EUKARYOTIC CELL, Apr. 2003, p. 274–283 Vol. 2, No. 21535-9778/03/$08.00�0 DOI: 10.1128/EC.2.2.274–283.2003Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Budding Yeast CTDK-I Is Required for DNADamage-Induced Transcription

Denis Ostapenko and Mark J. Solomon*Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine,

New Haven, Connecticut 06520-8024

Received 23 December 2002/Accepted 6 January 2003

CTDK-I phosphorylates the C-terminal domain (CTD) of the large subunit of yeast RNA polymerase II ina reaction that stimulates transcription elongation. Mutations in CTDK-I subunits—Ctk1p, Ctk2p, andCtk3p—confer conditional phenotypes. In this study, we examined the role of CTDK-I in the DNA damageresponse. We found that mutation of individual CTDK-I subunits rendered yeast sensitive to hydroxyurea(HU) and UV irradiation. Treatment with DNA-damaging agents increased phosphorylation of Ser2 within theCTD repeats in wild-type but not in ctk1� mutant cells. Using microarray hybridization, we identified geneswhose transcription following DNA damage is Ctk1p dependent, including several DNA repair and stressresponse genes. Following HU treatment, the level of Ser2-phosphorylated RNA polymerase II increased bothglobally and on the CTDK-I-regulated genes. The pleiotropic phenotypes of ctk mutants suggest that CTDK-Iactivity is essential during large-scale transcriptional repatterning under stress and unfavorable growthconditions.

The large subunit of RNA polymerase II contains a con-served C-terminal domain (CTD) composed of a heptapeptidemotif, YSPTSPS, repeated 26 to 52 times in different species(7). The CTD plays an important role in transcription, asdeletions or mutations within the repeat lead to conditionalphenotypes and loss of viability (30). The CTD is phosphory-lated during transcription initiation at two serine residues, Ser2and Ser5. Both Ser residues are essential for viability, thoughtheir functions have been separated genetically and biochem-ically (21, 34, 44). Cross-linking experiments have revealed thatphosphorylation of Ser5 occurs during transcription initiation,whereas phospho-Ser2 is associated with elongating poly-merases (21). CTD phosphorylation regulates the interactionof the polymerase with components of the preinitiation com-plex, transcription elongation factors, and RNA processingfactors (5, 28, 32, 42).

Extensive biochemical analyses have identified numerousprotein kinases specific for the CTD. In Saccharomyces cerevi-siae, Ctk1p and Srb10p phosphorylate Ser2; Kin28p, Srb10p,and Bur1p phosphorylate Ser5 (2, 6, 11, 15, 29). The functionaloutputs of these events vary: Kin28p is required for transcrip-tion initiation, whereas phosphorylation by Srb10p inhibitstranscription (15). Ctk1p assembles with Ctk2p, a cyclin-likeprotein, and Ctk3p into a three-subunit complex, CTDK-I(40). The purified complex increases the rate of transcriptionelongation in vitro (26). The CTK genes are not essential forviability, but mutants exhibit slow-growth and cold-sensitivephenotypes (25). Interestingly, environmental signals can in-fluence the extent of Ser2 phosphorylation, which increaseswhen yeast cells prepare to enter stationary phase (34). Thisincrease is mediated by Ctk1p and is thought to activate genes

in stationary phase (33). The Fcp1p phosphatase dephospho-rylates phospho-Ser2 at the end of the transcription cycle (4,20).

Yeast cells exposed to diverse environmental conditions ad-just their transcription program by coordinate activation andrepression of multiple genes. For example, exposure of cells togenotoxic agents leads to induction of DNA repair and envi-ronmental stress response genes (12, 18). Interestingly, thetranscription profile induced by DNA damage overlaps withthat caused by transition into stationary phase (17). In thisstudy, we observed that mutation of CTK genes rendered yeastcells sensitive to UV irradiation and hydroxyurea (HU). Wefound that DNA-damaging agents increased phosphorylationof the CTD on Ser2 in a Ctk1p-dependent manner. Usingmicroarray hybridization, we identified genes regulated byCtk1p. Several of these Ctk1-dependent genes are required forDNA repair and environmental stress responses.

MATERIALS AND METHODS

Yeast strains and growth conditions. Yeast strains were derivatives of W303a(ade2-1 trp1-1 leu2-3,112 his3-11,15 ura3-1) (36). Yeast transformations wereperformed as described previously (13). Yeast cultures were grown in yeastextract-peptone-dextrose (YPD) medium and in synthetic complete (SC) me-dium lacking individual amino acids. Cells were treated with DNA-damagingagents in YPD medium in the presence of 0.03% methylmethane sulfonate(MMS) or 0.1 M HU for the times indicated in the figure legends. To imposemild amino acid starvation, cells grown in SC medium (optical density at 600 nm[OD600], �0.5) were collected by centrifugation and inoculated at the samedensity into synthetic minimal medium lacking most amino acids and adenine(YNB-AA, 2% glucose, 20 mg each of uracil, histidine, tryptophan, and leucineper liter).

The ctk1� strain (W303a ctk1�::HIS3) was a kind gift of Opher Gileadi(Weizmann Institute of Science, Rehovot, Israel) (19). A functional copy ofCTK1 was a kind gift of Arno Greenleaf (Duke University, Durham, N.C.) (25).The CTK1 coding sequence was reamplified and hemagglutinin (HA) tagged byPCR with primers MSO776 (5�-GGGGATCCATGTCCTACAATAATGGC-3�)and MSO778 (5�-CCCTGCAGTTATCAGCCCAAGCTAGCGTAGTCAGGAACGTCATATGGATAGGCGCCTTTATCATCATCGTCATTATT-3�) (un-derlined residues correspond to introduced restriction sites). All PCR products

* Corresponding author. Mailing address: Department of MolecularBiophysics and Biochemistry, Yale University School of Medicine, 333Cedar St., New Haven, CT 06520-8024. Phone: (203) 737-2702. Fax:(203) 785-6404. E-mail: Mark.Solomon@yale.edu.

274

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

were sequenced to verify that no additional mutations were introduced. Theamplified fragment was inserted between the BamHI and PstI sites in YCplac22(14), yielding YCplac22-CTK1-HA, which rescued the cold-sensitive phenotypeof ctk1� cells.

Deletion of ctk2 (W303a ctk2�::URA3) was achieved by transforming ctk2�-YIplac211 into W303a. ctk2�-YIplac211 contained 200 bp from the noncoding 5�end and 200 bp from the noncoding 3� end of CTK2 to replace the genomic copyof CTK2 with URA3. The resulting URA� clones exhibited a cold-sensitivephenotype. Gene disruption was verified by PCR. CTK2 was tagged with the HAepitope by PCR amplification with primers MSO862 (5�-CTCGTTTCGCAATGGTTAGCG-3�) and MSO937 (5�-AAGGATCCTTATCAGCCCAAGCTAGCGTAGTCAGGAACGTCATATGGATAGGCGCCTGCATGTCTTGTAGAACTATTTATGC-3�). The amplified fragment was digested with BamHI andcloned into YCplac22. The resulting YCplac22-CTK2-HA plasmid rescued thecold-sensitive phenotype of ctk2� cells.

Deletion of ctk3 (W303a ctk3�::URA3) was achieved by transforming ctk3�-YIplac211 into W303a. ctk3�-YIplac211 contained URA3 flanked by 200 bp fromthe noncoding 5� end and 200 bp from the noncoding 3� end of CTK3 to replacethe genomic copy of CTK3 with URA3. The resulting URA� clones exhibited acold-sensitive phenotype. Gene disruption was verified by PCR. CTK3 wastagged with a Myc epitope by PCR amplification using primers MSO864 (5�-TGATGGGGCCCTACAACTACTTAC-3�) and MSO972 (5�-AACTGCAGTTATCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGGCGCCATATATGTAAGATGCCTTCGCAAT-3�). The amplified fragment was digested withPstI and cloned into YCplac22. The resulting YCplac22-CTK3-Myc plasmidcomplemented the cold-sensitive phenotype of ctk3� cells.

Extract preparation and immunoblotting. For protein extracts, cells from25-ml cultures (OD600, �0.6) were collected, washed with ice-cold Tris-bufferedsaline (TBS; 10 mM Tris-Cl [pH 8.0]–150 mM NaCl), and suspended in 0.4 ml oflysis buffer [200 mM Tris-Cl (pH 8.0), 320 mM (NH4)2SO4, 5 mM MgCl2, 10 mMEDTA, 20% glycerol, 10 �g each of leupeptin, chymostatin, and pepstatin(Chemicon) per ml, 1 mM dithiothreitol (DTT)]. Cells were lysed by shakingyeast suspensions with 0.5 g of glass beads (diameter, 0.5 mm; Sigma) in a beadbeater (Biospec Products) for five 30-s pulses with 30 s on ice between pulses.Glass beads and cell debris were removed by centrifugation at 14,000 rpm in aMicrofuge at 4°C for 10 min. The supernatant was clarified by centrifugation at65,000 rpm in a TLA 100.2 rotor (Beckman) for 10 min at 4°C. Protein concen-trations were determined by using the Bradford assay (Bio-Rad) with bovineserum albumin (BSA) as a standard. Yeast extracts were aliquoted, frozen inliquid nitrogen, and stored at �80°C.

For analysis of RNA polymerase, 5 �g of yeast protein extracts was separatedon sodium dodecyl sulfate (SDS)-polyacrylamide gels (6% total acrylamide) andtransferred to Immobilon-P membranes (Millipore). To detect phosphospecificisoforms, membranes were first incubated with antibody H5 or H14 (both fromCovance) at 1 �g/ml in TBST-BSA (TBS–0.1% Tween 20–3% BSA) overnight at4°C and then probed with anti-mouse immunoglobulin M (IgM) coupled tohorseradish peroxidase (500 ng/ml; Pierce). To detect unphosphorylated poly-merase, membranes were first incubated with 8WG16 antibodies (1 �g/ml; Co-vance) in TBST-BSA overnight at 4°C and then probed with anti-mouse IgG2acoupled to horseradish peroxidase (500 ng/ml; Pierce). Proteins were detected bychemiluminescence (SuperSignal; Pierce).

RNA isolation. Cells from 100-ml cultures (OD600, �0.5) were collected,frozen in liquid nitrogen, and stored at �80°C until RNA preparation. TotalRNA was isolated by an acid lysis protocol as described previously (38). Briefly,frozen cells were thawed, resuspended in 1.5 ml of lysis buffer (10 mM Tris-Cl[pH 7.5]–10 mM EDTA–0.5% SDS), and incubated with 1.5 ml of acidic phenol(pH �4.5; Gibco BRL) for 1 h at 65°C with brief vortexing every 10 min.Aqueous phases were extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and chloroform-isoamyl alcohol (24:1). RNA was ethanol precipitated for3 h at �20°C, centrifuged at 10,000 rpm for 15 min at 4°C in an SS34 rotor(Sorval), washed with 70% ethanol, and resuspended in 300 �l of H2O treatedwith diethyl pyrocarbonate (Sigma). The RNA concentration was determinedspectrophotometrically.

Northern blot hybridization. For hybridization analysis, 20 �g of RNA waselectrophoresed on 1% formaldehyde-agarose gels and transferred to Gene-Screen membranes (NEN Life Science Products), as described previously (37).The membranes were probed with short DNA fragments labeled with[�-32P]dCTP by using a random priming kit (Roche). Hybridizations were car-ried out for 10 h at 42°C in 5� SSPE (1� SSPE is 0.18 M NaCl, 10 mMNaH2PO4, and 1 mM EDTA [pH 7.7])–50% formamide–5� Denhardt’s solu-tion–1% SDS–10% dextran sulfate. The filters were washed sequentially with 200ml of 2� SSPE for 15 min at 23°C, 2� SSPE–1% SDS at 65°C for 45 min (twice),

and 0.1� SSPE for 15 min at 23°C and were then exposed to PhosphorImagerscreens (Molecular Dynamics) and autoradiography.

Microarray hybridization and analysis. For microarray hybridization, totalRNA was further purified with the RNeasy kit (Qiagen), and mRNA was isolatedby using an Oligotex column (Qiagen). To synthesize Cy-labeled probes, 2 �g ofmRNA and 2 �g of oligo(dT)15-18 were denatured at 70°C for 10 min andassembled with 8 �l of first-strand buffer (Life Technologies), 2 �l of de-oxynucleoside triphosphate mixture (2 mM [each] dATP, dGTP, and dTTP, and1 mM dCTP), 4 �l of 0.1 M DTT, 3 �l of Cy3 or Cy5 conjugated to dCTP (1 mM;Amersham), and 2 �l of Superscript II (200 U/�l; Life Technologies) in a 40-�lreaction volume. Reaction mixtures were incubated for 2 h at 42°C, cooled brieflyto 4°C, and treated with 1 �l of RNase H (200 U/�l; Gibco) and 1 �l of RNaseA (200 U/�l; Roche) for 15 min at 37°C. Synthesized Cy3- and Cy5-labeledprobes were combined and purified from unincorporated nucleotides by reten-tion on Microcon YM-30 columns (Amicon). Cy-labeled probes were adjusted to50% formamide–5� SSC (1� SSC is 0.15 M NaCl plus 0.015 M sodium citrate)–0.1% SDS–50 �g of poly(A) (Sigma) per ml, denatured at 94°C for 4 min, andspotted onto a custom-made yeast whole-genome microarray (8). Hybridizationwas carried out in a CMT hybridization chamber (Corning) at 50°C for 10 h. Themicroarray was washed sequentially with 100 ml of 2� SSC–0.1% SDS at 42°Cfor 1 min, 0.1� SSC–0.1% SDS at 23°C for 5 min (twice), and 0.1� SSC at 23°Cfor 2 min (twice). The microarray was dried in a stream of nitrogen and read ona GenePix4000A laser scanner (Axon Instruments Inc.).

The fold change for every gene was calculated as an average of pixel-by-pixelratios by using GenePix Pro software (Axon Instruments Inc.). Data shownrepresent means from at least two hybridization experiments, including swappingof Cy3 and Cy5 probes. Clustering analysis was performed with the Cluster andTreeView programs developed by Michael Eisen, Lawrence Berkeley NationalLab (available at http://rana.stanford.edu/software). We used K-mean clusteringto demonstrate the minimal number of clusters with fundamentally differentpatterns. Annotations for gene function were from the Yeast Proteome Data-base. The data represent background-corrected log2 values of the red/green ratiomeasured for each gene. A full set of genes and their fold changes in texttab-delimited format are available from the authors.

Chromatin immunoprecipitation. Chromatin cross-linking and immunopre-cipitation were performed as previously described (21, 24, 39, 41). Briefly, 100-mlcultures (OD600, �0.8) were treated with 1% formaldehyde for 17 min at 23°Cand quenched by addition of 240 mM glycine for 5 min at 23°C. Cells werecollected and washed twice with ice-cold TBS. Cells were lysed by shaking yeastsuspensions with an equal volume of glass beads (diameter, 0.5 mm; Sigma) in500 �l of FA buffer (50 mM HEPES-KOH [pH 7.5], 150 mM NaCl, 1 mMEDTA, 0.1% sodium deoxycholate, 0.1% SDS, 10 �g each of leupeptin, chymo-statin, and pepstatin [Chemicon] per ml) for 45 min at 4°C. Cell extracts wereseparated from glass beads and sonicated as described previously (41). Theextracts were adjusted to 800 �l with FA buffer, clarified by centrifugation at70,000 rpm in a TLA 100.2 rotor (Beckman) for 20 min at 4°C, aliquoted, andstored at �80°C.

For chromatin immunoprecipitation, 50 �l of protein A Dynabeads (Dynal)was coupled to 25 �g of a monoclonal antibody against RNA polymerase II (H5or H14; Covance). The beads were incubated with 100 �l of yeast extracts in 400�l of FA buffer for 3 h at 4°C. Bead-protein complexes were washed twice for 7min with 1 ml of FA buffer, twice with FA buffer containing 500 mM NaCl, oncewith 10 mM Tris-Cl (pH 8.0)–1 mM EDTA–250 mM LiCl–0.5% NP-40, and oncewith 10 mM Tris-Cl (pH 8.0)–1 mM EDTA, by using a magnetic particle con-centrator (Dynal). To elute precipitated material, the beads were heated in 400�l of 25 mM Tris-Cl (pH 7.5)–10 mM EDTA–0.5% SDS at 65°C for 10 min.Formaldehyde cross-links were reversed by incubation with 20 �g of proteinaseK (Roche) for 1 h at 42°C, followed by 5 h at 65°C. The eluted DNA was purifiedwith phenol-chloroform, precipitated with ethanol, dissolved in 400 �l of 10 mMTris-Cl (pH 8.0)–1 mM EDTA, and stored at �20°C.

For quantitative PCR, 1 �l of the immunoprecipitated DNA or 0.01 �l of theinput material was used. PCR mixtures (25 �l) contained 0.5 �M primers, 0.1mM deoxynucleoside triphosphates, 2 �Ci of [�-32P]dCTP (3,000 Ci mmol�1),1� PCR buffer, and 0.5 U of Taq polymerase (Roche). Cycling was performedfor 20 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C. PCR products wereresolved on 7% polyacrylamide–Tris-borate-EDTA gels and visualized by auto-radiography.

Primers were 24- to 26-mers designed to amplify DNA fragments within thepromoter region and immediately downstream of the transcription start site.Numbers in primer designations are relative to the gene coding sequence. Thechromosome V intergenic primers were located between YEL073C andYEL072W. Primer sequences were as follows: FLR�160, 5�-ATGGGCGGGATAATTAGTCAGGTA; FLR1�112, 5�-TTCTTGTTTCATCTTCACGGGCAC;

VOL. 2, 2003 CTDK-I 275

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

GTT2�165, 5�-CTTCAGTTTCTCCGTTCCGTGTCC; GTT2�183, AGGCTTCTTGTGCTCTCCCTTCCA; YNL134C�103, TGCCGTTTTCTTCCTCTCACTTCT; YNL134C�160, ATCAATATGTTTCCAATCGGTAGGG; ADH1�195, 5�-GGTATACGGCCTTCCTTCCAGTTAC; ADH1�155, 5�-TGCCAAGCGTGCAAGTCAGTGTGA; Intergenic ChrV-F, AGAGGTGATGGTGATAGGCGTTGAGT; Intergenic ChrV-R, TGGCCCTTGTTATGATGTACCTGTTTA.

RESULTS

Mutations of CTK genes render yeast sensitive to DNA dam-age. Genes encoding subunits of CTDK-I are not essential forviability, but mutants exhibit growth-impaired cold-sensitivephenotypes (40). In an attempt to identify additional roles forCTDK-I, we examined the viability of ctk mutants under var-ious growth conditions. We found that yeast strains carryingdeletions of individual CTK genes were unable to grow in thepresence of the DNA synthesis inhibitor HU (Fig. 1). Dele-tions of CTK1, CTK2, or CTK3 produced similar phenotypes,consistent with a common function within CTDK-I. Plasmidscarrying functional copies of the disrupted genes comple-mented the HU sensitivity. These ctk mutants were also sen-sitive to UV irradiation (Fig. 1) and slightly sensitive to MMS(data not shown). A single amino acid substitution within theCtk1p catalytic domain, Asp324 to Asn324, rendered yeast sen-sitive to both HU and UV irradiation, indicating that proteinkinase activity is essential for this function (data not shown).Therefore, it appears that CTDK-I has a specialized role in theDNA damage response.

Phosphorylation of the CTD at Ser2 increases after DNAdamage. The sensitivity of ctk cells to genotoxic agents sug-gested that CTD phosphorylation is required for the DNAdamage response. To test whether DNA damage alters RNApolymerase II phosphorylation, wild-type cells were treatedwith HU for different times, and resulting protein extracts werecompared. Various CTD isoforms were detected by usingmonoclonal antibodies that recognize phospho-Ser2, phospho-Ser5, and unphosphorylated polymerase. As seen in Fig. 2A,HU treatment increased phosphorylation of Ser2, whereas lev-els of phospho-Ser5 and unphosphorylated polymerase wereunchanged. Levels of phospho-Ser2 remained high during thecourse of the experiment, consistent with the continued pres-ence of the DNA-damaging agent. We observed similar

changes in CTD phosphorylation after treatment of yeast withMMS (data not shown), indicating that this effect was generalfor different types of DNA damage.

Since Ctk1p is known to phosphorylate Ser2, we were inter-ested in whether Ctk1p is responsible for the increased CTDphosphorylation. To this end, we compared phosphorylation ofRNA polymerase II in HU-treated wild-type and ctk1� cells.Figure 2B shows that deletion of ctk1 abolished Ser2 phos-phorylation in untreated cells (Fig. 2B, lane 5) and followingHU treatment (Fig. 2B, lanes 6 to 8). The apparent phosphor-ylation of Ser5 increased at all times in ctk1� cells, possibly dueto better accessibility of monoclonal antibodies to Ser5 in theabsence of Ser2 phosphorylation. Therefore, CTDK-I is re-sponsible for the DNA damage-induced hyperphosphorylationof RNA polymerase on Ser2.

CTDK-I modulates DNA damage-induced expression of

FIG. 1. ctk mutants are sensitive to HU and UV irradiation. Wild-type (WT), ctk1�, ctk1�/YCp22CTK1-HA, ctk2�, ctk2�/YCp22CTK2-HA, ctk3�, and ctk3�/YCp22CTK3-Myc YPD diluted fivefold andspotted onto YPD plates. The first plate was left untreated, the secondplate contained 0.1 M HU, and the third plate was irradiated with 40J of UV-B light per m2. All plates were subsequently incubated for 3days at 30°C and photographed with a Kodak digital camera.

FIG. 2. HU treatment increases CTD phosphorylation on Ser2.(A) Wild-type (WT) cells were treated with 0.1 M HU for the indicatedtimes. The resulting protein extracts were resolved on SDS-polyacryl-amide gels and immunoblotted with monoclonal antibodies specific forphospho-Ser2 (H5), phospho-Ser5 (H14), and unphosphorylated RNApolymerase II (8WG16). Proteins were detected by chemilumines-cence. (B) Wild-type and isogenic ctk1� cells were treated with 0.1 MHU for the indicated times. Proteins were extracted and immunoblot-ted as described above.

276 OSTAPENKO AND SOLOMON EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

RNR genes. We hypothesized that the conditional phenotype ofctk mutants might be due to a transcriptional deficiency ofgenes required for protection from DNA-damaging agents.Because various types of DNA lesions induce transcription ofRNR genes, which encode subunits of ribonucleotide reductase(10), we first examined RNR expression in a ctk background.As seen in Fig. 3, transcription of RNR1 was reduced in ctk1�cells and its induction by HU and MMS was attenuated (Fig. 3,lanes 2, 5, and 8). Activation of RNR2 and RNR3 was alsomuted in ctk1� cells, though to a lesser extent than that ofRNR1. A tagged version of CTK1 introduced in ctk1� cellsrestored expression of RNR genes (Fig. 3, lanes 3, 6, and 9).

The amount of RNR1 mRNA can be important for cellsurvival, as its overexpression, even by twofold, rescues thelethality of mec1 and rad53 DNA damage checkpoint mutants(9). We reasoned that if RNR1 is a major target of Ctk1p, itsoverexpression might rescue the ctk1 phenotype. Therefore,ctk1� cells were transformed with a multicopy plasmid carryingRNR1 under the control of a constitutive GAP promoter. Theresulting strain demonstrated the same level of HU sensitivityas the original mutant, indicating that RNR1 is not the onlyimportant gene dependent on CTDK-I (data not shown).

The transcriptional response to HU treatment requiresCtk1p. To identify other genes regulated by Ctk1p, we set upmicroarray hybridization experiments. Recent work has dem-onstrated that MMS treatment changes the transcriptional

profiles of many yeast genes (12, 18). We extended this analysisto HU because ctk mutants have a stronger phenotype in HU.Five sets of hybridizations were performed. In the first two,mRNAs from wild-type cells after 30- and 60-min incubationswith HU were isolated, fluorescently labeled, mixed with con-trol mRNA from untreated wild-type cells labeled with a dif-ferent fluorophore, and hybridized to yeast microarrays. Theabundance of every transcript in the HU-treated sample wascalculated relative to that in the untreated control sample (Fig.4A, arrays 1 and 2). In the third experiment, mRNA levels inuntreated ctk1� cells were compared to those in untreatedwild-type cells (Fig. 4A, array 3). The final two experimentscompared mRNA levels in HU-treated ctk1� cells to those inHU-treated wild-type cells (Fig. 4A, arrays 4 and 5). The av-erage data from the microarray hybridizations were analyzedby K-mean clustering, so that genes with similar expressionpatterns were grouped together. Only results for the 187 geneswhose expression changed at least threefold in at least oneexperiment are shown.

Five clusters of gene expression patterns were evident (Fig.4A). Cluster I comprises genes whose expression was inducedto similar extents by HU treatment of wild-type cells and ctk1�cells. Genes in this cluster include many involved in stressresponses, such as HSP26, SSE2, and TRX2, and some withfunctions in carbohydrate metabolism, such as GLK1, PGM2,and TPS1. Cluster II comprises genes whose expression wasrepressed in both wild-type cells and ctk1� cells. Several ofthese genes, such as FAL1, NOP2, and NSR1, are involved inaspects of rRNA processing. These two clusters demonstratethat not all changes in gene expression following HU treatmentrequire CTK1.

The expression of 108 genes was altered in untreated andtreated ctk1� cells (Fig. 4A, array 3, clusters III, IV, and V).Cluster IV comprises genes whose transcription levels in-creased in ctk1� cells, whether or not those cells were treatedwith HU. HU treatment caused a very slight overall stimula-tion of these genes in wild-type cells. Most of the genes in thiscluster, such as LYS1, ARG1, and HIS5, encode amino acidbiosynthesis enzymes. In contrast, cluster V comprises genesthat were inhibited in ctk1� cells, again whether or not thosecells were treated with HU. HU treatment caused a very slightoverall inhibition of these genes in wild-type cells.

We were particularly interested in genes showing coordinateinduction by HU in wild-type cells but reduced expression inHU-treated ctk1� cells (Fig. 4A, cluster III, and Fig. 4B).Several of these transcripts encode proteins directly involved inDNA repair, including the protein kinase Dun1p, the ribonu-cleotide reductase Rnr2p, and the checkpoint protein Hug1p.A recent study demonstrated that these genes are specificallyinduced by various types of DNA damage (12). AlthoughRNR1 is induced by HU (Fig. 3), its absence from the microar-ray display is probably due to the absence of a correspondingDNA feature (altogether, about 50 genes were found to bemissing from the microarray).

Products of other genes in cluster III participate in differentaspects of detoxification, including the glutathione transferaseGtt2p, the fluconazole resistance protein Flr1p, and a proteinof unknown function, YNL134C. Apparently, functions ofthese proteins provide a broad spectrum of defense mecha-nisms utilized by cells to neutralize the toxic effects of HU.

FIG. 3. Ctk1p is required for induction of RNR genes by HU andMMS. Wild-type (WT), ctk1�, and ctk1�/YCp22CTK1-HA cells wereeither left untreated (�) (lanes 1 to 3), treated with 0.1 M HU for 60min (lanes 4 to 6), or treated with 0.03% MMS for 60 min (lanes 7 to9). Total RNA was isolated, resolved on a formaldehyde-agarose gel,and transferred to a nylon membrane. The membrane was sequentiallyhybridized with 32P-labeled probes corresponding to RNR1, RNR2,RNR3, and RPS3. The results of hybridization were visualized by au-toradiography. The level of ribosomal RPS3 mRNA served as a loadingcontrol.

VOL. 2, 2003 CTDK-I 277

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

FIG. 4. Transcriptional responses of wild-type (WT) and ctk1� cells to HU. (A) Results of five experiments (numbered on the right) are shown.Experiments 1 and 2 compared mRNA levels in wild-type cells treated with HU for 30 and 60 min, respectively, to those in untreated wild-typecells. Experiment 3 compared mRNA levels in untreated ctk1� cells to those in untreated wild-type cells. Experiments 4 and 5 compared mRNAlevels in HU-treated ctk1� cells to those in HU-treated wild-type cells after 30 and 60 min of treatment, respectively. Only the 187 genes whoseexpression changed at least threefold in at least one experiment were included in the K-mean clustering. The color scale at the bottom representsthe fold change in transcript abundance; red indicates gene induction by HU, and green indicates gene repression. (B) Genes activated by HU inwild-type cells but not in ctk1� cells (cluster III). Only the subset of genes with known functions is shown. Annotations for gene functions are fromthe Yeast Proteome Database. The full set of 187 genes and their fold changes are available from the authors.

278 OSTAPENKO AND SOLOMON EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

Although their expression is compromised in untreated ctk1�cells, their activation appears to become vital only under thestress of HU treatment. The collective abnormal expression ofmany DNA repair and detoxification genes probably explainsthe HU-sensitive phenotype of ctk1� cells.

The requirement for Ctk1p is promoter and pathway spe-cific. We were interested in confirming the microarray results,in determining whether different DNA-damaging agents in-duced the same genes, and in determining whether all threeCTDK-I subunits are necessary for this induction. To this end,ctk1�, ctk2�, and ctk3� cells were treated with DNA-damagingagents, and the abundances of several mRNAs were examinedby Northern blot hybridization. As expected, MMS and HUtreatments induced transcription of FLR1, GTT2, andYNL134C in wild-type cells, though the extent of stimulationvaried greatly (Fig. 5A, lanes 1 to 3). Mutation of CTDK-Isubunits disrupted activation of target genes, indicating that allthree Ctk proteins were required for transcriptional induction(Fig. 5A, lanes 4 to 12). Interestingly, MMS and HU haddifferent stimulatory effects on the expression of these genes.For instance, FLR1 was hardly induced by MMS treatment,whereas YNL134C was induced equally by MMS and HU (Fig.5A, lanes 1 to 3). In general, disruption of CTDK-I had agreater effect on HU-induced transcription than on MMS-induced transcription, perhaps reflecting the selection of thesegenes as strongly HU inducible in the microarray experiment.The differential effects of ctk mutants on various genes indicatethat reduced expression was not due to a general block toinduced transcription but rather was dependent on the specificsignaling pathway regulating a given promoter (Fig. 4A, clus-ters I and II versus clusters III, IV, and V; Fig. 5A). Thus, it islikely that activation of GTT2 by MMS and HU occurs throughdifferent mechanisms and may involve distinct sets of transcrip-tion factors. The nature of these factors would dictate theirrequirement for Ctk1p kinase activity and CTD phosphoryla-tion. Interestingly, ctk mutations had little effect on transcrip-tion of these genes in untreated cells, implicating CTDK-I inthe global repatterning of expression in HU-treated cells.

We wondered whether the attenuated expression of stressresponse genes was due to a delay in transcriptional activation,in which case their expression would increase after prolongedexposure to genotoxic agents. We addressed this question witha time course experiment in which cells were incubated withHU for different times. In wild-type cells, levels of the FLR1and GTT2 transcripts gradually increased, consistent with thecontinued presence of DNA damage (Fig. 5B, lanes 1 to 5). Incontrast, transcription of these genes remained at undetectablylow levels in ctk1� cells (Fig. 5B, lanes 6 to 10). Therefore, itseems unlikely that attenuated expression was due to a slowrate of transcriptional activation.

HU treatment increases binding of phosphorylated poly-merase to induced genes. Since treatment of cells with HUincreased phosphorylation of the CTD on Ser2 (Fig. 2), wewondered whether induced genes would show an increase inSer2 phosphorylation of bound polymerase. To address thisquestion, we used chromatin immunoprecipitations after lightformaldehyde treatment to examine the levels of phosphory-lated polymerase associated with selected genes. We foundthat HU treatment increased cross-linking of phosphorylatedpolymerase to FLR1, GTT2, and YNL134C, which correlated

with the transcriptional induction of these genes, but not toADH1, which is expressed constitutively (Fig. 6, lanes 1, 2, 6,and 7). In untreated cells, polymerase cross-linking to tran-scriptionally inactive genes was relatively low and comparableto cross-linking at intergenic regions, which served as internalcontrols for nonspecific binding. Deletion of CTK1 decreasedcross-linking of phospho-Ser2 polymerase for all HU-inducedgenes, confirming that CTDK-I is the major kinase responsible

FIG. 5. Activation of DNA damage response genes is compromisedin ctk mutants. (A) Wild-type (WT), ctk1�, ctk2�, and ctk3� cells wereeither grown under normal conditions (�) (lanes 1, 4, 7, and 10),treated with 0.03% MMS for 60 min (lanes 2, 5, 8, and 11), or treatedwith 0.1 M HU for 60 min (lanes 3, 6, 9, and 12). Total RNA wasisolated, resolved on a formaldehyde-agarose gel, and transferred to anylon membrane. The membrane was hybridized sequentially with32P-labeled probes corresponding to FLR1, GTT2, YNL134C, andRPS3. Results of hybridizations were visualized by autoradiography.(B) Wild-type and ctk1� mutant cells were incubated with 0.1 M HUfor 0, 1, 2, 4, or 6 h. Total RNA was isolated and analyzed by Northernblot hybridization with probes corresponding to FLR1, GTT2,YNL134C, and ADH1, which served as a loading control.

VOL. 2, 2003 CTDK-I 279

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

for Ser2 phosphorylation (Fig. 6, lanes 3 and 4; see also Fig. 2).Cross-linking of phospho-Ser2 polymerase to ADH1 was re-duced but not eliminated in ctk1� cells; presumably the resid-ual phosphorylation is carried out by Srb10p. The reduction ofSer2 phosphorylation in ctk1� cells also decreased the cross-linking of phospho-Ser5 polymerase. Therefore, HU treatmentincreased the phosphorylation of polymerase on transcription-ally induced genes. It is possible that some genes, such asFLR1, GTT2, and YNL134C, are intrinsically sensitive to thelevel of polymerase phosphorylation. In the absence of phos-pho-Ser2, as observed in ctk1� cells, transcription initiation orelongation from their promoters might be impaired.

Ctk1p is required for reprogramming of gene expression

upon amino acid starvation. We wondered whether CTDK-Ifunction is restricted to DNA damage signaling or whether it isrequired for adjustments to other environmental changes.Therefore, we examined the transcriptional response to aminoacid starvation, a nontoxic perturbation often encountered byyeast cells under natural conditions. In this experiment, cellswere shifted from a rich medium to a minimal medium de-pleted of all amino acids not required for growth of this strain.Five sets of hybridizations were performed. In the first two,wild-type cells starved for amino acids were compared to un-treated wild-type cells (Fig. 7A, arrays 1 and 2). The thirdhybridization examined ctk1� and wild-type cells in a richmedium. The last two hybridizations compared mRNAs fromctk1� and wild-type cells following amino acid starvation (Fig.7A, arrays 4 and 5).

As expected, depletion of amino acids activated transcrip-tion of at least 180 genes involved in amino acid biosynthesispathways and general stress responses. Approximately half ofthese genes were similarly induced in wild-type and ctk1� cells,indicating that signaling of amino acid starvation was not im-paired by the ctk1� mutation (Fig. 7A, cluster I). Cluster IIIcomprises 94 genes whose transcription was induced in wild-type cells but not in ctk1� cells. This group includes genesencoding enzymes involved in amino acid biosynthesis, such asLYS9, URA10, and PUT4, and stress response genes GRE2,YNL134C, and YDR533C, which had previously been impli-cated in HU response (Fig. 7B). Therefore, it appears thatCtk1p is required for global reprogramming of gene transcrip-tion in response to amino acid starvation and, presumably,other environmental stresses.

DISCUSSION

Numerous studies indicate that phosphorylation of the C-terminal domain of the large subunit of RNA polymerase II onSer2 and Ser5 within the heptapeptide repeats regulates tran-scription initiation, elongation, and RNA processing (3, 21, 31,42). Several lines of evidence suggest that Ser2 may have anadditional function, since its phosphorylation increases whenyeast cells approach stationary phase and after heat shock (34).The results of this study indicate that Ser2 phosphorylationalso plays a role in the DNA damage response following HUand MMS treatments.

Given the multitude of CTD functions, it is not surprisingthat several enzymes regulate its phosphorylation. Ser5 is phos-phorylated by Kin28p, Srb10p, and Bur1p (11, 15, 29). Srb10pcan also phosphorylate Ser2 (2). However, deletion of CTK1 orany other subunit of the CTDK-I complex dramatically de-creased Ser2 phosphorylation in vivo, indicating that Ctk1p isthe major protein kinase responsible for this phosphorylation(4, 33) (Fig. 2B). Yeast cells carrying mutations in CTK genesgrow like wild-type cells but are inviable at reduced tempera-tures and exhibit a delay during exit from stationary phase (25).In addition, we present evidence that ctk mutant cells aresensitive to DNA-damaging agents and UV irradiation. Thesepleiotropic phenotypes suggest that CTDK-I activity is essen-tial during large-scale transcriptional repatterning under stressand unfavorable growth conditions. This hypothesis is sup-ported by the finding that Ctk1p is required for gene activationfollowing a nutritional shift.

FIG. 6. HU increases phosphorylation of RNA polymerase II as-sociated with induced genes. Wild-type (WT) and ctk1� cells wereeither left untreated (�) (lanes 1, 3, 6, and 8) or treated with 0.1 M HUfor 60 min (lanes 2, 4, 7, and 9). Protein-DNA complexes were cross-linked with formaldehyde, and RNA polymerase II was immunopre-cipitated from cell extracts with antibodies against phospho-Ser2 (H5)and phospho-Ser5 (H14). DNA fragments associated with RNA poly-merase II were PCR amplified and labeled with 32P. The resulting PCRproducts were resolved on 8% polyacrylamide gels and visualized byautoradiography. PCR mixtures contained two pairs of primers; thefirst pair corresponded to the transcription start site of the indicatedgene, and the second pair amplified an intergenic region on chromo-some V, which was a control for nonspecific binding (indicated byasterisks). The input control contained DNA isolated from whole-cellextracts.

280 OSTAPENKO AND SOLOMON EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

Ctk1p has been implicated in transcriptional elongation. Thepurified CTDK-I complex stimulates the rate of transcriptelongation in vitro, and the ctk1� mutation is syntheticallylethal with mutations in transcription elongation factors suchas Elp1p, Spt5p, and Ppr2p (TFIIS) (19, 26, 27). It is notknown whether most or just a few genes require CTDK-I forefficient elongation. The results of this study indicate that asubset of genes fails to be induced in the absence of CTK1 (Fig.4 and 7, clusters III and V). Some of these genes are alsoderegulated by elp mutants that compromise the activity of theElongator complex (22). Because the complex binds to phos-phorylated RNA polymerase, it is not surprising that CTDK-Iand Elongator regulate overlapping sets of genes (32). Alter-natively, some genes might be affected indirectly, due to de-regulation of other transcription factors. For example, expres-sion of ADA2, which encodes a subunit of the nucleosomalhistone acetyltransferase complexes ADA and SAGA (1, 35),was compromised in ctk1� cells.

We noticed that the abundances of several mRNAs in-creased in ctk1� cells, suggesting that CTDK-I might functionas a gene-specific repressor. Repressor activity has been dem-onstrated previously for another cyclin-dependent kinase,Srb10p, which phosphorylates the CTD on Ser2 and Ser5 (16,23). When this phosphorylation occurs prior to formation ofthe preinitiation complex, it inhibits transcription (15). Simi-larly, Ctk1p-mediated phosphorylation of Ser2 might haveboth positive and negative effects, depending on the timing andpromoter context. It is also possible that some genes are in-duced indirectly, in compensation for the loss of Ctk1p activity.

Given that ctk1� cells are viable, it is likely that undernormal conditions, yeast cells can tolerate a great reduction inSer2 phosphorylation. However, high-efficiency transcriptionmay become essential under stress conditions. We showed thatinduction of several genes was critically dependent on theactivity of CTDK-I. Deletion of CTK1 attenuated the DNAdamage-induced expression of RNR1, RNR2, and RNR3, which

FIG. 7. Transcriptional response of wild-type (WT) and ctk1� cells to amino acid starvation. (A) Results of five experiments (numbered on theright) are shown. Experiments 1 and 2 compared mRNA levels in wild-type cells depleted of amino acids for 60 or 120 min, respectively, to thosein wild-type cells maintained in a rich medium. Experiment 3 compared mRNA levels in ctk1� cells and wild-type cells in a rich medium.Experiments 4 and 5 compared mRNA levels in amino acid-depleted ctk1� cells to those in wild-type cells depleted of amino acids for 60 and 120min, respectively. Only the 328 genes whose expression levels changed at least threefold in at least one experiment were included in the K-meanclustering. Roman numerals indicate five major gene clusters with similar expression patterns. Colors indicate fold changes in transcript abundance(see the color scale at bottom right). (B) Genes activated by amino acid starvation in wild-type cells but not in ctk1� cells (cluster III). Only thesubset of genes strongly dependent on Ctk1p is shown. Annotations for gene functions are from the Yeast Proteome Database. The full set of 328genes and their fold changes are available from the authors.

VOL. 2, 2003 CTDK-I 281

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

is essential for DNA repair. This finding supports previouswork that implicated CTD phosphorylation in regulation ofRNR transcription (43). In addition to RNR genes, severalstress response genes, such as FLR1, GTT2, and YNL134C,were not expressed in the absence of Ser2 phosphorylation. Itappears that the collective loss of function of these genescompromises cellular defense mechanisms against DNA-dam-aging agents, making ctk cells sensitive to DNA damage.

Interestingly, the essential role of CTDK-I is probably notlimited to the DNA damage response, as several genes werenot activated in ctk1� cells during amino acid starvation. It islikely that Ser2 phosphorylation is essential during the globalreprogramming of transcription in response to various stresses,such as survival at low temperature, stationary phase, or DNAdamage. Rapid gene activation requires the integrity of thegeneral transcription machinery, which might explain why mu-tation of Ctk1p reduces the ability of cells to respond to a widerange of conditions.

ACKNOWLEDGMENTS

We thank Janet Burton, Aiyang Cheng, Shannon Gerry, PhilippKaldis, Adrienne Natrillo, and Vasiliki Tsakraklides for support, dis-cussions, and critical reading of the manuscript. Many aspects of themicroarray and chromatin immunoprecipitation experiments were crit-ically dependent on help from Michael Snyder and members of his lab,including Christine Horak and John Rinn. We thank Ken Nelson forassistance with microarray printing and Katy Suvorova for program-ming and analysis of the data.

The microarray facility was supported by grant CA77808 from theNational Institutes of Health to Michael Snyder. This work was sup-ported by grant GM47830 from the National Institutes of Health (toM.J.S.).

REFERENCES

1. Berger, S. L., B. Pina, N. Silverman, G. A. Marcus, J. Agapite, J. L. Regier,S. J. Triezenberg, and L. Guarente. 1992. Genetic isolation of ADA2: apotential transcriptional adaptor required for function of certain acidic ac-tivation domains. Cell 70:251–265.

2. Borggrefe, T., R. Davis, H. Erdjument-Bromage, P. Tempst, and R. D.Kornberg. 2002. A complex of the Srb8, -9, -10, and -11 transcriptionalregulatory proteins from yeast. J. Biol. Chem. 277:44202–44207.

3. Cadena, D. L., and M. E. Dahmus. 1987. Messenger RNA synthesis inmammalian cells is catalyzed by the phosphorylated form of RNA polymer-ase II. J. Biol. Chem. 262:12468–12474.

4. Cho, E. J., M. S. Kobor, M. Kim, J. Greenblatt, and S. Buratowski. 2001.Opposing effects of Ctk1 kinase and Fcp1 phosphatase at Ser 2 of the RNApolymerase II C-terminal domain. Genes Dev. 15:3319–3329.

5. Cho, E. J., T. Takagi, C. R. Moore, and S. Buratowski. 1997. mRNA cappingenzyme is recruited to the transcription complex by phosphorylation of theRNA polymerase II carboxy-terminal domain. Genes Dev. 11:3319–3326.

6. Cismowski, M. J., G. M. Laff, M. J. Solomon, and S. I. Reed. 1995. KIN28encodes a C-terminal domain kinase that controls mRNA transcription inSaccharomyces cerevisiae but lacks cyclin-dependent kinase-activating kinase(CAK) activity. Mol. Cell. Biol. 15:2983–2992.

7. Dahmus, M. E. 1996. Reversible phosphorylation of the C-terminal domainof RNA polymerase II. J. Biol. Chem. 271:19009–19012.

8. DeRisi, J. L., V. R. Iyer, and P. O. Brown. 1997. Exploring the metabolic andgenetic control of gene expression on a genomic scale. Science 278:680–686.

9. Desany, B. A., A. A. Alcasabas, J. B. Bachant, and S. J. Elledge. 1998.Recovery from DNA replicational stress is the essential function of theS-phase checkpoint pathway. Genes Dev. 12:2956–2970.

10. Elledge, S. J., Z. Zhou, J. B. Allen, and T. A. Navas. 1993. DNA damage andcell cycle regulation of ribonucleotide reductase. Bioessays 15:333–339.

11. Feaver, W. J., J. Q. Svejstrup, N. L. Henry, and R. D. Kornberg. 1994.Relationship of CDK-activating kinase and RNA polymerase II CTD kinaseTFIIH/TFIIK. Cell 79:1103–1109.

12. Gasch, A. P., M. Huang, S. Metzner, D. Botstein, S. J. Elledge, and P. O.Brown. 2001. Genomic expression responses to DNA-damaging agents andthe regulatory role of the yeast ATR homolog Mec1p. Mol. Biol. Cell12:2987–3003.

13. Gietz, R. D., R. H. Schiestl, A. R. Willems, and R. A. Woods. 1995. Studieson the transformation of intact yeast cells by the LiAc/SS-DNA/PEG pro-cedure. Yeast 11:355–360.

14. Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectorsconstructed with in vitro mutagenized yeast genes lacking six-base pair re-striction sites. Gene 74:527–534.

15. Hengartner, C. J., V. E. Myer, S. M. Liao, C. J. Wilson, S. S. Koh, and R. A.Young. 1998. Temporal regulation of RNA polymerase II by Srb10 andKin28 cyclin-dependent kinases. Mol. Cell 2:43–53.

16. Holstege, F. C., E. G. Jennings, J. J. Wyrick, T. I. Lee, C. J. Hengartner,M. R. Green, T. R. Golub, E. S. Lander, and R. A. Young. 1998. Dissectingthe regulatory circuitry of a eukaryotic genome. Cell 95:717–728.

17. Jelinsky, S. A., P. Estep, G. M. Church, and L. D. Samson. 2000. Regulatorynetworks revealed by transcriptional profiling of damaged Saccharomycescerevisiae cells: Rpn4 links base excision repair with proteasomes. Mol. Cell.Biol. 20:8157–8167.

18. Jelinsky, S. A., and L. D. Samson. 1999. Global response of Saccharomycescerevisiae to an alkylating agent. Proc. Natl. Acad. Sci. USA 96:1486–1491.

19. Jona, G., B. O. Wittschieben, J. Q. Svejstrup, and O. Gileadi. 2001. Involve-ment of yeast carboxy-terminal domain kinase I (CTDK-I) in transcriptionelongation in vivo. Gene 267:31–36.

20. Kobor, M. S., J. Archambault, W. Lester, F. C. Holstege, O. Gileadi, D. B.Jansma, E. G. Jennings, F. Kouyoumdjian, A. R. Davidson, R. A. Young, andJ. Greenblatt. 1999. An unusual eukaryotic protein phosphatase required fortranscription by RNA polymerase II and CTD dephosphorylation in S.cerevisiae. Mol. Cell 4:55–62.

21. Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphory-lated forms of RNA polymerase II and associated mRNA processing factorsduring transcription. Genes Dev. 14:2452–2460.

22. Krogan, N. J., and J. F. Greenblatt. 2001. Characterization of a six-subunitholo-elongator complex required for the regulated expression of a group ofgenes in Saccharomyces cerevisiae. Mol. Cell. Biol. 21:8203–8212.

23. Kuchin, S., and M. Carlson. 1998. Functional relationships of Srb10-Srb11kinase, carboxy-terminal domain kinase CTDK-I, and transcriptional core-pressor Ssn6-Tup1. Mol. Cell. Biol. 18:1163–1171.

24. Kuras, L., and K. Struhl. 1999. Binding of TBP to promoters in vivo isstimulated by activators and requires Pol II holoenzyme. Nature 399:609–613.

25. Lee, J. M., and A. L. Greenleaf. 1991. CTD kinase large subunit is encodedby CTK1, a gene required for normal growth of Saccharomyces cerevisiae.Gene Expr. 1:149–167.

26. Lee, J. M., and A. L. Greenleaf. 1997. Modulation of RNA polymerase IIelongation efficiency by C-terminal heptapeptide repeat domain kinase I. J.Biol. Chem. 272:10990–10993.

27. Lindstrom, D. L., and G. A. Hartzog. 2001. Genetic interactions of Spt4-Spt5and TFIIS with the RNA polymerase II CTD and CTD modifying enzymesin Saccharomyces cerevisiae. Genetics 159:487–497.

28. McCracken, S., N. Fong, K. Yankulov, S. Ballantyne, G. Pan, J. Greenblatt,S. D. Patterson, M. Wickens, and D. L. Bentley. 1997. The C-terminaldomain of RNA polymerase II couples mRNA processing to transcription.Nature 385:357–361.

29. Murray, S., R. Udupa, S. Yao, G. Hartzog, and G. Prelich. 2001. Phosphor-ylation of the RNA polymerase II carboxy-terminal domain by the Bur1cyclin-dependent kinase. Mol. Cell. Biol. 21:4089–4096.

30. Nonet, M., D. Sweetser, and R. A. Young. 1987. Functional redundancy andstructural polymorphism in the large subunit of RNA polymerase II. Cell50:909–915.

31. O’Brien, T., S. Hardin, A. Greenleaf, and J. T. Lis. 1994. Phosphorylation ofRNA polymerase II C-terminal domain and transcriptional elongation. Na-ture 370:75–77.

32. Otero, G., J. Fellows, Y. Li, T. de Bizemont, A. M. Dirac, C. M. Gustafsson,H. Erdjument-Bromage, P. Tempst, and J. Q. Svejstrup. 1999. Elongator, amultisubunit component of a novel RNA polymerase II holoenzyme fortranscriptional elongation. Mol. Cell 3:109–118.

33. Patturajan, M., N. K. Conrad, D. B. Bregman, and J. L. Corden. 1999. Yeastcarboxyl-terminal domain kinase I positively and negatively regulates RNApolymerase II carboxyl-terminal domain phosphorylation. J. Biol. Chem.274:27823–27828.

34. Patturajan, M., R. J. Schulte, B. M. Sefton, R. Berezney, M. Vincent, O.Bensaude, S. L. Warren, and J. L. Corden. 1998. Growth-related changes inphosphorylation of yeast RNA polymerase II. J. Biol. Chem. 273:4689–4694.

35. Pollard, K. J., and C. L. Peterson. 1997. Role for ADA/GCN5 products inantagonizing chromatin-mediated transcriptional repression. Mol. Cell. Biol.17:6212–6222.

36. Rothstein, R. 1991. Targeting, disruption, replacement, and allele rescue:integrative DNA transformation in yeast. Methods Enzymol. 194:281–301.

37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

38. Sherman, F. 1991. Getting started with yeast, p. 3–21. In Guide to yeastgenetics and molecular biology. Academic Press, San Diego, Calif.

39. Solomon, M. J., P. L. Larsen, and A. Varshavsky. 1988. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 isretained on a highly transcribed gene. Cell 53:937–947.

40. Sterner, D. E., J. M. Lee, S. E. Hardin, and A. L. Greenleaf. 1995. The yeastcarboxyl-terminal repeat domain kinase CTDK-I is a divergent cyclin–cyclin-

282 OSTAPENKO AND SOLOMON EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.

dependent kinase complex. Mol. Cell. Biol. 15:5716–5724.41. Strahl-Bolsinger, S., A. Hecht, K. Luo, and M. Grunstein. 1997. SIR2 and

SIR4 interactions differ in core and extended telomeric heterochromatin inyeast. Genes Dev. 11:83–93.

42. Svejstrup, J. Q., Y. Li, J. Fellows, A. Gnatt, S. Bjorklund, and R. D. Korn-berg. 1997. Evidence for a mediator cycle at the initiation of transcription.Proc. Natl. Acad. Sci. USA 94:6075–6078.

43. Wong, J. M., and C. J. Ingles. 2001. A compromised yeast RNA polymeraseII enhances UV sensitivity in the absence of global genome nucleotideexcision repair. Mol. Gen. Genet. 264:842–851.

44. Yuryev, A., and J. L. Corden. 1996. Suppression analysis reveals a functionaldifference between the serines in positions two and five in the consensussequence of the C-terminal domain of yeast RNA polymerase II. Genetics143:661–671.

VOL. 2, 2003 CTDK-I 283

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

05

Febr

uary

202

2 by

117

.146

.123

.15.