1

Cell Stem Cell, volume 13 Supplemental Information Tet1 Regulates Adult Hippocampal Neurogenesis and Cognition Run-Rui Zhang, Qing-Yan Cui, Kiyohito Murai, Yen Ching Lim, Zachary D. Smith Shengnan Jin, Peng Ye, Luis Rosa, Yew Kok Lee, Hai-Ping Wu, Wei Liu, Zhi-Mei Xu, Lu Yang Yu-Qiang Ding, Fuchou Tang Alexander Meissner, Chunming Ding, Yanhong Shi, and Guo-Liang Xu

Supplemental Figures and Legends

Figure S1. Tet1 Expression in Neural Progenitors and the Effect of Its Acute

Ablation on Neurosphere Growth, Related to Figure 2

2

(A) Tet1 mRNA levels in ESC, adult NPCs and indicated tissues were determined by

quantitative PCR (qPCR) analysis. Data are normalized to Gapdh (Error bars are

presented as mean ± s.e.m.).

(B) Neurosphere immunostaining confirm the protein expression of Tet1 in WT, but

not in KO neural progenitors. Two different antibodies specific for the N- and

C-terminal protein were used. Scale bar, 100 μm.

(C) Neurospheres were infected with control (empty-IRES-GFP) and Cre

(Cre-IRES-GFP) lentiviruses for 7 days. Tet1f/f NPCs were isolated from the adult DG.

Scale bar, 100 μm.

(D) Average diameter of infected GFP-positive neurospheres (n = 3 cases, two-tailed

t-test: *P < 0.05, error bars are presented as mean ± s.e.m.).

3

Figure S2. Normal Dentate Gyrus Formation and Neuronal Proliferation in

Young Neural Tissue Specific Knockout Mice, Related to Figure 3

(A) Normal dentate gyrus formation in early development (P0) and young adult mice

(P60). Tet1 f/-; Nestin-Cre mice were compared with Tet1 f/+; Nestin-Cre.

(B) TUNEL assay of SGZ coronal brain sections of Tet1 f/+; Nestin-Cre and Tet1 f/-;

Nestin-Cre mice. No apoptosis was observed in 2-month-old NCKO mice. Scale bar, 200

μm. Mouse E12.5 trigeminal ganglion coronal sections were used as positive control.

Scale bar, 15 μm.

4

(C) – (F) Immunostaining and quantification of BrdU-positive cells in the SGZ of Ctrl

(Tet1 f/+; Nestin-Cre) and NCKO (Tet1 f/-; Nestin-Cre) hippocampi at P14 (C and D) and P30

(E and F). Scale bar, 100 μm. In the quantification, n = 3 pairs of mice, two-tailed

t-test, and P > 0.05, error bars are presented as mean ± s.e.m.

5

Figure S3. Reduced Neural Progenitor Proliferation and Impaired Neurogenesis

in Adult Tet1 Deficient Mice, Related to Figure 3

6

(A) – (D) Immunostaining and quantification of proliferating cells (A and B) and

newborn neurons (C and D) in the SGZ at 4 months in Ctrl (Tet1f/+; Nestin-Cre) and Tet1

NCKO (Tet1f/-; Nestin-Cre ) dentate gyrus. (n = 4 pairs of mice, two-tailed t-test: *P <

0.05, **P < 0.01, error bars are presented as mean ± s.e.m.. All scale bars of whole

images are 100 μm and the upper-left panels are enlarged images of the arrow-pointed

cells with a scale bar of 10 μm).

(E) and (F) Lentiviral knockdown of Tet1 expression reduced neural progenitor cell

proliferation in the hippocampal dentate gyrus of adult mouse brains. (E) Lentiviral

transduction of Tet1 shRNA (shTet1) reduced BrdU labeling in the dentate gyrus of

mouse brains. Wild-type mouse brains were injected with scrambled control (SC) or

shTet1-expressing lentiviruses. Both SC and shTet1-expression vectors harbor a GFP

reporter. BrdU staining was performed to label dividing cells and was shown in red

and nuclei DAPI staining was shown in blue. Scale bar, 50µm for top panels. The

bottom panels are enlarged images of the arrow-pointed cells with a scale bar of 12.5

µm. (F) Quantification of the GFP-positive and BrdU-positive (GFP+BrdU+) cells

among the GFP+ cells in the dentate gyrus of viral-transduced mouse brains. Data are

represented as mean ± standard deviation. ***P=0.000418 by Student’s t-test. n = 10

for scrambled control RNA-transduced mice and n = 7 for shTet1-transduced mice.

7

Figure S4. Proliferation of Tet1-null NPCs in Vitro Was Partially Rescued by

Galanin Supplementation, Related to Figure 4

(A) Growth of Tet1-null neurospheres in medium with or without the supplementation

of 5 nM Galanin 2–11. Galanin 2-11 is a Galanin receptor agonist and can stimulate

NPCs proliferation (Abbosh et al., 2011). Adult NPCs for neurosphere assay were

sorted from Tet1+/+; Nestin-GFP (WT) and Tet1-/-; Nestin-GFP (KO) mice. Scale bars, 100 μm.

(B) and (C) Quantification of the number and diameter of primary neurospheres in

normal and rescue media (n = 3 cases, two-tailed t-test: *P < 0.05, error bars are

presented as mean ± s.e.m.).

(D) and (E) Quantification of the number and diameter of secondary neurospheres in

normal and rescue media (n = 3 cases, two-tailed t-test: *P < 0.05, **P < 0.01, error

bars are presented as mean ± s.e.m.).

8

Table S1. List of Genes with Both Differential Promoter Methylation (RRBS) and

Differential Expression (RNA-seq), Related to Figure 4. A promoter was considered

as differentially methylated if the absolute methylation level difference was ≥ 20%

between KO and WT. A significant expression change was defined as 1) expression

ratio between KO and WT was either ≥ 2 or ≤0.5; and 2) P < 0.01 (Fisher exact test

adjusted by the Benjamini-Hochberg method).

Supplemental Experimental Procedures

Generation of Tet1 Knockout Mice

A targeting vector for Tet1 was prepared using the recombineering technique (Liu et

al., 2003) and electroporated into 129Sv ES cells for selection of targeted clones. The

floxed region contains exons 10-13, which code for the most part (421 amino acids

from VEYEE to YNRWV, GenBank accession number NP_001240786) of the

catalytic domain (Figure 1A). Positive clones were further characterized by Southern

blotting to confirm homologous recombination on the left side of the targeted

genomic region (Figure 1B). Embryonic stem cells carrying a correctly targeted allele

were injected into blastocysts to generate germline chimaeras. Mice with a floxed

allele were obtained by breeding with C57BL/6J mice. Mice with a floxed Tet1 allele

were crossed with EIIa-Cre mice, Nestin-Cre or Nestin-CreERT2 mice for generating

whole-body knockout (KO) or nervous system knockout lines respectively.

Whole-body KO line was used for initial phenotype analysis. Tet1 KO mice with

Nestin-GFP transgenic background and nervous system-specific knockout strains

were used for analysis of neurogenesis. Male mice on a mixed 129Sv&C57BL/6J

9

background were used in all experiments. Primers for genotyping PCR are as follows

(5'-3'):

• Tet1C CAGTAGTATTTTGCCTGCCTGCAT

• Tet1F CATCCTAAATAACCCAACCACCAA

• Tet1R TTCCCTAAGGAGTTTACTGCAACG

Morris Water Maze

The Morris water maze was conducted as described (Vorhees and Williams, 2006). A

white plastic tank 120  cm in diameter was filled with 22°C water, which was made

opaque with white non-toxic plastic beads. A transparent platform 10 cm in diameter

was located in the center of one of the four virtually divided quadrants during training

and was submerged 0.5  cm below the surface of opaque water. Mice were handled

daily for 1  week before swim training. The swim training was consisted of 1day of

pre-training, 1 day of visible platform version and 5 days hidden platform version. For

pre-training, mice were released in the corner and were allowed to stay in the hidden

platform for 30 sec once they found it. For visible platform version, the tank was

rounded by curtains. Platform location was indicated by a multicolor rod, which was

24 cm above the water and was attached to the platform. Mice were trained with

visible platform for four trials per day with an inter-trial interval of about 30 min.

Each trial started with a random point away from the visible platform and lasted either

until the mouse had found the platform or for a maximum of 60 sec. Afterwards, mice

were allowed to stay on or were put onto the platform for 30 sec. Hidden platform

trainings were conducted 1 day after the visible version in the same pool within the

same room. Distal cues, such as air-conditioner and painted cardboard on the white

wall, were provided as spatial references. The platform was submerged 0.5 cm below

10

the opaque water in a new fixed position without any visible local cues. Training

procedures were identical to that of the visible platform. Memory was examined by

using a probe trial that was administered 24 hrs (short-term probe) or 3 weeks

(long-term probe) after the last training. During the probe trial, mice were allowed to

swim 60 sec without the platform in the tank. We used a video tracking system

(Ethovision; Noldus Information Techonology) to record and analyze the swimming

path, velocity and time taken to reach the platform (latency) or in each zone. We

compared the single time-points’ data by Student t-test and also analyzed the serial

days’ data as dependent values by two-way ANOVA.

Isolation of Nestin-GFP Positive Cells

Dentate gyrus was dissected from Nestin-GFP transgenic adult mice in Hibernate

A/B27 medium (Invitrogen), then digested in 0.25% papain (Worthington) at 37 °C

for 30 min. After quenching the digestion, the material was triturated with a

fire-polished Pasteur pipette. Dissociated cells were suspended in Neurobasal A/B27.

Cell sorting and analyses were performed using a FACSVantage flow cytometer/cell

sorter equipped with CELL Quest software (Becton-Dickinson). Cells were analyzed

for forward scatter, side scatter and GFP fluorescence with an argon laser (488 nm,

100 mW). Dead cells were excluded by gating on forward and side scatter. Viable

cells from the transgenic mice were sorted into Neurobasal A/B27 medium for further

experiments.

Neurosphere Assay

Neurosphere cultures were prepared as described (Brewer and Torricelli, 2007).

Briefly, Nestin-GFP positive cells sorted from adult dentate gyrus were plated 20,000

11

cells per well of 24-well plate. The cultures were maintained in NeurobasalA/B27

medium (Invitrogen) containing growth factors (20 ng/ml bFGF and 20 ng/ml EGF).

After 7-day culture, neurospheres were dissociated by TrypLE™ (Invitrogen) and

suspensions were diluted to 20,000 cells per well in fresh medium for secondary

neurosphere formation. The number and diameter of neurosphere were measured by

using the Microcomputer Imaging Device Program.

For differentiation, neurospheres were dissociated to single cells and plated onto

glass substrate coated with 100 μg/ml poly-D-Lys (Sigma) at 50,000 cells per P24

well in NeuroCult Differentiation Medium (Stem Cell). After 7-day culture, cells

were used for immunostaining.

Immunohistochemistry and Antibodies

For neurosphere immunostaning, neurospheres were settled by gravity and fixed by 4%

PFA. Then they were cryoprotected in 30% sucrose overnight and 10- μm thick

sections were prepared. Immunostaining was conducted with rabbit antibodies

specific for the N- and C-terminal Tet1 protein. For neurosphere differentiation assay,

primary antibodies to Tuj1 (Mouse, 1:1000, Covance), GFAP (Mouse, 1:500, Cell

Signaling), O4 (Mouse, 1:200, Millipore) were used. Secondary antibodies used were

Alexa Fluor 488 or 546 conjugated, goat anti-rabbit, goat anti-mouse or donkey

anti-goat antibodies.

For brain immunostaining, wild-type and mutant mice were transcardially

perfused with 4% PFA. Brains collected were cryoprotected in 30% sucrose for 24 hrs,

and sectioned in the coronal plane on a cryostat (Leica) at 40 μm. For BrdU staining,

sections were treated in 2 M HCl at 37°C for 15 min before blocking. Antibody

incubation was carried out overnight at 4°C. Primary antibodies to BrdU (Mouse,

12

1:500, Millipore; Rat, 1:200, Abcam), Ki67 (Rabbit, 1:500, Abcam), Tbr2 (Rabbit,

1:200, Abcam), GFAP (Mouse, 1:500, Cell Signaling), Nestin (Goat, 1:50, Santa),

Dcx (Rabbit, 1:2000, Abcam), NeuN (Mouse, 1:100, Millipore) and GFP (Rabbit,

1:500, Invitrogen) were used. The following day, sections were incubated with

secondary antibodies. Secondary antibodies used were Alexa Fluor 488 or 546

conjugated, goat anti-rabbit, goat anti-mouse or donkey anti-goat antibodies. Sections

were examined using a Olympus fluorescent microscope or a Leica confocal system.

For quantification, 10-12 sections (every 5th section of slides from each animal)

including the DG area were selected. The entire dentate gyri were scanned using a

confocal microscope. Z series stacks of confocal images were obtained. The number

of single or double stained cells were counted using the Image Pro Plus software.

Two-tailed t-test was used in statistics.

Lentiviral Infection and Acute Ablation of Tet1 in Tet1 flox/flox NPCs

Control (UbiC-empty-IRES-EGFP) or Cre-expressing (UbiC-Cre-IRES-EGFP)

FUIGW lentiviral construct was co-transfected with two other helper vectors (PAX2

and SVGV) into HEK-293T cells. Packaged lentiviral particles were harvested at 48h

and 72h post transfection. Harvested lentiviral particles were then combined and

concentrated using ultracentrifugation (Beckman L-100K rotor, 20,000 rpm for 120

min). Adult Tet1 flox/flox NPCs were transduced with concentrated lentiviruses in the

presence of 4 μg/ml polybrene (Sigma) by centrifugation (300 g for 90 min) and

analyzed 7 days after infection.

13

BrdU Labeling for Young Postnatal Mice

P14 and P30 mice were injected BrdU every two hours for 3 times and perfused 2

hours later. Then brain sections were processed for immunostaining.

Nissl Staining

It was performed by using 0.25% Cresyl violet on 30-μm frozen sections.

TUNEL Assay

Cell apoptosis in SGZ was examined using a Terminal deoxynucleotidyl transferase-

mediated dUTP nick end labeling (TUNEL) kit (Roche).

Viral Production and Intracranial Lentiviral Infection

The scrambled control and Tet1 shRNA 3387-expressing lentiviruses were produced

using 293T cells as described (Shi et al., 2004); For intracranial lentiviral infection,

0.5 µl of concentrated lentiviruses was injected into the hippocampal dentate gyrus of

6-8-week-old wild type ICR mice by stereotaxic injection as described (Qu et al.,

2010). Two weeks after viral injection, the transduced mice were injected with BrdU

for 7 days and preceded for perfusion and subsequent BrdU (Sigma) labeling. The

coordinates for the dentate gyrus of wild type mice were anterior-posterior-2.5 mm,

mediolateral (ML) ±2.6 mm, and dorsoventral (DV) -2.8 and -3.3 mm from the skull

surface.

Reduced Representation Bisulfite Sequencing (RRBS)

Adult NPCs were sorted from dentate gyrus of Nestin-GFP transgenic mice.

Genomic DNA was prepared by using Qiagen DNeasy Blood &Tissue Kit. The

14

RRBS library construction and sequencing referred to previous methods(Meissner et

al., 2005). Briefly, genomic DNA was fragmented by sequential restriction digestion

with MspI and TaqI according to manufacturer’s instructions (New England Biolabs).

The digested product was purified with the QIAquick PCR Purification Kit (Qiagen).

End-repair and adaptor ligation were performed using the ChIP-Seq Sample

Preparation Kit (Illumina). Illumina’s RRBS for Methylation Analysis protocol was

followed. The purified fragments were then bisulfite-treated using the EZ DNA

Methylation-Gold Kit (Zymo Research), according to manufacturer’s instructions.

The converted DNA was amplified with 1x reaction buffer, additional 1.5 mM of

MgCl2, 300 µM of dNTP mix, 500 nM each of PCR primer PE 1.0 and 2.0, and 2.5 U

of HotStar Taq DNA polymerase. The thermocycling condition was 15 min at 94 °C

for heat activation, and 8-12 cycles of 20 sec at 94 °C, 30 sec at 65 °C and 30 sec at

72 °C, followed by a 5-min final extension at 72 °C. The enriched fragments were

purified by gel electrophoresis and quantified by Agilent 2100 Bioanalyzer (Agilent

Technologies). Sequencing was performed on the Illumina Genome Analyzer IIx

platform, as per manufacturer’s instructions.

A promoter was defined as -1000 to 500-bp relative to a transcription start site.

The methylation level of a promoter was determined by calculating the average

methylation level for CpGs with ≥10 sequencing depth. A promoter was considered as

differentially methylated if the absolute methylation level difference between WT and

KO was ≥20%.

RNA-Seq Analysis

Total RNA was purified from sorted nestin-GFP positive progenitor cells of adult DG

by using the Qiagen RNeasy Micro Kit. cDNA synthesis and amplification was

15

performed according to the protocol of RNA-Seq analysis of a single cells (Tang et al.,

2010). In brief, about 1-2 ng of RNA was added to 4 µl of lysis buffer and reverse

translated into cDNA. After free primer removal, 3’ polyA tailing and second strand

synthesis, the cDNA was amplified using the UP1 primer for 18 cycles. Then the

amplified products were purified, and the purified products were separated on a 2%

agarose gel, fragments excised from the size range of 0.5-8 kb. The gel-purified

products were amplified for 10 cycles with AUP1 and AUP2 primers. The second

round amplification products were purified and products within the size range from

0.5 to 5 kb isolated. Then the final purified products (about 1 μg) were fragmented by

Covaris S2 sonicator (Covaris) and purified with QIAquick PCR purification kit.

About 100 ng of the products were converted to sequencing libraries with the TruSeq

DNA Sample Prep Kit (Illumina). The libraries were pair-end sequenced by

IlluminaHiseq 2000 instrument.

Expression levels for the genes were reported as RPKM (Reads Per Kilobase of

exon model per Million mapped reads). Only genes with RPKM ≥ 0.5 in at least one

of the samples were used in the analysis. For genes with RPKM less than 0.5, their

RPKM value was set to 0.5. A gene was considered differentially expressed if 1)

Fisher exact test with a Benjamini-Hochberg corrected p-value of less than 0.01 and 2)

ratio between WT and KO ≤ 0.5 or ≥ 2.

RNA Isolation and Quantitative RT-PCR

Total RNA was purified from sorted nestin-GFP positive progenitor cells of adult DG

by using the Qiagen RNeasy Microprep Kit, treated with DNAase and

reverse-transcribed into the first-strand cDNA by One Step SYBR PrimeScript

RT-PCR Kit (Takara). Real-time PCR was performed in Bio-Rad CFX96 using

16

SYBR Premix Ex Taq (Takara). PCR efficiency and specificity of each primer pair

was examined by standard curve of serially diluted cDNA and melting curve

functionality respectively. Fold change was calculated based on 2-∆∆Ctmethod after

normalization to the transcript level of housekeeping gene Gapdh. Gene specific

primers used for quantitative RT-PCR are as follows (5'-3'):

• Atp5h Atp5h-qRT-F GCTGGGCGTAAACTTGCTCTA

Atp5h-qRT-R CAGACAGACTAGCCAACCTGG

• Galanin Galanin-qRT-F GGCAGCGTTATCCTGCTAGG

Galanin-qRT-R CTGTTCAGGGTCCAACCTCT

• Gapdh Gapdh-qRT-F GCCAGCCTCGTCCCGTAGACA

Gapdh-qRT-R CAACAATCTCCACTTTGCCACTGC

• Ng2 Ng2-qRT-F GGGCTGTGCTGTCTGTTGA

Ng2-qRT-R TGATTCCCTTCAGGTAAGGCA

• Ngb Ngb-qRT-F CCGGAGTCAGAGCTGATCC

Ngb-qRT-R GCGGCCATTGTACTGGAAGA

• Kctd14 Kctd14-qRT-F CAAAGGTCATCTATGGAGCCAG

Kctd14-qRT-R GAGAAGCCCAAAGTAGGTGCC

• Tet1 Tet1-RT-d CATTCTCACAAGGACATTCACAACA

Tet1-RT-e AGTAAAACGTAGTCGCCTCTTCCTG

• Trpm3 Trpm3-qRT-F CCGTGGGGGACCGTTTATTTT

Trpm3-qRT-R CAATTTAGGGGTCGAGAAGCAT

17

Gene-specific Bisulfite Sequencing

We carried out bisulfite conversion of 100 ng of genomic DNA purified from adult

NPCs using EZ DNA methylation-Gold Kit according to manufacturer’s instructions.

Hot-start PCR was used to amplify the region of interest from the bisulfite converted

genomic DNA. The PCR products were purified (Qiagen) and sub-cloned into the

pMD19-T vector (Takara). 10 clones were randomly selected and sequenced.

Genomic sequences were retrieved from the Ensemble. All the bisulfite genomic

sequencing primers were designed using the MethPrimer program. Gene-specific

PCR primers for bisulfite sequencing are as follows (5'-3'):

• Galanin Galanin-BS-R2F GTAGTTTTTATTGGGTATAAATA

Galanin-BS-R2R AAAAACAAAACTATAAAAAATACA

• Ng2 Ng2-BS-F TTTGGGGGTTTAAAGATTTAAG

Ng2-BS-R CCAAAATAAAAACCAAAACCA

• Ngb Ngb-BS-F TTTTTTGGGTTGGATTAGTAAAG

Ngb-BS-R ATCAATAACAAACCAAACAATCTC

Tet-Assisted Bisulfite Sequencing (TAB-seq)

200 ng of genomic DNA purified from adult NPCs were treated as described (Yu et

al., 2012). Gene specific PCR primers for TAB-seq were the same as those for

bisulfite sequencing PCR.

Rescue Experiment

Tet1-null single neural progenitor cell suspensions were cultured in the presence of 5

nM Galanin 2-11 (GL Biochem) for 7 days to form neurospheres. The number and

18

diameter of both primary and secondary neurospheres were compared among cell

samples of WT, Tet1 KO and Tet1 KO treated with Galanin 2-11.

Supplemental Reference

Abbosh, C., Lawkowski, A., Zaben, M., and Gray, W. (2011). GalR2/3 mediates

proliferative and trophic effects of galanin on postnatal hippocampal precursors. J

Neurochem 117, 425-436.

Brewer, G.J., and Torricelli, J.R. (2007). Isolation and culture of adult neurons and

neurospheres. Nature protocols 2, 1490-1498.

Liu, P., Jenkins, N.A., and Copeland, N.G. (2003). A highly efficient

recombineering-based method for generating conditional knockout mutations.

Genome research 13, 476-484.

Meissner, A., Gnirke, A., Bell, G.W., Ramsahoye, B., Lander, E.S., and Jaenisch, R.

(2005). Reduced representation bisulfite sequencing for comparative high-resolution

DNA methylation analysis. Nucleic Acids Res 33, 5868-5877.

Qu, Q., Sun, G., Li, W., Yang, S., Ye, P., Zhao, C., Yu, R.T., Gage, F.H., Evans,

R.M., and Shi, Y. (2010). Orphan nuclear receptor TLX activates Wnt/beta-catenin

signalling to stimulate neural stem cell proliferation and self-renewal. Nat Cell Biol

12, 31-40; sup pp 31-39.

Shi, Y., Chichung Lie, D., Taupin, P., Nakashima, K., Ray, J., Yu, R.T., Gage, F.H.,

and Evans, R.M. (2004). Expression and function of orphan nuclear receptor TLX in

adult neural stem cells. Nature 427, 78-83.

19

Tang, F., Barbacioru, C., Nordman, E., Li, B., Xu, N., Bashkirov, V.I., Lao, K., and

Surani, M.A. (2010). RNA-Seq analysis to capture the transcriptome landscape of a

single cell. Nat Protoc 5, 516-535.

Vorhees, C.V., and Williams, M.T. (2006). Morris water maze: procedures for

assessing spatial and related forms of learning and memory. Nat Protoc 1, 848-858.

Yu, M., Hon, G.C., Szulwach, K.E., Song, C.X., Jin, P., Ren, B., and He, C. (2012).

Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine. Nat Protoc 7,

2159-2170.