APPENDICES

i

i

APPENDIX III

ACHIEVEMENT TEST – BOTANY

Class : XI Duration: 2 hours Division: Marks : 50 I. Choose the correct answer: (1x 30 = 30) 1. A stretch of chromosome that codes for a trait can be called a

a) Chromatid b) replication fork c) gene d) base-pair

2. To which of these DNA strands would the DNA strand A-T-G-C-C-G-T-T

match? a) G-C-A-T-T-A-C-C b) C-G-T-A-A-T-G-G c) T-A-C-G-G-C-A-A d) T-T-G-C-C-G-T-A

3. Which of these sequences correctly describes how DNA is copied?

a) replication—bonding of bases—separation of strands—base pairing b) separation of strands —base pairing—bonding of bases—replication c) replication—bonding of bases—base pairing—separation of strands d) separation of strands—bonding of bases—replication—base pairing

4. During replication, what enzyme adds complementary bases?

a) Helicase b) Synthesase c) Replicase d) polymerase

5. A DNA strand has the following bases: A A G C C A. What are the bases on its

complementary strand? a) A A G C C A b) A C C G A A c) T T C G G T d) C C A T T C

6. Transcription results in :

a) an amino acid chain b) messenger RNA c) complementary DNA d) Okazaki fragments

ii

7. In RNA, _____ codons translate to ______ amino acids. a) 1, 1 b) 3, 1 c) 3, 3 d) 1, 20

8. A nucleotide consists of: a) a phosphate and a base b) a phosphate, and a sugar c) a base and an amino acid d) a phosphate, a sugar, and a base

9. The enzymes that break hydrogen bonds and unwind DNA are:

a) primase b) helicases c) polymerases d) ligase

10. If a DNA molecule is found to be composed of 40% thymine, what percentage

of adenine would be expected? a) 10% b) 20% c) 40% d) 80%

11. Attributes of the genetic code include all of the following EXCEPT:

a) Each codon consists of 3 nucleotides. b) Each codon specifies more than one amino acid. c) Codons are non-overlapping. d) Most amino acids are coded for by more than one codon.

12. Which of the following statements regarding DNA structure is INCORRECT ? a) Adenine always pairs with thymine; and guanine pairs with cytosine. b) The DNA helix has both major and minor grooves. c) Base pairs are stabilized by salt bridges. d) The two strands of a DNA helix are anti-parallel.

13. Okazaki fragments are

a) the pieces of DNA that result from DNA degradation. b) the pieces of DNA that result from the interrupted synthesis of the

lagging strand of DNA during replication. c) the pieces of RNA used to prime the replication of DNA by DNA

polymerase. d) the pieces of DNA that are synthesized in the place of the RNA primer

during DNA replication.

iii

14. DNA polymerization occurs in a) the 3’ to 5’ direction on both the leading and lagging strands. b) the 5’ to 3’ direction on both the leading and lagging strands. c) the 5’ to 3’ direction on the leading strands, and the 3’ to 5’ direction on

the lagging strands. d) the 3’ to 5’ direction on the leading strands, and the 5’ to 3’ direction on

the lagging strands. 15. The mRNA codons of amino acids in a sequence of part of a polypeptide chain

are shown below. UGU-GAU-CAC-UAG-GAU-AAG-CAC . Which DNA base sequence could provide the code for this section of polypeptide? a) ACA-CTA-GTG-ATC-CTA-TTC-GTG b) ACA-CTA-GTG-ATG-CTA-AAC-GTG c) ACA-CTT-GTG-ATG-CTA-TTC-GTG d) ACA-CUA-GUG-AUG-CUA-UUC-GUG

16. Which statement correctly describes the transcription of DNA?

a) It produces amino acids. b) It produces messenger RNA.

c) It results in increased DNA synthesis. d) It is a semi-conservative process.

17. What is the function of the enzyme DNA polymerase? a) To build a strand of DNA using DNA as a template. b) To build a strand of DNA using a polypeptide as a template. c) To build a strand of mRNA using DNA as a template. d) To build a strand of DNA using mRNA as a template. 18. What does a molecule of transfer RNA carry? a) An amino acid molecule b) Enzyme for protein synthesis c) Information from the DNA d) Sequence of codons.

19. Which statement describes the base pairing in nucleic acids? a) Purine bases always pair with other purine bases. b) Purine bases can only pair with pyrimidine bases. c) Adenine cannot pair with either uracil or thymine. d) Hydrogen bonding can only occur between the pyrimidine bases.

20. Which one of the following is NOT immediately essential for protein synthesis? a) ATP b) Enzyme c) Glucose d) mRNA

iv

21. What is the maximum number of possible amino acids which could be coded for using the triplet code? a) 3 b) 16 c) 48

d) 64

22. What is the advantage of DNA having two complementary strands? a) Transcription and replication can occur simultaneously. b) Semi-conservative replication is possible. c) Diploid cells can inherit DNA from both parents. d) Pyrimidines can form one strand and purines the other. 23. Which of the following base is never found in RNA? a) Cytosine b) Guanine c) Uracil d) Thymine 24. Adenine comprised 36% of the nitrogenous bases in the DNA of cells from a

bacterial clone. What was the percentage of guanine in the DNA? a) 14% b) 18% c) 36% d) 64%

25. Which of the following statements about the strands of a newly replicated DNA molecule is correct? a) Both strands are made up of newly assembled nucleotides. b) One strand is new and the other is part of the original molecule. c) Both strands contain some nucleotides from the original molecule. d) The sugar-phosphate chains are conserved and new bases are inserted

between them.

26. Which of the following is involved in the inter-chain linkage between complementary strands of DNA? a) Covalent bonding between the sugar and nitrogenous bases b) Covalent bonding between the sugar and the phosphate groups c) Covalent bonding between adjacent sugar groups d) Hydrogen bonding between the nitrogenous bases

27. If the nucleotide sequence of an anticodon was AUC, then the DNA triplet

would be a) ATC

b) TAG c) AUC d) UAG

v

28. If the code for an amino acid is AGC on the DNA molecule, the anticodon on the tRNA would be a) AGC

b) TGC c) UCG d) UGC

29. A section of DNA has the following sequence of nitrogenous bases: CGATTACAG. Which of the following sequences would be produced as a result of transcription? a) CGTUUTCTG

b) GCTAATGTC c) CGAUUACAG d) GCUAAUGUC 30. DNA replication involves the breaking of bonds between

a) bases. b) sugars and bases c) phosphates and bases. d) sugars and phosphates

II. Answer the following

31. The following base sequence represents part of a normal mRNA strand:

A U G – G G U – U C U – U A G

Write the sequence of amino acids coded for by the mRNA codons. (2 marks)

Amino acids: ______________ - _______________ -

_______________ - _______________

32. Find out the mRNA sequence of codons that code for these amino acids. (2 marks)

alanine - cysteine - leucine – phenylalanine

mRNA: _______________ - _______________ - _______________ - _______________

vi

33. You have isolated some double-stranded dinosaur DNA from a biting insect preserved in fossilized amber. You then add the appropriate enzymes and manage to transcribe a strand of mRNA from one of the DNA strands. Below is the percentage composition of the bases for the DNA and m-RNA.

(2 marks)

C G T A U DNA Strand

1

15 24 31 30 0

DNA Strand

2

24 15 30 31 0

m-RNA

24 15 0 31 30

Which strand of DNA is the strand from which the mRNA was made? Explain.

34. Give the mRNA, DNA, and tRNA sequences that code for each of the following

amino acids. If there is more than one sequence, just give one. (3 marks)

Aspartic acid Valine m RNA DNA t RNA

35. From a hospital patient afflicted with a viral disease, you isolate and culture some cells and then extract the DNA. You find that the DNA from the culture contains two different kinds of DNA, each placed in a different test tube: one is double-stranded human DNA and the other is single-stranded virus DNA. You analyze the percent base composition of the two DNA extracts with the following results.

A C G T Tube 1 22 28 28 22 Tube 2 35 15 30 20

Which tube contains the single-stranded viral DNA? Explain. (3 marks)

vii

36. From an extract of human cells growing in tissue culture, you obtain a white fibrous substance. By noting the differences in chemical structure, building blocks, etc. list the features by which you could distinguish whether it was DNA, RNA, or protein. (3 marks)

DNA RNA PROTEIN

37. Describe, with the help of suitable diagrams, the steps in protein synthesis, beginning with the attachment of a messenger RNA molecule to the small subunit of a ribosome and ending with the release of the polypeptide from the ribosome. Include in your answer a discussion of how the different types of RNA function in this process.

(5 marks)

i

APPENDIX IV

SCORING KEY AND MARKING SCHEME

Sl.No: Expected Outline Answers Marks allotted to each point

Total Marks

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30.

C C B D C B B D B C B C B B A B A A B C D B D D B D A A D A

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

30

31. Methionine Glycine Serine Stop codon

½ ½ ½ ½

2

32. GCU/GCC/GCA/GCG UGU/UGC UAA/UUG/CUU/CUC/CUA/CUG UUU/UUC

½ ½ ½ ½

2

ii

33. DNA 1 Anti-sense strand, complementary to m-RNA strand

½

1 ½

2

34.

Aspartic acid- m-RNA: GAU/GAC DNA: CTA/CTG tRNA: CUA/CUG Valine- mRNA: GUU/GUC/GUA/GUG DNA: CAA/CAG/CAT/CAC tRNA:CAA/CAG/CAU/CAC

½ ½ ½

½ ½ ½

3

35.

Tube 2 A not equal to T and C not equal to G in single stranded DNA

½

1 ½

3

36.

DNA-nucleotides are the building blocks, contains deoxyribose sugar, bases A,T,G and C and phosphate. Double stranded RNA- nucleotides are the building blocks, contains ribose sugar, bases A,U,G and C and phosphate. Single stranded Proteins- amino acids are the building blocks, linked by peptide bonds forming polypeptides.

1 1 1

3

37.

Translation takes place in the cytoplasm. Initiation -

(i) mRNA binds to small subunit of ribosome in

iii

presence of initiation factors.

(ii) initiator codon AUG on mRNA binds with small subunit forming initiation complex.

(iii) Then larger subunit (having the P-site and A- site) binds.

(iv) First aminoacyl tRNA binds to P-site. Initiation factors are released.

(v) Second aminoacyl tRNA binds to A-site followed by peptide bond formation (enzyme- peptidyl transferase)between the two amino acids.

Elongation-

(i) Ribosome moves to adjacent codons on mRNA (translocation -by translocase enzyme) and the process continues.

Termination - on finding the stop codons Diagram-

Types of RNA: mRNA: where ribosome binds to bring about protein synthesis. t RNA helps to bring the amino acids to the site of protein synthesis. rRNA : needed for the synthesis of ribosomes

2 ½

1 ½

1

5

Sir/ Madam, This rating scale is meant for collecting your views regarding the availability of resources, extent of use and need for special training to teachers for using Computer Assisted Instruction (CAI) and Constructivist Model (CM) in

classrooms. Kindly record y

A. Availability of Resources1. For CAI

Sl.No: (i) Availability of computers in your school

(ii) Internet facility in your school

(iii) Availability of computer assisted lessons

(iv) Availability of suitable literatures for the

development of educational softwares

2. For Constructivist ModelSl.No: (i) Availability of suitable resources

(ii) Availability of suitable support systems

(iii) Availability of literatures and reference materials for

preparing constructivist lessons

B. Extent of Use

(i) Of CAI in teaching Biology

(ii) Of Constructivist Model in teaching Biology

C. Need for Special training

Sl.No: Need for training to teachers for teaching Biology (i)

Using CAI

(ii)

Using Constructivist Model

RATING SCALE FOR TEACHERS

This rating scale is meant for collecting your views regarding the availability of resources, extent of use and need for special training to teachers for using Computer Assisted Instruction (CAI) and Constructivist Model (CM) in

classrooms. Kindly record your opinion by a mark in the appropriate column.

Availability of Resources

Aspects Availability of computers in your school

Internet facility in your school

Availability of computer assisted lessons

Availability of suitable literatures for the development of educational softwares

For Constructivist Model Aspects

Availability of suitable resources

Availability of suitable support systems

Availability of literatures and reference materials for preparing constructivist lessons

Extent of Use Extent of Use

Of CAI in teaching Biology

Of Constructivist Model in teaching Biology

Need for Special training Need for training to teachers for teaching Biology

Using Constructivist Model

i

APPENDIX V

This rating scale is meant for collecting your views regarding the availability of resources, extent of use and need for special training to teachers for using Computer Assisted Instruction (CAI) and Constructivist Model (CM) in

mark in the appropriate column.

GE SE NA

Availability of suitable literatures for the

GE SE NA

GE SE NA

GE SE NA

APPENDIX VI

QUESTIONNAIRE FOR TEACHERS Sir / Madam, This Questionnaire is meant to find out the practical difficulties likely to be encountered by teachers while using Computer Assisted Instruction and Constructivist Model in classrooms. Rank in order the practical difficulties likely to be encountered by teachers if the methods (CAI and CM) are adopted in classrooms as teaching-learning strategy.

Sl.No:

Practical difficulties

Rank in order of difficulty CAI CM

i. Rigid timetable

ii.

Overcrowded classrooms

iii. Lack of structure within the classes

iv. Consumption of time

v. Inadequate reference/ library facilities

vi. Unavailability of suitable resource materials

vii. Inadequate knowledge of the method of instruction

viii. Unfamiliarity with the theory underlying the models

ix. Overloaded syllabus

x. Lack of cooperation from authorities

xi. Lack of cooperation from colleagues

xii. Lack of cooperation from parents

xiii. Lack of training

xiv. Defective examination system

xv. Greater challenge to teachers

Any other: Please give your suggestions for the effective implementation of the two methods (CAI and CM) in teaching Biology.

i

APPENDIX II

CONSTRUCTIVIST MODEL LESSON-I

Name : Jisha Rose Mary Joseph Subject : Biology Unit : Molecular Genetics Lesson Unit: Structure of DNA

Name of School: Standard : XI

Date :

Instructional Objectives: The pupil I. Remembers the terms - DNA backbone, deoxyribose sugar, nitrogenous bases, Base-Pair Rule, Nucleoside, Nucleotide and related facts.

II. Acquires Understanding of the above said terms and related facts. III. Develops ability to Apply the knowledge in the class.

i. Pupil is able to construct a DNA strand by relating the bases, sugars and phosphate groups. IV. Develops ability to Analyse the learned facts and concepts.

i. Pupil is able to identify the four nitrogenous bases and sugar present in DNA. ii. Pupil is able to identify the two base pairs of DNA. iii. Pupil is able to analyse the structure of DNA .

V. Develops ability to Evaluate the learned facts and concepts. i. Pupil is able to differentiate the nitrogenous bases, sugar and phosphate groups and form the structure of DNA

VI. Develops ability to Create the learned facts and concepts. i. Pupil is able to create the model of DNA using the materials provided.

ii

Phases

Activities/ Interactions

Displays/ Resources Used

Engage Explore Explain

Teacher reads a news report that explains a crime that has been committed and the criminal is unknown. It is also stated that DNA samples have been picked up at the scene and a DNA test will help find the criminal. Why is a DNA test a possible way to find the criminal? Student makes the suggestion that DNA of every individual is unique. Students are divided into groups of three each. Teacher asks the students to read the relevant area in the text. Student reads the relevant section in the text and each group discusses on what DNA is. Teacher asks questions to the students on what they know about DNA. Students give the responses in the response sheet Discusses about the basic knowledge on DNA. Teacher gives the following guiding questions. Taking the pictures of DNA as reference and based on what they understood from reading the text, the students are asked to give their responses on the sheet of paper provided. What are the components of DNA? Sugar, nitrogen bases and phosphates What is the structure of DNA? A DNA molecule is formed of two long chains or backbones and four types of Nitrogen bases.

News report Text book Student response sheet Response sheet / Notebook Two pictures of DNA, on showing the helical structure ad the other showing the arrangement of nucleotides

iii

What forms the DNA backbone? The DNA backbone is formed of a chain of alternating sugars and phosphate groups. Each sugar molecule is joined at the 3’ and 5’ hydroxyl groups to the phosphate groups through ester links called phosphodiester bonds. Name the sugar present in DNA. Deoxyribose. How many bases are present in DNA? Four bases Which are the bases present? Adenine(A), Thymine(T), Guanine (G) and Cytosine(C) How do the bases differ? Adenine and Guanine are formed of two fused rings and are called purines. Cytosine and Thymine are single ringed structures and are called pyrimidines. How do the bases pair? The bases pair in a specific manner by hydrogen bonds. What is the Base-Pair Rule? Adenine always pairing with Thymine by two H-bonds and Cytosine always pairing with Guanine by three H-bonds. This is called the Base-Pair Rule. How is the base pair attached to the DNA backbone? Each base in the base-pair is also connected to a sugar molecule in the DNA backbone.

Response sheet/ note book

iv

What is a nucleoside? A Nitrogen base covalently attached to a sugar molecule is a nucleoside. What is a nucleotide? A deoxyribose sugar, a N-base and a phosphate group together form a nucleotide. Which is the basic unit of DNA? Nucleotide Referring to Pic.2, teacher asks, What is the peculiarity about the structure of DNA? Does it resemble any object ? DNA looks like a twisted ladder. The base pairs form the rungs or steps of the ladder and the sugar-phosphate backbone forms the sides of the ladder. How do the two chains of DNA differ? They run in opposite directions.(anti-parallel) Now do you know why the DNA of every individual is unique? Because of the characteristic base pairing How does the DNA vary among individuals? Changing the position of base pairs allows for infinite number of sequences to occur Teacher walks around and uses individual interventions to provide guidance.

Response sheet /Notebook

v

Elaborate Evaluate

Teacher discusses the responses of the students and uses group intervention to reinforce concepts or instructions that have surfaced from individual questions or interventions. Teacher asks the students to make their models of DNA using the materials provided. Student makes the DNA model from the materials given. Homework exercise is given. Student completes it for the next day Since this is a constructivist lesson, it purposely does not review and link the new concept to old concepts—it was left to the students to do the initial linking. Students were allowed to give their responses based on what they understood and later group interventions were used to reinforce the concepts. Students were asked to construct the DNA model based on their knowledge of DNA.

Materials provided include 2 black wires, 12 red beads, 12 green beads, 12 blue beads, 12 yellow beads, toothpicks [The 2 black wires serve as DNA backbone, Beads represent the four bases, red-A, blue-T., green-C and yellow- G. Toothpicks show the H-bonds between the base-pairs.] Home work exercise

Review

1. What is the difference between nucleotide and nucleoside? 2. How does DNA vary among individuals?

Follow up Activity

1. A sequence of 15 bases is given. AUGCATTGATTCGAC. Construct a DNA molecule using materials of your choice. 2. Draw a double helical structure of DNA and label it neatly. 3. Find out the different types of DNA and the features of each.

vi

CONSTRUCTIVIST MODEL LESSON-II

Name : Jisha Rose Mary Joseph Subject : Biology Unit : Molecular Genetics Lesson Unit: Replication of DNA

Name of School: Standard : XI

Date :

Instructional Objectives: The pupil I. Remembers the terms - DNA replication, semi-conservative mode, replication origins, replication bubble, replication fork, DNA

polymerase, helicase, single strand binding proteins, primase, exonuclease, DNA ligase, topoisomerase, leading strand, lagging strand, Okazaki fragments and related facts and concepts.

II. Acquires Understanding of the above said terms and related facts and concepts. III. Develops ability to Apply the knowledge in the class.

i. Pupil is able to construct the model showing DNA replication. ii. Pupil is able to show how the basic structure of DNA is important in the process of DNA replication.

IV. Develops ability to Analyse the various steps involved in DNA replication. V. Develops ability to Evaluate the learned facts and concepts.

i. Pupil is able to summarise the role of various enzymes involved in DNA replication. VI. Develops ability to Create the learned facts and concepts.

i. Pupil is able to relate the enzymes involved with their role, in DNA replication. ii. Pupil is able to explain the importance of DNA strand separation.

vii

Phases

Activities/ Interactions

Displays/ Resources Used

Engage Explore Explain

An embryonic cell divides again and again. Where there was one cell, there are two, then four, then eight and so on….Each holds the genetic information needed to create a new human being. How exactly do these cells make copies of themselves? As cells divide, DNA is passed on from the parent cells to the daughter cells. So, now let’s see how the DNA passes from the parent cell to the daughter cells. Students are divided into groups of three each. Teacher asks the students to read about DNA replication and Meselson-Stahl Experiment from the text. To make sure they understand how replication works, teacher tells the students to write down interesting points in a paper while reading and makes sure they are understanding the main ideas. Teacher asks questions to link previous knowledge of the students with what is to be learned. Student writes the answers in the response sheet. What do you think DNA does when cell divides? DNA divides. Does each new cell contain DNA? Yes. Where does this extra DNA come from? From the parent cell.

Text book Text book and Response sheets Response Sheet Chart showing semi-conservative, conservative and dispersive replication

viii

How does DNA make copies of themselves? By replication What is meant by DNA replication? DNA replication is the process by which a double-stranded DNA molecule makes a copy of itself. Teacher asks the following guiding questions. Student writes the answers in the response sheet/ note book. Why does DNA replicate? The basis of life is built on the ability of the cells to replicate with identical blueprints for survival. DNA replication provides the foundation of this process. Do the base-pairing rules for replication match the base-pairing rules learned in the previous class? Yes What is the type of replication? Semi-coservative Why is it so called? When the replication process is complete, two DNA molecules - identical to each other and identical to the original - have been produced. This mode of replication is described as semiconservative: one-half of each new molecule of DNA is old and one-half new. How is the basic structure of DNA important in the process of replication? The daughter DNA produced are exactly similar to the parent DNA. Teacher walks around and uses individual interventions to provide guidance.

Response sheet / Notebook

ix

Elaborate Evaluate

Teacher discusses the responses of the students and uses group intervention to reinforce concepts or instructions that have surfaced from individual questions or interventions. Teacher asks the students to demonstrate replication with the help of the DNA model prepared in the previous class. From the DNA model prepared in the previous class, student will show how replication occurs. Old strands are marked with tape so that the student can tell what happens to the different strands. Replication models are made by breaking the toothpicks (H-bonds) between the base-pairs and by creating two new strands complementary to the old strands following the base-pair rule. Teacher gives additional information about the mechanism of DNA replication and the role of various enzymes involved in it. Since this is a constructivist lesson, it purposely does not review and link the new concept to old concepts—it was left to the students to do the initial linking. Students were allowed to give their responses based on what they understood and later group interventions were used to reinforce the concepts. Students were asked to show DNA replication using the DNA model prepared in the previous class.

Materials needed to demonstrate replication of DNA (Blue wires, tooth picks, coloured beads-red, blue, green and yellow, scissors, tape and the DNA model prepared in the previous class) are given to each group

Review

1. What is meant by replication of DNA? 2. Why is DNA replication called semi-conservative?

Follow-up Activity

1. Read the mechanism of DNA replication from the text book and explain the steps involved in the replication of DNA.

x

CONSTRUCTIVIST MODEL LESSON-III

Name : Jisha Rose Mary Joseph Subject : Biology Unit : Molecular Genetics Lesson Unit: RNA-Structure, Types and Functions

Name of School: Standard : XI

Date :

Instructional Objectives: The pupil

I. Remembers the terms - Ribose sugar, Uracil, messenger RNA (m-RNA), ribosomal RNA (r-RNA) and Transfer RNA (t-RNA) II. Acquires Understanding of the above said terms and related facts and concepts.

III. Develops ability to Apply the knowledge in the class. i. Pupil is able to construct the model of RNA.

IV. Develops ability to Analyse the learned facts and concepts. i. Pupil is able to identify the four nitrogenous bases and sugar present in RNA.

ii. Pupil is able to analyse the structure of RNA . V. Develops ability to Evaluate the learned facts and concepts.

i. Pupil is able to compare and contrast the different types of RNA based on their structures and functions. VI. Develops ability to Create the learned facts and concepts.

i. Pupil is able to create an RNA strand if a DNA strand is given.

xi

Phases

Activities/ Interactions

Displays/ Resources Used

Engage Explore Explain

Teacher shows the coloured pictures of DNA and RNA. Students are divided into groups and each group is asked to refer to the pictures and identify and write down the similarities and dissimilarities between the structure of DNA and RNA. Teacher asks the students to read the relevant area in the text book and write down the points which they feel interesting in their note books. Teacher asks questions to activate the prior knowledge of students. What are the two chemical differences between RNA and DNA? In RNA, the sugar is ribose and the base Uracil(U) is present in place of Thymine(T). What are the characteristics of genetic material? Should reproduce and be transmitted faithfully from generation to generation. Should be structurally and chemically stable. Should be able to express itself. Should be capable of changing by mutation. Teacher asks several guiding questions. Student writes the answers in the response sheet / notebook Does RNA fulfill all the characteristics of a genetic material? Let’s take them one by one. Is RNA capable of making copies? Yes Is RNA stable?

Coloured pictures of DNA and RNA Text book and Response sheet/ Note book Response sheet Response sheet / Note book

xii

RNA is easily degradable (because of the 2’-OH group present in every nucleotide).RNA is also catalytic and hence more reactive. RNA is less stable than DNA. Is RNA capable of expressing itself? RNA can directly code for proteins. Is RNA capable of mutating? RNA being less stable mutate faster. Which do you think is a better genetic material-DNA or RNA? DNA and RNA function as genetic material but DNA being more stable helps in the storage of genetic information while RNA helps in the transmission of genetic information. Which is the first genetic material? RNA. Why is RNA considered as the first genetic material? Essential life processes evolved around RNA. RNA acted as a genetic material as well as a catalyst in various biochemical reactions. But being a catalyst, RNA was reactive and unstable. Therefore, DNA has evolved from RNA. How does the structure of RNA affect its function? Being single stranded, RNA is able to complement itself and form tertiary structures. Tertiary structure of RNA plays a crucial role in determining its function. Which are the three main types of RNA? Messenger RNA (m-RNA), ribosomal RNA (r-RNA) and Transfer RNA (t-RNA)

xiii

Elaborate Evalute

What are functions of m-RNA, r-RNA and t-RNA? messenger RNA (mRNA)- encode proteins needed for the function of a particular cell (e.g., the mRNA for haemoglobin in the precursors of red blood cells). ribosomal RNA (rRNA)- Is used in the building of ribosomes which form the machinery for synthesizing proteins by translating mRNA. transfer RNA (tRNA)- RNA molecules that carry amino acids to the growing polypeptide. Teacher shows a chart on the structure of t-RNA and asks students to explain its structure. Teacher gives help whenever needed. Teacher walks around and uses individual interventions to provide guidance. Teacher discusses the responses of the students and uses group intervention to reinforce concepts or instructions that have surfaced from individual questions or interventions. Teacher asks the students to make a model of RNA using the materials provided. Student makes RNA model using the materials. Since this is a constructivist lesson, it purposely does not review and link the new concept to old concepts—it was left to the students to do the initial linking. Students were allowed to give their responses based on what they understood and later group interventions were used to reinforce the concepts. Students were asked to make a model of RNA using the materials provided.

Chart - Structure of t-RNA Each group is given materials to make their RNA model. (Red wires, tooth picks, coloured beads-red, orange, green and yellow) Red wires serve as sugar-phosphate backbone, Beads represent the four bases, red-A, orange-U., green-C and yellow- G. Toothpicks- to join the bases with the sugar-phosphate backbone.

xiv

Review:

1. Why is DNA considered a predominant genetic material? 2. What are the three main types of RNA? Mention their functions. 3. Differentiate between RNA and DNA

Follow-up Activities.

1. Find out more about the different types of RNA and their functions. 2. Make a model of RNA

xv

CONSTRUCTIVIST MODEL LESSON-IV

Name : Jisha Rose Mary Joseph Subject : Biology Unit : Molecular Genetics Lesson Unit: Transcription

Name of School: Standard : XI

Date :

Instructional Objectives: The pupil I. Remembers of the terms- Gene expression, Central Dogma, Transcription, Anti-sense strand and related facts and concepts.

II. Develops Understanding of the above said terms and related facts and concepts. III. Develops ability to Apply the knowledge in the class.

i. Pupil is able to construct the model showing transcription. IV. Develops ability to Analyse the learned facts and concepts.

i. Pupil is able to analyse the steps involved in transcription. V. Develops ability to Evaluate the learned facts and concepts.

i. Pupil is able to identify that transcription is an important step in protein synthesis. VI. Develops ability to Create the learned facts and concepts.

i. Pupil is able to organise in order the steps involved in transcription.

xvi

Phases

Activities/ Interactions

Displays/ Resources Used

Engage Explore Explain

Hair grows from your head, non-stop, day in and day out. The cells of your hair follicles somehow generate all of the protein that make up this hair. How is this protein created?

Today, we shall learn how this protein is created. First, we shall learn about transcription , which is the process in which DNA is copied by m-RNA and try to create a model of transcription.

Students are divided into groups of three each. Teacher asks the students to read the relevant area in the text. To make sure they understand, teacher tells the students to write down interesting points in a paper while reading. Materials to demonstrate the processes of transcription ,namely the prepared DNA model, One red wire, red beads, green beads, yellow beads ,orange beads, toothpicks, scissors, tape ,etc are given to each group. Teacher uses guided inquiry to activate the prior knowledge of students. Students are asked to write their responses in the response sheet. What happens during the process of cell division? DNA is replicated and new cell structures are formed. What are the new cell structures made of? Proteins. Who gives the information for the synthesis of proteins? Genes located on DNA.

Text book/Resource material Text book and Response sheets Response Sheet

xvii

What do genes code for? Proteins What is the role of proteins in the cell? Give structure to the cell and do functions in the cell Which are the sites of protein synthesis? Ribosomes Where are ribosomes located? In the cytoplasm Where are genes located? On the DNA inside the nucleus. How does the genetic information get out of the nucleus? Information in the DNA is copied by the m-RNA and this m-RNA moves into the cytoplasm through the nuclear pores. Showing a simple flowchart of the steps in gene expression, teacher asks, How do the genes provide the cell with information necessary for protein synthesis? Or, how are the genes expressed? Or, How do cells use DNA to make proteins? Sequence of DNA is copied enzymatically to produce a complementary RNA strand, called messenger RNA (mRNA), which in turn is passed into the cytoplasm to be translated to proteins. What is meant by gene expression? Gene Expression is the process by which information contained in the gene (DNA) is converted into molecules (proteins) that determine the properties of the cell. What are the steps involved in Gene Expression? Gene expression occurs in two steps:

• Transcription = DNA → RNA

Flowchart showing the steps in gene expression

xviii

• Translation = RNA → protein.

Showing a simple figure of Central Dogma, teacher asks, What is meant by the Central Dogma of Molecular Biology?

DNA in the nucleus is first copied into a single stranded molecule called RNA which travels out of the nucleus into a protein and do work and provide structure to the cell.

Transcription and Translation together make up the central dogma of molecular biology: DNA → RNA → protein.

To help understand Central Dogma in terms of what the students already know, teacher shows an analogy of Central dogma, and asks, How can you compare the analogy with the Central Dogma

Student compares the symbols that best describe the functions of the bio-molecules. Blueprint of the house is compared to DNA, Engineer to m-RNA, land where the house is to be built to the ribosomes, workers to the t-RNA, materials to amino-acids, and picture of the house to proteins.

Teacher continues with the following questions. What is transcription? Transcription is the process by which genetic information stored in a strand of DNA is copied into a strand of RNA.

What are the steps involved in transcription?

Separation of the DNA strands and Synthesis of an m-RNA strand in the 5’ to 3’ direction on one of the DNA strand known as the anti-

Chart on Gene Expression and Central Dogma of Molecular Biology Teacher shows the analogy: Blueprint of a house, engineer, land, materials for building the house(bricks, cement, iron rods, paint,etc.),workers (masons, carpenters, painters,etc.), picture of house.

xix

Elaborate

sense strand.

Does a particular gene transcribe its m-RNA in different amounts at different times? Yes, Cells can regulate the amount of proteins.

Teacher walks around and uses individual interventions to provide guidance.

Teacher discusses the responses of the students and uses group intervention to reinforce concepts or instructions that have surfaced from individual questions or interventions.

Teacher writes a sequence of nucleotides on the black board and asks the students to make their model of transcription with the help of the materials provided, taking hints from what they have understood.

Student makes models of transcription using the materials. Transcription:DNA ���� m-RNA Step 1: Unzipping the DNA. Cells copy only one side of the DNA ladder. In order to make this copy, the chemical bases forming the rungs of the DNA ladder must be separated. • Cut or break in the middle the toothpicks in the model to separate the chemical bases and unzip the DNA ladder. • Set the unlabelled backbone with chemical bases attached aside. Step 2: Begin to form the mRNA strand. The exposed chemical bases, or nucleotides of the unzipped DNA (DNA 1 or 2) are used to make the copy. This copy is called messenger RNA (mRNA). The chemical bases in mRNA form pairs. Adenine (A) binds with Uracil (U) and Guanine (G) binds with Cytosine (C).

Materials include: DNA model made during the first class, a red wire, 12 red beads 12 green beads 12 blue beads 12 yellow beads 12 orange beads toothpicks The red wire serves as RNA backbone, beads represent the bases, red-A, blue-T, green-C and yellow- G and orange-U, Toothpicks show the H-bonds between the base-pairs.

xx

Evaluate

• Place the backbone labelled “DNA-1” or “DNA-2” depending on which one to make the model. • Follow the rules of base pairing to make the mRNA copy of the DNA code by lining up coloured beads with their appropriate match. Step 3: The chemical bases of mRNA are also attached to a backbone as in DNA. • Attach the new chemical bases to the red wire backbone using toothpicks cut or broken in half. This forms a new mRNA copy of the DNA strand. • Label this new strand mRNA-1 or mRNA-2 on the left end of the backbone. Since this is a constructivist lesson, it purposely does not review and link the new concept to old concepts—it was left to the students to do the initial linking. Students were allowed to give their responses based on what they understood and later group interventions were used to reinforce the concepts. Students were asked to show transcription using the materials provided.

Review

1. Write a DNA sequence and make a complementary RNA of it 2. What are the steps involved in transcription? 3. What is meant by Central Dogma of Molecular Biology?

Follow up Activities:

1. Draw and neatly label Central Dogma of Molecular Biology. 2. Draw a diagram showing transcription. 3. Briefly explain the process of transcription with suitable labeled diagrams.

xxi

CONSTRUCTIVIST MODEL LESSON-V

Name : Jisha Rose Mary Joseph Subject : Biology Unit : Molecular Genetics Lesson Unit: Structure of DNA

Name of School: Standard : XI

Date :

Instructional Objectives: The pupil

I. Acquires Remembrance of the terms - Translation, Aminoacylation of t-RNA, Initiation, Elongation , Termination,

Genetic code chart, codon, anticodon and related facts. II. Acquires Understanding of the above said terms and related facts and concepts.

III. Develops ability to Apply the knowledge in the class. i. Pupil is able to construct the model showing translation.

ii. Pupil is able to describe the process of protein synthesis. IV. Develops ability to Analyse the learned facts and concepts.

i. Pupil is able to analyse the steps involved in translation. V. Develops ability to Evaluate the learned facts and concepts.

i. Pupil is able to recognize the importance of protein synthesis. VI. Develops ability to Create the learned facts and concepts.

i. Given a “code”, pupil is able to determine the amino acid sequence. ii. Pupil is able to organise in order the steps involved in translation.

xxii

Phases

Activities/ Interactions

Displays/ Resources Used

Engage Explore Explain

How do cells synthesise the proteins it require? Messenger RNA (mRNA) copied from DNA, in turn passes into the cytoplasm and gets translated to proteins. Students are divided into groups of three each. Teacher asks the students to read the relevant area in the text. To make sure they understand, teacher tells the students to write down interesting points in a paper while reading. Materials to demonstrate the processes of transcription namely, prepared m-RNA strand, large oval cut-outs, coloured circle cut-outs, cresent shaped cut-outs. Teacher also introduces the Genetic code chart and helps the students to read it. Student reads the relevant area and notes down interesting facts. Also learns to read the Genetic Code chart Teacher asks questions to link the prior knowledge of students with what is to be learned. Student writes the responses in the response sheet. What do genes code for? Proteins What is the role of proteins in the cell? Give structure and do functions in the cell Which are the sites of protein synthesis? Ribosomes Where are ribosomes located? In the cytoplasm Where are genes located? On the DNA inside the nucleus.

Text book and Response sheet/ Note book Text book and Genetic code chart Student response sheet Response sheet

xxiii

How does the genetic information get out of the nucleus? DNA strand is copied enzymatically to produce a complementary RNA strand, called messenger RNA (mRNA), which in turn is passed into the cytoplasm to be translated to proteins. Which is the second step in the Central Dogma of Molecular Biology? Translation. What is translation? The process by which information in m-RNA gets translated into proteins is called translation. Teacher asks the following questions and students write their responses in the response sheet. Does m-RNA travel to different parts of the cell to be translated? Proteins are made where they are needed in the cell. Are new proteins synthesized at all times in the cell? New proteins are produced at all times to support the life processes of the cell. How is m-RNA read? m-RNA is read in groups of three nucleotides or bases. Each group of three bases tells the cell which amino acid to assemble. What are the steps involved in translation? Charging of t-RNA (Aminoacylation of t-RNA) Initiation

Response sheet / Notebook

xxiv

Elongation Termination What is meant by charging of t-RNA? The amino acids are activated in presence of ATP and linked to their appropriate t-RNA by an activating enzyme specific for that amino acid as well as for the t-RNA assigned to it. What do you know about the structure of t-RNA? t-RNA looks like a clover-leaf. Each tRNA also called soluble RNA(sRNA)has a sequence of 3 unpaired nucleotides - the anticodon - which can bind, following the rules of base pairing, to the complementary triplet of nucleotides - the codon - in a messenger RNA (mRNA) molecule. Just as DNA replication and transcription involve base pairing of nucleotides running in opposite direction, so the reading of codons in mRNA (5' � 3') requires that the anticodons bind in the opposite direction. Anticodon: 3' CGG 5' Codon : 5' GCC 3' It also has an aminoacid acceptor arm to which it binds to aminoacids.

The aminoacid for the particular t-RNA is Alanine. There are no t-RNAs for stop codons. What happens during initiation? Initiator tRNA carrying methionine binds to the P site of the ribosome where it has encountered the start codon AUG. How does elongation of the peptide chain take place? An aminoacyl-tRNA (a tRNA covalently bound to its amino acid)

xxv

Elaborate

able to base pair with the next codon on the mRNA arrives at the A site. The preceding amino acid (Met at the start of translation) is covalently linked to the incoming amino acid with a peptide bond. The initiator tRNA is released from the P site. The ribosome moves one codon downstream. This shifts the more recently-arrived tRNA, with its attached peptide, to the P site and opens the A site for the arrival of a new aminoacyl-tRNA and the process goes on and on. How do protein synthesis terminate? The end of translation occurs when the ribosome reaches one or more STOP codons (UAA, UAG, UGA). No t-RNA enters the A- site. When the stop codon is reached the ribosome falls off the mRNA and translation stops. Teacher walks around and uses individual interventions to provide guidance. Teacher discusses the responses of the students and uses group intervention to reinforce concepts or instructions that have surfaced from individual questions or interventions. Teacher asks the students to make a model of translation using the materials provided. Finally, Teacher asks to record the results in their notebooks. 1) What was the initial DNA sequence?

Materials : Prepared m-RNA strand , large oval cut-outs representing ribosomes, coloured circle cut-outs representing t amino acids, cresent shaped cut-outs representing t-RNAs, tape, Genetic code chart,etc Notebook

xxvi

2) What was the mRNA sequence? 3) What were the amino acids that made up the protein sequence?

Finally, teacher gives an activity to the students to display their understanding of the process of protein synthesis. Activity will help student to display his understanding of the process of protein synthesis.

Students work in groups.

1. A student picks up a DNA template card, and transcribes it into mRNA.

2. With the mRNA sequence, he goes back to the group’s desk and the ribosomal student writes out the tRNA anticodon sequence.

3. The tRNA student searches out the correct anticodon card and flip the card over revealing the word and he writes down the word.

4. After completing the sentence, a student in the group tells his group sentence.

The sentences are as follows:

1. Education is the way to success. 2. Biology is all around you. 3. Biology is so much interesting. 4. DNA is the code of life. 5. DNA is different in every individual.

Students work in groups - assign one student to be the mRNA, another student to write down the anticodons (ribosome) and the

Materials required:

• 5 DNA Template Cards: these will be kept on the desk at all times since DNA cannot leave the nucleus.

• 64 Anticodon Cards: These will be taped to the walls around the classroom.

• Paper: to write down the mRNA strand and the tRNA molecules and the sentence.

• Pen

DNA template cards.

1. ATGGCTCCGAGAGGAGGCAGGTAG 2. ATGCCCCCGAGCCCUTGCTAG 3. ATGCCCCCGGCACGGGCGTAG 4. ATGTTACCGAGATTCTTGTTTTAG 5. ATGTTACCGTATGTCAAAGGGTAG

t-RNA Cards with Words.

AUG = Start , UAG = Stop, GCU = Education, CCC = Biology, CCG = is, AGA = the, AGC = all, GCA = so, GGA = way, CCU = around, GGC = to, UAU = different, UUC = code, GUC = in, UUG = of, AAA = every, UUU = life, GGG = individual, UUA = DNA, UGC = you, CGG = much, AGG = success, GCG = interesting

xxvii

Evaluate

third student to search out the proper words (tRNA). Procedure:

1. Make up all the DNA Template Cards and the Anticodon-word cards.

2. Hang up the Anticodon -word cards, so the anticodons are showing. (write the anticodon on one side of the card, and the word on the other).

3. Each group is told that their desk is the nucleus and the DNA templates cannot leave the area.

4. A student is to pick up a DNA template card, and transcribe it into mRNA.

5. With the mRNA sequence, he will go back to the group's desk and the ribosomal student will write out the tRNA anticodon sequence.

6. The tRNA student will search out the correct anticodon card and flip the card over revealing the word. He will write down the word.

7. After completing the sentence, a student in the group will tell his group sentence. If not correct, have the group go over the same DNA template. If correct, have the students pick another card.

Since this is a constructivist lesson, it purposely does not review and link the new concept to old concepts—it was left to the students to do the initial linking. Students were allowed to give their responses based on what they understood and later group interventions were used to reinforce the concepts. Students were asked to show translation using the materials provided. Students worked in groups and demonstrated protein synthesis

xxviii

Review:

1. What is translation? 2. What is meant by charging of t-RNA?

Follow-up Activities:

1. Write a DNA sequence and translate it into a polypeptide sequence. 2. Briefly describe the process of protein synthesis with the help of neat, labeled diagram

APPENDIX VII

LIST OF EXPERTS

1. Dr. A. Sukumaran Nair, Former Vice- Chancellor, Mahatma Gandhi University.

2. Dr. J Exemmal, Former Dean, Faculty of Education, University of Kerala. 3. Dr. B. Suresh, Principal, Institute of Advanced Study in Education,

Trichur. 4. Dr. David Devraj Kumar, Professor of Science Education, Florida Atlantic

University, USA. 5. Dr. Jayasree T. K., Assistant Professor, Government College of Teacher

Education, Thiruvananthapuram. 6. Dr. Oommen P. Mathew, Research Investigator, Population Research

Centre, University of Kerala. 7. Dr. K. Y. Benedict, Associate Professor, Mar Theophilus Training

College, Thiruvananthapuram. 8. Dr. Esther Gladiz, Associate Professor, Mar Theophilus Training College,

Thiruvananthapuram. 9. Dr. Maya S., Assistant Professor, Mar Theophilus Training College,

Thiruvananthapuram 10. Mrs. Lalitha Justin, Biology Teacher, Christ Nagar Higher Secondary

School, Thiruvananthapuram.