biology course map - georgia standards frameworks/9-12...biology course map ... a type of graphic...

Georgia Department of Education Kathy Cox, State Superintendent of Schools

10/2/2006 2:48 PM of 109 All Rights Reserved

Biology Course Map The attached document is part of a framework that was designed to support the major concepts addressed in the Biology Curriculum of the Georgia Performance Standards through laboratory experiences and field work using the processes of inquiry. This framework is a thematic approach that is divided into the four units outlined below. Within each unit, the unifying themes of cells, organisms, ecology and evolution reoccur. Concept maps are attached to each unit outlining the understandings derived from the standards that are addressed for each of the recurring topics. There are several strategies that are common throughout the units such as the use of a laboratory notebook or field sketchbook, written laboratory reports and common teaching strategies. These strategies are described on the following pages. Whereas these units are written to be stand alone units that may be taught in any sequence, it is recommended that the organization unit be taught first and the equilibrium unit taught last.

Unit Two Focus: Energy Transformations Energy can be neither created nor destroyed but can be transformed from one form to another as it flows through organisms and ecosystems.

Unit One Focus: Organization Life is organized at all levels from cells to biosphere.

Unit Three Focus: Growth and Heredity Organisms must be able to grow and reproduce to ensure species survival.

Unit Four Focus: Equilibrium Survival and stability require that living things maintain biological balance at all levels.

Topics: Cell structure and Function Evolutionary History History of Life Classification of Kingdoms Ecosystem Structure Viruses Duration (Block): 23 days Duration (Traditional): 7-9 weeks

Topics: Chemistry of Life Function of Organic Molecules Photosynthesis Cellular Respiration Cycles of Matter Energy Flow Food Chains and Webs Duration (Block): 22 days Duration (Traditional): 7-9 weeks

Topics: Asexual and Sexual Reproduction Cell Growth Mendelian Genetics DNA and RNA Processes Chromosomes and Mutations Genetic Engineering DNA Technology and Cloning Biological Resistance Bioethics Duration (Block): 22 days Duration (Traditional): 7-9 weeks

Topics: Cellular Transport Homeostasis Natural Selection Plant Adaptations Animal Adaptations and Behavior Succession Population Genetics Duration (Block): 23 days Duration (Traditional): 7-9 weeks



Safety Issues: Student safety in science education should always be foremost during instruction. The Characteristics of Science curriculum standards increase the need for teachers to use appropriate precautions in the laboratory and the field. The guidelines for the safe use, storage and disposal of chemicals must be observed. To ensure student and teacher safety in the science classroom, it is critical that appropriate safety policies and procedures be established in the classroom and that all students and teachers know and follow appropriate safety guidelines. The Internet and many science vendors can offer support for safety guidelines. Common Teaching Strategies: There are several teaching strategies that are used throughout the course. For clarification purposes they are described below: Lab notebook or Field sketchbook: A notebook that students use to record data, journal on assigned topics and complete assigned drawing activities. Ticket Out the Door: A commonly used summarizing strategy that is effective as a formative assessment tool. Students are given a short writing assignment on the concept covered in class that is to be turned in as they leave the classroom. These brief glimpses into student understanding may be graded or not. The same strategy can be used as a Ticket In the Door to assess student understanding at the beginning of the class on a concept from the day before or as a check on a homework assignment. KIM diagrams: A three column table where students can organize technical language to allow better understanding of how they relate to the topic of the day. On a KIM diagram, a key term is listed in the first column, an illustration of the key term in the second column and a student derived meaning written in the third column. Jigsaw activities: An effective grouping strategy that teachers use to facilitate peer teaching in the classroom. Students are first grouped together to become experts on an assigned topic. Student groups are then reorganized in such a manner that new groups are formed containing one student from each of the expert groups. The experts on each topic then serve as a peer teacher to the other students in the newly formed group.



Cloze: A note taking strategy where students either provide missing terms to complete a paragraph using appropriate language for the topic being addressed, or where students generate a paragraph from a list of appropriate terms. Gallery or Poster Walk: This is a peer assessment strategy. Students place their work on a wall or other location where it can be reviewed by their peers. Students provide written commentary on the posted work and the original creators are given the opportunity to revise their product. Teacher note: Students may require training to use appropriate feedback in their commentary. Flapbook or Flipbook: A type of graphic organizer where students group information in order to see relationships within categories. 10-2 Lecture format: A strategy where teachers limit the introduction of material to a time frame of 10 minutes or less and then students are allowed a 2 minute opportunity to reflect on the material and share what they have learned with their peers. Glaze the Doughnut: A type of organizer that allows teachers to pre-assess student knowledge or to monitor student progress that resembles a doughnut as one smaller circle is drawn inside another. The big idea is written inside the small circle and the doughnut is “iced” or “glazed” with what the students know about the topic. The information can then be reorganized into tables or organizers. Name Jar: A strategy used to ensure students are randomly selected to answer questions in class. Student names are placed on craft sticks and placed in a jar. During questioning the teacher selects sticks from the jar and the student identified must answer the question. Several blank sticks could be included in which the teacher must answer the questions when they are selected. KWL: A pre and post assessment strategy often used in classrooms where, at the beginning of the lesson, teachers guide students to identify what they already know about a particular topic and what they need to know about the topic. Following the lesson, the teacher leads students to review what they have learned. Acrostic: An activity for students to make connections with the language that often accompanies a particular topic. The key term is written vertically on paper and students write words or phrases that relate to that term using the letters that make up the key term.



Growth/Heredity Unit Understanding: Organisms must be able to

grow and reproduce to ensure species survival.

CELLS ORGANISMS

EVOLUTION

ECOLOGY

• The instructions for specifying the characteristics of an organism are carried in DNA, a large polymer formed from the subunits ATCG, located in the cell(s) of that organism. SB1a, SB2a,b

• Using the DNA code, cells manufacture needed proteins that determine an organism’s phenotype. SB1a, SB2a,b

• Cells in sexually reproducing organisms contain two copies of each chromosome; therefore, two copies of each gene explain many features of heredity such as how variations that are hidden in one generation can be expressed in the next. SB1a, SB2b,c

• Sexual reproduction leads to diversity and asexual reproduction does not. SB2e

• The reproductive patterns of organisms are affected by environmental conditions. SB2e, SB4d

• Changes in DNA occur spontaneously at low rates; some of these changes make no difference to the organism whereas others can change cells and organisms. SB2d

• Only mutations in germ cells can contribute to the variation that changes an organism's offspring. SB2d, SB5e

• Favorable variations among individuals that increase the chance of survival tend to be passed onto successive generations. SB5d

• Hereditary information, coded by DNA, is passed down from generation to generation in a predictable way. SB2c

• The development and use of technologies may lead to social, moral, ethical, and legal issues. SB2f



Content and Characteristics of Science for Growth and Heredity Content Standards

SB1. Students will analyze the nature of the relationships between structures and functions in living cells.

a. Explain the role of cell organelles for both prokaryotic and eukaryotic cells, including the cell membrane, in maintaining homeostasis and cell reproduction.

SB2. Students will analyze how biological traits are passed on to successive generations.

a. Distinguish between DNA and RNA

b. Explain the role of DNA in storing and transmitting cellular information.

c. Using Mendel’s laws, explain the role of meiosis in reproductive variability.

d. Describe the relationships between changes in DNA and potential appearance of new traits including • Alternations during

replication. o Insertions o Deletions o Substitutions

• Mutagenic factors that can alter DNA.

• High energy radiation (x-rays and ultraviolet)

• Chemical e. Compare the advantages of sexual

reproduction and asexual reproduction in different situations.

f. Examine the use of DNA technology in forensics, medicine, and agriculture.

Characteristics of Science SCSh1. Students will evaluate the importance of curiosity, honesty, and skepticism in science.

a. Exhibit the above traits in their own scientific activities.

b. Recognize that different explanations often can be given for the same evidence.

c. Explain that further understanding of scientific problems relies on the design and execution for new experiments which may reinforce or weaken opposing explanations.

SCSh2. Students will use standard safety practices for all classroom laboratory and field investigations.

a. Follow correct procedures for uses of scientific apparatus.

b. Demonstrate appropriate technique in all laboratory situations.

c. Follow correct protocol for identifying and reporting safety problems and violations.

SCSh3. Students will identify and investigate problems scientifically.

a. Suggest reasonable hypotheses for identified problems.

b. Develop procedures for solving scientific problems.

c. Collect, organize and record appropriate data.

d. Graphically compare and analyze data points and/or summary statistics.

e. Develop reasonable conclusions based on data collected.

f. Evaluate whether conclusions are reasonable by reviewing the process and checking against other available information.



SB4. Students will assess the dependence of all organisms on one another and the flow of energy and matter within their ecosystems.

d. Assess and explain human activities that influence and modify the environment such as global warming, population growth, pesticide use, and water and power consumption.

SB5. Students will evaluate the role of natural selection in the development of the theory of evolution.

d. Relate natural selection to changes in organisms. e. Recognize the role of evolution to biological resistance (pesticide and antibiotic resistance).

SCSh4. Students use tools and instrument for observing, measuring, and manipulating scientific equipment and materials.

a. Develop and use systematic procedures for recording and organizing information.

b. Use technology to produce tables and graphs.

SCSh5. Students will demonstrate the computation and estimation skills necessary for analyzing data and developing reasonable scientific explanations.

a. Trace the source on any large disparity between estimated and calculated answers to problems.

b. Consider possible effects of measurement errors on calculation.

c. Recognize the relationship between accuracy and precision.

SCSh6. Students will communicate scientific investigation and information clearly.

a. Write clear, coherent laboratory reports related to scientific investigations.

b. Write clear, coherent accounts of current scientific issues, including possible alternative interpretations of the data.

c. Use data as evidence to support scientific arguments and claims in written or oral presentations.

d. Participate in group discussions of scientific investigation and current scientific issues.

SCSh7. Students analyze how scientific knowledge is developed. Students recognize that:

a. The universe is a vast single system in which the basic principles are the same everywhere.

b. Universal principles are discovered through observation and experimental verification.

c. From time to time, major shifts occur in the scientific view of how the world works. More often, however, the



changes that take place in the body of scientific knowledge are small modifications or prior knowledge. Major shifts in scientific views typically occur after the observation of a new phenomenon or an insightful interpretation of existing data by an individual or research group.

d. Hypotheses often cause scientists to develop new experiments that produce additional data.

e. Testing, revising, and occasionally rejecting new and old theories never ends.

SCSh8. Students will understand important features of the process of scientific inquiry. Students will apply the following to inquiry learning practices:

a. Scientific investigators control the conditions of their experiments in order to produce valuable data.

b. Scientific researchers are expected to critically assess the quality of data including possible sources of bias in their investigations’ hypotheses, observations, data analyses, and interpretations.

c. Scientists use practices such as peer review and publication to reinforce the integrity of scientific activity and reporting.

d. The merit of a new theory is judged by how well scientific data are explained by the new theory.

e. The ultimate goal of science is to develop an understanding of the natural universe which is free of biases.

f. Science disciplines and traditions differ from one another in what is studied, techniques used, and outcomes sought.

SCSh9. Students will enhance reading in all curriculum areas by:

a. Reading in all curriculum areas • Read a minimum of 25 grade-level

appropriate books per year from a variety



of subject disciplines and participate in discussions related to curricular learning in all areas.

• Read both informational and fictional texts in a variety of genres and modes of discourse.

• Read technical texts related to various subject areas.

c. Building vocabulary knowledge • Demonstrate an understanding of

contextual vocabulary in various subjects.

• Use content vocabulary in writing and speaking.

• Explore understanding of new words found in subject area texts.

d. Establishing context • Explore life experiences related to

subject area content. • Discuss in both writing and speaking

how certain words are subject area related.

• Determine strategies for finding content and contextual meaning for unknown words.

Contextual Language: DNA, chromosome, sexual reproduction RNA, allele, Mendel’s Laws, genes, inheritance, traits, genotype, cloning, phenotype, asexual reproduction, mutation, mutagenic factors, biological resistance, bioethics



Misconceptions for Growth and Heredity: Students think that:

- All mutations are bad. Students should understand that mutations provide variations among individuals in a population. Sometimes those variations are favorable and are maintained in subsequent generations as adaptations.

- Changes in somatic (body) cells are inheritable. Students should understand that only sex cells contribute to genetic information in the next generation.

- Plants don’t reproduce sexually. Students should realize that plants reproduce both sexually and asexually.

- DNA in one organism is completely different from that in another organism. Students should understand that the basic structure of DNA is the same in all organisms. It is the sequence of nucleotides in the strands of DNA that result in different gene expressions in individuals.

- Cells within an organism have different DNA. Students should understand that the entire genetic code for an organism is identical in each and every cell of that organism.



Balanced Assessment Plan for Growth and Heredity Informal Observations

Selected Responses

Constructed Responses Performance Assessments

- Growth and Heredity Anagram (Pre-Assessment) - Stages of Mitosis - Hieroglyphics Code - Hot Seat Review Game - Field Sketchbook Drawing and Sharing - As the Frog Leaps - Bio-ethics - DNA Sequencing Cow vs. Human

-Teacher prepared items on quizzes and summative tests to assess specific unit content

- Asexual versus Sexual Graphic Organizer - Field Sketchbook – Mendelian Genetics - Abstract of Topic related current issues Punnett Square Crosses - Is That Your Baby Activity - Sample Essay Questions: Choose from:

“Compare the advantages and disadvantages of

asexual and sexual reproduction.” “Choose three known mutations and discuss the type of change in DNA that resulted in that mutation. Explain how the mutation affects the organism.” “Discuss how DNA technology is used in forensics, medicine, and agriculture.” “Answer one of the Essential Questions from this unit, organizing what you have learned during this unit to support your answer.

-Asexual Reproduction Lab - ABC Book of Genetics - Meiosis Poem - Socratic Seminar on Cloning - Race for Life (Protein Synthesis Activity) - Translation Simulation - DNA/RNA Processes - DNA Song - DNA Extraction Lab - Human Genetics Lab – Phenotype – Genotype -Genetic Disorder Dramatization Presentations - Animal Adaptation Lab - Gel electrophoresis - Who’s Your Daddy?



Sample Culminating Performance Task(s): ABC’s of Growth and Heredity Book pages 34-36 You are an author who has been asked to write an ABC children’s book about genetics. As you create this ABC book you must address: * DNA technology * Biological resistance * Sexual and Asexual Reproduction * Mendelian Genetics * DNA & RNA processes * Chromosomes & mutations



Internet Resources for Growth and Heredity Sample List of Appropriate Resources for Unit Growth and Heredity: http://www.biology.arizona.edu/human_bio/human_bio.html http://gslc.genetics.utah.edu/units/biotech/gel http://www.biology.arizona.edu/human_bio/problem_sets/DNA_forensics_1/DNA_forensics.htmlhttp://www.actionbioscience.org/evolution/meade_callahan.html http://bioethicsweb.ac.uk/browse/mesh/D030342.html http://learn.genetics.utah.edu/units/biotech/gel/

http://www.biology.arizona.edu/human_bio/human_bio.html

http://gslc.genetics.utah.edu/units/biotech/gel

http://www.biology.arizona.edu/human_bio/problem_sets/DNA_forensics_1/DNA_forensics.html

http://www.actionbioscience.org/evolution/meade_callahan.html

http://bioethicsweb.ac.uk/browse/mesh/D030342.html

http://learn.genetics.utah.edu/units/biotech/gel/



Growth and Heredity Unit Daily Plans

DAY

Enduring Understanding Content and Characteristics

Standards

Teacher and Student Activities Assessments

1 • Sexual reproduction leads to diversity and asexual reproduction does not.

SB2.e SCSh1.a,b,c SCSh2.a,b,c SCSh3.a,b SCSh6.d SCSh8.a,f

• Hook – Pre-Assess with a Growth/Heredity Acrostic Growth_Heredity_Acrostic (Page 31)

• Introduce the Asexual reproduction lab (Page 32-33) where students will design a lab to test the question. “Can plants reproduce without using a seed?” Directions are provided for the teacher to assist the students in their experimental design not as a prescriptive method for students to follow.

• Assign and discuss ABC Book of Genetics (Pages 34-36) (culminating activity) Teacher note: Provide students with opportunities to conduct and revise their work throughout the unit.

Pre-Assessment Informal: Teacher observation and questioning during lab design

2 • Sexual reproduction leads to diversity and asexual reproduction does not.

• The reproductive patterns of organisms are affected by environmental conditions.

SB2.e SB4.d SCSh1.a,b,c SCSh2.a,b,c SCSh3.a, b, c SCSh4.a,b SCSh8.a,b,f SCSh9.a,c,d

• Asexual reproduction lab continued – students set up their designed lab.

• Create a graphic organizer on asexual reproduction to help students gain an understanding that asexual reproduction involves one cell/organism that produces two identical cells and is used for growth and repair and cell replication. For each type the students find, they should include a representative organism for that method along with the advantages and disadvantages or when this method most commonly occurs in nature. (Teacher note: the different types are not to be assessed. The spirit of this activity is for the students to develop an understanding of the advantages and disadvantages of asexual reproduction.)

• Have the students answer the following prompt: “Compare the advantages and disadvantages of asexual reproduction.” as their Ticket Out the Door

Performance Task: Asexual Reproduction Lab Ticket Out the Door



3 • Cells in sexually reproducing organisms contain two copies of each chromosome; therefore, two copies of each gene explain many features of heredity such as how variations that are hidden in one generation can be expressed in the next.

• Sexual reproduction leads to diversity and asexual reproduction does not.

• The reproductive patterns of organisms are affected by environmental conditions.

SB1.a SB2.b,c,e SB4.d SCSh1.a,b,c SCSh9.a,b,c

• Divide students into groups of 4. Give each group a copy of the Phases of meiosis (Pages 37-41). Ask students to predict the order in which they think the pictures should be sequenced. When all groups have completed their sequences, ask students to explain why they put the pictures in the order they chose. Teacher Note: You are to stress the process, not what occurs in each of the individual phases of meiosis.

• Using a 10-2 lecture format, study guide, group work, or discussion; discuss how meiosis results in four different cells and how this process is different from mitosis. Review why both asexual and sexual reproduction is necessary. Explain that meiosis is needed to reduce the chromosome number to produce gametes for sexual reproduction whereas mitosis results in identical daughter cells with no change in chromosome number. Also emphasize that independent assortment and crossing over during meiosis, along with random mating, ensures diversity among sexually reproducing organisms. Point out that while most complex organisms (like plants and animals) reproduce sexually, other organisms have a sexual phase in their life cycle (fungi and many protists) or at least a method for increasing diversity (conjugation in bacteria). Have students complete the Graphic organizer (Pages 42-43) on asexual and sexual reproduction.

• Field Sketchbook (Pages 44-45) on Meiosis. Students will illustrate the stages of Meiosis in their journal and explain why this process is necessary to organisms. Explain crossing over and how it helps maintain diversity in organisms.

• Write a Meiosis Poem (Page 46) to assess student understanding of how meiosis ensures diversity. (Share poems)

Drawing Journal sharing Performance Task – Share Poems Informal – Teacher observation and questioning Graphic Organizer- Asexual versus Sexual Reproduction



• Provide students a few minutes to observe the asexual reproduction lab, collect data and tend to the needs of the organisms.

4 • Cells in sexually reproducing organisms contain two copies of each chromosome; therefore, two copies of each gene, which explains many features of heredity such as how variations that are hidden in one generation can be expressed in the next.


SB1.a SB2.b,c SCSh1.a,b,c SCSh9.a,c,d

• Continue Field Sketchbook (page 44-45) sharing on Meiosis

• Complete and present Meiosis Poem (page 46) to assess student understanding of how meiosis ensures diversity.


Drawing Journal sharing Performance Task – Share Poems Informal – Teacher observation and questioning

5 • Using the DNA code the cell manufactures needed proteins that determine an organism’s phenotype.

• The instructions for specifying the characteristics of an organism are carried in DNA, a large polymer formed from the subunits ATCG, located in the cell(s) of that organism.

SB1.a SB2.a, b SCSh1.a,b,c SCSh9.a,c,d

• Hieroglyphics and the Genetic Code (Page 47) to introduce the concept of coding of DNA. Students will decipher a hieroglyphic code to explain how codes are used to denote something else.

• Using a 10-2 lecture format, study guide, group work, or discussion explain the process of DNA/RNA (replication, transcription, and translation.) Reinforce prior information that DNA and RNA are examples of one of the types of macromolecules. Be sure to mention the need for enzymes like DNA polymerase and RNA polymerase in these processes.

• Assign the DNA song (Pages 48-50) or have students write their own DNA song. Teacher Note: If you are having students write their own DNA song you may want to do this

Informal – Teacher observation/questioning Performance Task – Create and perform a song to compare and contrast DNA/RNA



as a group activity. You could take this to the next level by having students include the differences between DNA and RNA in their song. The song will help the students remember the structure and function of DNA.


6 • The instructions for specifying the characteristics of an organism are carried in DNA, a large polymer formed from the subunits ATCG, located in the cell(s) of that organism.

• Using the DNA code the cell manufactures needed proteins that determine an organism’s phenotype.

SB1.a SB2.a,b SCSh1.a,b,c SCSh2. a, b, c SCSh6. a SCSh9.a,c,d

• Complete and present DNA Song (these could be presented during natural wait times during the DNA extraction activity)

• DNA Extraction Lab (Page 51) – Students will extract DNA from strawberries and will conduct a test to indicate the substance extracted is DNA.

• Explain the abstract format (Pages 52-54). Students will be assigned a variety of topics to research and prepare an abstract for. Students should be provided an opportunity to improve work through the use of teacher and/or peer commentary/feedback. Provide students with specific due dates for each article and for the finished product.

• Explain Socratic Seminar (Pages 55-68) on cloning and give students the article they will need to read. Socratic Seminar will be held later in the unit. (Teacher Note: Alternative articles could be selected according to student reading levels)


Formal Lab report on DNA Lab Read article and complete abstract

7 • The instructions for specifying the characteristics of an organism are carried in DNA, a large polymer formed from the

SB1.a SB2. a, b SCSh1.a,b,c SCSh6.d

Choose from one or more of these transcription/translation activities:

• Race for Life (Pages 69-70) - mRNA race – Students will work as a team to carry out the process of transcription and translation.

• Translation Simulation (page 74) – Students will complete

Performance Task – Translation activity Informal –



subunits ATCG, located in the cell(s) of that organism.


a simulation of the process of translation. Conduct a large group discussion to assess student understanding of the end result of translation. Rearrange two of the amino acids to simulate a mutation. Emphasize the results of a mutation on an organism.

• DNA/RNA Processes – Students will demonstrate an understanding of the process of translation (Pages 81-82)


Teacher observation/questioning

8 • Using the DNA code the cell manufactures needed proteins that determine an organism’s phenotype.

• Cells in sexually reproducing organisms contain two copies of each chromosome; therefore, two copies of each gene explain many features of heredity such as how variations that are hidden in one generation can be expressed in the next.

• Hereditary information, coded by DNA, is passed down from generation to generation in a predictable way.

SB1.a SB2.a,b,c SCSh1.a,b,c SCSh4.a SCSh5.c SCSh6.c, d SCSh7.a,b SCSh8.e

• Using a 10-2 lecture format, study guide, group work, or discussion; help students understand Mendel’s contribution to the study of genetics. Explain Mendel’s Laws.

• Explain the use of Punnett squares (Monohybrid crosses, incomplete dominance, co-dominance, and sex-linked crosses) in predicting the outcome of genetic crosses. Show students how to use Punnett square problems to make these predictions.

• Continue work on Mendelian Abstracts and Socratic Seminar.


Informal – Teacher Observation/questioning Punnett square problems

9 • Using the DNA code the cell manufactures

SB1.a SB2.a,b,c,e

• Students complete Punnett square problems (also incomplete dominance problems) (Pages 83-85)

- Informal – Teacher



needed proteins that determine an organism’s phenotype.




SCSh1.a,b,c SCSh4.a SCSh5.c SCSh6.c, d SCSh7.a, b SCSh8.e SCSh9.a, c

• Continue work for Socratic Seminar. • Provide students a few minutes to observe the asexual

reproduction lab, collect data and tend to the needs of the organisms.

Observation/questioning - Punnett square problems - Read article and complete abstract


• Using the DNA code the

SB1.a SB2.a,b,c,e SCSh1.a,b,c SCSh4.a SCSh5.c SCSh6. c, d SCSh7.a, b SCSh8.e

Choose one of the following activities to complete:

• Is That Your Baby – determine the phenotypes of rabbits using Mendel’s principles. (Pages 87-88)

• Human Genetics Lab – determine how traits are inherited from parents. (Pages 89-90)

Then complete the following activity:

• Genetics Disorder Dramatization – identify the results of genetic disorders (Page 91)

Phenotype Activity Informal- Teacher Observation Lab – Genetics Research of Genetic Disorder



cell manufactures needed proteins that determine an organism’s phenotype.




• Provide students a few minutes to observe the asexual



SB1.a SB2.a,b,c,e,f SCSh1.a,b,c SCSh4. a, b SCSh5. a, c SCSh9. a,c,d


• Continue work on Socratic Seminar.

Performance Tasks: - Genetics lab







• The development and use of technologies may cause social, moral, ethical, and legal issues.

12 • The instructions for specifying the characteristics of an organism are carried in

SB1.a SB2.a,b,c,d,e,f SB5.e SCSh1. a,b,c

• Using a 10-2 lecture format, study guide, group work, or discussion; explain the types of genetic mutations (gene and chromosomal) and their effects on an organism. Be sure to point out that although some mutations are visible, some

Informal – Teacher observation and questioning



DNA, a large polymer formed from the subunits ATCG, located in the cell(s) of that organism.




• Changes in DNA occur spontaneously at low rates, some of these changes make no difference to the organism whereas others can change cells and organisms.

SCSh7. a SCSh8. e SCSh9. a,c,d

mutations are internal and not visible when viewing an organism. Be sure to tie the information about mutations to plant and animal adaptations.

• Work in small groups on sentence mutations What’s A Mutation (Page 92). Students complete the activity to see how mutations affect an organism.




• Only mutations in germ cells can contribute to the variation that change an organism's offspring





• Changes in DNA occur spontaneously at low rates, some of these changes make no difference to the organism whereas others

SB1.a SB2. a,b,c,d SB5.d SCSh1. a SCSh2. a, b, c SCSh3. e SCSh6. a SCSh7. a, b SCSh8. a, f

• Assess understandings of mutations using DNA Sequence (Pages 93-94) of a Human vs. a Cow. Students will examine the differences in the DNA sequence of a human and a cow and conclude that these DNA sequences are very similar.

• Introduce Population Genetics Lab (Pages 95-97) • Provide students a few minutes to observe the asexual


Informal: Teacher observation/questioning Performance task - Mutations lab - Abstract: Mendelian Genetics due



can change cells and organisms.

• Favorable variations among individuals that increase the chance of survival tend to be passed onto successive generations.


14 • Changes in DNA occur spontaneously at low rates, some of these changes make no difference to the organism whereas others can change cells and organisms.

• Only mutations in germ cells can contribute to the variation that change an organism's offspring.


• The development and use of technologies may

SB2. d, f SB5. d, e SCSh1. a, b, c SCSh2. a, b, c SCSh3. e SCSh6. a SCSh7. a, b SCSh8. a, f

• Complete activity: Population Genetics – (Pages 95-97). Formal Laboratory_Report and Lab_Rubric (Page 108-109)

• Continue work on Socratic Seminar.

- Abstract: on DNA Technology or Genetic Engineering - Performance task Animal Adaptation Lab Report - Informal: Teacher Observation and questioning -Ticket Out the door



cause social, moral, ethical, and legal issues.

15 • Only mutations in germ cells can contribute to the variation that change an organism's offspring.



SB2.d,f SB5.e SCSh1. a, c SCSh6. d SCSh7. c SCSh8. e, f

• Using a 10-2 lecture format, study guide, group work, or discussion explain what genetic engineering is and how it is used. Be sure to address: * Recombinant DNA * Transgenic organisms (animals) * Use of gene therapy to treat genetic disorders * DNA fingerprinting used in forensics * Gel electrophoresis * Uses of modern genetic engineering in agriculture


Informal: Teacher observation/questioning

16 • The development and use of technologies may cause social, moral, ethical, and legal issues.

SB2.f SCSh1. a, c SCSh6. d SCSh7. c SCSh8. e, f SCSh9. a, c

• Using a 10-2 lecture format, study guide, group work, or discussion identify how DNA technology/cloning is used in forensics.

• Students will prepare for Socratic Seminar (modified version)

Informal: Teacher observation and questioning Read article and complete abstract


SB2.f SCSh1. a, c SCSh6. d SCSh7. c

Socratic Seminar (modified version) to be held this day. Students will debate the issue of cloning. Students will choose a position on cloning and write a paper about their choice. Students will justify their position based on information from the

Informal: Teacher observation/questioning



SCSh8. e, f SCSh9. a, c

documents they have read and the comments in the Socratic Seminar. (Pages 55-68)

Position Paper on Cloning


SB2.f SCSh1. a, c SCSh6. d SCSh7. c SCSh8. e, f SCSh9. a, c

• Discuss Bio-ethics using As the Frog Leaps (Page 98) – Biology Buddies on Bioethics – This is a round robin game where students will discuss bioethical issues.

• Introduce the Gel electrophoresis Lab Choose between one of the following labs depending on your resources (i.e. lab equipment, computers, etc.) *Authentic gel electrophoresis (Teacher Note: Actual gel electrophoresis if lab equipment is available) * On-line gel electrophoresis lesson http://learn.genetics.utah.edu/units/biotech/gel/ * Fingerprinting on a Reduced Budget (Page 99-104) *Who’s Your Daddy? - Paternity Lab (on-line at http://www.biology.arizona.edu/human_bio/problem_sets/DNA_forensics_1/DNA_forensics.html)

• The Biology Project will help you learn about the basic principles that govern the use of DNA technology (Teacher Note: This can be used as an application with any of the above mentioned gel electrophoresis activities.)


Informal discussion Abstract on DNA technology or genetic engineering


SB1a SB2.a,b,c,f SCSh1. a, c SCSh6. a. d SCSh7. c SCSh8. e, f SCSh9. a, c

• Conduct the Gel electrophoresis Lab that best suits the resources available.

Choose between one of the following labs depending on your resources (i.e. lab equipment, computers, etc.) *Authentic gel electrophoresis (Teacher Note: Actual gel electrophoresis if lab equipment is available) * On-line gel electrophoresis lesson http://learn.genetics.utah.edu/units/biotech/gel/ * Fingerprinting on a Reduced Budget (Page 99-104)

Read article and complete abstract Informal: Teacher observation/questioning




http://www.biology.arizona.edu/






*Who’s Your Daddy? - Paternity Lab (on-line at http://www.biology.arizona.edu/human_bio/problem_sets/DNA_forensics_1/DNA_forensics.html)

• The Biology Project will help you learn about the basic principles that govern the use of DNA technology (Teacher Note: This can be used as an application with any of the above mentioned gel electrophoresis activities.)


Performance Task: Gel electrophoresis Lab

20 • Changes in DNA occur spontaneously at low rates, some of these changes make no difference to the organism whereas others can change cells and organisms.

• Only mutations in germ cells can contribute to the variation that change an organism's offspring.


SB2.d,f SB5e SCSh1. a, c SCSh6. d SCSh8. e, f SCSh9. a, c, d

Explain how biological resistance is changing organisms – • Jigsaw_Activity_on_Microbes: What they do and how

antibiotics change them.” http://www.actionbioscience.org/evolution/meade_callahan.html (Use alternative articles based upon reading levels of the students)Students will be placed into five (5) different groups. All the ones will read Section 1, the students in group two will read Section 2 and so on. After students have read their assigned section, they will discuss the information and become “experts” on their section. After about 20 minutes, you will reassign the students so that there is a 1, 2, 3, 4, and 5 in each group. The students will then share the section on which they have become an “expert”. (Teacher Note: You may want to have students take notes when they are re-assigned in the group that has a 1, 2, 3, 4, and 5. Take up the notes as their ticket out the door.) (Page 105)

• Ticket Out the Door: Have students describe how bacteria could become resistant to antibiotics. Teacher note: If time and resources allow, students could design and conduct a lab to support their description.

Informal: Teacher observation/questioning Jigsaw activity on biological resistance Ticket Out the Door

21 • The instructions for specifying the

SB1a SB2a,b,c,d,e,f

• Complete formal lab report for the Asexual Reproduction Activity that has been observed for the last 4 weeks.

Lab report



http://www.biology.arizona.edu/





characteristics of an organism are carried in DNA, a large polymer formed from the subunits ATCG, located in the cell(s) of that organism.

• Using the DNA code the cell manufactures needed proteins which determine an organism’s phenotype

• Cells in sexually reproducing organisms contain two copies of each chromosome and therefore two copies of each gene, which explains many features of heredity such as how variations that are hidden in one generation can be expressed in the next.


• Changes in DNA occur spontaneously at low rates, some of these changes make no difference to the

SCSh9a,c,d Laboratory_Report and Lab_Rubric (pages 108 – 109) • hotseat (page 106)(review activity) • Summative Evaluation

Summative Assessment



organism whereas others can change cells and organisms.




22 • The instructions for

specifying the characteristics of an organism are carried in DNA, a large polymer formed from the subunits ATCG, located in the cell(s) of that organism.

• Using the DNA code the cell manufactures needed proteins which determine an organism’s phenotype

• Cells in sexually reproducing organisms

SB1a SB2a,b,c,d,e,f SB9a,b,c

• ABC Book of Genetics Due (Culminating Activity) - Students will create an ABC picture book of genetic concepts. (Pages 34-36). Students should conduct a peer review of the ABC Books. This could be completed as a Gallery Walk or a “hot potato” activity in which students pass a book until time is called. At that point they will receive another book to critique. Use sticky note pads to provide the feedback and commentary. This could also be completed in small groups.

• Ticket out the Door: return the original growth and

heredity acrostic from the beginning of this unit to the students. Allow them to revise their work.

Performance Task: ABC Book of Genetics (Culminating Activity) Ticket Out the Door



contain two copies of each chromosome and therefore two copies of each gene, which explains many features of heredity such as how variations that are hidden in one generation can be expressed in the next.





• The development and use of technologies may



cause social, moral, ethical, and legal issues.



Growth and Heredity Acrostic

Begin the unit by asking the students to write concepts, use vocabulary or tell anything that they know about growth and heredity using an anagram. G R O W T H / H E R E D I T Y Retain the students’ papers and return them at the end of the unit. Ask the students to go back and correct and add to the above anagram.



Asexual Reproduction Lab Inquiry Lesson

(This is intended as a guide for teachers not as a student worksheet)

Complete a formal lab report using the Lab Report format on page 108. Materials: A variety of plants:

• strawberry stem • carrot top • white potato • green onion • iris/day lilies • various containers • water • potting soil • plastic spoons (to dig dirt) • culture medium

Procedures: Students should develop a method to reproduce a plant by any of the standard cultivation techniques used in the agricultural or horticultural setting. Include the horticulture or AgEd teacher in this project if one is available.

Sample Procedures for Rooting:

1. Leaves: Many plants with succulent leaves can be propagated from leaf cuttings. To make a leaf cutting, cut the petiole at a 45o angle about 1 cm from the leaf (less if the petiole is short).

2. Leaves: Insert the petiole up to the leaf in the culture medium. Vegetative roots will form in 3-4 weeks. Begonias (Rex) may also be propagated by placing a leaf disk about 2 cm in diameter on damp filter paper in a covered Petri dish, where roots and shoots will form. From this and the following plant cloning activities, record sketches or descriptions of your methods and subsequent observations.

3. Leaves: Place a Bryophyllum or Jade plant leaf on the surface of potting soil. Keep the soil moist and observe the edges of the leaf.

4. Stems: One of the most common methods used in asexual plant propagation uses stem cuttings. To make a stem cutting, use a clean, sharp razor blade or knife to cut a section of stem optimally containing at least two nodes (points of leaf attachment). Remove all except the top 3 or 4 leaves. Insert the bottom 3 to 5 cm of the stem section into the solution containing rooting hormone. Roots will form in a couple of weeks.

5. Stolons: Strawberries and Bermuda grass are actually modified stems. As the plant reproduces asexually the stolons continue to spread. Cover the stolon lightly with soil and new plants will form.

6. Tubers: Tubers, such as white potatoes, are plants with swollen, underground stems. The "eyes" on a potato are tuber buds from which a new plant will grow. Leave some potatoes in a closed cabinet for several weeks. Make daily observations of the eyes on the potatoes. Other ways to propagate plants from



potatoes include (a) cutting the eyes from a potato and planting them in soil; and (b) placing four toothpicks around the center of a sweet potato and placing the potato, pointed side down, into a jar of water.

7. Bulbs: Bulbs are plants with short, underground stems and thick, fleshy leaves. The leaves store food for the growth of the plant. Plant several bulbs, such as onions, tulips, daffodils, or lilies, in potting soil. After two weeks, make daily observations of one of the bulbs by removing and carefully brushing away the soil. Allow the other bulbs to continue growing undisturbed.

8. Roots: Grow plants from carrot tops (roots) by filling a shallow container with sand. Thoroughly wet the sand with water and insert the cut end of the carrot tops into the wet sand. Place the container in a lighted area and keep the sand wet. Observe the tops of the carrots for several weeks. Transfer them to a deeper container for further maturing of the plants. Check with a professional at a nursery for the best growing soil for carrots.



ABC Book of Genetics

You are an author who has been asked to write an ABC children’s book about genetics. As you create this ABC book you must address:

• DNA technology (used in forensics, medicine, and agriculture) • Biological resistance • Sexual and asexual reproduction (the need for both) • Mendelian Genetics • DNA & RNA processes (replication, transcription, and translation) • Chromosomes (chromosome number, homologous chromosomes, and sister chromatids) • Mutations (gene and chromosomal)

Requirements:

1. All letters of the alphabet must be used. 2. Each page must have a letter and a picture. The picture may be illustrated by hand or may be found on

the Internet. 3. In addition to the letter and picture, each student must provide the information about genetics that is

represented by that letter and be tied into one or more of the seven themes listed above. 4. DO NOT put more than one letter of the alphabet on a page. 5. You must include an example of the following in your book: DNA technology, biological resistance,

chromosome mutation, point mutation, DNA translation and transcription, Mendelian genetics, asexual reproduction, and sexual reproduction.

Example:

T T is for twins. Identical twins have exactly the same genes and look nearly the same. Fraternal twins are no more alike than any other brothers and sisters. Each fraternal twin has his or her own unique combination of genetic information. TEACHER NOTE: The following differentiated instruction techniques may be used for students with special needs/disabilities. Choose the level that best fits the needs of particular students.

• Reading/research buddies • Extended time to complete task • Allow students to work in pairs • Give specific terms for each letter of the alphabet for the student to research and draw.

This may include allowing the student to go to a resource room during class time to work on the project.



ABC Book of Genetics Rubric

Exceeds

Expectations 4

Meets Expectations

3

Does Not Meet Expectations

2 DNA

technology The student explains recombinant DNA, transgenic organisms, gene therapy, DNA fingerprinting, and gel electrophoresis; he/she also gives examples of each type of DNA technology.

The student explains recombinant DNA, transgenic organisms, gene therapy, DNA fingerprinting, and gel electrophoresis.

The student shows little or no evidence of an understanding of DNA technology.

Biological Resistance

The student explains how biological resistance is spread and how this can affect humans; he/she also gives examples of ways that humans can help to prevent biological resistance.

The student explains how biological resistance is spread and how this can affect humans.

The student shows little or no evidence of an understanding of biological resistance.

Mutations The student explains that a mutation is a change in the DNA sequence; he/she also explains the two types of mutations: chromosomal and gene mutations; one way to increase diversity.

The student explains that a mutation is a change in the DNA sequence is one way to increase diversity.

The student shows little or no evidence of an understanding of mutations.

Evidence of Scientific

Understanding

DNA Transcription

and Translation

The student explains that DNA transcription is the process of making a strand of mRNA from a strand of DNA; he/she also explains that translation is the process of synthesizing proteins. The student describes the steps of transcription and translation.

The student explains that DNA transcription is the process of making a strand of mRNA from a strand of DNA; he/she also explains that translation is the process of synthesizing proteins.

The student shows little or no evidence of an understanding of mutations.



ABC Book of Genetics Rubric (continued)

Exceeds Expectations

4

Meets Expectations

3

Does Not Meet Expectations

2 Mendelian Genetics

The student explains the Law of Segregation, Law of Independent Assortment and the Law of Dominance and explains how a Punnett square is used to illustrate these laws.

The student explains a Punnett square and shows an example.

The student shows little or no evidence of an understanding of Mendelian genetics.


Understanding

Asexual/Sexual Reproduction

The students explain that asexual reproduction occurs in somatic cells, resulting from one cell (parent), and that the offspring is identical to the parent cell. The student gives examples of asexual reproduction (mitosis, binary fission, regeneration) and explains that sexual reproduction occurs when gametes come together and fuse to from an offspring that is different from the two parents. The student notes that meiosis from these gametes is used in sexual reproduction.

The student explains that asexual reproduction involves only one cell (parent) and that the offspring is identical to the parent cell. The student further explains that sexual reproduction involves two gametes and that the offspring is not exactly like either parent.

The student shows little or no evidence of an understanding of asexual and sexual reproduction.

Relevance/Relati

onship

The letter, picture and statement are correctly related into more than one of the seven themes.

The letter, picture, and statement are correctly related to one of the seven themes.

The letter, picture, and statement are not correctly related to one of the seven themes.



Phases of Meiosis

Teacher’s Worksheet

Interphase I Prophase I

Metaphase I



Anaphase I Telophase I

Prophase II Metaphase II



Anaphase II Telophase II

Pictures taken from:

http://taggart.glg.msu.edu/bs110/meiosis.htm

http://taggart.glg.msu.edu/bs110/meiosis.htm



Phases of Meiosis Student Worksheet



Graphic Organizer for Asexual versus Sexual Reproduction

Characteristics to be

Compared Items to be Compared and Contrasted Similarities and/or

differences

Asexual Reproduction Sexual Reproduction

Process Description

Disadvantages

Advantages

Genetic Variation



Asexual verses Sexual Reproduction (TEACHER NOTES/POSSIBLE STUDENT RESPONSES)

Characteristics to be Compared

Items to be Compared and Contrasted Similarities and/or differences

Asexual Reproduction Sexual Reproduction

Process Description

Mitosis requires only one parent. Offspring are identical replicas of the parent. The cell divides after the DNA replicates. There are no gametes formed. It can also occur by fragmentation (a piece of the organism breaking off).

Meiosis requires two parents. Each parent contributes one-half of the genetic information passed to the offspring. Each gamete is haploid (having 1 copy of each chromosome). When gametes fuse they produce a diploid (2 copies of each chromosome) offspring that is not identical to either parent.

Both mitosis and meiosis are forms of reproduction. In asexual reproduction only one parent is needed; in sexual reproduction two parents are required. Mitosis produces offspring that are identical to parents, and meiosis produces genetically unique offspring

Disadvantages

All offspring are genetic replicas; there is not genetic variation except from mutations. This is a disadvantage because this does not allow organisms to adapt to changing environments.

This process requires two parents. This causes the process of producing offspring to be slower. The population cannot grow as quickly.

No similarities or differences in disadvantages.

Advantages

Only one parent is needed which allows the population to increase rapidly. Under desirable environmental conditions this is an advantage in ensuring population size.

The offspring produced by sexual reproduction are genetically different and able to adapt and evolve to a changing environment. Sexual reproduction is an advantage in less desirable environments.

No similarities or differences in advantages.

Genetic Variation

There is little or no variation among a population that is otherwise identical. The only variations come from mutations.

There is great diversity among populations due to the recombination of two parents. Mutations also occur in meiosis.

Mutations are a source of variation in both asexual and sexual reproduction. Asexual reproduction produces identical offspring and sexual reproduction produces two genetically unique offspring.



Guidelines for Field Sketchbook

(Growth and Heredity)

This should be completed in the field sketchbook that is used throughout all the units. Each of the following concepts should be illustrated and labeled on the right-side page and a verbal description explaining the illustration and labels should be neatly written on the left-side page. All illustrations should be in color.

A. Illustrate Mendel’s crosses and results. Include the following for the P generation and F1 generation: height of plant, pod appearance and color, seed texture and color and flower color. What is the probability ratio for each trait/characteristic?

B. Correctly illustrate the structure of a DNA molecule, including the following: deoxyribose, phosphate

groups, hydrogen bonds and the following: adenine, guanine, cytosine, and thymine correctly paired

C. Correctly illustrate the process of DNA replication using your own representations. Include: helicase, replication fork, DNA polymerase, old and new DNA strands.

D. Correctly illustrate the process of transcription using your own representations.

Include DNA (2 strands), mRNA, RNA polymerase, adenine, guanine, cytosine, thymine and uracil (correctly paired).

E. Correctly illustrate the process of translation using your own representations.

Include the nucleus, amino acids, transfer RNA (tRNA), messenger RNA (mRNA), codons, anticodons, and ribosomes.

F. Sketch a human sex chromosome. Label and color 3 types of possible genes and where the genes

might be located on the chromosome. G. Illustrate a cartoon, correctly depicting a bioethical issue/dilemma. Describe using captions or

character dialogue (balloons) and the issue being addressed. Incorporate an obvious start, middle and end, depicting how you feel about the particular issue.

H. Illustrate the developmental process of an organism produced by sexual reproduction and the

developmental process of an organism that reproduces by asexual reproduction. Sexual reproduction might be illustrated by the developmental process of a human, animal or plant. Asexual reproduction might be illustrated by the developmental process of an organism that undergoes binary fission, budding, etc.

I. Illustrate the stages of meiosis and explain why this process is necessary to organisms. Explain

crossing over and how it helps to maintain diversity in organisms.



Sharing

The Drawing Journals (Share, Pair, Square)

Each student should share at least one of his/her journal entries with a partner. Then both partners will share their entries with another pair of students. Finally, the final group of four students will share their entries with the entire class (commonly called share, pair, square).



Meiosis Poem

Have students write a poem about how meiosis ensures biodiversity using the language that is appropriate to the process of meiosis. Give students the rubric so that they have access to this contextual language before creating the poem. Or, students may create an alternative rubric beforehand and submit it for teacher approval to ensure that it meets the criteria of the assignment.. Instruct the students that the poem must be at least 12 lines long and it must rhyme. Students should present their poems. TEACHER NOTE: If you do not require the poem to rhyme, the students will write a paragraph which is much more difficult to grade.

Meiosis Poem Rubric Exceeds Meets Does Not Meet

Cellular outcome of meiosis

Compares and contrasts outcomes of mitosis and meiosis

States the results of meiosis as four different (non-identical) cells

No explanation of the results of meiosis

Results of crossing over

Explains how crossing over occurs when a tetrad forms as homologous chromosomes exchange genetic information

Shows evidence of understanding that homologous chromosomes exchange genetic information

Little or no evidence of understanding that homologous chromosomes exchange genetic information

Effects of meiosis on biodiversity

Illustrates in depth the understanding of how crossing over in meiosis and random combination of gametes at fertilization leads to biodiversity

Shows evidence of understanding that random combination leads to diversity

Does not explain why we have diversity


Understandings

Why meiosis is important in the

formation of organisms?

Illustrates that meiosis cuts the chromosome number in half as compared to mitosis

Shows evidence of understanding the meiosis cuts the chromosome number in half

Does not show evidence of understanding that meiosis cuts the chromosome number in half

Length of Poem Poem is 12 lines long

Poem is between 9 and 11 lines long

Poem is less than 9 lines long

Format

Requirements Rhyming of Poem

Most of the poem rhymes (At least 10 lines rhyme)

Some of the lines rhyme (At least 8 lines but less than 10 lines rhyme)

Few lines rhyme (At least 6 lines but less than 8 lines rhyme)



Hieroglyphs and the Genetic Code Cracking an Unknown Code

Objective: Students will understand that codes represent other words or instructions. They will also understand that codes must be deciphered in order to be understood. Background Information: Watson and Crick had to work long hours at the trying task of deciphering the DNA model. The dilemma of solving the language of DNA was very similar to the problems encountered with the deciphering of ancient hieroglyphs. Procedures:

1. Divide the students into groups of three. 2. Each group should list their last names written without spaces (ex. watsonmalonebridges). Each

group will then separate the letters like a DNA triplet (ex, wat son mal one bri dge s). Remember: not all strands end with a perfect triplet.

3. Use the last names triplet code of the students to create a hieroglyphic code. ⌃

4. Once the hieroglyphic code has been created as in step three, give your hieroglyphic code to another group to decipher.

A N B O C P D Q E R F S G T ⌃ H U ⌥ I V J W K X L Y M Z

Conclusion: Write a paragraph to explain how this activity relates to Watson and Crick’s discover of DNA.



DNA Song (Sing to the tune of Row, Row, Row Your Boat)

We love DNA made of nucleotides

sugar, phosphate, and a base bonded down one side.

Adenine and thymine

make a lovely pair cytosine without guanine

would feel very bare.

D, D, DNA different sets of genes

look inside the nucleus for instructions to make proteins.

We love DNA

it’s the code of life and the genetic makeup of

all you have in side. Differentiation: You may want to have students write their own songs about DNA. Have students work in groups to create a DNA song. Requirements:

• Explain what makes up a DNA strand: nucleotide sugar phosphate bases (nitrogenous)

• Explain the base pairing concept: thymine pairing with adenine cytosine paring with guanine

• Explain where DNA is found and that they are the instructions used to make proteins. • Explain that it is the genetic make-up of all organisms.



DNA Song (Example 2) We love______________ nucleotides, DNA made of _________________________ one, base, phosphate sugar, _________________ and a ____________________ bonded down _____________side. ________________ and_______________________ pair, thymine, make a lovely ___________________, adenine, cytosine, __________________without________________ bare, guanine would feel very ___________. D, D, __________________ DNA, proteins, different sets of____________________. genes, nucleus Look inside the _____________________ for instructions to make_____________________. We love ______________ DNA, inside, code it’s the _____________ of______________ genetic, life and the __________________makeup of

all you have_______________________.



DNA Song (to the tune of “Row, row, row your boat”)

Assignment: Students will perform this song.

Teacher note: As an option for differentiated instruction with this activity, students may be allowed to fill in specific, missing words from the song using a word bank and then recite directly from the completed paper. Two example sheets are attached. Each one provides a different level of performance expectation by reducing the amount of memorization and/or by breaking the information into smaller, more manageable pieces.

DNA Song (Ex. 1): One word bank is provided with only the missing words. Students will fill in the blanks and then recite the completed form. A blank copy of this form may be given in advance for the student to practice before the assessment.

DNA Song (Ex. 2): A word bank is provided for each stanza of the song. The provided words fit the corresponding stanza only. Students will fill in the blanks and then recite the completed form. A blank copy of this form may be given in advance for the student to practice before the assessment. .



DNA Extraction Lab

There are many good websites for DNA extraction on the Internet. Below are some sample sites: http://carnegieinstitution.org/first_light_case/horn/DNA/BERRYteacDNA http://www.accessexcellence.org/AE/AEC/CC/DNA_extractions.html

http://learn.genetics.utah.edu/units/activities/wheatgerm Teacher Note: You need to take this lab to the next level by having students verify that DNA is the molecule they have extracted. This can be done by testing for DNA and can be accomplished by using the substance Diphenylamine Reagent. This is a clear solution that turns blue if DNA is present. Safety precautions must be used with this substance.

http://carnegieinstitution.org/first_light_case/horn/DNA/BERRYteacDNA

http://www.accessexcellence.org/AE/AEC/CC/DNA_extractions.html

http://learn.genetics.utah.edu/units/activities/wheatgerm



Abstract Format

Procedures:

1. Each week the student is to research a topic that is predetermined by the instructor. The topic is aligned with the curriculum being taught.

Example: This week’s topic is growth & heredity. 2. The student researches the topic and prints a copy of the chosen article. He/she writes a one page

abstract that is composed of three paragraphs. The first paragraph is a synopsis of the article, the second paragraph expresses whether or not the student liked the article with a valid reason defending his opinion based on the content of the article as it relates to the curriculum being taught and the third and final paragraph explains which group of individuals the student thinks will benefit from reading this particular article and why/how they would benefit.

3. The abstract is attached to the article and turned in by a specific date. The abstracts are hand written and must be legible. The students are advised about plagiarism as the instructor can check for plagiarism using the Internet.

4. When the abstracts are turned in, the instructor reads and offers comments on the student’s performance regarding the standard (see abstract rubric). The instructor makes suggestions as to what the student may change to create a better abstract. The instructor returns the abstract to the student.

5. The student may resubmit the corrected copy attached to the top of the original and the article. The instructor decides how long the student has to make corrections and when the corrected copy is due. The abstracts are filed in the student’s abstract portfolio.

6. Near the end of the nine week grading period, the student selects any two abstracts from that nine week period to be graded for accuracy. The student writes a paragraph to explain why they think the abstract was their best work sample and attaches this to the front of the abstract. These grades are posted. The students do not know ahead of time which abstracts will be chosen for grading purposes; therefore they must do all abstracts and correct and resubmit them for the best grade possible. It is the instructor’s choice as to how the grade will be used (ex. homework, research, exam, etc.).

Differentiation Strategies: Option 1 Specific articles with guided questions may be assigned to students with special needs/disabilities rather than having students summarize their own selection. Option 2 The teacher selects the article for the students to read. Students work in pairs. Student A reads aloud to Student B. Student B summarizes to Student A orally. Students will then reverse roles. After each student has read and summarized orally, they will write an individual summary to be turned in as directed in Steps 4-6 above.



Abstract Points

Synopsis (25 points)

Did you Like? Dislike? Why? (10 points)

Who would benefit? How? (10 points)

Grammar (10 points)

Is the abstract clear (easy to read)? (15 points)

Does the abstract match the article? (10 points)

Matching Article Attached (10 pts)

TOTAL=

Abstract Points




Grammar (10 points)




TOTAL=



Option 2 Peer-Review of Abstract

Abstract Points Peer-Tutoring Peer Assessment




Grammar (10 points)




TOTAL=

Abstract Points Peer-Tutoring Peer Assessment




Grammar (10 points)




TOTAL=



Cloning Socratic Seminar

Objective: Read a selected article concerning cloning and decide your position on the issue. You will also be required to use the article to justify your position. The Text Students will read the teacher selected article on cloning. The instructor will supply the article. You will not be allowed to discuss information from other sources. It is important that everyone is working from the same information. Vocabulary The terms listed are related to the article and are to be used appropriately in context by the students. (Teacher Note: These terms are to be defined only to help the students as they read the article. They are not to be memorized or tested.) embryos fetus prenatal lineage perpetuating pluralistic surrogate motherhood in vitro fertilization artificial insemination corollary therapeutic eugenic endowment inviolable unprocurable autonomy caveat predispose morbidity mortality toxemia unethical allayed arguably epigenetic deformity precedent somatic oocytes The Questions: Keep these questions in mind as you read the article.

• Should cloning, for the purpose of producing children, be allowed? • Are there special circumstances when cloning, for the purpose of producing

children, should be allowed? Socratic Seminar Etiquette

1.) Students should raise hand by placing elbow on the desk. 2.) Students should make a name tag. 3.) Students should mention the name of the person whose comment or question they are

referencing. 4.) Students should give a specific reference to the text with each comment or question. (The

Socratic Seminar is not about your opinion alone; it is about supporting your opinion with the article).

5.) Students will be respectful of other students’ opinion.



Position Statement After the Socratic Seminar you will be required to write a position paper where you will state your position. You are also required to justify your position using information from the cloning article. You need to be specific and thorough in your response. Due Dates:

• Defined vocabulary words. Due date: __________________ • Articles with evidence of note taking (highlighting, notes, and questions in margin) Due date: __________________ • Position statement Due date: __________________

Teacher Notes for Socratic Seminar

• Make enough copies of the article for each student to have one. Copying front to

back is preferred. Students are expected to write on their copy. • The pre-seminar assignment of defining terms needs to be turned in prior to the

seminar. This will ensure that students have a good working vocabulary during the seminar. The pre-seminar assignment of showing evidence of note taking can be turned in with the position paper.

• Give students the copy of the article about two weeks before you are going to conduct the Socratic Seminar.

• It is important that all students use the same information. • If at all possible, the room needs to be arranged in a circle so that everyone can

see everyone else. • Have a copy of the class roll available to keep up with who has spoken and how

many times. Use tally marks to help with this. • You may have to encourage some students to talk while controlling those who

easily share their opinions. About 10 minutes before the end of the seminar remind those students that have not responded that they need to prepare to say something before the end of the period.

The information for this Socratic Seminar on Cloning was taken from the following website. Not all of the information on the website was used. You may choose to use more of the information than was included in this assignment. http://bioethicsprint.bioethics.gov/reports/cloningreport/overview.html

http://bioethicsprint.bioethics.gov/reports/cloningreport/overview.html



Cloning Socratic Seminar Rubric

Exceeds Expectations 3

Meets Expectations 2

Did Not Meet Expectations 1

Position Student clearly states position on cloning of humans and explains why the opinion stated is the most appropriate.

Student clearly states position on cloning of humans but does not explain why the opinion stated is the most appropriate.

Position is not clearly stated; difficult to determine where the student stands on the issue of cloning.

Justification of Position

Student cites relevant evidence from the article to support his position on cloning; student uses it persuasively to support his position.

Student cites relevant evidence from the article to support his position on cloning but does not use the evidence persuasively to support his position.

Student does not cite relevant evidence from the article to support his position on cloning.

Position Paper

Depth of Information

Student provides a well-articulated and detailed argument containing no errors in logic.

Student provides a well-articulated, logical argument but does not include details.

Student makes no clear point and has so many errors in his logic that argument is invalid.

Pre-Socratic

Seminar Requirements

Defined vocabulary terms and

evidence of note-taking of

article

All vocabulary terms are defined correctly and turned in on time. There is evidence of note taking (highlighting, notes and questions in the margin) and these are turned in on time.

Most vocabulary (at least 23 or 80%) terms are defined. There is some evidence of note taking (at least one of the following is evident: highlighting, notes, or questions in the margin).

Few, if any, of the vocabulary terms are defined and there is no evidence of note taking in the article.

Socratic Seminar

Performance during the seminar

The student mentions the name of the person whose comment or question they are referencing. The student makes a specific reference to the text with each comment or question. The student is respectful of other students’ opinions.

The student mentions the name of the person whose comment or question they are referencing and is respectful of other students’ opinion. However, the student only makes a general, not specific, reference to the text with each comment or question.

Student has very little to say during the seminar. The student does not reference other students’ comments or the text.



Human Cloning and Human Dignity: An Ethical Inquiry

The President's Council on Bioethics Washington, D.C. July 2002 www.bioethics.gov Chapter Five

The Ethics of Cloning-to-Produce-Children

Cloning-to-produce-children has been the subject of two major national reports in recent years – first by the National Bioethics Advisory Commission in June 1997,1 and more recently by the National Academy of Sciences in January 2002.2 Both reports concluded that attempts to clone a human being "at this time" would be unethical, owing to questions about the safety of the technique and the likelihood of physical harm to those involved. But both reports also concluded that the nation required much deeper reflection about the "ethical and social implications" of cloning-to-produce-children beyond the scientific and medical aspects of the procedure. As the National Academy of Sciences report stated:

Our present opposition to human reproductive cloning is based on science and medicine, irrespective of broader considerations. The panel stresses, however, that a broad ethical debate must be encouraged so that the public can be prepared to make decisions if human reproductive cloning is some day considered medically safe for mothers and offspring.3

In this chapter we attempt to take up this charge to engage in a broad ethical consideration of the merits of cloning-to-produce-children.

The prospect of cloning-to-produce-children raises a host of moral questions, among them the following: Could the first attempts to clone a human child be made without violating accepted moral norms governing experimentation on human subjects? What harms might be inflicted on the cloned child as a consequence of having been made a clone? Is it significant that the cloned child would inherit a genetic identity lived in advance by another – and, in some cases, the genetic identity of the cloned child's rearing parent? Is it significant that cloned children would be the first human beings whose genetic identity was entirely known and selected in advance? How might cloning-to-produce-children affect relationships within the cloning families? More generally, how might it affect the relationship between the generations? How might it affect the way society comes to view children? What other prospects would we be tacitly approving in advance by accepting this practice? What important human goods might be enhanced or sacrificed were we to approve cloning-to-produce-children?

In what follows, we shall explicitly consider many of these questions. But as we do so, we shall not lose sight of the larger and fundamental human contexts discussed in Chapter One – namely, the meaning of human procreation and care of children, the means and ends of biotechnology, and the relation between science and society. Indeed, overarching our entire discussion of the specific ethical issues is our concern

http://bioethicsprint.bioethics.gov/

http://bioethicsprint.bioethics.gov/reports/cloningreport/children.html#endnote1



http://bioethicsprint.bioethics.gov/reports/cloningreport/overview.html



for the human significance of procreation as a whole and our desire to protect what is valuable in it from erosion and degradation – not just from cloning but from other possible technological and non-technological dangers. Readers of this report are encouraged to consider the discussion that follows in a similar light.

We will begin by formulating the best moral case for cloning-to-produce-children – describing both the specific purposes it might serve and the philosophic and moral arguments made in its favor. From there we will move to the moral case against cloning-to-produce-children. Beginning with the safety objections that have dominated the debate thus far, we will show how these concerns ultimately point beyond themselves toward broader ethical concerns. Chief among these is how cloning-to-produce-children would challenge the basic nature of human procreation and the meaning of having children. We shall also consider the effects of cloning on human identity, how it might move procreation toward a form of manufacture or toward eugenics, and how it could distort family relations and affect society as a whole.

* *

I. The Case for Cloning-to-Produce-Children

Arguments in defense of cloning-to-produce-children often address questions of reproduction, but they tend to focus on only a relatively narrow sliver of the goods and principles involved. This certainly does not mean that such arguments lack merit. Indeed, some of the arguments in favor of cloning-to-produce-children appeal to the deepest and most meaningful of our society's shared values.

A. Purposes

In recent years, in anticipation of cloning-to-produce-children, proponents have articulated a variety of possible uses of a perfected technology: providing a "biologically related child" for an infertile couple; permitting reproduction for single individuals or same-sex couples; avoiding the risk of genetic disease; securing a genetically identical source of organs or tissues perfectly suitable for transplantation; "replacing" a loved spouse or child who is dying or has died; obtaining a child with a genotype of one's own choosing (including one's own genotype); replicating individuals of great genius, talent, or beauty, or individuals possessing traits that are for other reasons attractive to the “cloners”; and creating sets of genetically identical humans who might have special advantages in highly cooperative ventures in both war and peace.4 The desire to control or select the genomes of children-to-be through cloning has charmed more than a few prospective users, in the United States and around the world.

Although we appreciate that a perfected technology, once introduced for one purpose, might then be used for any of these purposes, we shall examine further only those stated purposes that seem to us to merit serious consideration.




1. To Produce Biologically Related Children

Human cloning would allow individuals or couples with fertility problems to have biologically related children. For example, if a man could not produce sperm, cloning would allow him to have a child who is "biologically related" to him. In addition, it would allow married couples with fertility problems to avoid using donor gametes, and therefore avoid raising children with genetic inheritances from outside the marriage.

2. To Avoid Genetic Disease

Human cloning could allow couples at risk of generating children with genetic disease to have healthy children. For example, if both parents carried one copy of a recessive gene for the same heritable disorder, cloning might allow them to ensure that their child does not inherit the known genetic disease (without having to resort to using donor gametes or practicing preimplantation or prenatal genetic diagnosis and elimination of afflicted embryos or fetuses).

3. To Obtain "Rejection-Proof" Transplants

Human cloning could produce ideal transplant donors for people who are sick or dying. For example, if no genetic match could be found for a sick child needing a kidney or bone marrow transplant, and the parents had planned to have another child, cloning could potentially serve the human goods of beginning a new life and saving an existing one.

4. To "Replicate" a Loved One

Human cloning would allow parents to "replicate" a dead or dying child or relative. For example, one can imagine a case in which a family – mother, father, and child – is involved in a terrible car accident in which the father dies instantly and the child is critically injured. The mother, told that her child will soon die, decides that the best way to redeem the tragedy is to clone her dying child. This would allow her to preserve a connection with both her dead husband and her dying child, to create new life as a partial human answer to the grievous misfortune of her child's untimely death, and to continue the name and biological lineage of her deceased husband.

5. To Reproduce Individuals of Great Genius, Talent, or Beauty

Human cloning would allow families or society to reproduce individuals of great genius, talent, or beauty, where these traits are presumed to be based on the individuals' desirable or superior genetic makeups. For example, some admirers of great athletes, musicians, or mathematicians, believing that the admired attributes are the result of a superior genetic endowment, might want to clone these distinguished individuals. Just as the cloning of cattle is being promoted as a means of perpetuating champion milk- or meat-producing cows, so cloning-to-produce-children has been touted as a means of perpetuating certain "superior" human exemplars.



B. Arguments

The purposes or reasons for cloning-to-produce-children are, as they are stated, clearly intelligible on their face. When challenged, the defenders of these purposes often appeal to larger moral and political goods. These typically fall within the following three categories: human freedom, existence, and well-being.

1. The Goodness of Human Freedom

Strictly speaking, the appeal to human freedom is not so much a defense of cloning itself as it is of the right to practice it, asserted against those who seek to prohibit it. No one, we suspect, would say that he wanted to clone himself or any one else in order to be free or to vindicate the goodness of liberty. Nevertheless, human freedom is a defense often heard in support of a "right" to clone.

Those who defend cloning-to-produce-children on the grounds of human freedom make two kinds of arguments. The first is that because individuals in pluralistic societies have different definitions of the good life and of right and wrong, society must protect individual freedom to choose against the possible tyranny of the majority. This means securing and even expanding the rights of individuals to make choices so long as their choices do not directly infringe on the rights (and especially the physical safety) of other rights-bearing citizens. In Eisenstadt v. Baird (1972), the United States Supreme Court enunciated what has been called a principle of reproductive freedom: "If the right to privacy means anything, it is the right of the individual, married or single, to be free from unwarranted governmental intrusion into matters so affecting a person as a decision whether to bear or beget a child."5 Defenders of cloning-to-produce-children argue that, in the event that the physical risks to mother and future child were shown to be ethically acceptable, the use of this new reproductive technology would fall under the protective umbrella of reproductive freedom.

A second defense of human cloning on the grounds of freedom is the claim that human existence is by its very nature "open-ended," "indeterminate," and "unpredictable." Human beings are always remaking themselves, their values, and their ways of interacting with one another. New technologies are central to this open-ended idea of human life, and to shut down such technologies simply because they change the "traditional" ways of doing things is unjustifiable. As constitutional scholar Laurence Tribe has argued in reference to human cloning: "A society that bans acts of human creation that reflect unconventional sex roles or parenting models (surrogate motherhood, in vitro fertilization, artificial insemination, and the like) for no better reason than that such acts dare to defy 'nature' and tradition (and to risk adding to life's complexity) is a society that risks cutting itself off from vital experimentation and risks sterilizing a significant part of its capacity to grow."6

2. The Goodness of Existence

Like the appeal to freedom, the appeal to the goodness of existence is not an argument for cloning, but an argument against opponents who speak up in the name of protecting the cloned child-to-be against the harms connected with its risky and strange origins as a clone. This argument asserts that attempts to produce children through cloning, like any attempt to produce a child, will directly benefit the cloned child-to-be, since without the act of cloning the child in question would not exist. Existence itself, it is argued, is the





first "interest" that makes all other interests – including the interests of safety and well-being – possible. Even taking into account the possibility of serious genetic or developmental disorders, this position holds that a cloned individual, once born, would prefer existence as a clone to no existence at all. There is also a serious corollary about how, in the absence of a principle that values existence as such, we will and should regard and treat people born with disabilities or deformities: opponents of cloning might appear in a position of intolerance – of saying to cloned individuals, "Better for us (and for you) had you never existed."

3. The Goodness of Well-Being

The third moral argument for cloning-to-produce-children is that it would contribute in certain cases to the fulfillment of human goods that are widely honored and deeply rooted in modern democratic society. These human goods include the health of newborn and existing children, reproductive possibilities for infertile couples, and the possibility of having a biologically related child. In all these circumstances, human cloning could relieve existing suffering and sorrow or prevent them in the future. Those who take this position do not necessarily defend human cloning-to-produce-children as such. Rather, they argue that a moral and practical line can be drawn between cloning-to-produce-children that serves the "therapeutic" aims of health (for the cloned child-to-be, for the infertile couple, or for an existing child) and the "eugenic" aims of producing or mass-producing superior people.

Some people argue more broadly that an existing generation has a responsibility to ensure, to the extent possible, the genetic quality and fitness of the next generation. Human cloning, they argue, offers a new method for human control and self-improvement, by allowing families to have children free of specific genetic diseases or society to reproduce children with superior genetic endowments. It also provides a new means for gaining knowledge about the age-old question of nature versus nurture in contributing to human achievement and human flourishing, and to see how clones of great geniuses measure up against the "originals."

II. The Case against Cloning-to-Produce-Children

A. The Ethics of Human Experimentation

We begin with concerns regarding the safety of the cloning procedure and the health of the participants. We do so for several reasons. First, these concerns are widely, indeed nearly unanimously, shared. Second, they lend themselves readily to familiar modes of ethical analysis – including concerns about harming the innocent, protecting human rights, and ensuring the consent of all research subjects. Finally, if carefully considered, these concerns begin to reveal the important ethical principles that must guide our broader assessment of cloning-to-produce-children. They suggest that human beings, unlike inanimate matter or even animals, are in some way inviolable, and therefore challenge us to reflect on what it is about human beings that makes them inviolable, and whether cloning-to-produce-children threatens these distinctly human goods.



In initiating this analysis, there is perhaps no better place to start than the long-standing international practice of regulating experiments on human subjects. After all, the cloning of a human being, as well as all the research and trials required before such a procedure could be expected to succeed, would constitute experiments on the individuals involved – the egg donor, the birthing mother, and especially the child-to-be. It therefore makes sense to consider the safety and health concerns that arise from cloning-to-produce-children in light of the widely shared ethical principles that govern experimentation on human subjects.

Since the Second World War, various codes for the ethical conduct of human experimentation have been adopted around the world. These codes and regulations were formulated in direct response to serious ethical lapses and violations committed by research scientists against the rights and dignity of individual human beings. Among the most important and widely accepted documents to emerge were the Nuremberg Code of 19477 and the Helsinki Declaration of 1964.8 Influential in the United States is also the Belmont Report, published in 1978 by the National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research.9

The Nuremberg Code laid out ten principles for the ethical conduct of experiments, focusing especially on voluntary consent of research subjects, the principle that experiments should be conducted only with the aim of providing a concrete good for society that is unprocurable by other methods, and with the avoidance of physical or mental harm. The Helsinki Declaration stated, among other things, that research should be undertaken only when the prospective benefit clearly outweighs the expected risk, when the research subject has been fully informed of all risks, and when the research-subject population is itself likely to benefit from the results of the experiment.

Finally, the Belmont Report proposed three basic ethical principles that were to guide the treatment of human subjects involved in scientific research. The first of these is respect for persons, which requires researchers to acknowledge the autonomy and individual rights of research subjects and to offer special protection to those with diminished autonomy and capacity. The second principle is beneficence. Scientific research must not only refrain from harming those involved but must also be aimed at helping them, or others, in concrete and important ways. The third principle is justice, which involves just distribution of potential benefits and harms and fair selection of research subjects. When applied, these general principles lead to both a requirement for informed consent of human research subjects and a requirement for a careful assessment of risks and benefits before proceeding with research. Safety, consent, and the rights of research subjects are thus given the highest priority. It would be a mistake to view these codes in narrow or procedural terms, when in fact they embody society's profound sense that human beings are not to be treated as experimental guinea pigs for scientific research.

The ethics of research on human subjects suggest three sorts of problems that would arise in cloning-to-produce-children: (1) problems of safety; (2) a special problem of consent; and (3) problems of exploitation of women and the just distribution of risk. We shall consider each in turn.

1. Problems of Safety

First, cloning-to-produce-children is not now safe. Concerns about the safety of the individuals involved in a cloning procedure are shared by nearly everyone on all sides of the cloning debate. Even most proponents of cloning-to-produce-children generally qualify their support with a caveat about the safety of the






procedure. Cloning experiments in other mammals strongly suggest that cloning-to-produce-children is, at least for now, far too risky to attempt. Safety concerns revolve around potential dangers to the cloned child, as well as to the egg donor and the woman who would carry the cloned child to birth.

(a) Risks to the child. Risks to the cloned child-to-be must be taken especially seriously, both because they are most numerous and most serious and because – unlike the risks to the egg donor and birth mother – they cannot be accepted knowingly and freely by the person who will bear them. In animal experiments to date, only a small percentage of implanted clones have resulted in live births, and a substantial portion of those live-born clones have suffered complications that proved fatal fairly quickly. Some serious though nonfatal abnormalities in cloned animals have also been observed, including substantially increased birth-size, liver and brain defects, and lung, kidney, and cardiovascular problems.

Longer-term consequences are of course not known, as the oldest successfully cloned mammal is only six years of age. Medium-term consequences, including premature aging, immune system failure, and sudden unexplained death, have already become apparent in some cloned mammals. Some researchers have also expressed concerns that a donor nucleus from an individual who has lived for some years may have accumulated genetic mutations that – if the nucleus were used in the cloning of a new human life – may predispose the new individual to certain sorts of cancer and other diseases.

(b) Risks to the egg donor and the birth mother. Accompanying the threats to the cloned child's health and well-being are risks to the health of the egg donors. These include risks to her future reproductive health caused by the hormonal treatments required for egg retrieval and general health risks resulting from the necessary superovulation.

Animal studies also suggest the likelihood of health risks to the woman who carries the cloned fetus to term. The animal data suggest that late-term fetal losses and spontaneous abortions occur substantially more often with cloned fetuses than in natural pregnancies. In humans, such late-term fetal losses may lead to substantially increased maternal morbidity and mortality. In addition, animal studies have shown that many pregnancies involving cloned fetuses result in serious complications, including toxemia and excessive fluid accumulation in the uterus, both of which pose risks to the pregnant animal's health. In one prominent cattle cloning study, just under one-third of the pregnant cows died from complications late in pregnancy.

Reflecting on the dangers to birth mothers in animal cloning studies, the National Academy report concluded:

Results of animal studies suggest that reproductive cloning of humans would similarly pose a high risk to the health of both fetus or infant and mother and lead to associated psychological risks for the mother as a consequence of late spontaneous abortions or the birth of a stillborn child or a child with severe health problems.

(c) An abiding moral concern. Because of these risks, there is widespread agreement that, at least for now, attempts at cloning-to-produce-children would constitute unethical experimentation on human subjects and are therefore impermissible. These safety considerations were alone enough to lead the National Bioethics Advisory Commission in June 1997 to call for a temporary prohibition of human cloning-to-produce-



children. Similar concerns, based on almost five more years of animal experimentation, convinced the panel of the National Academy of Sciences in January 2002 that the United States should ban such cloning for at least five years.

Past discussions of this subject have often given the impression that the safety concern is a purely temporary one that can be allayed in the near future, as scientific advances and improvements in technique reduce the risks to an ethically acceptable level. But this impression is mistaken, for considerable safety risks are likely to be enduring, perhaps permanent. If so, there will be abiding ethical difficulties even with efforts aimed at making human cloning safe.

The reason is clear: experiments to develop new reproductive technologies are necessarily intergenerational, undertaken to serve the reproductive desires of prospective parents but practiced also and always upon prospective children. Any such experiment unavoidably involves risks to the child-to-be, a being who is both the product and also the most vulnerable human subject of the research. Exposed to risk during the extremely sensitive life-shaping processes of his or her embryological development, any child-to-be is a singularly vulnerable creature, one maximally deserving of protection against risk of experimental (and other) harm. If experiments to learn how to clone a child are ever to be ethical, the degree of risk to that child-to-be would have to be extremely low, arguably no greater than for children-to-be who are conceived from union of egg and sperm. It is extremely unlikely that this moral burden can be met, not for decades if at all.

In multiple experiments involving six of the mammalian species cloned to date, more than 89 percent of the cloned embryos transferred to recipient females did not come to birth, and many of the live-born cloned animals are or become abnormal. If success means achieving normal and healthy development not just at birth but throughout the life span, there is even less reason for confidence. The oldest cloned mammal (Dolly) is only six years old and has exhibited unusually early arthritis. The reasons for failure in animal cloning are not well understood. Also, no nonhuman primates have been cloned. It will be decades (at least) before we could obtain positive evidence that cloned primates might live a normal healthy (primate) life.

Even a high success rate in animals would not suffice by itself to make human trials morally acceptable. In addition to the usual uncertainties in jumping the gap from animal to human research, cloning is likely to present particularly difficult problems of interspecies difference. Animal experiments have already shown substantial differences in the reproductive success of identical cloning techniques used in different species. If these results represent species-specific differences in, for example, the ease of epigenetic reprogramming and imprinting of the donor DNA, the magnitude of the risks to the child-to-be of the first human cloning experiments would be unknown and potentially large, no matter how much success had been achieved in animals. There can in principle be no direct experimental evidence sufficient for assessing the degree of such risk.

Can a highly reduced risk of deformity, disease, and premature death in animal cloning, coupled with the inherently unpredictable risk of moving from animals to humans, ever be low enough to meet the ethically acceptable standard set by reproduction begun with egg and sperm? The answer, as a matter of necessity, can never be better than "Just possibly." Given the severity of the possible harms involved in human cloning, and given that those harms fall on the very vulnerable child-to-be, such an answer would seem to be enduringly inadequate.



Similar arguments, it is worth noting, were made before the first attempts at human in vitro fertilization (IVF). People suggested that it would be unethical experimentation even to try to determine whether IVF could be safely done. And then, of course, IVF was accomplished. Eventually, it became a common procedure, and today the moral argument about its safety seems to many people beside the point. Yet the fact of success in that case does not establish precedent in this one, nor does it mean that the first attempts at IVF were not in fact unethical experiments upon the unborn, despite the fortunate results.

Be this as it may, the case of cloning is genuinely different. With IVF, assisted fertilization of egg by sperm immediately releases a developmental process, linked to the sexual union of the two gametes, that nature has selected over millions of years for the entire mammalian line. But in cloning experiments to produce children, researchers would be transforming a sexual system into an asexual one, a change that requires major and "unnatural" reprogramming of donor DNA if there is to be any chance of success. They are neither enabling nor restoring a natural process, and the alterations involved are such that success in one species cannot be presumed to predict success in another. Moreover, any new somatic mutations in the donor cell's chromosomal DNA would be passed along to the cloned child-to-be and its offspring. Here we can see even more the truly intergenerational character of cloning experimentation, and this should justify placing the highest moral burden of persuasion on those who would like to proceed with efforts to make cloning safe for producing children. (By reminding us of the need to protect the lives and well-being of our children and our children's children, this broader analysis of the safety question points toward larger moral objections to producing cloned children, objections that we shall consider shortly.)

It therefore appears to us that, given the dangers involved and the relatively limited goods to be gained from cloning-to-produce-children, conducting experiments in an effort to make cloning-to-produce-children safer would itself be an unacceptable violation of the norms of the ethics of research. There seems to be no ethical way to try to discover whether cloning-to-produce-children can become safe, now or in the future.

2. A Special Problem of Consent

A further concern relating to the ethics of human research revolves around the question of consent. Consent from the cloned child-to-be is of course impossible to obtain, and because no one consents to his or her own birth, it may be argued that concerns about consent are misplaced when applied to the unborn. But the issue is not so simple. For reasons having to do both with the safety concerns raised above and with the social, psychological, and moral concerns to be addressed below, an attempt to clone a human being would potentially expose a cloned individual-to-be to great risks of harm, quite distinct from those accompanying other sorts of reproduction. Given the risks, and the fact that consent cannot be obtained, the ethically correct choice may be to avoid the experiment. The fact that those engaged in cloning cannot ask an unconceived child for permission places a burden on the cloners, not on the child. Given that anyone considering creating a cloned child must know that he or she is putting a newly created human life at exceptional risk, the burden on the would-be cloners seems clear: they must make a compelling case why the procedure should not be avoided altogether.

Reflections on the purpose and meaning of seeking consent support this point. Why, after all, does society insist upon consent as an essential principle of the ethics of scientific research? Along with honoring the free will of the subject, we insist on consent to protect the weak and the vulnerable, and in particular to



protect them from the powerful. It would therefore be morally questionable, at the very least, to choose to impose potentially grave harm on an individual, especially in the very act of giving that individual life. Giving existence to a human being does not grant one the right to maim or harm that human being in research.

3. Problems of Exploitation of Women and Just Distribution of Risk

Cloning-to-produce-children may also lead to the exploitation of women who would be called upon to donate oocytes. Widespread use of the techniques of cloning-to-produce-children would require large numbers of eggs. Animal models suggest that several hundred eggs may be required before one attempt at cloning can be successful. The required oocytes would have to be donated, and the process of making them available would involve hormonal treatments to induce superovulation. If financial incentives are offered, they might lead poor women especially to place themselves at risk in this way (and might also compromise the voluntariness of their "choice" to make donations). Thus, research on cloning-to-produce-children could impose disproportionate burdens on women, particularly low-income women.



Race for Life

Type of Activity: hands-on, simulation, review/reinforcement, group/cooperative learning

Target Audience: Life Science /Biology

Abstract: This activity will help students to learn or display an understanding of the process of protein synthesis.

Materials:

• 20 DNA Template Cards that will be kept on your desk at all times- after all, DNA cannot leave the nucleus.

• 62 anti-codon Cards- these will be taped to the wall around your room. • Paper for writing down the mRNA strand and the tRNA molecules and the sentence • Pen/Pencil

Procedures for the Teacher:

1. Make up all the DNA Template Cards and the anti-codon/word cards--See below for instructions. 2. Hang up the anti-codon word cards, so the anti-codons are showing. 3. Show the student the cards and tell them what they are. 4. In groups, one student is assigned to be the mRNA, another student will serve as recorder and the third

student will be the tRNA. 5. Tell the students that your desk is the nucleus and the DNA templates cannot leave the area. 6. A student is to pick up a DNA template card, write down the DNA template card number, and

transcribe it into mRNA. 7. With the mRNA sequence, s/he will go back to the group's desk and the ribosomal student will write

out the tRNA anti-codon sequence. Remind students that every sentence must have a start (ATG) and a stop (TAG) codon.

8. The tRNA student will search out the correct anti-codon card and flip the card over revealing the word. S/he will write down the word.

9. After completing the sentence, a student in the group will tell you his/her group sentence. If not correct, have the group go over the same DNA template. If correct, have the students pick another card.



Keys for making cards: *Key to tRNA Cards with words (Note: write the anti-codon on one side of the card and write the word on the other):

Word DNA mRNA tRNA Amino Acids (period) ACT UGA ACU Stop

a CAT GUA CAU Valine A double TTG AAC UUG Asparagine

acids CTA GAU CUA Aspartic acid amino CTC GAG CUC Glutamic acid

and GAG CUC GAG Leucine and Crick TTT AAA UUU Lysine

Are TCC AGG UCC Arginine bases TCC AGG UCC Arginine

blueprint GGG CCC GGG Proline bond TCA AGU UCA Serine build GTC CAG CUG Glutamine

causes ATC UAC AUC Tyrosine cell CCC GGG CCC Glycine

changes ACA UGU ACA Cysteine codon AGC UCG AGC Serine

contains CCG GGC CCG Glycine continuity CGC GCG CGC Alanine

crimes TGA ACU UAU Threonine Discoverers GCT CGA GCU Arginine

DNA GGA CCU GGA Proline ensures CAG GUC CAG Valine

four TGT ACA UGU Threonine genetic CGG GCC CGG Alanine

has UAA AUU UAA Isolecine helix TTC AAG UUC Lysine helps TGC ACG UGC Threonine house AGA UCU AGA Serine

Is GGC CCG GGC Proline itself TAT AUA UAU Isolecine life’s GGT CCA UUT Proline

manages ATA UAU AUA Tyrosine molecule TTA AAU UUA Asparagine mutations ACG UGC ACG Cysteine nitrogen TCT AGA UCU Arginine



nucleus AAC UUG AAC Leucine pattern AAG UUC AAG Phenylalanine

phosphate GAT CUA GAU Leucine process CAC GUG CAC Valine

processes AGG UCC UGG Serine produce CAA GUU CAA Valine protein ACC UGG ACC Tryptophan proteins GTA CAU GUA Histidine

repeatedly TAG AUC UAG Isolecine Word DNA mRNA tRNA Amino Acids

replicates TCG AGC UCG Serine replication CCT GGA CCU Glycine ribosomes CGT GCA CGU Alanine

RNA GCG CGC GCG Arginine shape GCA CGU GCA Arginine solve TGG ACC UGG Threonine

successful CGA GCU CGA Alanine sugar GAC CUG GAC Leucine

support GAA CUU GAA Leucine synthesis AAT UUA AAU Leucine

The TAC AUG UAC Methionine three GTT CAA GUU Glutamine

translation AAA UUU AAA Phenylalanine transport CTG GAC CUG Aspartic acid

triplet CCA GGU CCA Glycine tRNA CTT GAA CTT Glutamic acid types GTG CAC GUG Histidine

unzipping AGT UCA AGU Serine Watson GCC CGG GCC Arginine



Key for the sentences *16 Sentences:

1. The discoverers are Watson and Crick*.

TACGCTTCCGCCTTTUGA

2. The shape is a helix.

TACGCAGGCCATTTCUGA

3. The molecule helps solve crimes.

TACTTATGCTGGTGAUGA

4. The four nitrogen bases bond.

TACTGTTCTTCCTCAUGA

5. The molecule replicates itself repeatedly.

TACTTATCGTATTAGUGA

6. The RNA has three types.

TACGCGUAAGTTGTGUGA

7. The RNA helps build proteins.

TACGCGTGCGTCGTAUGA

8. The DNA is life’s blueprint.

TACGGAGGCGGTGGGUGA

9. The phosphate and sugar support.

TACGATGAGGACGAAUGA

10. The tRNA transports amino acids.

TACCTTCTGCTCCTAUGA

11. The replication process causes unzipping.

TACCCTCACATCAGTUGA



12. The codon contains a triplet.

TACAGCCCGCATCCAUGA

13. The ribosomes house protein synthesis.

TACCGTAGAACCAATUGA

14. The translation process ensures continuity.

TACAAACACCAGCGCUGA

15. The nucleus manages cell processes.

TACAACATACCCAGGUGA

16. The pattern changes produce mutations.

TACAAGACACAAACGUGA

Method of Evaluation:

Students are graded on accurate sentence building from the DNA code and on proper execution of the sequence of the protein synthesis process.

Extension and Reinforcement:

Mistakes are happy events in this activity. Students can see first-hand the raw material for mutation and evolution when they come up with sentences that are not correct. These can easily be referred to when discussing variation and change in a population.

TEACHER NOTE: Some of the words in some of the sentences code for the same amino acid. This allows you to teach the students that some amino acids are coded for by several different codons.

Ticket Out the Door: How can only 20 amino acids be responsible for the variation we see in organisms?

Modified from: http://www.accessexcellence.org/AE/ATG/data/released/0247-LynnWartski/description.html

http://www.accessexcellence.org/AE/ATG/data/released/0247-LynnWartski/description.html

http://www.accessexcellence.org/AE/ATG/data/released/0247-LynnWartski/description.html



Translation Simulation

1. Have students translate an mRNA segment (AUGCAGGACGGUAAGUGCCGAUGA). 2. Give students a card with either tRNA anti-codon with amino acid or an mRNA codon. 3. Ask the students what starts the process of translation. 4. Have the student with the start mRNA Start Codon (AUG) come to the front of the room. 5. Put a piece of tape on the back of this card and tape it to the board. 6. Ask for the next mRNA codon to come up and continue to repeat Steps 2-4 until you reach the STOP

codon. 7. Next, have the student with the anti-codon that is complimentary to the start codon (AUG) come to

the board and place his anti-codon with the amino acid on the board just above the mRNA codon (the amino acid, t-RNA and anti-codon need to be separate. This is due to the fact that once the anti-codon matches with the codon and the amino acid binds to the polypeptide chain, the t-RNA will separate and go back into the cytoplasm to be used again).

8. Continue this process until all mRNA codons have been matched with the tRNA codons and a polypeptide chain has been formed.

9. You can ask students to predict what will happen if the anti-codons don’t match up correctly. Would this change the amino acids and,if so, what would this mean for the organism?



t-RNA t-RNA



UAC GUC Methionine Glutamine CUG CCA Aspartic Acid Glycine



UUC ACG Lysine Cysteine GCU ACU Arginine Stop



DNA/RNA Processes Performance Task

Teacher Note: Using index cards, students should be able to arrange each component of the process of DNA replication and protein synthesis. You may construct a set of index cards for the students or have the students construct their own set. You may informally assess the students on each process along the way or have them sketch each process as it is completed to turn in for a grade. *** Be certain not to create a misconception in the student’s mind. Clarify that while DNA replication is taking place in the nucleus, protein synthesis in the cell is shut down. The two processes are not taking place simultaneously. Each of the following should be represented on an index card: For Replication:

Component Color Helicase (enzyme) Purple Replication Fork Written in words on the card

DNA polymerase (enzyme) (2 cards)

Light green

Original DNA strand Dark Blue Adenine, Guanine, Cytosine, Thymine

New DNA Strand Dark Green

Students should re-use one of the DNA strands for use in the transcription process For Transcription:

Component Color DNA Strand

Messenger RNA (mRNA) Strand

Red RNA polymerase Light Green

Adenine, guanine, cytosine, thymine, and uracil

Dark Green

DNA

Helicase

Replication Fork

Original DNA Strand

DNA Polymerase

“New” DNA Strand



For Translation:

Component Color Nucleus and amino acids 4 different cards/different colors

Transfer RNA (tRNA) – x5 Anticodons (x5)

Messenger RNA (mRNA) strand Codons (x10)

Ribosomes (x2)

Light Brown

Polypeptide Chain (made of at least 8 amino acids)

Teacher will monitor student progress. When items are not sequenced correctly do not tell them which ones are incorrect. Say something like: “Two cards are not in the correct order.” This enables the student to self-assess and to re-evaluate their response. When the student has the correct sequence, have them summarize (individually) the processes (replication, transcription, and translation) as their “Ticket Out the Door.”



Punnett Square Problems

You are a scientist who is investigating the genetic makeup of organisms in your area. Use your information about genetics to help you answer the following problems.

1. Below are the genotypes for some of the characteristics of the organisms in your area. Decide whether the genotypes are heterozygous (Tt) or homozygous (tt). Record your answers below.

AA_____ Ff_____ HH_____ Rr_____ aa _____ hh_____ Hh _____ rr_____ Aa_____ ff_____ FF_____ RR_____ Which of the genotypes in number 1 would be purebred (homozygous)?_________________ Which of the genotypes in number 1 could be a hybrid (heterozygous)? ________________ 2. Use the information below to determine the possible phenotypes of Billy Bird. Green body (A) is dominant to yellow (a) body color. AA _______________ Aa _________________ aa________________ Long feathers (F) is dominant to short feathers (f) FF _______________ Ff__________________ ff_________________ 3. Use the information below concerning phenotype to determine Anna Aves’ genotype. Short legs (H) are dominant to long legs (h) Short legs = ____________________ Long legs= ______________________ Long beak (R) is dominant to short beaks (r ) Long beak= ____________________ Short beak=______________________ 4. Billy Bird and Anna Aves met and fell in love. Billy Bird is dominant for a green body

but Anna Aves has a yellow body. Use a Punnett Square to show the possible offspring that would result from a mating between Billy Bird and Anna Aves. Be sure to show your work.

A. List all of the possible phenotypes and genotypes of the offspring. B. What percent of the offspring would have green bodies?

C. What percent of the offspring would have yellow bodies?



5. Billy Bird and Anna Aves are both heterozygous for feather length. What would the

genotype be for Billy and Anna? __________ Use a Punnett Square to show the possible offspring of their children.

A. List the possible genotypes and phenotypes of their offspring.

B. What are the chances of the offspring having long feathers? _______out of ______ or ________%

C. What are the chances of the offspring having short feathers? _______out of ______ or ________%

6. All of Billy’s family is homozygous dominant for short legs. Anna has a short beak.

What is Anna’s genotype? ____________ Use a Punnett Square to show the genotype of the possible offspring that would result from a mating between Billy and Anna.

A. List the phenotypes for their possible offspring.

B. What are the chances of the offspring having short legs? _____%

C. What are the chances of the offspring having long legs? _____%

D. Would the offspring be considered purebred or hybrid?

7. If Billy Bird is heterozygous for body color, is he purebred or hybrid?

If Anna has a genotype of AA for body color, is she purebred or hybrid? What is her body color? Use a Punnett Square to show a cross between Billy Bird with a heterozygous genotype for body color and Anna’s genotype AA for body color. What are the genotypes and phenotypes of their offspring?



A. What percent of the offspring will have a homozygous genotype? _______________ B What percent of the offspring will have a heterozygous genotype? ________________



Punnett Square Problems Incomplete Dominance

Sammy Skunk loves to grow flowers in his garden. He wants to grow flowers that come in three colors: Red, Blue, and Purple. 1. The red allele is R. The blue allele is D. What are the genotypes for the following: Red= _________ Purple=__________ Blue= __________ 2. What would the possible offspring be of a cross between red flowers and purple flowers? Show your work in a Punnett Square.

A. What are the possible genotypes and phenotypes of the offspring? B. What percent of the plants would be red? _________% C. What percent of the plants would be purple? _______% D. What percent of the plants would be blue? ________%

3. What would the possible offspring be of a cross between a purple and blue flower? Show

your work in a Punnett Square.

A. Give the genotypes and phenotypes of the offspring. B

B. What percent of the plants have red flowers? ______% C. What percent of the plants have purple flowers?_____% D. What percent of the plants have blue flowers? ______%

4. What would happen if Sammy Skunk crossed two plants with purple flowers? Show

your work in a Punnett Square. A. What are the genotypes and phenotypes of the offspring?

B. What percent of the plants have red flowers? ______% C. What percent of the plants have purple flowers? _____%

D. What percent of the plants have blue flowers? _______%



Is That Your Baby?

Objective: Students will use their knowledge of gene dominance and their knowledge of inheritance to determine the traits of a baby bear. Background: When two gametes (sperm and egg) join, fertilization occurs. The sperm contributes half of the genetic material and the egg contributes half of the material to the offspring. You will use coins to represent the traits contributed by the sperm and egg. In this activity both parents are heterozygous for all of the traits the baby bear will inherit. The trait will be determined by the toss of a coin. Once you have determined all of the traits, you are to draw your baby bear. Materials: construction paper glue sticks scissors markers two coins Procedures:

1. You and a partner will work together on this activity. You must decide who will represent the female and who will represent the male.

2. You will each have a coin. Heads will represent the dominant allele and tails will represent the recessive allele. Remember: you are both heterozygous for all traits.

Baby Bears Phenotypes Traits RR Rr rr

Head Shape Round head Round head Square head Eye Color Brown eyes Yellow eyes Green eyes Nose shape Square shape Square shape Round shape Whiskers Long Long Short Ear Size Big ears (4 or more

centimeters) Medium ears ( 2 or 3 centimeters)

Small ears (1 centimeter)

Fur Color Black Black Brown Sex Male (draw

something to indicate it is a male)

Female (draw something to indicate it is a female)



Data:

Individual Data Traits Genotype Phenotype

Head shape Eye color Nose shape Whiskers Ear size Fur Color Sex (only the male flips a coin)

Class Data Traits Genotype Phenotype

Head shape Eye color Nose shape Whiskers Ear size Fur Color Sex (only the male flips a coin)

1. After you flipped the coins, which of the traits were dominant?

2. After you flipped the coins, which of the traits were recessive?

3. Were there any traits that were neither dominant nor recessive? Why did this occur?

4. Based on the class data, what is the ratio of square noses to round noses?



Human Genetics

Trait Description Yourself Class % Genotype

Phenotype

Tongue rolling Bent little fingers Widow’s peak Hitchhiker’s Thumb Hand clasping, left over right thumb Arm folding: fold your arms across your chest/stomach…which one is on top?

Free earlobe Chin cleft Hair on middle joints of fingers Short big toe Ear points Round face Curly hair Sodium Benzoate Taster (Do Not Use PTC or Thiourea)- Sodium Benzoate will detect salty, sour, bitter or sweet.

Eye Color (blue?)

Tongue Rolling

Widows Peak

Blue eyes When a person is homozygous for a recessive gene no pigment is deposited in the iris (front part) of the eye and a blue layer at the back of the iris shows through. A dominant gene allows pigment to be deposited that masks the blue color. Other genes are responsible for the type and



Hitchhiker’s thumb amount of this pigment, leading to various shades of brown, hazel, green and other colors.

TEACHER NOTE: You can give each student a half sheet of Sodium Benzoate. Place the half sheet of Sodium Benzoate on the center of the tongue and record the first taste they detect.

Conclusion:

1. Pick one trait and explain what your parent’s genotype would be and show the probable testcross.

2. Pick a trait and tell what your spouse’s genotype would have to be to produce a heterozygous offspring. Show P1, Punnett Square, F1 generation, and phenotypic and genotypic ratios.



Genetics Disorder

Objective: Identify the effects of genetic mutations. Required Information: Research a genetic disorder and explain:

a general description of the characteristics of the condition. the specific cause of this disorder. the treatment for this condition. the prognosis for the affected individual’s life span and quality of life. the screening (procedures for detecting this disorder before it becomes apparent) for this

condition.. what the chances are of inheriting this disorder. what percent of the population is affected by this condition. if it is more common in certain populations (ethnic, gender, or geographic regions).

General Instructions: You will work with a partner. One of you will be a doctor and the other person will be the patient. You will work together to research the genetic disorder and find the required information. After you complete your research you will write a script and prepare for your presentation. As the patient, you need to be able to tell the doctor what symptoms you are experiencing and come up with questions you might ask the doctor. The doctor needs to be able to answer all the questions the patient may have. Your role play must be realistic. During your presentation, you must address all required information.



What is a Mutation?

A mutation is a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene. How does this happen? Like words in a sentence, the DNA sequence of each gene determines the amino acid sequence for the protein it encodes. The DNA sequence is interpreted in groups of three nucleotide bases called codons. Each codon specifies a single amino acid in a protein.

Mutate a sentence!

We can think about the DNA sequence of a gene as a sentence made up entirely of three-letter words. In the sequence, each three-letter word is a codon, specifying a single amino acid in a protein. Examine the following sentence:

Thesunwashotbuttheoldmandidnotgethishat.

If you were to split this sentence into individual three-letter words, you would probably read it like this:

The sun was hot but the old man did not get his hat.

This sentence represents a gene. Each letter corresponds to a nucleotide base and each word represents a codon. What if you shifted the three-letter "reading frame?” You would end up with:

T hes unw ash otb utt heo ldm and idn otg eth ish at.

Or

Th esu nwa sho tbu tth eol dma ndi dno tge thi sha t.

As you can see, only one of these three "reading frames" translates into an understandable sentence. In the same way, only one three-letter reading frame within a gene codes for the correct protein.

Now, review the original sentence:

Thesunwashotbuttheoldmandidnotgethishat.

See how you can mutate the reading frame of this sentence by inserting or deleting letters within the sentence.

It's easy to make mutations that create "nonsense" sentences. Can you make mutations that maintain or change the meaning of the sentence without creating such nonsense?



DNA Sequence Replication-Transcription-Translation

Step 1: Using the original DNA strand, compare the two strands below. Mark each of the differences in the sequences. Step 2: Transcribe from the original DNA sequence to form a strand of mRNA. Step 3: Translate the mRNA sequence using any codon table. Step 4: Compare the amino acid sequence for the cow protein and the human protein and determine the number of differences in the sequence. Step 5: Prepare a paragraph summary that will answer the following questions.

• How many differences were counted in the DNA sequence? • Did all the differences create a different amino acid? • How many amino acids were different? • How does the sequence of amino acids help to show evolutionary relationships? • How related are a cow and a human? • What other evidence can be used to show the relationship between a cow and a

human? SEQUENCE #1 (HUMAN PROTEIN A) CCA-TAG-CAC-CTT-GTT-ACA-ACG-TGA-AGG-TAA-ACA-AGG- GAC-ATG-GTT-GAC-CTT-TTG-ATG-ACA-TTA SEQUENCE #2 (COW PROTEIN A) CCG-TAG-CAT-CTT-GTT-ACA-ACG-CGA-AGG-CAC-ACA-AGG- GAG-ATG-GTT-GAC-CTT-TTG-ATA-ACA-TTA



DNA/RNA Sequence Humans vs. Cow

Answer Key

SEQUENCE #1 (HUMAN) CCA-TAG-CAC-CTT-GTT-ACA-ACG-TGA-AGG-TAA-ACA-AGG-

GGT-ATC-GTG-GAA-CAA-TGT-TGC-ACT-TCC-ATT-TGT-TCC-

GGU- AUC- GUG-GAA- CAA- UGU-UGC-ACU- UCC- AUU- UGU-UCC- Glycine, Isolecine, Valine, Glutamic Acid, Glutamine, Cysteine, Cysteine, Threonine, Serine, Isolecine, Cysteine, Serine, Leucine, Tyrosine, Glutamine, Leucine, Glutamic Acid, Asparagine, Tyrosine, Cysteine, Asparagine GAC-ATG-GTT-GAC-CTT-TTG-ATG-ACA-TTA

CTG-TAC-CAA-CTG-GAA-AAC-TAC-TGT-AAT

CUG-UAC-CAA-CUG-GAA-AAC-UAC-UGU-AAU SEQUENCE #2 (COW) CCG-TAG-CAT-CTT-GTT-ACA-ACG-CGA-AGG-CAC-ACA-AGG-

GGC-ATC-GTA-GAA-CAA-TGT-TGC-GCT-TCC-GTG-TGT-TCC-

GGC- AUC- GUA- GAA-CAA- UGU- UGC-GCU- UCC- GUG-UGU-UCC- Glycine, Isolecine, Valine, Glutamic Acid, Glutamine, Cysteine, Cysteine, Alanine, Serine, Valine, Cysteine, Serine, Leucine, Tyrosine, Glutamine, Leucine, Glutamic Acid, Asparagine, Tyrosine, Cysteine, Apsparagine GAG-ATG-GTT-GAC-CTT-TTG-ATA-ACA-TTA

CTC-TAC-CAA-CTG-GAA-AAC-TAT-TGT-AAT

CUC-UAC-CAA-CUG-GAA-AAC-UAU-UGU-AAU



Population Genetics

Materials (for each student group) • Closed container (cigar boxes, brown paper lunch bags, opaque plastic containers, etc) • 50 white beads and 50 red beads in the container • Sandwich bag with an additional 50 red beads

Background A fatal genetic disease has been observed in a population of Spotted salamanders commonly found throughout the state of Georgia. You are a wildlife biologist who has been charged with monitoring changes in the population. You have determined that the fatal disease is the result of a recessive trait and that the affected salamanders typically die in their second year of life. Male and female salamanders are equally likely to be affected by the disease. You have decided to use beads to simulate the salamanders’ gene pool. You are using red beads to represent normal alleles and white beads to represent the allele for the fatal gene. A container will hold the gene pool of the salamanders. (Note: this exercise simulates the change in allele frequencies under selection. It involves procedural shortcuts that simplify the calculations. These shortcuts do not affect the validity of the simulation or the conclusions you can draw from it.) Procedure Remove the bag of extra red beads from the opaque bag. The opaque bag will contain the “gene pool”. Reseal the opaque bag of red and white beads and thoroughly mix the tubes in the opaque bag. Without looking, withdraw 2 beads from the opaque bag. Tally the beads’ colors (red-red, red-white, or white-white) in the table below, and return the two beads to the bag. Thoroughly mix the beads. Continue withdrawing beads two at a time, tallying their colors, and returning the beads to the container, until you have drawn 50 pairs of beads. Find the frequency of each color combination using the following formula:

Frequency of a color combination = number drawn of the combination / 50.

Generation 1

Red-red

Red-white

White-white

Color combination Tally

Number of pairs with color combination

Frequency of color combination



Now you will simulate the removal of individuals with the fatal white/white gene pair from the population.

Determine the total number of white beads you withdrew in white/white pairs. Remove this number of white beads from the gene pool (the bag) and replace them with red beads from the bag of extra red beads. For example, if you drew 13 white/white pairs, replace 26 white beads with 26 red beads.

From the new “gene pool”, randomly draw another 50 pairs of beads, tally their color combinations (red-red, red-white, white-white) as before, and return them to the opaque bag before you draw the next set.

Generation 2 Red-red

Red-white

White-white




Determine the total number of white beads you withdrew from the opaque bag in white/white pairs. Remove this number of white beads from the gene pool and replace them with red beads from the bag containing the extra red beads as before.



Repeat the counting procedure a third time, and tally your results below.

Generation 3

Red-red

Red-white

White-white




Questions Please answer the following questions by yourself.

1. Assign a letter to each of the normal and lethal alleles, and use the letters to form the genotypes of the salamanders. Produce a Punnett square showing the cross of two salamanders, both of which are heterozygous for the lethal gene. Provide a key to the symbols you use in the cross and identify the phenotype for each genotype derived from the cross.



As The Frog Leaps or

Biology Buddies on Bioethics

Procedures:

1. Arrange desks in a circle so that no one is left out. 2. Use a stuffed or bean bag frog or other animal as an object to be passed from student to

student to give each person a chance to state his opinion or give examples of bioethics. NOTE: Only the student with the frog speaks. No one else is allowed to speak until the frog hops to him and it is his turn.

3. Each student has to add to the discussion. Give participation grades or let your students design a rubric that is acceptable to everyone to determine how they earn their grade. Warning: Be careful of the opinionated student who wants to monopolize the frog and the student who deflects the frog leap so he/she will not have to participate.

4. Allow the students to determine the amount of time (minutes) that a student can possess the frog and how many times a student can hold the frog before beginning the discussion/debate.

5. TEACHER NOTE: You will have to be careful of joining in and may need to redirect discussion as well as soothe tempers. Since bioethics is a volatile topic, you may need to predetermine acceptable discussion and share all of the ground rules with the class before the discussion day. You may also want to allow the students to research several examples before discussion day. If you choose to research, you may want to provide specific examples (animal product testing, animal euthanasia, assisted suicide/mercy killing, capital punishment, cloning, stem cell research, organ donors) and lead the discussion in a specific direction to keep from allowing other topics to “rule” the discussion. Be creative; let your students make some decisions and, most of all, let them have fun and learn from each other.



DNA Fingerprinting for the Reduced Budget This activity will introduce students the functions of restriction enzymes and how a DNA fingerprint is created in the laboratory with the use of the expensive gel electrophoresis equipment. This activity can also be extended across curriculum lines to include the government/civics class by holding a mock trial. Background: In this exercise students will be introduced to the function of the restriction enzymes on the DNA molecule, and the concept of gel electrophoresis used in DNA analysis. Students will act as forensic detectives, investigating a crime scene where a fresh blood sample was obtained. The blood sample apparently resulted from an injury sustained by the perpetrator prior to fleeing the scene. The recovered blood sample provided enough white blood cells (WBC) to isolate and extract a DNA sample. The DNA removed from the nucleus of the WBC was amplified by polymerase chain reaction (PCR) which provided a sufficient quantity of DNA for a gel electrophoresis. Three suspects have been identified. Each suspect consented to have a blood sample drawn for DNA analysis. Restriction enzymes will be used to cut each DNA sample into fragments. The position of the cuts made by the restriction enzymes is determined b the specific base pairing sequences on the DNA molecule. The fragments will be separated using gel electrophoresis which will produce specific banding patterns visible on the gel following staining. The restriction patterns from the three suspects will then be compared with the DNA pattern recovered from the crime scene. Materials

• Hae III and EcoR1 restriction enzyme data sheets (one each per group of 3) • Electrophoresis Gel sheets (two per group) • Scissors • Glue sticks

Procedure

• Cut out the first DNA sample collected at the Crime Scene from the data sheet. • Identify and mark the specific sites the Hae III restriction enzyme will interact with the

DNA. o GG CC

CC GG • When all sites are marked, use the scissors to cut the Crime Scene Sample at the

appropriate places. • Attach the segments to the Electrophoresis Gel sheet by sliding the fragment up and

down until it is in the section of the triangle that is the same size. The fragment should



not extend beyond the boundaries of the triangle nor should there be space between the boundary and the segment.

• Continue until all segments are attached. • Cut out the second DNA sample collected from Suspect 1 and follow the same procedure

as you did for the Crime Scene Sample. • Repeat the process for the remaining two suspects. • With the second set of DNA, you will identify and mark the specific sites the EcoR1

restriction enzyme will interact with the DNA. o G AATTC

CTTAA G • Cut and insert the fragments on Electrophoresis Gel sheets just like you did for the Hae

III restriction enzyme data. Discussion

• Each member of the group will represent one of the three suspects. • Prepare an “opening statement” for your client’s trial.

Extension

• Create a scenario for the actual crime. Use robberies, vandalism of the school, computer hackers or less violent crimes as your model. Avoid rape and murder for obvious reasons.

• Select a judge and jury from the government/civics class and have a mock trial. • The scoring rubric would be created with the government/civics teacher to include such

items as “chain of custody” of the samples, legitimacy of “search warrants” to collect the blood samples from the suspects, alibis and other items of interest in a criminal trial setting.



Hae III Restriction Enzyme

GG CC CC GG

DNA from Crime Scene AAATACGGCCAGGAATTCCTGAGGCCTGATGAATTCTGAGAGAATTCTG TTTATGCCGGTCCTTAAGGACTCCGGACTACTTAAGACTCTCTTAAGAC DNA from Suspect 1 AAATACGGCCATTGCGAATTCAGGCCATATGGGCGAGCCTTAGTGATAA TTTATGCCGGTAACGCTTAAGTCCGGTATACCCGCTCGGAATCACTATT DNA from Suspect 2 AAATACGGCCAGGAATTCCTGAGGCCTGATGAATTCTGAGAGAATTCTC TTTATGCCGGTCCTTAAGGACTCCGGACTACTTAAGACTCTCTTAAGAG DNA from Suspect 3 CCCAAAGGGTGAATTCGCATATGGCCAGCAGCTATATACCCAGCGAAAA GGGTTTCCCACTTAAGCGTATACCGGTCGTCGATATATGGGTCGCTTTT



EcoR1 Restriction Enzyme

G AATTC CTTAA G

DNA from Crime Scene AAATACGGCCAGGAATTCCTGAGGCCTGATGAATTCTGAGAGAATTCTG TTTATGCCGGTCCTTAAGGACTCCGGACTACTTAAGACTCTCTTAAGAC DNA from Suspect 1 AAATACGGCCATTGCGAATTCAGGCCATATGGGCGAGCCTTAGTGATAA TTTATGCCGGTAACGCTTAAGTCCGGTATACCCGCTCGGAATCACTATT DNA from Suspect 2 AAATACGGCCAGGAATTCCTGAGGCCTGATGAATTCTGAGAGAATTCTC TTTATGCCGGTCCTTAAGGACTCCGGACTACTTAAGACTCTCTTAAGAG DNA from Suspect 3 CCCAAAGGGTGAATTCGCATATGGCCAGCAGCTATATACCCAGCGAAAA GGGTTTCCCACTTAAGCGTATACCGGTCGTCGATATATGGGTCGCTTTT



Jigsaw Activity on Microbes

Make a copy of the article at the following website: http://www.actionbioscience.org/evolution/meade_callahan.html Divide students into five groups. Give each group a part of the article to read. The students will become experts on the information they are to read. Give the students twenty minutes to read their part of the article and discuss what they have read. When the students have become experts, you will need to regroup the students so that each group has a student from Group 1, Group 2, Group 3, Group 4, and Group 5. Each of the students will share with the group the part of the article in which they became experts. Ticket Out the Door: Have students answer the following question: Why would antibiotic soap be harmful to your health?




Hot Seat A Review Game

Make a list of questions/answers from the material that needs to be reviewed. You could use the questions off of a study guide. Place each question on the front of a small rectangle of paper. You may want to put the answer on the back of the question. Put questions in a container that you can reach in and draw out individually. As each question is used, place into a separate container.

• Divide students into 3 equal groups. You may use various methods to obtain groups including allowing the students to choose their groups.

• Allow students to choose/create their group name. Encourage them to use favorite vocabulary terms used in the unit, ex. The Locomotors, Genetics Gals, The Mitotic Robotics.

• Place 3 chairs in front of your seat/table. Place groups around the classroom away from each other.

Rules of the game:

1. Each student in each group must take his/her turn. One student from each group will sit in the hot seat.

2. No texts, notes, etc. can be used by people in the hot seat or team/group people. 3. The group cannot give the student in the hot seat any help in answering their question. 4. A group member is chosen to answer the question. 5. A question will be randomly selected from the container. 6. Each question is read only twice so all students and groups must listen carefully. 7. The selected student may answer the question correctly earning their team 10 pts. If

answered incorrectly, the group receives 0 points. If the student in the hot seat chooses not to answer the question and pass it to his/her team members, the team has to wait until all students in the hot seats have had a chance to answer/pass their questions. Students/groups do not steal questions from each other.

8. After each student receives his/her own question and answers or passes, the teacher then asks the group to answer the question that was passed to them by their member. If the group answers correctly, the team/group earns 5 pts.

9. Appoint a scorekeeper (this person could be your principal, fellow colleague, or parent volunteer) to put group names and points earned on the board. The teacher can keep up with the score if there is no scorekeeper.

10. After each student/group has had a chance to answer their question, the student in the hot seat returns to his/her group and the next group member sits in the hot seat.

11. If group members try to give their hot seat team member the answer or are too loud, deduct 5 pts from the group’s total points.

12. Continue in this fashion until you delete your question bank or you run out of time. 13. A lightening round can be played where the group picks the person in the hot seat. 14. The students are playing for points earned as a bonus on their exam. Let students decide

the number of points. My students usually chose 5 points for the group with the highest score, 3 pts for the second highest score, and either 2 or 1 point for the lowest scoring group. (1 pt if each student in the hot seat passed their question to the group and did not try to answer any question.)



15. You may want to limit the group’s time to answer the question if it is passed to them. The review got its name due to students sitting with their group who knew everything until it is their turn to sit in the ‘hot seat’ and they can not remember anything.



Laboratory experiences are an important part of science education. These experiences in the classroom allow students the opportunity to practice the processes of scientific inquiry in order to promote scientific literacy and problem solving skills necessary to develop an understanding of scientific concepts. Skills employed while doing lab include reading, writing and critical thinking as well as the appropriate use of laboratory equipment, precision and accuracy of measuring and organizing data. For this class you will be required to keep a lab notebook. The lab notebook will be stored in my room and will be used for all labs. Lab Focus Question: What is the purpose of this lab? Why is the lab being done? The lab group is responsible for developing an appropriate lab focus question. Lab Procedure: You are expected to write a descriptive paragraph explaining how the lab was conducted. You may not use any personal pronouns such as I, we, us, etc. The narrative should contain only that information a reader would need to be able to explain how the lab was conducted. Be sure to include all equipment and/or solutions, chemicals, etc., needed to complete the lab. Make sure that no “understood” procedures are included (i.e. materials were gathered). Lab Questions: You are expected to answer all questions in a lab. The questions should be answered in complete sentences and be correct. Calculations, when required, are clearly shown. Specific formulas or equations for reaction during the lab are shown. Safety: All safety procedures are expected to be followed and all safety equipment is expected to be worn while anyone in the lab is still working. Work Ethic: Group works together cooperatively, is continually on-task and all members of group are participating. There is no horseplay or wasted time. Format: Blue or black ink is recommended with no whiteout. Proper spelling and grammar is followed and no 1st or 3rd person personal pronouns are used. Conclusion is written in such a way that lab focus question is easily identifiable. All sections are written in proper paragraph form, (remember, one sentence is not a paragraph). Conclusion: The conclusion should be written in paragraph form and should answer the lab focus question using data obtained as supporting evidence. Be sure to identify the data as either qualitative or quantitative or both. Also, explain how the skills and concepts studied in today’s lab are relevant in today’s society.



Lab Rubric: Lab Focus Question:

Teacher Criteria Peer

10 5 0

Lab Focus Question: Present and relevant to the topic

Present and closely related to the topic Absent or not directly related to the topic

10 5 0

5 3

0

Lab Procedure: Written as a descriptive paragraph with relevant steps and materials included

Written as a list with relevant steps and materials included OR Written as a paragraph but missing relevant steps and or materials Absent or more than 50% of relevant steps and or materials missing

5 3

0

5 3 0

Lab Results: All results are clearly written; proper units are used when necessary

Results are present, some without proper units or some results are missing No results are included OR less than 50% of the results are included

5 3 0

5

3

0

Lab Questions: Answered in complete sentences, calculations, when required are clearly shown; specific formulas or

equations for reactions during the lab are shown Answers not in complete sentences, most calculations, formulas or equations are shown OR less than

80% of these are shown correctly Answers, calculations formulas and/or equations missing OR less than 50% of these are shown

directly.

5

3

0

5

3

0

Safety: All safety procedures were observed; all safety equipment was used correctly; group was not cited for

a safety violation Safety procedures were observed, safety equipment was used; group cited for ONE safety violation. Safety procedures were not observed; safety equipment was not used; group was cited for more than

one safety violation.

5

3

0

10

5

0

Lab Conclusion: Written in paragraph form answering the lab focus question using data as supporting evidence, also explains how the information discovered in the lab is applicable in today’s society, data is identified

as either qualitative or quantitative Paragraph format absent but lab focus question is addressed using appropriate data OR paragraph format present and application to today’s society is missing OR data is not properly identified as

qualitative or quantitative Paragraph format absent, lab focus question is not addressed using appropriate data and application to

today’s society is missing and data is not identified as qualitative or quantitative

10

5

0

5 3 0

Format: Neatly presented, uses appropriate grammar, and adheres to format.

Neatly presented, few grammar mistakes, minor format mistakes Neatness absent, frequent grammar mistakes, does not follow format

5 3 0

5 3 0

Work Ethic: Group is on task; no horseplay; works cooperatively; all members actively participate

Group is redirected one time; 80% of members work cooperatively and actively participate Group is redirected more than one time, 50% of members work cooperatively and actively participate.

5 3 0

Total points earned = Lab grade

biology course map - georgia standards frameworks/9-12...biology course map ... a type of graphic...

Documents