunol.,145: 1761—1767,1990.

24. Nishimura,M. I., Kawakami, Y., Charmley, P., O'Neil, B., Shilyansky,J., Yannelli,J. R., Rosenberg,S. A., and Hood, L T-cell receptorrepertoirein tumor-infiltratinglymphocytes:analysisof melanoma-specificlong-termlines. J. Immunother.,16:85—94,1994.

25. Sensi, M., Salvi, S., Castelli, C., Maccalli, C., Mazzocchi, A., Mortarini, R., Nicolini,G., Herlyn, M., Parmiani, 0., and Anichini, A. I cell receptor (TCR) structure of

autologousmelanoma-reactivecytotoxicT lymphocyte(CTL) clones:tumor-infiltrating lymphocytesoverexpressin vivo the TCR@ chainsequenceusedby an HLAA2-restricted and melanocyte-lineage-specific CTL clone. J. Exp. Med., 178:1231—1248,1993.

26. Hwu, P., Shafer,G. E., Treisman,J., Schindler,D. 0., Gross,G., Cowerd, R.,Rosenberg,S.A., andEshhar,Z. Lysisofovariancancercellsby humanlymphocytesredirectedwith a chimericgenecomposedof anantibodyvariableregionandtheFcreceptor@)‘chain.J. Exp. Med., 178: 361—366,1993.

752

secrete IL-2 (Fig. 2). Similarly, ilL clone A42 was stimulated tosecretegranulocyte/macrophage-colony-stimulating factor by T2 cellspulsed with MART-1(2735) at concentrations as low as 1 n@i(15).Therefore, both the ilL clone and the Jurkat transfectantsrequiresimilar concentrations of MHC-peptide complex for stimulation, suggesting that additional factors may be involved. Since the clone 5Jurkatcells expressa TCR derived from an MHC classI-restricted,CD8@T-cell clonein a CD8 T-cell leukemialine, lackof expressionof CD8@on the Jurkat cell might hinder their ability to be stimulatedby tumor cells. Additionally, it is possible that T2 and melanoma cellsdifferentially express the appropriate adhesion molecules required forefficient stimulation of the Jurkat transfectants.

Cell-basedimmunotherapycurrently usesthe adoptivetransfertopatients of tumor-reactive ilL which are expandedex vivo (2, 3). Thetechnology now exists for us to identify tumor reactive T-cells,characterizeandclonetheTCR Va andVf3genesthatmediatetumorrecognition, and determine the epitopes recognized by these T cells.JurkatTCR transfectantsdo not recognizenative antigenpresentonthe tumor cells. However, the purpose of these experiments usingJurkat cells was to demonstratethe function and specificity of theTCRgenes.Thesubsequentinsertionof thesefunctionalTCRgenesinto cells normally capable of recognizing tumor which have theappropriate costimulatory and adhesion molecules (such as autologous T cells or T-cell progenitors) should give rise to cellscapable of recognizing tumor (26). It may, therefore, be possible togenerate a more effective TIL by conferring anti-tumor reactivityto nonspecific T-cell populations or by actually creating ahomogeneous tumor-reactive reagent.

Acknowledgments

We thank Dr. Pat Concannon for helpful suggestions. We also thank ArnoldMixon and Ellen Fitzgerald for help with FACS analysis.

References

1. RosenbergS. A., Speiss,P., andLafreniere,R. A. A newapproachto the adoptiveimmunotherapyof cancerwith tumor infiltrating lymphocytes.Science(WashingtonDC),233:1318—1321,1986.

2. Rosenberg,S.A. Theimmunotherapyandgenetherapyof cancer.J.Clin. Oncol.,10:180-199,1992.

3. Rosenberg,S. A., Packard,B. S,. Aebersold,P. M., et a!. Use of tumor infiltratinglymphocytesand interleukin-2 in the immunotherapyof patientswith metastaticmelanoma.N. EngI.J. Med.,319: 1676—1680,1988.

4. Darrow,T. L, Slingboff,C. L, Jr.,andSiegler,H. F.Theroleof HLA classI antigensin recognitionof melanomacells by tumor-specificcytotoxic T lymphocytes:cvidencefor sharedtumor-antigens.J. hnmunol.,142:3329-3335, 1989.

5. Kawakami, Y., Zakut, R., Topalian, S. L., Stofter, H., and Rosenberg, S. A. Recognition by tumor-infiltrating lymphocytes in HLA-A2.1-transfected melanomas.J. lmmunol., 148: 638—643,1992.

6. Topalian,S. L., Solomon,D., and Rosenberg,S. A. Tumor specific cytolysis bylymphocytesinfiltrating humanmelanomas.J Immunol.,142:3714—3724,1989.

7. Matis, L. A. The molecularbasisof T cell specificity. Annu. Rev. Immunol.,8:65—82,1990.

8. Bjorkman,P. J., Saper,M. A., Samraoui,B., Bernet,W. S., Strominger,J. L., andWiley, D. C. The foreignantigenbindingsiteandT cell recognitionregionsof classI histocompatabilityantigens.Nature(Land.),329:512—518,1987.

Research. on October 12, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

1995;55:748-752. Cancer Res   David J. Cole, Daniel P. Weil, Joel Shilyansky, et al.   AntigenReceptor Heterodimer Recognizing the MART-1 Melanoma Characterization of the Functional Specificity of a Cloned T-Cell

  Updated version

  http://cancerres.aacrjournals.org/content/55/4/748

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/55/4/748To request permission to re-use all or part of this article, use this link

Research. on October 12, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from