characterization of mutants of the vitamin d-binding protein/group-specific component: molecular...

Hum Genet (1995) 95:507-512 �9 Springer-Verlag 1995

I. Yuasa �9 A. Kofler �9 A. Braun. K. Umetsu R. Bichlmaier �9 S. Kammerer �9 H. Cleve

Characterization of mutants of the vitamin D-binding protein/group-specific component: molecular evolution of GC*IA2 and GC*IA3, common in some Asian populations

Received: 27 September 1994

Abstract A well defined polymorphism of vitamin D- binding/group-specific component (GC) resides in exon 11. To characterize the molecular basis of GC*IA2 and GC*IA3, common in some Asian populations, we analyzed all coding exons amplified by the polymerase chain reaction. GC*IF was divided into GC*IF c and G C * I F r by a C-T transition in the third nucleotide of the codon (TGC/T) for cysteine 2s3 in exon 8. The sequencing of exons 8 and 11 showed that GC*IA2 and GC*IA3 had occurred on a GC* 1F c genetic background. They also shared a substitution of cysteine (TGC) for arginine (CGC) at position 429 in exon 11. GC* 1A2 was characterized by hav- ing glycine (GGC) instead of serine (AGC) at position 335 in exon 9. GC*IA2 evolved from G C * I F r by three mutational events, i.e. GC* 1FT---~GC * 1FC--->GC * 1A3---> GC*IA2. No evidence was obtained for the existence of the duplicated gene GC* 1F �9 1A2 suggested by isoelectric focusing (IEF) of serum samples. The idea that the char- acteristic banding pattern of GC*IF �9 1A2 after IEF results from partial formation of a disulfide bond in the additional cysteine at position 429 is discussed.

I. Yuasa �9 A. Kofler - A. Braun �9 R. Bichlmaier �9 S. Kammerer H. Cleve* Institut f~r Anthropologie und Humangenetik der Universit/it Mtinchen, D-80333 Mtinchen, Germany

I. Yuasa (~) Department of Legal Medicine, Tottori University School of Medicine, Yonago, 683 Japan

A. Braun Dr. von Haunersches Kinderspital der Universit~it Mfinchen, D-80337 Mtinchen, Germany

K. Umetsu Department of Forensic Medicine, Yamagata University School of Medicine, Yamagata, 990-23 Japan

*Deceased

Introduction

Human group-specific component (GC), also known as vitamin D-binding protein, belongs to the albumin family and is linked to the albumin and c~-fetoprotein genes on chromosome 4q (Weitkamp et al. 1966; Cooke and David 1985; Yang et al. 1985; Schoentgen et al. 1986; Cooke et al. 1986). The protein component consists of a single polypeptide chain of 458 amino acids with a molecular weight of 51 kDa (Schoentgen et al. 1986). The exact function of GC is still unknown, although it not only binds vitamin D, but also G actin, membrane IgG and comple- ment component C5a (reviewed in Constans 1992).

Isoelectric focusing (IEF) studies have shown that GC is highly polymorphic. Three common alleles, GC*IF, GC*IS and GC*2, and more than 120 variants have been observed (Cleve and Constans 1988). Some variants are common in limited populations. GC*IA2 and GC*IA3 are sporadically observed in Asians and native Ameri- cans. However, GC*IA2 is the fourth most common allele in the Japanese population with a frequency of about 2% (Yuasa et al. 1984). GC*IA3 occurs at a frequency of 20% in the Philippine Negritos and at 2% in a northeastern part of China (Omoto et al. 1978; Umetsu et al. 1992). In addition, a duplicated gene, GC*IF �9 1A2, has been suggested by IEF and immunoblotting results. In this type weak double bands, called GC*lF-like bands here, are observed slightly cathodally to GC 1A2 bands as well as GC 1A2 bands. It was assumed to have arisen from un- equal or abnormal crossing over between GC*IF and GC*IA2 (Yasuda et al. 1989; Kubo et al. 1993).

The gene structure of human GC has recently been es- tablished. The gene spans 42,394 bp from the transcrip- tion start site to the polyadenylation signal. It consists of 13 exons with the translational termination codon in exon 12 (Braun et al. 1993 a; Witke et al. 1993). The molecular difference of the three common GC alleles resides in exon 11. At position 416, the codon GAT for aspartic acid was identified in GC*IF and GC*2, while the codon GAG for glutamic acid was found in GC*IS. At position 420,

508

GC* 1F and GC* 1S have the codon ACG for threonine instead of AAG for lysine in GC*2. This threonine residue is a possible site for the O-glycosylation of GC* 1 products (Reynolds and Sensabaugh 1990; Braun et al. 1992).

To elucidate the evolution of GC variants, we analyzed the molecular basis of GC* 1A2 and GC* 1A3, common in some Asian populations. In addition, the existence of the putative duplicated gene GC* 1F �9 1A2 is discussed.

Materials and methods

Genomic DNA samples

Genomic DNA samples were obtained from whole blood of seven unrelated Japanese persons, six with G C * I A 2 and one with GC*IA3. In addition, family F with G C * I A 2 and GC*IA3 was examined. As shown in Fig. 1, the mother was homozygous for

GC* IA2. The GC I A2 bands were present as doublets. This GC 1A2 phenotype showed the typical characteristics of a duplicated gene, G C * I F . 1A2. The father had a GC 2-1A3 phenotype and his GC*IA3 products were also characterized by a doublet banding pattern just like GC* 1A2 products. The two additional bands mi- grated slightly anodally to the GC IF bands. The phenotype of the daughter was GC 1A2-1A3 with a total of eight bands. For the population studies, 61 additional samples from Japanese were used.

IEF and immunoblotting

IEF was carried out using Pharmalyte pH 4.5-5.4 (Pharmacia, Up- psala, Sweden) according to the instructions of the supplier. The banding patterns were visualized by passive immunoblotting with anti-GC and peroxidase-conjugated anti-lgG antibodies (Dako, Copenhagen, Denmark).

Polymerase chain reaction (PCR)

Each exon was amplified by PCR with pairs of oligonucleotide primers designed after the genomic sequence published by Braun et al. (1993 a). The primers for some exons, where mutations were found, are shown in Table 1 together with the size of amplified fragments and the annealing temperature. The PCR was carried out in a total reaction volume of 50 tal including about 1 t-tg genomic DNA, 50 ng of each primer, 1 U Taq DNA polymerase (Promega, Madison, Wis), 200 btM of each dNTP, and 2.5 mM MgCI 2. Each sample was subjected to the following 35 amplification cycles: 1 min at 94~ for denaturation, 1 min at 50~176 for annealing, and 45 s at 72~ for extension. The details of primers and PCR conditions will be published elsewhere (Kofler et al. in prepara- tion).

Single-strand conformation polymorphism (SSCP)

Fig. 1 The banding patterns of GC after isoelectric focusing (IEF) in a pH gradient of 4.5-5.4. Anode at top. Lanes 1 GC 2-1A3 (father), 2 GC IA2-1A3 (proband), 3 GC 1A2 (mother), 4 GC IF- 1C35, 5 GC 1S-1C2

SSCP was carried out with an LKB vertical electrophoresis appa- ratus (Pharmacia, Uppsala, Sweden), as described by Burgemeister et al. (1995). Briefly, a mixture of 2 btl PCR products and 5 ~1 for- mamide was heated at 95~ for 5 min followed by rapid cooling on ice. Electrophoresis was performed overnight at 300 V using 20% native polyacrylamide gels in standard TRIS-borate-EDTA, pH 8.0 with cooling at 20 ~ C. After electrophoresis, bands were visualized by silver staining.

Table 1 Amplified DNA fragments of the human group-specific component (GC) gene and the primers used for the polymerase chain reaction (PCR)

Exon Primer Sequence Annealing Size of the Structure of tempera- amplified the amplified fragment ture (~ C) fragment

(bp)

1 E l F E1R

8 E8F2 E8R

8 E8F2 E8RA22

9 E9F2 E9R2

11 E I I F E I l R

5"TACCACTTTTACATGGTCAC3" 5"GAATTCCTGTAAATGGTCAC3"

5"AATGCACAAACTAACCATTCG3" 5"CTTCCCTCCATCTGGCTG3"

5"AATGCACAAACTAACCATTCG3" 5"GCAGCTGGCATGAAGTAAGT3"

5"ATCTCCTTTTCTCCCTCATGC3" 5"AGGCAGTGAGCAAGTTTTGG3"

5"ACATGTAGTAAGACCTTAC3" 5"GATTGGAGTGCATACGTTC3 ~

53 157

55 313

55 151

55 239

50 233

62 bp non-coding and 58 bp coding regions of exon 1 and 37 bp intron 1

29 bp intron 7, exon 8 and 81 bp intron 8

29 bp intron 7 and 122 bp exon 8

24 bp intron 8, exon 9 and 85 bp intron 9

37 bp intron 10, exon I 1 and 63 bp intron 11

Ligation, subcloning and sequencing of PCR products

Ligation, subcloning and sequencing were performed as described elsewhere (Kofler et al. 1995). Templates for DNA sequencing were prepared in a batch manner. All bacterial colonies were washed off from agar plates with 10 ml LB medium. DNA was pu- rified by using a Qiaprep spin plasmid kit (Diagen, Hilden, Ger- many). This procedure avoids the detection of Taq polymerase in- fidelity. The DNA sequencing was done using the PCR primers as sequencing primers.

Restriction endonuclease digestion and polyacrylamide gel electrophoresis to detect restriction fragment length polymorphism (PCR-RFLP)

PCR products for exons 9 and 11 were digested with DdeI and Cr (Boehringer, Mannheim, Germany), respectively, according to the instructions of the supplier. The digested fragments were separated in 12% polyacrylamide gels.

Population studies

Two polymorphic sites, GC-23 in exon 1 (Braun et al. 1993 b) and GC-283.3 in exon 8 (found in this study) were examined in 68 unrelated Japanese. The PCR products of exon 1 amplified using

509

primers E 1F and E 1 R, and of exon 8 amplified using primers E8F2 and E8RA22 were analyzed by SSCP as described above.

Results

SSCP analysis

Each exon was ana lyzed by SSCP after ampli f icat ion. Al- tered migra t ion patterns were observed in 4 o f 12 exons tested. Figure 2 shows the SSCP results for exon 11. The three c o m m o n alleles, G C * I F , G C * I S and GC*2 were c lear ly and unambiguous ly dis t inguished. The PCR products from all the members of fami ly F and seven persons with GC* 1 A2 and GC* 1A3 had c o m m o n bands, suggesting that the same mutat ion had occurred in exon 11. Both variant genes also showed the same al tered pat terns in exons 1 and 8. The difference be tween G C * I A 2 and G C * I A 3 was sugges ted to be in exon 9. A mobi l i ty shift was observed only in PCR products f rom persons with G C * I A 2 .

Sequencing

Fig.2 Single-strand conformation polymorpbism (SSCP) analysis of 233-bp amplified DNA for exon 11 of the GC gene. Anode at bottom. Lanes 1 Gc 2, 2 GC 1F-1S, 3 GC 2-1A3 (father), 4 GC 1A2-1A3 (proband), 5 GC 1A2 (mother), 6 GC 1F-1S, 7 GC 1F- IA2, 8 GC 1S-1A3

The D N A sequence of the four exons indica ted by SSCP was de te rmined for all member s of fami ly F, as summa- r ized in Table 2. In exon 11 conta in ing two po lymorph ic sites at the codons for pos i t ions 416 and 420, the sequence o f the GC* 1A2 and GC* 1A3 genes was ident ical and was the same as that o f GC* 1F except for the codon for posi- t ion 429. The variant genes shared a C-T transit ion, resulting in an amino acid change from arginine (CGC) to cys te ine (TGC). Sequencing of exon 1 showed that they had a C in the known po lymorph ic site, GC-23 (Braun et al. 1993 b). In exon 8, a new T-C transit ion in the third nu- cleot ide of codon 283 was observed and this was des ig- nated GC-283.3 (Fig. 3). GC* 1A2 and GC* 1A3 had T G C instead o f the T G T es tabl i shed in the Caucas ian D N A samples (Cooke and Dav id 1985; Yang et al. 1985; Braun et al. 1993a). Since this mutat ion is silent, the encoded cyste ine remains unchanged. A new mutat ion dis t inguish- ing G C * I A 2 from G C * I A 3 was detected in exon 9 (Fig. 4). The GC* 1A2 gene conta ined G G C for g lyc ine at position 335, while G C * I A 3 and normal GC genes had A G C for serine. Since SSCP analysis might not detect all nu-

Table 2 Variations in six polymorphic sites of the GC gene in family F

Member GC IEF Exon 1 Exon 8 Exon 9 phenotype GC-23 Codon 283 Codon 335

Exon 11

Codon 416 Codon 420 Codon 429

Father 2-1A3 C TGT/TGC AGC GAT AAG/ACG CGC/TGC (Cys/Cys) (Ser) (Asp) (Lys/Thr) (Arg/Cys)

Child 1A2- l A3 C TGC AGC/GGC GAT ACG TGC (Cys) (Ser/Gly) (Asp) (Thr) (Cys)

Mother 1 A2 C TGC GGC GAT ACG TGC (Cys) (Gly) (Asp) (Thr) (Cys)

510

c leo t ide d i f fe rences , we d e t e r m i n e d the s e q u e n c e o f the o the r exons a m p l i f i e d f r o m D N A of the chi ld. No fur ther mu ta t i on was iden t i f i ed in G C * 1 A2 and G C * l A 3 .

P C R - R F L P analys is

T h e mu ta t i ons in exons 9 and 11 resul t in loss o f a restr ic- t ion site for D d e l and Cfi)I, respec t ive ly . The loss o f si tes was c o n f i r m e d by e l ec t rophore s i s af ter d iges t ion o f the P C R f r agmen t s wi th the e n z y m e s (data not shown) .

Fig.3 Sequence of amplified DNA for exon 8 of the GC gene. Ar- rowhead mutation site. A C-T transition is observed and the encoded cysteine remains unchanged

Fig.4 Sequence of amplified DNA for exon 9 of the GC gene from family F. Arrow- heads mutation sites. An A-G transition, resulting in a substitution of glycine for serine at amino acid position 335, is observed in GC* 1A2. The codon numbers and the corresponding amino acids are listed right

Popu la t i on s tudies

Table 3 s u m m a r i z e s the d i s t r ibu t ion o f p h e n o t y p e s and al- le les at the two p o l y m o r p h i c si tes G C - 2 3 and G C - 2 8 3 . 3 toge the r wi th the resul ts o f G C p h e n o t y p i n g by l E E Each site was p o l y m o r p h i c in a J apanese popu la t ion and each d is t r ibu t ion was in g o o d a g r e e m e n t wi th the H a r d y - W e i n - berg equ i l ib r ium. All 12 G C - 2 8 3 . 3 " C c o i n c i d e d wi th a G C p h e n o t y p e h e t e r o z y g o u s or h o m o z y g o u s for G C * l F . Apparen t ly , G C * I F was d i v i d e d into two genes , G C * 1F c

Table 3 Distribution of phenotypes and allele frequencies at two polymorphic sites in 68 unrelated Japanese

~' The variant phenotypes were excluded from the calculation of allele frequencies, because they were not collected at random

GC IEF GC-23 GC-283.3 Total phenotype

C C/T T C C/T T

Total 37 28 3 3 15 50 68

Allele fre- GC-23"C = 0.738 GC-283.3"C = 0.098 GC* 1F = 0.443 quencies: GC-23*T = 0.262 GC-283.3*T = 0.902 GC*IS = 0.262

GC*2 = 0.295

1F 4 6 2 1 3 8 12 I F - I S 7 7 1 0 3 12 15 1 S 4 () 0 0 0 4 4

2-1F 7 8 0 0 4 11 15 2-1 S 5 4 0 0 0 9 9 2 5 1 0 0 0 6 6 I F - I A 2 ~' 3 1 0 2 2 0 4 1 S - 1 A2 '~ 2 0 0 0 2 0 2

IS-1A3 ~ 0 1 0 0 1 0 1

511

and G C * I F r due to the sequence polymorphism in the GC-283.3 site. No association between GC-23 and GC phenotypes was found. Tables 2 and 3 indicate that both GC*IA2 and GC*IA3 are linked to GC-23"C and GC- 283.3"C.

Discussion

We have here presented evidence for molecular evolution of GC*IA2 and GC*IA3, common in some Asian populations. The sequencing of the two polymorphic sites at the codons for positions 416 and 420 in exon 11 showed that GC* 1 A2 and GC* 1 A3 were identical to GC* 1E The population study showed that GC*IF was divided into GC*IF c and G C * I F r on the basis of a C-T transition at the codon for position 283 in exon 8 (Table 3). It was ob- vious that both GC* 1A2 and GC* 1A3 were derived from GC*IF c. The variant genes also shared a substitution of cysteine (TGC) for arginine (CGC) at position 429 in exon 11. This mutation was responsible for the difference between GC*IF c and GC*IA3. The GC*IA2 gene was characterized by an additional mutation from serine (AGC) to glycine (GGC) at position 335 in exon 9. GC*IA3 was an evolutionary intermediate between GC*IF c and GC*IA2. The agreement of the nucleotide sequence in all tested polymorphic sites except position 335 between GC*IA2 and GC*IA3 (Table 2) indicated that GC*IA2 originated directly from GC*IA3. This hy- pothesis is consistent with a population genetic observa- tion that GC*IA2 is more limited in distribution than GC*IA3 (Constans et al. 1985; Kamboh and Ferrell 1986). GC*IA2 is observed at a polymorphic frequency in Japa- nese populations and is detected in the northeastern part of China. These Chinese populations also have GC*IA3 at polymorphic frequencies (Yuasa et al. 1984; Umetsu et al. 1992). It can be inferred that GC*IA2 arising from mutation of GC*IA3 in a northeastern part of China flowed into Japan through the Korean peninsula and was increased in Japan by random genetic drift. As far as investigated, anthropoid apes have a TGT sequence in the codon corresponding to the codon for position 283 of the human GC gene (Bichlmaier, unpublished data), suggesting that GC*IF T is more ancestral than GC*IF c. Therefore, GC*IA2 evolved from GC*IF T through three mutational events, i.e. GC* 1Fr---)GC * 1Fc--->GC * IA3---~GC* 1A2.

It is well-known that the CG dinucleotide often mu- tates to TG or CA (Barker et al. 1984; Li et al. 1984). Re- cently we studied the molecular basis of GC*IA1 and GC*2A9 and found point mutations at the codon for position 429. GC*IA1 had CAC for histidine and GC*2A9 had TGC for cysteine instead of CGC for arginine (Kofler et al. 1995). As mentioned above, GC*IA2 and GC*IA3 also contain TGC there. Thus, multiple occurrence of the mutation suggests that the codon CGC for position 429 is a mutational hotspot of the GC gene.

A duplicated GC*IF and GC*IA2 gene, GC*IF �9 1A2, has been suggested by IEF results on the GC protein in serum. In such cases weak double bands located catho-

dally to the major GC 1A2 bands were observed in addition to the GC 1A2 bands (Yasuda et al. 1989; Kubo et al. 1993). In the present study we have investigated a homozygous sample of GC*IA2 with the same characteristics as GC*IF �9 lA2 (Fig. 1). Nevertheless, no evidence for the existence of GC*IF was obtained by SSCP of exons 9 and 11 and sequencing of codons 335 and 429. In our experiment at the protein level (Umetsu and Yuasa, unpublished data), the cathodal GC 1F-like bands were detected in all fresh serum samples but not in all stored ones. These bands disappeared after sera had been kept at 37~ for about 1 week. The GC 1F-like bands were not located at the same positions as normal GC 1F bands, but were shifted slightly cathodally to the latter ones (Fig. 1). Similar cathodal bands were detected in GC 1A3 samples and exhibited the same characteristics as the GC 1F-like bands. Alpha-l-antitrypsin has only one cysteine residue on the surface of the molecule and the thiol group in cysteine forms a disulfide bridge with other thiol compounds such as cysteine and glutathione (Jeppsson et al. 1978). Interestingly, the major bands of the alpha-1-antitrypsin F variant, resulting from a substitution of cysteine for arginine, often migrate as doublets in IEF gels (Okayama et al. 1991). As mentioned above, GC*IA2 and GC*IA3 share one additional cysteine instead of arginine at amino acid position 429. It is probable that a similar phenome- non occurs in the products of both GC* 1A2 and GC* 1A3 and that oxidation of the thiol group shifted the isoelectric point of the GC molecules. In fact, mild reduction of serum samples with 2-mercaptoethanol made cathodal bands in doublets more intense and anodal bands less intense (Umetsu and Yuasa, unpublished data). It is con- cluded that the major anodal bands of GC*IA2 and GC* 1A3 are not genetic products but modified products arising from posttranslational oxidation of the thiol group in the circulation.

Acknowledgements We wish to thank N. Tamaki and M. Naka- gawa for providing some serum and DNA samples. This study was funded by a grant from the Deutsche Forschungsgemeinschaft, Bad Godesberg, Germany (C1 27/15-1).

References

Barker D, Schafer M, White R (1984) Restriction sites containing CpG show a higher frequency of a polymorphism in human DNA. Cell 36:131-138

Braun A, Bichlmaier R, Cleve H (1992) Molecular analysis of the gene for the human vitamin-D-binding protein (group-specific component): allelic differences of the common genetic GC types. Hum Genet 89:401-406

Braun A, Kofler A, Morawietz S, Cleve H (1993a) Sequence and organization of the human vitamin D-binding protein gene. Biochim Biophys Acta 1.216 : 385-394

Braun A, Kofler A, Bichlmaier R, Kammerer S, Cleve H (1993 b) A novel sequence polymorphism in exon 1 of the human vitamin D-binding protein (GC) gene. Hum Mol Genet 2:1750

Burgemeister R, R6tzer E, Gutensohn W (1995) Identification of a new missense mutation in exon 2 of the human hypoxanthine phosphoribosyl-transferase gene (HPRTIs~r). A further example of clinical heterogeneity in HPRT-deficiencies. Hum Mutat (in press)

512

Cleve H, Constans J (1988) The mutants of the vitamin D binding protein: more than 120 variants of the GC/DBP system. Vox Sang 54:215 225

Constans J (1992) Group-specific component is not only a vitamin D-binding protein. Exp Clin lmmunogenet 9:161-175

Constans J, Hazout S, Garruto RM, Gajdusek DC, Spees EK (1985) Population distribution of the human vitamin D binding protein: anthropological considerations. Am J Phys Anthropol 68 : 107-122

Cooke NE, David EV (1985) Serum vitamin D-binding protein is a third member of the albumin and alpha fetoprotein gene family. J Clin Invest 76:2420-2424

Cooke NE, Willard HF, David EV, George DL (1986) Direct re- gional assignment of the gene for vitamin D binding protein (Gc-globulin) to human chromosome 4ql 1-q13 and identification of an associated DNA polymorphism. Hum Genet 73: 225-229

Jeppsson J-O, Laurell C-B, Fagerhol M (1978) Properties of iso- lated human ~l-antitrypsins of Pi types M, S and Z. Eur J Biochem 83:143-153

Kamboh MI, Ferrell RE (1986) Ethnic variation in vitamin D- binding protein (GC): a review of isoelectric focusing studies in human populations. Hum Genet 72 : 281-293

Kofler A, Braun A, Jenkins T, Serjeantson SW, Cleve H (1995) Characterization of mutants of the vitamin D-binding protein/group specific component: GC Aborigine(1A1) from Aus- tralian Aborigines and South African Black, and 2A9 from South Germany. Vox Sang 68:50-54

Kubo S, Kitamura O, Tsuda R, Hirose W, Matsumoto H, Naka- sono l (1993) Hereditary recombined three-allele variant of the Gc system. Hum Genet 91:71-72

Li W-H, Wu C-I, Luo C-C (1984) Nonrandomness of point mutation as reflected in nucleotide substitutions in pseudogenes and its evolutionary implications. J Mol Evol 21:58-71

Okayama H, Brantly M, Holmes M, Crystal RG (1991) Character- ization of the molecular basis of the ctl -antitrypsin F allele. Am J Hun1 Genet 48:1154-1158

Omoto K, Misawa S, Harada S, Sumpaico JS, Medado PM, Ogonuki H (1978) Population genetic studies of the Philippine Negritos. I. A pilot survey of red cell enzyme and serum protein groups. Am J Hum Genet 30:190-201

Reynolds RL, Sensabaugh GF (1990) Use of the polymerase chain reaction for typing Gc variants. In: Polesky HF, Mayr WR (eds) Advances in forensic haemogenetics, vol 3. Springer, Berlin Heidelberg New York, pp 158-161

Schoentgen F, Metz-Boutigue M-H, Jolles J, Constans J, Jolles P (1986) Complete amino acid sequence of human vitamin D- binding protein (group-specific component): evidence of a three fold internal homology as in serum albumin and alpha-fetoprotein. Biochim Biophys Acta 871:189-198

Umetsu K, Ding M, Yuasa I, Suzuki T (1992) Genetic polymorphism of group-specific component in a Chinese population. Res Pract Forens Med 35 : 67-69

Weitkamp LR, Rucknagel DL, Gershowitz H (1966) Genetic link- age between structural loci for albumin and group specific component (Go). Am J Hum Genet 18 : 559-571

Witke WF, Gibbs PEM, Zielinski R, Yang F, Bowman BH, Dugaiczyk A (1993) Complete structure of the human Gc gene: differences and similarities between members of the albumin gene family. Genomics 16:751-754

Yang F, Brune JL, Naylor SL, Cupples RL, Naberhaus KH, Bow- man BH (1985) Human group-specific component (GC) is a member of the albumin family. Proc Natl Acad Sci USA 82 : 7994-7998

Yasuda T, Ikehara Y, Takagi S, Mizutani K, Kishi K (1989) A hereditary double double-banded variation in the vitamin D- binding protein (GC) system analyzed by immunoblotting: du- plication of the 1F and 1A2 genes? Hum Genet 82 : 89 91

Yuasa I, Suenaga K, Gotoh Y, Ito K, Yokoyama N (1984) Gc types in western Japan: report of a new variant Gc 1C35. Hum Hered 34:174-177

characterization of mutants of the vitamin d-binding protein/group-specific component: molecular...

Documents