Analysis of Adenovirus - host cellinteractions and comparative genomics

Adeel ur Rehman

Degree project in biology, Master of science (2 years), 2013Examensarbete i biologi 30 hp till masterexamen, 2013Biology Education Centre and Department of Medical Biochemistry and Microbiology, UppsalaUniversitySupervisor: Professor Catharina SvenssonExternal opponent: Roberta Biasiotto

1

ABSTRACT Human adenovirus (HAdV) is currently being developed as a promising therapeutic candidate for the

treatment of cancer. High gene transfer efficiency, relatively simple and efficient purification in large

scale and inherent ability to kill the cell following a completed infection cycle are the characteristics that

make adenovirus (Ad) a molecular tool of choice for many scientists. Consequently, Ad is among the

most frequently used viral vector in clinical trials. Tissue and tumor cell specificity, toxicity and host

immune responses are still main obstacles for the development of novel biological viral cancer

therapies. A good animal model is necessary to investigate these issues, but human Ad infection and

replication is restricted to human cells. Our lab recently identified a mouse cell line (NMuMG), which

shows full susceptibility to infection by human adenovirus serotype 2 (HAdV-2) but not to infection by

human adenovirus serotype 12 (HAdV-12). It is not known why some adenovirus serotypes are

susceptible while others are not. Nor is it known at what stage the virus infection cycle is blocked during

infection with the non-growing Ad serotypes. In this project, we showed that both human adenovirus

serotype 3 (HAdV-3) and human adenovirus serotype 11 (HAdV-11) efficiently deliver their genomes into

the nuclei of NMuMG cells. However no replication of DNA was found. In order to find differences

among Ad serotypes, a comparative bioinformatics analysis of HAdV-2, -3 and -12 was performed to

identify species-specific genes. We showed that there is a substantial genome variation in term of gene

content between the different Ad serotypes and a small number of novel species-specific genes were

identified. These results may suggest that specific viral proteins have a functionally important role on

host cell specificity.

2

Table of Contents ABSTRACT ...................................................................................................................................................... 1

ABBREVIATIONS ............................................................................................................................................ 3

INTRODUCTION ............................................................................................................................................. 4

Key features of Human adenovirus ........................................................................................................... 4

Genotypes and Genomics of Human adenovirus ...................................................................................... 4

Oncolytic Virus and Host Immune Response ............................................................................................. 4

Life cycle of Adenovirus ............................................................................................................................. 5

Aims of this study ...................................................................................................................................... 6

MATERIAL AND METHODS ............................................................................................................................ 7

Bioinformatics ........................................................................................................................................... 7

Cell lines and viruses ................................................................................................................................. 7

Virus infection and transfection ................................................................................................................ 7

Oligonucleotides........................................................................................................................................ 7

Cytoplasmic and Nuclear DNA extraction ................................................................................................. 7

Virus DNA extraction by Hirt method and PCR ......................................................................................... 8

RNA isolation and RT-PCR ......................................................................................................................... 8

Protein extraction, SDS-PAGE and Western Blot....................................................................................... 9

RESULTS ....................................................................................................................................................... 10

Differential distribution of genes ............................................................................................................ 10

Virus replication in infected NMuMG cells .............................................................................................. 12

DISCUSSION ................................................................................................................................................. 15

ACKNOWLEDGMENTS ................................................................................................................................. 17

REFERENCES ................................................................................................................................................ 18

APPENDIX I. List of PCR primers, master mix, reagents, stock volume and concentration ......................... 20

APPENDIX II. The final reciprocal BLAST search results list compiled by manual curation ......................... 22

3

ABBREVIATIONS HAdV: Human adenovirus

Ad: adenovirus

HAdV-2: Human adenovirus serotype 2

HAdV-3: Human adenovirus serotype 3

HAdV-11: Human adenovirus serotype 11

HAdV-12: Human adenovirus serotype 12

CAR: coxackie-adenovirus receptor

DSG-2: desmoglein-2

kb: kilo bases

GC-content: guanine-cytosine content

Ab: antibodies

ADP: adenoviral death protein (E3)

CAR: coxsackie and adenovirus receptor

CTL: cytotoxic T lymphocytes

NMuMG cells: Normal mouse mammary epithelial cells

A549 cells: Human lung adenocarcinoma epithelial cells

DMEM: Dulbecco’s modified Eagle’s medium

FBS: fetal bovine serum; ORF: open reading frame

RT: room temperature

FFU: florescence forming units

4

INTRODUCTION

Key features of Human adenovirus

Oncolytic viruses have the potential to infect cancer cells, multiply selectively within cancer cells and

cause death, with the release of new viruses that can infects neighboring cancer cells. Human

adenovirus (HAdV) is the major promising candidate available against in cancer gene therapy.1-5 So far,

1970 clinical gene therapy trials are being or have been performed worldwide in which, Adenoviruses

(Ad) are the most frequently used viral vector with 23% of all the trials.6 Several characteristics make

HAdV an attractive cancer gene therapy candidate, e.g., broad cell tropism, high gene transfer efficiency

in both dividing and non-dividing cells, relatively simple and efficient purification in large scale, and

induction of oncolysis by a completed infection cycle.7-8 Although first, second and third generation Ad

vectors have been developed, tissue specificity, host immune response against virus infection and lack

of animal model are the major problems.9

Genotypes and Genomics of Human adenovirus

Human Adenoviruses (HAdV) belong to family Adenoviridae and are non-enveloped viruses with a

comparatively small double standard linear genome of 34-37 kb (Table 1).8 HAdV are classified into

seven different species (A-G) on the basis of particular serology or more recently, of genome sequence

(http://hadvwg.gmu.edu/). Up to now, 65 different types have been identified, of these types, HAdV-5

of specie C is the most studied type.10 The Ad genome has two major groups of genes termed as early

and late transcription units. Early transcription units encode for E1A, E1B, E2, E3 and E4 protein that are

mostly involved in transcription activation, inhibition of apoptosis, DNA replication, immune response

and viral reprogramming of host cell. Late proteins L1 to L5 are expressed from a major late promoter

and are generated by alternative splicing of a single transcript.11 Comparative genomics is a powerful

tool to identify type specific markers for studies on viral replication, and can provide how the tissue

specificity and host immune response are regulated. The genome wide variation of HAdV types is

complex and remains largely unknown. So far only three types (HAdV-12, 5, 2) from two species (A, C)

have been subject to whole proteome sequencing and well annotation.

Oncolytic Virus and Host Immune Response

Several viral species such as Ad, retrovirus, poxvirus, herpes simplex virus, measles, reovirus and

vesicular stomatitis virus have been used as oncolytic virus or genetically reengineered vectors to

achieve cancer specific replication.12 The selective replication of different Ads has been studied by

comparing different cell lines (human or mouse) in vitro.13-14 Different cell lines have shown variable

levels of susceptibility to Ad infection and replication.13

HAdVs are relatively easy to grow and modify, but manipulations that will retain replication competence

are difficult because, these viruses interact with both innate and adaptive immune system as well as

many growth controlling functions of the host cell.8 Many genetically engineered Ad can induce cancer

specific immune response5 therefore, in order to evaluate tumor killing activities and host cell immune

response in vivo, immunocompetent animal models are required. Immunocompetent hosts trigger

robust immune responses against HAdV, characterized mostly by the production of neutralizing

5

antibodies. In addition T-cell responses are often generated resulting in the production of interferons.6,14

So far, a few studies have been done to evaluate the efficacy of immunocompetent animal model

against HAdVs. Syrian hamster and cotton rats are two recently established semi permissive animal

models,15-16 but in general, HAdV infection and replication is restricted to human cells. Nude mice

(athymic and lack in functional T-cells) are usually used as animal models involving human xenograft

studies, but these models do not allow investigation of host immune responses. Therefore, a replication

competent animal model could be a milestone in the development of cancer gene therapy. Our lab

recently identified that human adenovirus serotype 2 (HAdV-2) can infect and replicate in mouse cell

line (NMuMG; normal mouse mammary epithelial cells), while human adenovirus serotype 12 (HAdV-12)

cannot cause infection in the same cell line. It is unknown at which stage the virus infection cycle is

blocked during infection with the non-growing HAdV serotypes. A few characteristics of HAdV types 2, 3

and 12 are described in the table 1. These HAdV types were used in this study for comparative analysis.

Table 1. The HAdVs used for comparative analysis. The three different species of HAdV using different host cell receptors. e.g. HAdV-12 and 2 use coxackie-adenovirus receptor (CAR), whereas HAdV-3 use desmoglein-2 (DSG)17 as primary receptor. Integrin αvβ serve as secondary receptor. Kb, kilo bases; GC%, guanine-cytosine contents. 18-21

Species Serotype Receptor Size (Kb) GC% Genes Protein Site of infection

A 12 CAR, integrin αvβ 34 46.50 16 36 Intestine B 3 DSG-2, integrin αvβ 35 51.10 17 39 Respiratory tract C 2 CAR, integrin αvβ 36 55.20 - 36 Respiratory tract, Liver

Life cycle of Adenovirus

To develop an immunocompetent animal model, the life cycle of adenovirus needs to be considered and

compared to immune responses. During the first stage, the virus binds to surface receptor on the target

cell and enters into the cell via endocytosis. Lysosomal degradation is prevented by a viral escape from

early endosome and delivery of genome into the nucleus. Once in the nucleus, the viral gene expression

is sequential, starting with the early genes E1-E4 and followed by the late genesL1-L5. Viral DNA

replicates and virions progeny assembles in the infected cell nucleus.22

6

Figure 1. Life cycle of replicative adenovirus. The cycle consists three groups of events: host-cell interactions, host-organism interactions and viral replication. Ab: antibodies; ADP: adenoviral death protein (E3); CAR: coxsackie and adenovirus receptor; CTL: cytotoxic T lymphocytes. Picture taken from Jesus et al., 200022.

Aims of this study

The aim of this study was to investigate the viral replication in mouse epithelial cells. First we analyzed

the viral genome replication and then Ad protein expression by infecting cells with HAdV-3, HAdV-11

and HAdV-12. Secondly, in order to investigate the difference between HAdV serotypes, a comparative

bioinformatics analysis was performed to identify species specific genes by comparing HAdV-2, HAdV-3

and HAdV-12. That could increase our understanding of the tropism and the viral strategies to evade

host defense systems.

7

MATERIAL AND METHODS

Bioinformatics

HAdV-2, HAdV-3 and HAdV-12 were selected for whole genome comparative bioinformatics analysis.

Complete set of proteins thought to be expressed by HAdV-2 and HAdV-12 were taken from non-

redundant database (http://www.uniprot.org/), all the sequences were reviewed i.e. all the sequences

are high quality and manually curated. For, HAdV-3, all ORFs were taken from GenBank. Type specific

genes were identified by reciprocal BLAST (The Basic Local Alignment Search Tool) searches, using

BLASTP (Protein BLAST) and TBLASTN (translated nucleotide BLAST). The final gene lists were compiled

by manual curation of BLAST search result (appendix II).

Cell lines and viruses

All cells were maintained at 37 °C in an atmosphere containing 5% CO2. Normal mouse mammary

epithelial cells (NMuMG) and human lung adenocarcinoma epithelial cells (A549) were maintained in

Dulbecco’s modified Eagle’s medium supplemented (DMEM) with 10 % fetal bovine serum (FBS). HAdV-

3, HAdV-11 and HAdV-12 crude lysate were stored in -80 °C freezer and thawed immediately before use.

Virus titre was determined using fluorescence forming units (FFU) assay.

Plasmid encoding E1A and VA RNA were provided by our lab. NMuMG cells were plated and transfected

using TurboFect (Fermentas) according to manufacturer’s instructions.

Virus infection and transfection

Ten 10 fluorescence forming units (FFU) per cells were infected in serum free medium (DMEM). After 1

hour, cells were re-fed with medium containing 2 % FBS and incubated at 37 °C in humidified air with 5%

CO2. Cells were harvested at different time points by trypsinization followed by centrifugation (4000

RPM; 4-8 OC; 10 min) and cell pellet was frozen -20 °C for further DNA, RNA and protein extraction.

Oligonucleotides

Primers for PCR experiments were designed and all primers were purchase from Invitrogen. The

oligonucleotides were dissolved in ddH2O to a concentration of 20 µM. In order to get 10 µM mix of

each primer pair, forward and reverse primer of each ORF were mixed in a ratio of 1:1. The specificity of

each primer was tested by using genomic DNA of respective adenovirus serotype (data not shown).

Cytoplasmic and Nuclear DNA extraction

The cell pellets were resuspended in 500 µl Nonidet P-40 (NP40) solution (appendix I), incubate on ice

for 10 min and centrifuged (13000 RPM; 4 °C; 10min). For cytoplasmic DNA extraction, supernatant were

collected into new tube and the same volume of phenol/chloroform was added, mixed and incubate at

room temperature (RT) for 5 min. For nuclear DNA extraction, pellet was lysed in RIPA lysis buffer was

added, mixed and incubated for 1 h at 37 °C, after which phenol/chloroform was added. After the

centrifugation at 12000 RPM; RT; 10 min, a phase separation occurred. The upper aqueous phase

(containing cytoplasmic or nuclear DNA) was collected carefully into new tube and 2x amount of 99 %

ethanol and 1/10 amount of NaCl were added. Following incubation for 1h at RT, the precipitated DNA

was recovered by centrifugation (13000 RPM; RT; 10 min).

8

The pellet was air dried at RT and resuspended in 20 µl H2O. The DNA concentration was measured using

a Nanodrop spectrophotometer. The DNA was stored at -80 °C.

Virus DNA extraction by Hirt method and PCR

Harvested cells were lysed by adding cell lysis buffer (500 µl), proteinase K (250 µl) and 10 % SDS (50 µl)

and incubated at 37 °C for 3h. 150 µl of NaCl (5 M) was added to the lysed cells and incubated at 4 °C for

2h. Following centrifugation (13000 RPM; 4 °C; 30 min) the supernatant was collected into a new tube,

to which an equal volume of phenol was added. After vortexing and centrifugation (13000 RPM; 4 °C; 10

min) the phenol extraction step was repeated once, with a phenol/chloroform mixture 50:50. Finally,

any residual phenol was extracted by an equal volume of chloroform. The aqueous phase was collected

into a new tube and 2x 88 % ethanol was added and incubated at -20 °C for overnight. After a final

centrifugation step (13000 RPM; 4 °C; 10 min), the supernatant was removed and the pellet air-dried at

RT.

For PCR: 20 ng/µl of DNA and 0.4 µl of a 10 µM primer pair were added to PCR mix (appendix I) to a

reaction volume of 20 µl. The PCR program was set to 5 min denaturation period at 95 °C followed by 30

cycles at 95 °C for 20 sec, 60 °C for 20 sec, and 72 °C for 20 sec. Extension was run for 3 min at 72 °C. PCR

products were analyzed on 1.2 % agarose gel (appendix I). 100 kb ladder was used for determination of

product sizes.

RNA isolation and RT-PCR

NMuMG and/or A549 cells infected with Ad were grown on 20 cm diameter plate, collected at indicated

time points (Figure 6). All steps were performed on ice. The cells were washed with PBS and lysed in

IsoB/NP40 (0.65 %). The cells were collected by the help of scraper and transfer into new eppendorf

tubes followed by 20 sec vortexing and incubation on ice for 5 min. After centrifugation (11500 RPM;

4 °C; 5 min) the supernatant was transferred into a new tube. 130 µl 5xRPS (appendix I) and 600 µl

phenol was added followed by vortexing and centrifugation (13000 RPM; RT; 5 min). The upper phase

was carefully collected and 600 µl phenol was added and the tube was centrifuged (13000 RPM; RT; 5

min). The upper phase was collected again into new tube and 600 µl chloroform-isoamyl alcohol 24:1

was added and centrifuged at 13000 RPM, RT, 5 min. RNA was precipitated from aqueous phase by

adding 600 µl isopropanol and 15 µl NaCl, vortex and incubated for 30 min at -20 °C. RNA was collected

by centrifugation (12000 RPM; 4 °C; 10 min). 2 µg of cytoplasmic RNA was used to synthesize cDNA using

Superscript II Reverse transcriptase (Invitrogen) according to the manufacturer instructions.

9

Protein extraction, SDS-PAGE and Western Blot

Cells pellets were lysed in 100 µl of cell lysis buffer (appendix I) and incubated for 30 min on ice. After

centrifugation (12000 RPM; 4 °C; 10 min) supernatant was collected into a new tube. After addition of

25 µl 5x loading dye (appendix I) and boiling for 5 min, the protein was stored at -20 °C. The denatured

protein samples were separated in 10 % SDS-PAGE gel (appendix). The proteins were transferred to a

PVDF membrane (Millipore). After the transfer, membrane was incubated in Odyssey blocking buffer (LI-

COR Biosciences) for 1 h, washed three times for 5 min with PBS-1 % Tween 20 (1-3 %) and probed with

monoclonal antibody directed against E1A (diluted in 1:2000 in PBS 1 % BSA) for 2 hours After the

membrane was washed 3 times for 5 min with PBS 1 % Tween 20, followed by incubation with

secondary antibody (Odyssey). The membrane was washed again with PBS 1 % Tween20 and was

scanned on the Odyssey infrared imaging system by Odyssey 2.1 software (LI-COR Biosciences).

10

RESULTS

Differential distribution of genes

Most HAdVs genomes are fairly similar and most genes/proteins are conserved. To identify most

promising gene that could be involved in replication specificity or specific immune response in HAdV, a

bioinformatics analysis was performed of the type 2 (HAdV specie C), 3 (HAdV specie B) and 12 (HAdV

specie A).

Comparison of HAdV-2, 12, and 3 using BLASTP and TBLASTN searches showed a significance sequence

divergence in E3 glycoprotein. In addition, all the 3 Ads contain type specific glycoprotein or death

protein specific for each serotype (Table 2 and appendix II). Comparisons among the three HAdVs types

revealed the presence of type specific gene. The HAdV-2 has 6 specific genes, while HAdV-3 and HAdV-

12 have 4 and 2, respectively (Table 2). The majority of identified specific genes have no sequence

similarity to known sequences and their function is therefore unknown. In total 12 HAdVs open reading

frames displayed weak hits (E-value higher than 1e-20) for domains or signatures and/or existence in

other organisms in the BLAST searches were performed at NCBI non redundant database (Figure 2,

Table 2, Appendix II). HAdV-2 and HAdV-12 both contain a specie specific isoform of early E1A gene

(appendix II). Unique genes shared between two types were compiled in Table 3.

Figure 2. Shared and non-shared gene content comparison. Venn diagram display shared and non-shared genes content of HAdV serotype 2, 3 and 12. The intersection shows the shared gene content among 2 or three genomes. BLASTP and TBLASTN searches were used to identify specific genes. 45 represent core gene content of HAdV. HAdV-2 contains 6 serotype specific genes, 4 genes specific for HAdV-3 and 2 genes for HAdV-12. HAdV-2 and HAdV-3 shared 4 genes that were non-existent in HAdV-12. One gene is shared between HAdV-12 and HAdV-2.

11

Table 2. A List of identified unique genes. Type gene identity (with link), protein names, gene name and length (amino acid) are indicated number.

Type Gene ID Protein Names Gene names Length

HAdV-2 P24935 Early E3A 11.6 kDa glycoprotein 101

HAdV-2 P03289 Uncharacterized protein F-112 112

HAdV-2 P03294 Uncharacterized protein F-121 121

HAdV-2 P03292 Uncharacterized protein C-168 168

HAdV-2 P03285 Uncharacterized protein D-172 172

HAdV-2 P03286 Uncharacterized protein E-95 95

HAdV-12 YP_002640220.1 Membrane glycoprotein E3 CR1-alpha (unknown) E3 264

HAdV-12 YP_002640221.1 Membrane glycoprotein E3 CR1-beta (unknown) E3 252

HAdV-3 YP_002213787.1 Membrane glycoprotein E3 CR1-alpha E3 146

HAdV-3 YP_002213789.1 Membrane glycoprotein E3 CR1-beta E3 179

HAdV-3 YP_002213790.1 Membrane glycoprotein E3 CR1-gamma E3 189

HAdV-3 YP_002213791.1 Membrane protein E3 CR1-delta E3 77

Table 3. Unique shared gene content between 2 serotypes. In this comparison, HAdV-2 and HAdV-3 share 4 genes while HAdV-2 and 12 share only one gene. No significant sharing was found between HAdV-12 and 3. Shared GeneID Protein Name Length Gene ID Protein Name Length

Ad2-Ad3 P68978 Early E3 18.5 kDa glycoprotein 159 P11323 Early E3 18.5 kDa glycoprotein 172

Ad2-Ad3 P0DJX2 U exon protein (UXP) 217 Q2KSJ3 U protein 53

Ad2-Ad3 P03290 Uncharacterized protein E-115 115 DQ086466.1

Ad2-Ad3 P03291 Uncharacterized protein F-215 215 Q2KSK5 Hypothetical 12.6 kDa protein 111

Ad2-Ad12 P03293 Uncharacterized protein B-137 137 X73487.1

12

Virus replication in infected NMuMG cells

To screen for mouse animal model that might be permissive to HAdV-3, 11 and 12 infection, 2 different

primary cell cultures from human and mouse was established and infected with HAdV-3, 11, 12. Earlier

work from our group showed that, in contrast to HAdV-12, HAdV-2 is able to infect mouse mammary

epithelial cells.8 In order to understand why some HAdVs lack activity in murine cells, we analyzed the

amount viral DNA and to investigate at which step the HAdVs infectious cycle was blocked.

The amount of adenovirus viral DNA (divided in cytoplasmic and nuclear DNA extract) extracted from

human (A549) and mouse (NMuMG) cell cultures 1, 2, 4, 12, 24 and 48 h postinfection were measured

by PCR using E1A region primers (Figure 3). As positive control, HAdV-3 and 11 replication were analyzed

in human A549 cells, which showed no substantial increase in the virus DNA. In contrast, Mouse cells

(NMuMG) infected from HAdV3 shows no increased in viral DNA at 4, 12 and 24 h postinfection while

NMuMG cells infected with HAdV-11 shows enter into the cytoplasm followed by nuclear entry but at 4,

12 and 24 h postinfection it revealed low amount of viral DNA.

Figure 3. HAdV-3 and 11 activity in NMuMG and A549 cells. L and M represent 100bp ladder and

uninfected control respectively. PCR products from cytoplasmic and nuclear fractions are shown at

different time after infection (Hours).

We redesigned new primers for HAdV-12, HAdV-3 and HAdV-11 E1A primers to confirm the results we

got above (Figure 3). PCR analysis was done using new E1A type specific primers (Appendix I). The PCR

gels (Figure 4) showed the results for each HAdV type. It’s not known why HAdV-3 and HAdV-11

cytoplasmic fractions showed strong bands at 48 and 72 hours after infection on PCR gel, probably

because the contamination between cytoplasmic and nuclear fractions. However, we also found two

strong bands in HAdV-12 nuclear fraction at 48 and 72 hours after infection. This is despite that previous

results showed that, HAdV-12 neither infects nor replicate in NMuMG cells8.

13

Figure 4. The course of HAdV-3, HAdV-11, HAdV-12 infection in NMuMG cells by detecting E1A gene in cytoplasmic and nuclear extracts A) NMuMG cells infected with HAdV-3, B) NMuMG cells infected with HAdV-11, C) NMuMG cells infected with HAdV-12. E1A specie specific primers were used in each experiment. M represents uninfected mock.

In order to check expression of E1A gene in NMuMG cells, whether it increased permissivity of the HAdV

infection in NMuMG cells or whether E1A helps HAdV-11 infection or not transfection complementation

analysis was done. NMuMG cells were transfected with plasmids encoding (type 2) E1A or (type 2) VA

RNA and followed by infection with HAdV-11 at indicated time points. PCR using (type 2) E1A primer

revealed strong bands on PCR gels, when HadV-11 transfected with E1A or VA RNA in NMuMG cells

(Figure 5), there was a marked increase in the amount of viral DNA.

We then examined HAdV early protein expression using E1A monoclonal antibody. Western blot showed

that there was almost absence of early protein expression in all three HAdV (data not shown).

Quantitative PCR (Figure 6) produced very low CT value in all cases. These results suggest that E1A gene

was transcribed but we could not confirm E1A translation in NMuMG cells due to high concentration of

cDNA in our RT PCR experiment.

Figure 5. PCR analysis of the E1A gene in NMuMG cells transfected with plasmid expressing the E1A or VA RNA; cells were infected with HAdV-11 at indicated time points.

14

Figure 6. RT-PCR analysis of the expression of E1A in NMuMG cells transfected with plasmid expressing E1A or VA RNA; cells were infected with HAdV-11. 10FFU cells were transfected with E1A or VA RNA followed by infection with HAdV-11. Total cellular RNA was extracted from infected cells at indicated time point. Two microgram was reverse transcribed and 50 ng of cDNA was then subject to quantitative PCR using E1A (type 2) region primers. Uninfected mocked was used as a control.

13,00

13,50

14,00

14,50

15,00

15,50

36 hours 48 hours 60 hours

C(t) Mean

E1A expression of HAdV-11

E1A+VA RNA

HAdV-11

E1A

VA RNA

15

DISCUSSION The genome of different HAdVs are relatively similar in term of core gene content, but tend to differ

with respect to genes responsible for antigenicity. In this study, comparative genomic analysis of HAdV-

2, HAdV-3 and HAdV-12 revealed that the membrane glycoprotein or Ad death proteins and

hypothetical proteins were quite divergent. These results seem promising and candidate virus species-

specific genes can be characterized in future and their impact on virus proliferation and host cell

responses might improve the understanding of Ad host cell interactions.

The Ad genome contains a small fraction of hypothetical genes that code for protein of unknown

function. The lack of significant hits to other virus genomes likely shows strong adaptation of virus to its

host environment. Since a large number of adenovirus sequences are available and database

continuously growing, several adenovirus proteins will likely to assign orthologs and annotate, but

experimental efforts will be required to determine the function of these proteins.

Comparative analysis of HAdVs shows that E3 glycoproteins were quite divergent from each other. Low

amino acid sequence identity were found in the E3 glycoprotein of human adenovirus that may suggest

distinctive roles for these proteins.23 Moreover structural homology searches of E3 glycoprotein did not

identify any structure that align well with HAdV-2 E3 glycoprotein. This suggest that E3 glycoprotein may

have a unique structure.24

It is true that genomic data cannot alone resolve the question of host cell specificity and virus

proliferation, but genomic sequence data provide an evolutionary insight into how virus genomes have

been changed over the course of evolution. In addition, the identification of specie specific novel genes

and gene variants will provide candidate for future functional studies.

Immunocompetent animal model are very important for the development and assessment of biological

therapies. Specially, the efficacy of oncolytic viruses is directly affected by the host immune response. So

far, there is no model organism available to study replication competent oncolytic adenovirus and

immune response of the host. Our lab recently identified NMuMG, a non-transformed epithelial

mammary mouse cell line as permissive for HAdV-2 replication but not to HAdV-12.8 In addition,

NMuMG cells support replication of HAdV-2 nearly as efficiently as A549 cells. The replication of HAdV-

11 and HAdV-3 was compared in A549 cells (Figure 3). No viral replication was detected in A549 cells. It

could be due to short post infection time. In this report, we tested HAdV-3, HAdV-11 and HAdV-12

replication and infection specificity in NMuMG cells. We found that, HAdV-3 and HAdV-11 were able to

enter NMuMG cells, but that no replication of DNA was found. However, when we use serotype specific

E1A primer (appendix I), HAdV-3 and HAdV-11 cytoplasmic fraction show strong band on PCR gel after

48 h and 72 h of infection (Figure 4). It might due to contamination between cytoplasmic and nuclear

fraction, though, we measured the amount of cells and virus used for each experiment, before every

infection. But still it is difficult to quantify the exact amount of infected and non-infected cells.

E1A complementation efficiency was tested in NMuMG cells transfected with either the E1A encoding

plasmid or the VA RNA encoding plasmid, or both plasmids together. Figure 5 (left gel) showed strong

bands for E1A and VA RNA suggesting that complementation assay was efficient.

16

We ran western blots to detect E1A protein, but we found uniform high background across the

membrane, it could be due to high concentration of antibody. We also ran a RT-PCR but CT value was

very low, this could be overcome by dilution cDNA (Figure 6).

In conclusion, there is genetic variation between adenovirus species and small number of type specific

genes have been identified. Future experiment could include characterization and structural homology

modeling of unique genes. Moreover, HAdV-3 and HAdV-11 can enter into the nucleus of NMuMG cells.

17

ACKNOWLEDGMENTS I would like to thanks to my supervisor Prof. Catharina Svensson for guideline, support, encouragement,

and precious time. Many thanks to Troy, Daniel and everyone in adenovirus group member for help,

support and friendliness.

18

REFERENCES 1. Cerullo V, Diaconu I, Romano V, Hirvinen M, Ugolini M, Escutenaire S, Holm SL, Kipar A,

Kanerva A, Hemminki A: An oncolytic adenovirus enhanced for toll-like receptor 9

stimulation increases antitumor immune responses and tumor clearance. Mol Ther 2012,

20(11):2076-2086.

2. Koski A, Kangasniemi L, Escutenaire S, Pesonen S, Cerullo V, Diaconu I, Nokisalmi P, Raki M,

Rajecki M, Guse K et al: Treatment of cancer patients with a serotype 5/3 chimeric oncolytic

adenovirus expressing GMCSF. Mol Ther 2010, 18(10):1874-1884.

3. Pesonen S, Nokisalmi P, Escutenaire S, Sarkioja M, Raki M, Cerullo V, Kangasniemi L,

Laasonen L, Ribacka C, Guse K et al: Prolonged systemic circulation of chimeric oncolytic

adenovirus Ad5/3-Cox2L-D24 in patients with metastatic and refractory solid tumors. Gene

Ther 2010, 17(7):892-904.

4. Nokisalmi P, Pesonen S, Escutenaire S, Sarkioja M, Raki M, Cerullo V, Laasonen L, Alemany R,

Rojas J, Cascallo M et al: Oncolytic adenovirus ICOVIR-7 in patients with advanced and

refractory solid tumors. Clin Cancer Res 2010, 16(11):3035-3043.

5. Cerullo V, Pesonen S, Diaconu I, Escutenaire S, Arstila PT, Ugolini M, Nokisalmi P, Raki M,

Laasonen L, Sarkioja M et al: Oncolytic adenovirus coding for granulocyte macrophage

colony-stimulating factor induces antitumoral immunity in cancer patients. Cancer Res 2010,

70(11):4297-4309.

6. Ginn SL, Alexander IE, Edelstein ML, Abedi MR, Wixon J: Gene therapy clinical trials worldwide to 2012 - an update. J Gene Med 2013, 15(2):65-77.

7. Choi JW, Kang E, Kwon OJ, Yun TJ, Park HK, Kim PH, Kim SW, Kim JH, Yun CO: Local sustained delivery of oncolytic adenovirus with injectable alginate gel for cancer virotherapy. Gene Ther 2013.

8. Wu C, Oberg D, Rashid A, Gupta R, Mignardi M, Johansson S, Akusjarvi G, Svensson C: A

mouse mammary epithelial cell line permissive for highly efficient human adenovirus

growth. Virology 2013, 435(2):363-371.

9. Young AM, Archibald KM, Tookman LA, Pool A, Dudek K, Jones C, Williams SL, Pirlo KJ, Willis

AE, Lockley M et al: Failure of translation of human adenovirus mRNA in murine cancer cells

can be partially overcome by L4-100K expression in vitro and in vivo. Mol Ther 2012,

20(9):1676-1688.

10. Morral N, O'Neal W, Rice K, Leland M, Kaplan J, Piedra PA, Zhou H, Parks RJ, Velji R, Aguilar-

Cordova E et al: Administration of helper-dependent adenoviral vectors and sequential

delivery of different vector serotype for long-term liver-directed gene transfer in baboons.

Proc Natl Acad Sci U S A 1999, 96(22):12816-12821.

11. Giberson AN, Davidson AR, Parks RJ: Chromatin structure of adenovirus DNA throughout

infection. Nucleic Acids Res 2012, 40(6):2369-2376.

12. Gurlevik E, Schache P, Goez A, Kloos A, Woller N, Armbrecht N, Manns MP, Kubicka S,

Kuhnel F: Meganuclease-mediated Virus Self-cleavage Facilitates Tumor-specific Virus

Replication. Mol Ther 2013.

13. Alemany R, Balague C, Curiel DT: Replicative adenoviruses for cancer therapy. Nat Biotechnol 2000, 18(7):723-727.

19

14. Miura Y, Yamasaki S, Davydova J, Brown E, Aoki K, Vickers S, Yamamoto M: Infectivity-selective oncolytic adenovirus developed by high-throughput screening of adenovirus-formatted library. Mol Ther 2013, 21(1):139-148.

15. Thomas MA, Spencer JF, La Regina MC, Dhar D, Tollefson AE, Toth K, Wold WSM: Syrian hamster as a permissive immunocompetent animal model for the study of oncolytic adenovirus vectors. Cancer Research 2006, 66(3):1270-1276.

16. Ganly I, Mautner V, Balmain A: Productive replication of human adenoviruses in mouse epidermal cells. J Virol 2000, 74(6):2895-2899.

17. Wang H, Li ZY, Liu Y, Persson J, Beyer I, Moller T, Koyuncu D, Drescher MR, Strauss R, Zhang XB et al: Desmoglein 2 is a receptor for adenovirus serotypes 3, 7, 11 and 14. Nat Med 2011, 17(1):96-104.

18. Sprengel J, Schmitz B, Heuss-Neitzel D, Zock C, Doerfler W: Nucleotide sequence of human adenovirus type 12 DNA: comparative functional analysis. J Virol 1994, 68(1):379-389.

19. Sirena D, Ruzsics Z, Schaffner W, Greber UF, Hemmi S: The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3. Virology 2005, 343(2):283-298.

20. Roberts RJ, Akusjarvi G, Alestrom P, Gelinas RE, Gingeras TR, Sciaky D, Pettersson U: A Consensus Sequence for the Adenovirus-2 Genome. In: Adenovirus DNA. Edited by Doerfler W, vol. 8: Springer US; 1986: 1-51.

21. Alestrom P, Akusjarvi G, Pettersson M, Pettersson U: DNA sequence analysis of the region encoding the terminal protein and the hypothetical N-gene product of adenovirus type 2. J Biol Chem 1982, 257(22):13492-13498.

22. Gomez-Navarro J, Curiel DT: Conditionally replicative adenoviral vectors for cancer gene therapy. Lancet Oncol 2000, 1:148-158.

23. Arnold J, Janoska M, Kajon AE, Metzgar D, Hudson NR, Torres S, Harrach B, Seto D, Chodosh J, Jones MS: Genomic characterization of human adenovirus 36, a putative obesity agent. Virus Res 2010, 149(2):152-161.

24. Li L, Muzahim Y, Bouvier M: Crystal structure of adenovirus E3-19K bound to HLA-A2 reveals mechanism for immunomodulation. Nat Struct Mol Biol 2012, 19(11):1176-1181.

20

APPENDIX I. List of PCR primers, master mix, reagents, stock volume and

concentration

Primers used for PCR experiments. Direction 5’ to 3’.

HAdV-2: E1A-F atgagacatattatctgccac HAdV-2: E1A-R ttacagactcgggaaaaatct HAdV-12: E1A-F atgagaactgaaatgactccc HAdV-12: E1A-R cattcaccgcctgttcattat HAdV-3: E1A-F atgagacacctgcgcttcctg HAdV-3: E1A-R ttcacagcttcctcattggga HAdV-11: E1A-F atgagagatttgcgatttctg HAdV-11: E1A-R agtatcaaaagtgtccaaagg

Cell lysis buffer

Reagents Final concentration

NaCl 100 mM Tris-HCl (pH 8.0) 10 mM EDTA (pH 8.0) 25 mM SDS 0.5 % Proteinase K 250 µg/ml

RIPA buffer

Reagents Final concentration

NaCl 150 mM Tris-HCl (pH 7.4) 50 mM deoxycholate 1 % Tween-20 1 % Protease inhibitor (Roche) 1 (Tablet)

PCR Mix preparation (20 µl)

Reagents Stocks Volume

H2O 14 µl 5xHF 4 µl 10mMdNTP 0.4 µl Primer A 0.2 µl Primer B 0.2 µl Template 1 µl or 20ng/ µl DMSO 0.6 µl Polymerase 0.2 µl

2X loading dye preparation (10 ml)

21

Reagents Stocks Volume

Tris-HCl pH6.8 1ml 10 % SDS 4 ml Glycerol 3.75 ml BPB 250 µl DDT 1M 1 ml

10% and 15% separating gel Preparation (10 ml)

Reagents Stocks volume (10%) Stocks volume (15%)

H2O 4 ml 3.3 ml 30% Acrylamide solution (Bio-Rad) 3.3 ml 4ml 1.5 M Tris (pH 8.8) 2.5 ml 2.5 ml 10% SDS 100 µl 100 µl 10% Ammonium persulphate 100 µl 100 µl TEMED 4 µl 4 µl

5% Stacking gel Preparation (5 ml)

Reagents Stocks volume

H2O 3.4 ml 30% Acrylamide solution (Bio-Rad) 830 µl 1.5 M Tris (PH 6.8) 630 µl 10% SDS 50 µl 10% Ammonium persulphate 50 µl TEMED 5 µl

1.2% agarose gel Preparation (100 ml)

Reagents Stocks volume

Agarose 1.2 g 0.5X TBE buffer 100 ml Gel red 5 µl

5X TBE buffer Preparation (1000 ml)

Reagents Stocks volume

H2O 900 ml (raise volume to 1 lL) Tris base 54 g Boric acid 27.5 g EDTA (pH 8.8) 20 ml

22

APPENDIX II. The final reciprocal BLAST search results list compiled by manual curation Table 4. HAdV-2 searched against HAdV-12 and HAdV-3. Ad2 Gene ID

Protein Names Gene names Leng

th Ad12 Gene ID

Protein names Gene names

Length

Identity

Score E-value Ad3 Gene ID

Protein Names Gene names Lengt

h Identity

Score E-value

P03252 Protease L3 204 P09569 Adenain 206 75% 857 1E-115 P10381 Adenain 209 80% 872 1E-118

P03264 Early E2A DNA-binding protein DBP 529 P04498 Early E2A DNA-binding protein DBP

484 50% 1,594 1E-156 Q2Y0H2 DNA binding protein (E2A DNA binding protein DBP) E2A

517 54% 1,777 1E-175

P03263 I-leader protein 145 P36704 Probable DNA-binding protein

205 43% 290 2E-30 Q2Y0I5 Probable DNA binding agnoprotein

198 48% 331 9E-37

P03261 DNA polymerase POL 1056 P06538 DNA polymerase POL 1,061 77% 5,425 0 Q2Y0I9 DNA polymerase E2B 1,122 78% 5,540 0

P03254 Early E1A 32 kDa protein 289 P03259 Early E1A 29.5 kDa protein 266 40% 470 1E-54 Q8JSK4 29.1 kDa protein E1A 261 36% 458 5E-53

P03254-2

Isoform early E1A 26 kDa protein of Early E1A 32 kDa protein E1A

243 P03259-2 Isoform Early E1A 26 kDa protein of Early E1A 29.5 kDa protein

235 37% 299 3E-30 Q8JSK3 25 kDa protein E1A 230 36% 323 8E-34

P03254-3

Isoform early E1A 6 kDa protein of Early E1A 32 kDa protein E1A

55 No hits found, Specie specific gene No hits found

P03244 E1B protein, large T-antigen E1B 495 P04491 E1B protein, large T-antigen 482 48% 1,518 1E-148 Q2Y0J2 E1B 55-kDa E1B 492 53% 1,817 1E-180

P03244-2

Isoform E1B-155R of E1B protein, large T-antigen (Isoform E1B-18K of E1B protein, large T-antigen) E1B

155 P04491 E1B protein, large T-antigen (E1B 55 kDa protein) (E1B-55K)

482 55% 247 3E-22 Q2Y0J2 E1B 55-kDa (Large T antigen) E1B

492 65% 307 1E-30

P03244-3

Isoform E1B-92R of E1B protein, large T-antigen (Isoform E1B-16K of E1B protein, large T-antigen) E1B

92 No hits found No hits found

P03244-4

Isoform E1B-82R of E1B protein, large T-antigen (Isoform E1B-15K of E1B protein, large T-antigen) E1B

82 No hits found No hits found

P03247 E1B protein, small T-antigen (E1B 19 kDa protein) (E1B-19K) (E1B-175R) E1B

175 P04492 E1B protein, small T-antigen (E1B 19 kDa protein) (E1B-19K)

163 47% 376 1E-43 Q2Y0J3 19 kDa small T antigen E1B 178 50% 408 3E-48

P15133 Early E3B 10.4 kDa protein 91 P36705 Early E3B 10.4 kDa protein 91 44% 210 1E-20 P11318 Early E3B 10.4 kDa protein 91 51% 257 9E-28

P24935 Early E3A 11.6 kDa glycoprotein 101 No hits found No hits found

P27311 Early E3A 12.5 kDa protein 107 P36706 Early E3A 12.1 kDa protein 105 61% 360 5E-43 P11319 Probable early E3 12.1 kDa glycoprotein

106 55% 318 1E-36

P68976 Early E3B 14 kDa protein 128 Q65288 E3B 14.7 KD protein 128 48% 293 4E-32 P11315 Early E3 15.3 kDa protein 136 49% 324 9E-37

P03250 Early E3B 14.5 kDa protein 130 P36707 Early E3B 12.7 kDa protein 110 33% 158 6E-12 P11316 Early E3B 14.5 kDa protein 134 37% 232 8E-23

P68978 Early E3 18.5 kDa glycoprotein (E3-19K) (E3gp 19 kDa) (E19) (GP19K)

159 No hits found P11323 Early E3 18.5 kDa glycoprotein 172 32% 201 2.E-17

P03241 Probable early E4 11 kDa protein 116 P36708 Probable early E4 11 kDa protein

116 45% 275 9E-30 Q2Y0F3 11 kDa protein E4 117 49% 253 2.E-26

P03240 Probable early E4 13 kDa protein 114 P36709 Probable early E4 13 kDa protein

120 40% 247 2E-25 Q2Y0F5 13.6 kDa protein E4 122 45% 275 1E-29

P03238 Probable early E4 17 kDa protein [Cleaved into: Early E4 10 kDa protein]

150 P36710 Early E4 34 kDa protein 291 46% 98 3E-02 Q2Y0F7 E4 ORF6/7 E4 141 48% 336 4E-38

P03242 Early 31 kDa protein 283 S10861 hypothetical protein (96%) 127 52% 115 5E-36 Q2Y0F1 13.9 kDa protein E4 125 46% 258 6E-25

P0DJX0 Early 4 ORF2 protein 130 S10863 hypothetical protein 131 48% 135 1E-43 Q2Y0F2 E4 ORF2 E4 144 32% 177 2E-14

P03239 Early E4 34 kDa protein 294 P36710 Early E4 34 kDa protein 291 55% 873 1E-115 Q2Y0F6 33.2 kDa protein E4 299 59% 958 1E-128

P03275 Fiber protein L5 582 P36711 Fiber protein (pIV) PIV 587 34% 1,004 1E-89 EF176023.1

fiber portein 286 30% 295 5E-22

P03279 Pre-capsid vertex protein L1 585 P36712 Peripentonal hexon- 582 73% 2,533 0 Q2Y0I0 L1 protein pIIIa L1 588 75% 2,712 0

23

associated protein (Protein IIIa) PIIIA

P03280 Pre-hexon-linking protein L4 227 P36713 Hexon-associated protein (Protein VIII) (pVIII) PVIII

233 75% 931 1E-126 P11324 Hexon-associated protein PVIII 135 78% 549 2E-69

P03282 Hexon-interlacing protein IX 140 P03284 Hexon-associated protein (Protein IX) (pIX) PIX

144 56% 365 1E-42 P68970 Hexon-associated protein PIX 138 51% 328 4E-37

P03277 Hexon protein (CP-H) (Protein II) L3 968 P19900 Hexon protein (Late protein 2) PII

919 76% 5294 0 P36849 Hexon protein (Late protein 2) PII

944 76% 5294 0

P24932 Shutoff protein (100 kDa protein) (p100K) (100K-chaperone protein) (L4-100K) (Shutoff protein 100K) L4

805 P36714 Late 100 kDa protein 782 66% 3118 0 Q2Y0H1 100 kDa hexon-assembly associated protein L4

828 64% 3167 0

P14269 Pre-core protein X L2 80 P35986 Late L2 mu core protein (11 kDa core protein) (Protein X) (pX) (pMu) PX

72 64% 280 3E-34 Q2Y0H6 L2 protein pX L2 75 69% 280 3E-34

P0DJX1 Packaging protein 2 (Packaging protein 22K) (L4-22K) L4

195 Q2Y0G9 22 kDa protein (L4 22-kDa protein) L4

199 50% 427 2E-50 X73487.1 hypothetical protein 55% 121 1E-33

P03262 Packaging protein 3 (L1-52/55 kDa protein) (Packaging protein 52K) L1

415 P36715 Late L1 52 kDa protein 373 75% 1,687 1E-168 Q2Y0I1 L1 52/55-kDa protein L1 385 70% 1,723 1E-172

P03276 Penton protein (Penton base protein) (Virion component III) (pIII) PIII

571 P36716 Penton protein (Penton base protein) (Virion component III) (pIII) PIII

497 68% 1,415 1E-135 Q2Y0H9 L2 protein III (Penton base) L2 544 70% 2,364 0

P03274 Pre-protein VI (pVI) [Cleaved into: Endosome lysis protein; Protease cofactor (pVI-C)] L3

250 P35988

Minor capsid protein 6 (Minor capsid protein VI) [Cleaved into: Protease cofactor] PVI

265 64% 814 1E-107 Q2Y0H5 L3 protein pVI (Protein VI) L3 250 63% 823 1E-109

P03272 Packaging protein 1 (Packaging protein IVa2) IVa2

449 P12540 Maturation protein (Protein IVa2) PIVA2

452 76% 2,270 0 Q2Y0J0 Maturation protein IVa2 IVa2 448 82% 2,411 0

P03269 DNA terminal protein (Bellett protein) (pTP protein) PTP

671 P12541 DNA terminal protein (Bellett protein) (pTP protein) PTP

606 77% 2,488 0 Q2Y0I4 E2B pTP E2B 640 80% 2,749 0

P24939 Splicing factor (Splicing factor 33K) (L4-33K) L4

228 X73487.1 promoter region EII (query cover44%)

87% 155 2E-35 Q2Y0H0 L4 33-kDa protein L4 274 46% 511 1E-61

P68950

Pre-histone-like nucleoprotein (Pre-core protein VII) (pVII) [Cleaved into: Histone-like nucleoprotein (NP) (Core protein VII)] L2

198 X73487.1 (query cover57%) 92% 174 3E-35 Q2Y0H8 L2 protein pVII L2 192 69% 656 3E-85

P03267 Core-capsid bridging protein L2 369 P36717 Minor core protein (Protein V) (pV) PV

347 57% 1,203 1E-116 Q2Y0H7 L2 protein pV (Protein V) L2 349 61% 1058 1E-141

P0DJX2 U exon protein (UXP) 217 No hits found Q2KSJ3 U protein U 53 60% 174 5E-14

P03289 Uncharacterized protein F-112 112 No hits found specie specific gene

P03290 Uncharacterized protein E-115 115 No hits found in Ad12 DQ086466.1

(query cover 78%) 41% 53.9 2E-11

P03287 Uncharacterized 11.6 kDa early protein 106 X73487.1 (query cover100%) 55% 144 4E-28 Q2Y0I7 Putative uncharacterized protein

106 72% 357 1E-42

P03294 Uncharacterized protein F-121 121 No hits found specie specific gene

P03293 Uncharacterized protein B-137 137 X73487.1 (query cover77%) 60% 92 3E-11 no hits found

P03292 Uncharacterized protein C-168 168 No hits found specie specific gene

P03285 Uncharacterized protein D-172 172 No hits found specie specific gene

P03291 Uncharacterized protein F-215 215 No hits found in Ad12 or Specie A, hits in specie C, B, D, E Q2KSK5 Hypothetical 12.6 kDa protein E2B

111 40% 113 4E-04

P03286 Uncharacterized protein E-95 95 No hits found specie specific gene

24

Table 5. The final reciprocal BLAST search results list compiled by manual curation. HAdV-12 searched against HAdV-2 and HAdV-3. Ad 12 Gene ID

Protein Names Gene names Leng

th Ad2 Gene ID

Protein names Gene names Leng

th Ident

ity Score E-value

Ad3 Gene ID

Protein Names Gene names

Length Ident

ity Score E-value

P06538 DNA polymerase (EC 2.7.7.7) POL 1,061 P03261 DNA polymerase (EC 2.7.7.7) POL 1,056 77% 4,472 0 Q2Y0I9 DNA polymerase E2B 1,122 75% 4,354 0

P36712 Peripentonal hexon-associated protein (Protein IIIa) PIIIA

582 P03279

Pre-capsid vertex protein (Capsid vertex-specific component IIIa) (CVSC) (Protein IIIa) (pIIIa) [Cleaved into: Capsid vertex protein] L1

585 73% 2,122 0 Q2KSK0 Protein IIIa L1 588 73% 2,169 0

P19900 Hexon protein (Late protein 2) PII 919 P03277 Hexon protein (CP-H) (Protein II) L3

968 76% 3,923 0 P36849 Hexon protein (Late protein 2) PII

944 78% 3,922 0

P36714 Late 100 kDa protein 782 P24932

Shutoff protein (100 kDa protein) (p100K) (100K-chaperone protein) (L4-100K) (Shutoff protein 100K) L4

805 65% 2,563 0 Q2KSI3 100 kDa hexon-assembly associated protein L4

824 64% 2,609 0

P36715 Late L1 52 kDa protein 373 P03262 Packaging protein 3 (L1-52/55 kDa protein) (Packaging protein 52K) L1

415 70% 1,401 0 Q2KSK1 55 kDa protein L1 385 73% 1,412 0

P36716 Penton protein (Penton base protein) (Virion component III) (pIII) PIII

497 P03276 Penton protein (CP-P) (Penton base protein) (Protein III) L2

571 69% 1,971 0 Q2Y0H9 L2 protein III (Penton base) L2 544 73% 2,046 0

P12540 Maturation protein (Protein IVa2) PIVA2

452 P03272 Packaging protein 1 (Packaging protein IVa2) IVa2

449 77% 1,869 0 Q2Y0J0 Maturation protein IVa2 IVa2 448 78% 1,875 0

P12541 DNA terminal protein (Bellett protein) (pTP protein) PTP

606 P03269 DNA terminal protein (Bellett protein) (pTP protein) PTP

653 77% 2,488 0 Q2Y0I4 E2B pTP E2B 640 77% 2,466 0

P04498 Early E2A DNA-binding protein DBP 484 P03264 Early E2A DNA-binding protein DBP

529 50% 1,328 1E-177 Q2Y0H2 DNA binding protein E2A 517 50% 1,312 1.E-175

P04491 E1B protein, large T-antigen (E1B 55 kDa protein) (E1B-55K)

482 P03244 E1B protein, large T-antigen E1B 495 48% 1,224 1E-162 Q2Y0J2 E1B 55-kDa (Large T antigen) E1B

492 47% 1,198 1.E-158

P36717 Minor core protein (Protein V) (pV) PV 347 P03267 Core-capsid bridging protein (Core protein V) L2

369 57% 998 1E-132 Q2Y0H7 L2 protein pV L2 349 59% 975 1E-129

P36713 Hexon-associated protein (Protein VIII) (pVIII) PVIII

233 P03280

Pre-hexon-linking protein (Pre-protein VIII) (pVIII) [Cleaved into: Hexon-linking protein-N (12.1 kDa protein VIII) (Protein VIII-N); Hexon-linking protein-C (7.6 kDa protein VIII) (Protein VIII-C)] L4

227 75% 931 1E-126 P11324 Hexon-associated protein (Protein VIII) (pVIII) PVIII

135 74% 523 2E-65

P36711 Fiber protein (pIV) PIV 587 P03275 Fiber protein (SPIKE) (Protein IV) L5

582 35% 932 1E-116 P04501 Fiber protein (pIV) PIV 319 37% 190 2E-13

P09569 Adenain (EC 3.4.22.39) (Endoprotease) (Late L3 23 kDa protein)

206 P03252

Protease (EC 3.4.22.39) (Adenain) (Adenovirus protease) (AVP) (Adenovirus proteinase) (Endoprotease) L3

204 75% 857 1E-115 P10381 Adenain (EC 3.4.22.39) (Endoprotease) (Late L3 23 kDa protein)

209 80% 871 1E-117

P36710 Early E4 34 kDa protein 291 P03239 Early E4 34 kDa protein 294 55% 873 1E-115 Q2KRZ1 34 kDa protein E4 294 55% 873 1E-115

P35988 Minor capsid protein 6 (Minor capsid protein VI) [Cleaved into: Protease cofactor] PVI

265 P03274 Pre-protein VI (pVI) [Cleaved into: Endosome lysis protein; Protease cofactor (pVI-C)] L3

250 64% 814 1E-107 Q2Y0H5 L3 protein pVI L3 250 64% 818 1E-108

YP_002640218.1

core protein precursor pVII L2 188 P68950

Pre-histone-like nucleoprotein (Pre-core protein VII) (pVII) [Cleaved into: Histone-like nucleoprotein (NP) (Core protein VII)] L2

198 68% 613 8E-79 Q2KSJ8 Protein VII L2 192 74% 670 1E-87

25

P03259 Early E1A 29.5 kDa protein 266 P03254 Early E1A 32 kDa protein 289 40% 470 9E-55 Q8JSK4 29.1 kDa protein E1A 261 42% 478 3.E-56

NP_597783.2

protein 33K (RNA splicing) L4 205 P24939 Splicing factor (Splicing factor 33K) (L4-33K) L4

228 48% 423 2E-49 Q2KSI2 33 kDa protein L4 230 49% 416 3E-48

P04492 E1B protein, small T-antigen 163 P03247 E1B protein, small T-antigen (E1B 19 kDa protein) (E1B-19K) (E1B-175R) E1B

175 47% 376 1E-43 Q2Y0J3 19 kDa small T antigen (E1B 21-kDa) E1B

178 41% 352 6.E-40

P36706 Early E3A 12.1 kDa protein 105 P27311 Early E3A 12.5 kDa protein 107 61% 360 5E-43 P11319 Probable early E3 12.1 kDa glycoprotein

106 67% 395 2E-48

P03284 Hexon-associated protein (Protein IX) (pIX) PIX

144 P03282 Hexon-interlacing protein (Protein IX) IX

140 56% 365 1E-42 P68970 Hexon-associated protein (Protein IX) (pIX) PIX

138 58% 352 1E-40

YP_002640223.1

control protein E4orf2 (unknown) E4 131 P03242-2 Isoform early 14 kDa protein-1 of Early 31 kDa protein

136 48% 344 9E-40 Q2KSI6 14.3 kDa protein E4 129 31% 154 4E-11

P03259-3 Isoform Early E1A 22 kDa protein of Early E1A 29.5 kDa protein

222 P03254 Early E1A 32 kDa protein 289 42% 364 2E-39 Q8JSK4 29.1 kDa protein (E1A 13S protein) (E1A 13s 28 kDa protein) E1A

261 44% 380 3.E-42

P35986 Late L2 mu core protein (11 kDa core protein) (Protein X) (pX) (pMu) PX

72 P14269 Pre-core protein X (pX) (11 kDa core protein) (Protein mu) (pMu) [Cleaved into: Core protein X] L2

80 64% 280 3E-34 Q2Y0H6 L2 protein pX L2 75 63% 255 3E-30

YP_002640224.1

control protein E4orf1 (unknown, transformation) E4

127 P03242-3 Isoform early 14 kDa protein-2 of Early 31 kDa protein

128 53% 299 4E-33 Q2Y0F1 13.9 kDa protein (E4 ORF1) E4 125 50% 319 4E-36

Q65288 E3B 14.7 KD protein; 128 P68976 Early E3B 14 kDa protein 128 48% 293 4E-32 P11315 Early E3 15.3 kDa protein 136 56% 354 2E-41

P03259-2 Isoform Early E1A 26 kDa protein of Early E1A 29.5 kDa protein

235 P03254 Early E1A 32 kDa protein 289 34% 310 2E-31 Q8JSK3 25 kDa protein (E1A 12S protein) (E1A 12s 25 kDa protein) E1A

230 39% 363 7.E-40

P36704 Probable DNA-binding protein (Agnoprotein)

205 P03263 I-leader protein 145 43% 290 2E-30 Q2Y0I5 Probable DNA binding agnoprotein

198 39% 288 2E-29

P36708 Probable early E4 11 kDa protein 116 P03241 Probable early E4 11 kDa protein 116 45% 275 9E-30 Q2Y0F3 11 kDa protein E4 117 61% 378 2E-45

P36709 Probable early E4 13 kDa protein 120 P03240 Probable early E4 13 kDa protein 114 40% 247 2E-25 Q2Y0F5 13.6 kDa protein E4 122 37% 221 2E-21

NP_597784.2

control protein E4orf6/7 (gene regulation, cell cycle regulation) E4

125 P03238 Probable early E4 17 kDa protein [Cleaved into: Early E4 10 kDa protein]

153 41% 248 4E-25 Q2Y0F7 E4 ORF6/7 E4 141 42% 239 7E-24

P36705 Early E3B 10.4 kDa protein 91 P15133 Early E3B 10.4 kDa protein 91 44% 210 1E-20 P11318 Early E3B 10.4 kDa protein 91 52% 218 8E-22

P36707 Early E3B 12.7 kDa protein 110 P03250 Early E3B 14.5 kDa protein 130 33% 158 5E-12 P11316 Early E3B 14.5 kDa protein 134 29% 132 4E-08

YP_002640222.1

protein U (unknown) U 52 Q2KSJ3 U protein U 53 43% 131 1E-09 ref|AP_000189.1|

U exon 54 46% 50 2E-12

YP_002640219.1

encapsidation protein 22K (DNA encapsidation, capsid morphogenesis, transcriptional control) L4

182 P24939 Splicing factor (Splicing factor 33K) (L4-33K) L4

228 41% 133 6E-07 Q2Y0G9 22 kDa protein (L4 22-kDa protein) L4

199 43% 328 9E-36

P03259-4 Isoform Early E1A 6 kDa protein of Early E1A 29.5 kDa protein

52 No hits found, specie specific gene No hits found, specie specific gene

YP_002640220.1

membrane glycoprotein E3 CR1-alpha (unknown) E3

264 No hits found, specie specific gene No hits found, specie specific gene

YP_002640221.1

membrane glycoprotein E3 CR1-beta (unknown) E3

252 No hits found, specie specific gene No hits found, specie specific gene

26

Table 6. The final reciprocal BLAST search results list compiled by manual curation. HAdV-3 searched against HAdV-12 and HAdV-2

Ad3 Gene ID Protein Names Gene names

Length

Ad12 Gene ID

Protein names Gene names Leng

th Identity

Score E-

value

Ad2 Gene ID

Protein Names Gene names Leng

th Ident

ity Score

E-value

YP_002213830.1 encapsidation protein IVa2 IVa2

448 P12540 Packaging protein 1 (Packaging protein IVa2) IVa2

452 78% 1875 0 P03272

Packaging protein 1 (Packaging protein IVa2) IVa2

449 82% 1,991 0

YP_002213831.1 DNA polymerase E2B 1193 P06538 DNA polymerase (EC 2.7.7.7) POL 1,061 75% 4354 0 P03261

DNA polymerase (Pol) (EC 2.7.7.7) 1,198 74% 4,896 0

YP_002213832.1 terminal protein precursor pTP E2B

658 P12541 DNA terminal protein (Bellett protein) (pTP protein) PTP

606 77% 2466 0 P03269

Preterminal protein (pTP) (Bellett protein) (Precursor terminal protein) [Cleaved into: Intermediate terminal protein (iTP); Terminal protein (TP)] PTP

671 80% 2,749 0

YP_002213772.1 encapsidation protein 52K L1

385 P36715 Packaging protein 3 (L1-52/55 kDa protein) (Packaging protein 52K) L1

373 73% 1409 0 P03262

Packaging protein 3 (L1-52/55 kDa protein) (Packaging protein 52K) L1

415 70% 1,433 0

YP_002213773.1 capsid protein precursor pIIIa L1

588 P36712

Pre-capsid vertex protein (Capsid vertex-specific component IIIa) (CVSC) (Protein IIIa) (pIIIa) [Cleaved into: Capsid vertex protein] L1

582 73% 2167 0 P03279

Pre-capsid vertex protein (Capsid vertex-specific component IIIa) (CVSC) (Protein IIIa) (pIIIa) [Cleaved into: Capsid vertex protein] L1

585 75% 2,266 0

YP_002213774.1 penton base L2 544 P36716 Penton protein (CP-P) (Penton base protein) (Protein III) L2

497 73% 2046 0 P03276

Penton protein (CP-P) (Penton base protein) (Protein III) L2

571 70% 2,031 0

YP_002213779.1 hexon L3 944 P19900 Hexon protein (CP-H) (Protein II) L3 919 78% 3939 0 P03277

Hexon protein (CP-H) (Protein II) L3 968 76% 3965 0

YP_002213782.1 hexon assembly protein 100K L4

828 P36714 Shutoff protein (100 kDa protein) (p100K) (100K-chaperone protein) (L4-100K) (Shutoff protein 100K) L4

782 64% 2601 0 P24932

Shutoff protein (100 kDa protein) (p100K) (100K-chaperone protein) (L4-100K) (Shutoff protein 100K) L4

805 64% 2602 0

YP_002213833.1 single-stranded DNA-binding protein E2A

517 P04498 Early E2A DNA-binding protein DBP 484 50% 1312 1E-175

P03264

DNA-binding protein (DBP) (Early 2A protein)

529 54% 1479 0

YP_002213767.1 control protein E1B 55K E1B

492 P04491 E1B protein, large T-antigen (E1B 55 kDa protein) (E1B-55K)

482 47% 1198 1E-158

P03244

E1B 55 kDa protein (E1B-55K) (E1B protein, large T-antigen) (E1B-495R) E1B

495 53% 1.492 0

YP_002213776.1 core protein V L2 349 P36717 Core-capsid bridging protein (Core protein V) L2

347 59% 975 1E-129

P03267

Core-capsid bridging protein (Core protein V) L2

369 61% 1,058 1E-141

YP_002213785.1 capsid protein precursor pVIII L4

227 P36713

Pre-hexon-linking protein (Pre-protein VIII) (pVIII) [Cleaved into: Hexon-linking protein-N (12.1 kDa protein VIII) (Protein VIII-N); Hexon-linking protein-C (7.6 kDa protein VIII) (Protein VIII-C)] L4

233 76% 928 1E-125

P03280

Pre-hexon-linking protein (Pre-protein VIII) (pVIII) [Cleaved into: Hexon-linking protein-N (12.1 kDa protein VIII) (Protein VIII-N); Hexon-linking protein-C (7.6 kDa protein VIII) (Protein VIII-C)] L4

227 79% 963 1E-131

YP_002213780.1 protease L3 209 P09569

Protease (EC 3.4.22.39) (Adenain) (Adenovirus protease) (AVP) (Adenovirus proteinase) (Endoprotease) L3

206 81% 874 1E-118

P03252

Protease (EC 3.4.22.39) (Adenain) (Adenovirus protease) (AVP) (Adenovirus proteinase) (Endoprotease) L3

204 80% 871 1E-117

YP_002213836.1 control protein E4 34K E4 299 P36710 Early E4 34 kDa protein 291 52% 853 1E-112

P03239

Early 4 ORF6 protein (E4-ORF6) (Early 4 34 kDa protein) (E4-34k)

294 59% 958 1E-128

YP_002213778.1 capsid protein precursor pVI L3

250 P35988 Pre-protein VI (pVI) [Cleaved into: Endosome lysis protein; Protease cofactor (pVI-C) L3

265 64% 818 1E-108

P03274

Pre-protein VI (pVI) [Cleaved into: Endosome lysis protein; Protease cofactor (pVI-C)] L3

250 63% 823 1E-109

YP_002213765.1 control protein E1A E1A 261 P03259 Early E1A 29.5 kDa protein 266 42% 478 3E-56 P03254

Early E1A 32 kDa protein 289 36% 458 5E-53

YP_002213786.1 control protein E3 12.5K E3 106 P36706 Early E3A 12.1 kDa protein 105 67% 395 2E-48 P27311

Early E3A 12.5 kDa protein (E3-12,5K) 107 55% 318 1E-36

YP_002213838.1 control protein E4orf3 E4 117 P36708 Probable early E4 11 kDa protein 116 61% 378 2E-45 P032 Early 4 ORF3 protein (E4-ORF3) (E4 ORF3 116 49% 253 2E-26

27

41 control protein) (Early 4 11 kDa protein) (E4-11k)

YP_002213794.1 control protein E3 14.7K E3 136 Q65288 E3B 14.7 KD protein 128 56% 354 3E-41 P68976

Early 3 14.7 kDa protein (E3-14.7k) 128 49% 324 1E-36

YP_002213768.1 hexon associated protein IX, capsid protein IX IX

138 P03284 Hexon-interlacing protein (Protein IX) IX

144 58% 352 1E-40 P03282

Hexon-interlacing protein (Protein IX) IX 140 51% 328 4E-37

YP_002213840.1 control protein E4orf1 E4 125 S10861 hypothetical protein 127 50% 124 5E-40 P03242

Early 4 ORF1 protein (E4-ORF1) (E4 ORF1 control protein)

128 46% 276 1E-29

YP_002213766.1 control protein E1B 19K E1B

178 P04492 E1B protein, small T-antigen (E1B 19 kDa protein) (E1B-19K)

163 41% 352 8E-40 Q2Y0J3

19 kDa small T antigen (E1B 21-kDa) E1B 178 100% 943 1E-129

YP_002213783.1 protein 33K L4 234 emb|X73487.1|

336 bp (Query cover 72%) 64% 177 2E-38 P24939

Splicing factor (Splicing factor 33K) (L4-33K) L4

228 54% 557 4E-69

YP_002213777.1 core protein precursor pX L2

75 P35986 Late L2 mu core protein (11 kDa core protein) (Protein X) (pX) (pMu) PX

72 63% 255 3E-30 P14269

Pre-core protein X (pX) (11 kDa core protein) (Protein mu) (pMu) [Cleaved into: Core protein X] L2

80 69% 280 3E-34

YP_002213771.1 protein 13.6K L1 139 P36704 Probable DNA-binding protein (Agnoprotein)

205 44% 275 2E-28 P03263

I-leader protein 145 48% 340 7E-39

YP_002213784.1 encapsidation protein 22K L4

199 emb|X73487.1|

255 bp (Query cover 67%) 50% 140 6E-27 P24939

Splicing factor (Splicing factor 33K) (L4-33K) L4

228 38% 167 2E-11

YP_002213796.1 fiber L5 319 P36711 Fiber protein (SPIKE) (Protein IV) L5 587 33% 271 2E-23 P03275

Fiber protein (SPIKE) (Protein IV) L5 582 29% 243 9E-20

YP_002213792.1 membrane protein E3 RID-alpha E3

91 P36705 Early E3B 10.4 kDa protein 91 52% 218 8E-22 P15133

Pre-early 3 receptor internalization and degradation alpha protein (Pre-E3-RID-alpha protein)

91 51% 259 4E-28

YP_002213837.1 control protein E4orf4 E4 122 P36709 Probable early E4 13 kDa protein 120 37% 221 2E-21 P03240

Early 4 ORF4 protein 114 45% 275 1E-29

YP_002213839.1 control protein E4orf2 E4 129 S10863 hypothetical protein 131 30% 62 1E-15 P0DJX0

Early 4 ORF2 protein (E4-ORF2) 130 32% 177 1E-14

YP_002213834.1 protein U U 52 emb|X73487.1|

50% 67.4 9E-12 P0DJX2

U exon protein 217 59% 176 3E-16

YP_002213793.1 membrane protein E3 RID-beta E3

134 P36707 Early E3B 12.7 kDa protein 110 29% 132 5E-08 P03250

Early 3 receptor internalization and degradation beta protein (E3 RID-beta protein) (Early E3B 14.5 kDa protein) (E3-14.5k)

130 37% 232 8E-23

YP_002213835.1 control protein E4orf6/7 E4 141 P36710 Early E4 34 kDa protein 291 34% 93 9E-02 P03238

Early 4 ORF6/7 control protein (E4-ORF6/7) (Early E4 17 kDa protein)

150 47% 328 6E-37

YP_002213775.1 core protein precursor pVII L2

192 No hits found in Ad12 P68950

Pre-histone-like nucleoprotein (Pre-core protein VII) (pVII) L2

198 69% 656 3E-85

YP_002213787.1 membrane glycoprotein E3 CR1-alpha E3

146 No hits found in Ad12

YP_002213788.1 membrane glycoprotein E3 gp19K E3

172 No hits found in Ad12 P68978

Early E3 18.5 kDa glycoprotein (E3-19K) (E3gp 19 kDa) (E19) (GP19K)

159 32% 201 2E-17

YP_002213789.1 membrane glycoprotein E3 CR1-beta E3

179 No hits found

YP_002213790.1 membrane glycoprotein E3 CR1-gamma E3

189 No hits found

YP_002213791.1 membrane protein E3 CR1-delta E3

77 No hits found