MUTATION IN BRIEF

HUMAN MUTATION Mutation in Brief #399 (2000) Online

© 2000 WILEY-LISS, INC.

Received 22 October 2000; revised manuscript accepted 15 December 2000.

Cathepsin C Gene: First Compound HeterozygousPatient with Papillon-Lefèvre Syndrome and a NovelSymptomless MutationLuis M. Allende 1, Miguel A. García-Pérez1, Angel Moreno 1, Alfredo Corell1, Miguel Carasol2,Pedro Martínez-Canut3, and Antonio Arnaiz-Villena1*

1Department of Immunology. Hospital 12 de Octubre, Universidad Complutense, Madrid, Spain; 2Department ofOdontology, Universidad Complutense, Madrid, Spain; 3 Department of Odontology, Universidad de Valencia,Spain

*Correspondence to Antonio Arnaiz-Villena, Departamento de Inmunología, Hospital 12 de Octubre, Ctra. deAndalucía, 28041-Madrid, Spain; Tel: 34 91 3908315; Fax: 34 91 3908399; E-mail: aarnaiz@eucmax.sim.ucm.es

Contract grant sponsor: Ministerio de Educación and Comunidad de Madrid; Contract grant number: PM95-57,PM96-21, 06/70/97 and 8.3/14/98.

Communicated by Vladislov Baranov

Papillon-Lefèvre syndrome (PLS) has recently been shown to be caused by mutations in thecathepsin C gene resulting in periodontal disease and palmoplantar keratosis. Thirteendifferent homozygous mutations have been characterised in PLS patients of different ethnicorigin. In the present paper, a PLS patient is described who carries two novel mutations(706G>T and 872G>A) in the paternal and maternal chromosomes, respectively. This is thefirst compound patient described so far. In addition, a novel symptomless mutation(458C>T) in the cathepsin C gene is described in three homozygous individuals. Thus, not allmutations should be considered as a cause of disease, whether case studies or generalpopulation screening is performed. Another already described mutation that provoked theHaim-Munk syndrome (HMS) in Indian Jews has also been found to give rise to PLS in aSpanish family from Madrid. On the other hand, PLS patients are ameliorated by retinoids,which indicates that retinoids may be used as therapeutic agents in this immune systemdeficiency. © 2000 Wiley-Liss, Inc.

KEY WORDS: Cathepsin C; CTSC; Papillon-Lefèvre syndrome; Haim-Munk syndrome; retinoid therapy; CD3 activationpathway

INTRODUCTION

Papillon-Lefèvre syndrome (Papillon and Lefèvre 1924) (PLS, MIM# 245000) is an autosomal recessiveinheritable form of palmoplantar hyperkeratosis combined with premature destruction of the periodontium of thedeciduous and permanent teeth. The frequency of this rare disease is approximately 1-4/million people, withparental consanguinity reported in almost half of PLS cases. Haim-Munk syndrome (Haim and Munk 1965) (HMS,MIM# 245010) is also a palmoplantar keratoderma (PPK) with severe periodontitis and additionally showsarachnodactyly, acroosteolysis and onychogryphosis. PLS and HSM are classified as type IV palmoplantarectodermal keratodermas (Stevens et al., 1996). The PLS immune system alterations were fully characterised by

2 Allende et al.

our group, and we found a defect in the CD28 T-lymphocyte activation pathway and an important decrease of thememory T-cells (CD45R0-positive) (Góngora et al., 1994).

At the end of 1999, two independent groups identified the candidate gene cathepsin C (CTSC; MIM# 602365),whose mutations were responsible for both PLS and HMS (Hart et al., 1999; Toomes et al., 1999). CTSC (ordipeptidyl aminopeptidase I) is a lysosomal protease capable of removing dipeptides from the amino terminus ofprotein substrates. CTSC transcripts are expressed mainly in immune cells including polymorphonuclearleucocytes, alveolar macrophages and their precursors. The enzyme is also essential in the activation of granuleserine proteases expressed in bone marrow-derived immune cells of both myeloid and lymphoid series. Theseproteases are implicated in a wide variety of innate and adaptive immune processes, which might explain a generalincreased susceptibility to infections in about 25% of PLS patients (Góngora et al., 1994). The PLS locus has beenmapped to chromosome 11q14-q21 band (Fischer et al., 1997; Laass et al., 1997; Hart et al., 1998); CTSC genespans 4.7 kb and encodes a 463-amino acid polypeptide that consists of 7 exons. The sequence analysis of CTSCgene from subjects that belong to consanguineous families and were affected with PLS and HMS revealedhomozygous sequence changes in all the patients (Toomes et al., 1999; Hart et al., 1999, 2000a, 2000b). CTSCmutations are distributed preferentially in exons 5-7, suggesting that this region is crucial for enzyme activity(Table 1).

In the present paper, we report the first compound heterozygous in the cathepsin C gene that causes Papillon-Lefèvre syndrome and a new symptomless point mutation at exon 3 and describe retinoids receptor motifs in thepromoter region of the gene.

MATERIALS AND METHODS

Patients and lymphocyte stimulation

Two PLS Spanish families were included in our study. The parents of C (Family 1) are unrelated and were bornin Alicante (Spain western coast), the parents of A (Family 2) are first cousins and were born in Madrid (Spain)(Góngora et al., 1994). The clinical diagnosis of PLS was based on the presentation of severe early onsetperiodontitis as well as on the appearance of hyperkeratosis on the palmar and plantar surfaces. Blood wascollected from the patients and their relatives after informed consent was obtained. Stimulation of peripheral bloodmononuclear cells (PBMCs) with anti-CD3 antibody and anti-CD3 with retinol was carried out as detailed inAllende et al. (1997).

Populations

The novel PLS/HMS mutations have been screened in the following populations: healthy unrelated Spaniardsfrom Madrid (n=50), healthy unrelated Moroccans from El Jadida (Morocco) (n=31) (Gómez-Casado et al., 2000),healthy unrelated Jews from Tel-Aviv (Israel) (n=36, 14 Ashkenazi and 22 non- Ashkenazi) (Martínez-Laso et al.,1996), healthy unrelated Algerians from Algiers (Algeria) (n=41) (Arnaiz-Villena et al., 1995).

Mutation analysis

DNA and cytoplasmic RNA were extracted from peripheral blood lymphocytes of the patients and their familymembers by using standard methods (Allende et al., 2000). Reverse transcription was done on 0,5 µg ofcytoplasmic RNA, using a one step RT-PCR method (Gibco BRL), by using specific primers for the reaction thatcover all the CTSC coding sequence. The primers used were: PLS(1) (a) 5’-CACCTCTTTTCTCAGCTCCC and(b) 5’-TTCCCCTTTACAACTGATGC and sequence variation were screened by direct cycle sequencing andconfirmed inserting the purified fragment into the TA-cloning kit (Invitrogen, Groningen, Netherlands). Ligation,transformation and identification of recombinant colonies were carried out according to manufacturer’srecommendations. Double-stranded DNA templates were sequenced using the dideoxy chain-terminator method ofSanger, with Applied Biosystems DyeDeoxy terminators (Allende et al., 2000).

Mutation analysis in populations

The segregation of the mutations within families and the presence of the mutation in controls were tested byPCR amplification of the exons. The already described non-conservative Q286R mutation (Hart et al., 2000a)(family 2) creates an AvaI restriction site at position 857, exon 6, (see Table 1). After amplification of a 150 bpfragment by using specific primers designed on genomic DNA (Toomes et al., 1999) (E6 forward 5’-

Cathepsin C Mutations 3

CATCGCCAGCATCCTGTGGC and E6 reverse 5’-AACACTTACCTTGAGCATAC), the PCR products werepurified using the QIAquick PCR purification kit (Qiagen, Germany). The purified fragments were eluted andseparated by electrophoresis in an 1.5% agarose gel. Amplification of the wild type sequence results in a 150 bpproduct that is not cleaved by AvaI. The amplified product of the mutated sequence (857A>G) was cleaved withAvaI (Promega, Madison, WI) giving two products of 108 and 42 bp.

The strategy for detecting the non-conservative D236Y paternal novel mutation (family 1) consisted of usingthe restriction enzyme RsaI (Promega, Madison, WI) that creates a restriction site at position 706, exon 5, (Table1). After amplification of 132 bp fragment using specific primers designed on genomic DNA (Toomes et al.,1999): E5 forward 5’-CCTTTCTAGGCCCAAACCTGC and E5 reverse 5’-TTTTTACCTTGGTTTCGAAC, theamplified product of the mutated sequence (706G>T) was cleaved with RsaI (10 U, 6 hours at 37o C) giving twoproducts of 72 and 60 bp. SSCP was used for detecting the non-conservative C291Y maternal new mutation,family 1, (Table 1) with the same pair of primers designed for the amplification of exon 6 (E6 forward and E6reverse, see above). The PCR product (150 bp) were heat-denatured, electrophoresed on a non-denaturingpolyacrilamide gel and visualized by silver staining. This mutation was detected as an SSCP variant.

Conservative and symptomless T153I new mutation (Table 1) was also analysed using SSCP assays. Theprimers designed for the amplification of exon 3 were: E3 forward 5’-TGTTTGCAGTATAAAGAAGAG and E3reverse 5’-GCAACTCACTTTTCCTGAGAA. The mutated PCR product (458C>T, 183bp of size) was alsodetected as an SSCP variant in 50 Spaniards sample: 34 wild type, 13 heterozygous and 3 homozygous individuals.

Statistical analysis

Student’s t-tests were performed for the comparison of two independent samples of equal size and theircorresponding P values were determined.

RESULTS AND DISCUSSION

Symptomatic mutations

We have carried out a systematic mutation search of PCR-amplified transcripts (Arnaiz-Villena et al., 1992;Allende et al., 2000) of the CTSC gene from two patients with Papillon-Lefèvre syndrome. Mutation analysis infamily 1 revealed the first compound heterozygous patient (C) in a non consanguineous family where the patientshowed the clinical features of Papillon-Lefèvre syndrome. The parents were heterozygous for each mutation andwithout identifiable characteristics of PPK nor did have a history of severe, early onset periodontitis. Themutations include two missense changes: the non-conservative paternal mutation (706G>T) in exon 5 changesD236Y (Genbank AF234264), and the non-conservative maternal’s one (872G>A) in exon 6 changes C291Y(Genbank AF254757). Both changes are responsible for the Papillon-Lefèvre syndrome and they have beenreported in this work for the first time, none of the 50 controls (Spaniards) tested were found to bear thesemutations (Table 1).

Asymptomatic mutations

During our search for mutations in the CTSC gene, we disclosed a single-nucleotide substitution in C’s fathermRNA as a single heterozygous change (Table 1). This novel conservative change is located in exon 3 (458C>T,T153I; Genbank AF234263) and it is the first polymorphism described in CTSC gene up until now. Three factssupport that this mutation may be considered as a symptomless polymorphism: firstly, although both changes infather´s mRNA (458C>T and 706G>T) were found in different chromosomes, the father did not manifest anyfindings of periodontitis or PPK; secondly, this point change was present at a relative high frequency (19%) in thecontrol population tested (50 Spaniards); and thirdly, we have found 3 homozygous healthy controls for thismutated allele. This may indicate that the region codified by exon 3 is not crucial for the enzyme activity of theCTSC protein or otherwise that the conservative amino acid change is not functionally important. The existence ofsymptomless mutations in the cathepsin C gene should be taken into account when case studies or generalpopulation screening are carried out.

4 Allende et al.

Table 1. Mutations described in the cathepsin C gene in the present work.

Patient/Family

Site Mutation Amino acid Effect Frequency in Spanishpopulation (%)

Disease

C’sfather/1

Exon 3 458C>TMissense

T153I Polymorphism 81 % allele C19 % allele T

Symptomlesshomozygous

(3 cases)C/1 Exon 5 706G>T

MissenseD236Y Paternal

Mutation100 % allele G

0 % allele TPapillon-Lefèvre

syndromeC/1 Exon 6 872G>A

MissenseC291Y Maternal

Mutation100 % allele G0 % allele A

compound

A/2 Exon 6 857A>GMissense

Q286R HomozygousMutation

100 % allele A0 % allele G

Papillon-Lefèvresyndrome

homozygous**This mutation has given rise to Haim-Munk disease in Cochin (India) Jews

Cochin (India) Jews and Spaniards (of probably Jewish origin) share the same cathepsin C gene mutations

The parents of the affected subject in family 2 are first cousins and were born in Madrid (Spain), this classicalPLS patient (A) shows the same homozygous change (857A>G) that there was been published in Jewish HMSpatients from Cochin, India (Hart et al., 2000a). This further stresses that the Jewish genetic background inAshkenazi, non-Ashkenazi and other Jewish groups have remained stable after their Diasporas (387 years BC and70 years AD). The same genetic background was found in Central European and Mediterranean Jews by usingHLA (histocompatibility antigens) markers (Martínez-Laso et al., 1996). In this paper, we find the same cathepsinC mutations in Spain (Sepharad for the Jews) from which the Jews were expelled in 1492. Many Jews did notleave Spain in 1492 and forcely “converted” to Christianity (Martínez-Laso et al., 1996). This Spanish PLS familymay well be of Jewish origin. This is the first report that shows exactly the same non-conservative change in ourSpanish PLS patient (A) at the same base and codon (857A>G and Q286R, respectively) that the one described inCochin-Jewish HMS patients. Other authors have reported a different change (856C>T; Q286X) at the same codonin PLS Turkish subjects (Hart et al., 2000a). Thus, we also suggest, like other authors (Hart et al., 2000a), that theHMS and PLS are clinical variants of the same homozygous cathepsin C gene mutation.

Table 2. Restriction enzyme (Ava I) analysis of Q286R mutation in different Mediterranean populations

Population(Country)

Number ofUnrelated donors

Frequency of Q286Rmutation (0%)

Spaniards (Spain) 50 0Moroccans (Morocco) 31 0

Jews (Israel) 36 0Algerians (Algeria) 41 0

Total 158 0

A part of the Cochin Jews named “White Jews” apparently reached India from Middle East, North Africa, andSpain in the 17th and 18th centuries (Faigin 2000). To test the origin of this mutation (857A>G) we analyseddifferent Mediterranean populations using restriction analysis with AvaI (Table 2). No heterozygous individualappeared of the total of 158 analysed individuals. This may be due to that PLS and HMS is a rare disease with avery low incidence.

The symptomatic mutations described in this report are in the region encoding for the enzymatic active centerand each replaces and amino acid that is highly conserved across species (Hart et al., 2000a) (Table 1). It is likelythat such mutations would cause a conformational alteration that may decrease or abolish the activity of the CTSCprotein.

Effect of retinoids in Papillon-Lefèvre Syndrome

The finding of identical mutations in the germline of individuals with two distinct clinical syndromes (PLS andHMS) gives rise to a number of speculations. PLS and HMS might represent a variable spectrum of the same

Cathepsin C Mutations 5

primary disorder, as data from our group and others (Hart et al., 2000a) suggest. However, other modulatorygenetic or epigenetic factors might be responsible for the phenotypic differences seen in the two disorders. Wewould put forward that one of these factors could be present in diet. The fact that retinoids (vitamin A derivatives)have been used to ameliorate PLS patients symptoms (our patients has been successfully treated with retinoids)could be one of the factors that might explain the phenotypic differences of both PLS and HMS syndromes. In aprevious study (Allende et al., 1997), the effect of retinoids on PBMCs from PLS patients were tested, showingthat retinol is an important cofactor in the improvement of the CD3-induced T-lymphocyte activation (Table 3).This effect is specifically observed in the CD3 biochemical transduction pathway, probably by specific inductionof nuclear retinoid receptors. Therefore, vitamin A is an ‘anti-infective vitamin’ having importantimmunoregulatory functions involving T (Table 3) and B lymphocytes, natural killer cells and polymorphonuclearleucocytes (Semba et al., 1993).

Table 3. Effect of retinoids on CD3-induced PBMC proliferation*

Patient+ CD3 CD3+Retinoids pC 15,727±2,508 32,382±2,555 0.0138A 19,242±2,812 52,578±2,337 <0.0001

Controls (n=32) 38,400±26,000 61,100±39,000 0.0042* Data expressed as mean ± standard deviation in c.p.m. (3H-thymidine incorporation)+ The results shown in the patients are representative of three independent experiments(see Materials and Methods and Allende et al., 1997)

These and other results support the in vivo therapeutic use of retinoids to ameliorate certain primary andsecondary immunodeficiencies. Finally, the thought of finding a functional basis for retinoid treatments of PLSpatients is intriguing and should be pursued. It is noteworthy that ten retinoic acid response elements (RAREs) arefound in the CTSC gene promoter region (results not shown; Hyckstein et al., 1992; Rao et al., 1997); this couldexplain the therapeutic response of Papillon-Lefevre patients to retinoids.

REFERENCES

Allende LM, Corell A, Madroño A, Góngora R, Rodríguez-Gallego C, López-Goyanes A, Rosal M, Arnaiz-Villena A. 1997.Retinol (vitamin A) is a cofactor in CD3-induced human T-lymphocyte activation. Immunology 90: 388-396.

Allende LM, Hernández M, Corell A, García-Pérez MA, Varela P, Moreno A, Caragol I, García-Martín F, Guillén-Perales J,Olive T, Español T, Arnaiz-Villena A. 2000. A novel CD18 genomic deletion in a patient with severe leucocyte adhesiondeficiency: a possible CD2/lymphocyte function-associated antigen-1 functional association in humans. Immunology 99:440-450.

Arnaiz-Villena A, Benmamar D, Alvarez M, Díaz-Campos N, Varela P, Gómez-Casado E and Martínez-Laso J. 1995. HLAallele and haplotype frequencies in Algerians. Hum Immunol 43: 259-268.

Arnaiz-Villena A, Timón M, Corell A, Pérez-Aciego P, Martín-Villa M, Regueiro JR. 1992. Primary immunodeficiency causedby mutations in the gene encoding the CD3-gamma subunit of the T-lymphocyte receptor. N Engl J Med 327: 529-533.

Bairoch A. University of Geneva. Switzerland. (TM) Intelligenetics Inc. Release 6.85. 1995.

Faigin DP. 2000. “Who are the Jews of India, and what are their origins”. In: http://www.landfield.com/faqs/judaism/FAQ/07-Jews-As-Nation/section-10.html

Fischer J, Blanchet-Bardon C, Prud’homme JF, Pavek S, Steijlen P, Dubertret L, Weissenbach J. 1997. Mapping of Papillon-Lefèvre syndrome to the chromosome 11q14 region. Eur J Hum Genet 5: 156-160.

Gómez-Casado E, del Moral P, Martínez-Laso J, García-Gómez A, Allende LM, Silvera-Redondo C, Longas J, González-Hevilla M, Kandil M, Zamora J, Arnaiz-Villena. 2000. HLA genes in Arabic-speaking Moroccans: close relatedness toBerbers and Iberians. Tissue Antigens 55: 239-249.

6 Allende et al.

Góngora R, Corell A, Regueiro JR, Carasol M, Rodríguez-Gallego C, Paz-Artal E, Timón M, Allende LM, Arnaiz-Villena A.1994. Peripheral blood reduction of memory (CD29+, CD45R0+, and ‘bright’ CD2+ and LFA-1+) T lymphocytes in Papillon-Lefèvre syndrome. Hum Immunol 41: 185-192.

Haim S & Munk J. 1965. Keratosis palmo-plantaris congenita, with periodontitis, archnodactyly and peculiar deformity of theterminal phalanges. Br J Dermatol 77: 42-54.

Hart TC, Bowden DW, Ghaffar KA, Wang W, Cutler WC, Cebeci I, Efeoglu A, Firatli E. 1998. Sublocalization of the Papillon-Lefèvre syndrome locus on 11q14-q21. Am J Med Genet 79: 134-139.

Hart TC, Hart PS, Bowden DW, Michalec MD, Callison SA, Walker SJ, Zhang Y, Firatli E. 1999. Mutations of the cathepsin Cgene are responsible for Papillon-Lefèvre syndrome. J Med Genet 36: 881-887.

Hart TC, Hart PS, Michalec MD, Zhang Y, Firatli E, Van Dick TE, Stabholz A, Zlorogorski A, Shapira L, Soskolne WA.2000a. Haim-Munk syndrome and Papillon-Lefèvre syndrome are allelic mutations in cathepsin C. J Med Genet 37: 88-94.

Hart TC, Hart PS, Michalec MD, Zhang Y, Marazita ML, Cooper M, Yassin OM, Nusier M, Walker S. 2000b. Localisation of agene for prepubertal periodontitis to chromosome 11q14 and identification of a cathepsin C gene mutation. J Med Genet 37:95-101.

Hickstein DD, Baker DM, Gollahon KA, Back A. 1992. Identification of the promoter of the myelomonocytic leukocyteintegrin CD11b. Proc Natl Acad Sci USA 89: 2105-2109.

Laass MW, Hennies HC, Preis S, Stevens HP, Jung M, Leigh IM, Wienker TF, Reis A. 1997. Localisation of a gene forPapillon-Lefèvre syndrome to chromosome 11q14-q21 by homozygosity mapping. Hum Genet 101: 376-382.

Martínez-Laso J, Gazit E, Gómez-Casado E, Morales P, Martínez-Quiles N, Alvarez M, Martín-Villa M, Fernández V, Arnaiz-Villena A. 1996. HLA DR and DQ polymorphism in Ashkenazi and non-Ashkenazi Jews: comparison with otherMediterraneans. Tissue Antigens 47: 63-71.

Papillon MM & Lefèvre P. 1924. Deux cas de keratodermie palmaire et plantaire symetrique familiale (maladie de Meleda)chez le frere et la soeur. Coexistence dans les deux cas d’alterations dentaires graves. Bull Soc Fr Dermatol Syphilis 31: 82-87.

Rao NV, Rao GV, Hoidal JR. 1997. Human dipeptidyl-peptidase I. Gene characterization, localization, and expression. J BiolChem 272: 10260-10265.

Semba RD, Muhilal, Ward BJ, Griffin DE, Scott AL, Natadisastra G, West KP Jr, Sommer A. 1993. Abnormal T-cell subsetproportions in vitamin-A-deficient children. Lancet 341: 5-8.

Stevens HP, Kelsell DP, Bryant SP, Bishop DT, Spurr NK, Weissenbach J, Marger D, Marger RS, Leigh IM. 1996. Linkage ofan American pedigree with palmoplantar keratoderma and malignancy (palmoplantar ectodermal dysplasia type III) to17q24. Literature survey and proposed updated classification of the keratodermas. Arch Dermatol 132: 640-651.

Toomes C, James J, Wood AJ, Wu CL, McCormick D, Lench N, Hewitt C, Moynihan L, Roberts E, Woods CG, Markham A,Wong M, Widmer R, Ghaffar KA, Pemberton M, Hussein IR, Temtamy SA, Davies R, Read AP, Sloan P, Dixon MJ,Thakker NS. 1999. Loss-of-function mutations in the cathepsin C gene result in periodontal disease and palmoplantarkeratosis. Nat Genet 23: 421-424.