an interaction between s•tag and s•protein derived from human ribonuclease 1 allows...

www.elsevier.com/locate/jim

Journal of Immunological Me

Research paper

An interaction between S!tag and S!protein derived from human

ribonuclease 1 allows site-specific conjugation of an enzyme

to an antibody for targeted drug delivery

Tsuneaki Asai, Letitia A. Wims, Sherie L. MorrisonT

Department of Microbiology, Immunology, and Molecular Genetics, University of California Los Angeles,

405 Hilgard Avenue, Los Angeles, CA 90095, USA

Molecular Biology Institute, University of California Los Angeles, 405 Hilgard Avenue, Los Angeles, CA 90095, USA

Received 31 August 2004; received in revised form 14 January 2005; accepted 15 January 2005

Available online 7 April 2005

Abstract

We have previously demonstrated that an antibody–avidin fusion protein could be used to deliver biotinylated enzymes to

tumor cells for antibody-directed enzyme prodrug therapy. However, the presence of the chicken protein avidin suggests that

immunogenicity may be a problem. To address this concern, we developed a new delivery system consisting of human proteins.

The amino-terminal 15-amino-acid peptide derived from human ribonuclease 1 (human S!tag) can bind with high affinity to

human S!protein (residues 21–124 of the same ribonuclease). We constructed an antibody–S!protein fusion protein in which

S!protein was genetically linked to an anti-rat transferrin receptor IgG3 at the carboxyl terminus of the heavy chain. We also

constructed an enzyme–S!tag fusion protein in which S!tag was genetically linked to the carboxyl terminus of Escherichia coli

purine nucleoside phosphorylase (PNP). When these two fusion proteins were mixed, S!tag and S!protein interacted specificallyand produced homogeneous antibody/PNP complexes that retained the ability to bind antigen. Furthermore, in the presence of

the prodrug 2-fluoro-2V-deoxyadenosine in vitro, the complex efficiently killed rat myeloma cells overexpressing the transferrin

receptor. These results suggest that human ribonuclease-based site-specific conjugation can be used in vivo for targeted

chemotherapy of cancer.

D 2005 Elsevier B.V. All rights reserved.

Keywords: ADEPT; Human ribonuclease 1; S!protein; S!tag; Site-specific conjugation

0022-1759/$ - s

doi:10.1016/j.jim

Abbreviation

serum; F-dAdo,

ribonucleoside;

polyacrylamide

T Correspondi

Hilgard Avenue

E-mail addr

thods 299 (2005) 63–76

ee front matter D 2005 Elsevier B.V. All rights reserved.

.2005.01.020

s: ADEPT, antibody-directed enzyme prodrug therapy; AP, alkaline phosphatase; F-Ade, 2-fluoroadenine; FBS, fetal bovine

2-fluoro-2V-deoxyadenosine; IMDM, Iscove’s modified Dulbecco’s medium; MESG, 2-amino-6-mercapto-7-methylpurine

PNP, purine nucleoside phosphorylase; RNase, ribonuclease; SD, standard deviation; SDS-PAGE, sodium dodecyl sulphate

gel; TfR, transferrin receptor.

ng author. Department of Microbiology, Immunology, and Molecular Genetics, University of California Los Angeles, 405

, Los Angeles, CA 90095, USA. Tel.: +1 310 206 5124; fax: +1 310 794 5126.

ess: [email protected] (S.L. Morrison).

http://www.biokin.com/dynafit/index.html

T. Asai et al. / Journal of Immunological Methods 299 (2005) 63–7664

1. Introduction

The ability to specifically target cytotoxic drugs to

the site of tumors can improve the efficacy of

chemotherapy by reducing the adverse side effects

and damage to normal tissues associated with

systemic drug delivery and thereby increasing the

effective dose. In antibody-directed enzyme prodrug

therapy (ADEPT), an antibody/enzyme complex is

first administered and allowed to bind selectively to

tumor antigens (Bagshawe, 1987; Senter et al., 1988).

After allowing sufficient time for unbound antibody/

enzyme to be cleared from the circulation, a nontoxic

prodrug is administered systemically. The prodrug is

then cleaved by the tumor-localized enzyme to

generate a potent cytotoxic agent. Theoretically this

approach can solve many of the problems observed

with standard chemotherapy and can lead to more

effective and non-toxic chemotherapy (Bagshawe et

al., 1999; Syrigos and Epenetos, 1999; Xu and

McLeod, 2001). However, the current approaches to

ADEPT have some limitations. One of the major

obstacles is the difficulty of producing homogeneous,

functionally active antibody/enzyme complexes (Bag-

shawe et al., 1999; Syrigos and Epenetos, 1999; Xu

and McLeod, 2001).

In earlier studies we used the avidin/biotin system

to address this problem (Asai et al., 2005). We

constructed an antibody–avidin fusion protein in

which avidin was genetically linked to an anti-rat

transferrin receptor (TfR) IgG3 at the carboxyl

terminus of the heavy chain (anti-rat TfR IgG3–

avidin; Penichet et al., 1999). We also constructed a

fusion protein in which a human biotin acceptor

domain (called P67; Leon-Del-Rio and Gravel, 1994)

was genetically linked to an enzyme. When produced

in Escherichia coli cells overexpressing biotin protein

ligase (Chapman-Smith and Cronan, 1999), the

enzyme–P67 fusion protein was efficiently mono-

biotinylated at a defined site in the P67 domain. When

these two fusion proteins were mixed, homogeneous

antibody/enzyme complexes were reproducibly gen-

erated through the interaction between avidin and

biotin. Furthermore, the complex retained the func-

tions of the antibody and enzyme, and in vitro

efficiently killed rat Y3-Ag1.2.3 myeloma cells over-

expressing the TfR (Galfre et al., 1979) only in the

presence of the prodrug. This approach was success-

fully applied to two different enzymes, suggesting that

the antibody–avidin fusion protein can serve as a

universal enzyme delivery vehicle for targeted chemo-

therapy of tumors overexpressing the TfR. However,

presence of the chicken protein, avidin, raises

concerns about whether immunogenicity will preclude

long-term use of this delivery system.

We now describe an enzyme delivery system that

retains the efficiency and convenience of the avidin/

biotin system but is comprised of human proteins. The

system utilizes the S!tag and S!protein fragments

derived from human ribonuclease (RNase) 1 (Dubel,

1999). It is well known that the 15-amino-acid peptide

carrying the amino-terminal sequence of bovine

RNase A (bovine S!tag) can bind with high affinity

to bovine S!protein (residues 21–124 of the same

RNase) (Raines et al., 2000). Although neither S!tagnor S!protein alone possesses any RNase activity, the

complex of these two fragments is almost as active as

intact RNase A. The closest human homolog of

RNase A is pancreatic RNase 1. Importantly, the

two fragments derived from the corresponding regions

of RNase 1 (called here human S!tag and S!protein)can also interact with similar affinity and regenerate

the RNase activity (Dubel, 1999; Backer et al., 2003).

The three-dimensional structure of RNase 1 closely

resembles that of RNase A (Pous et al., 2001), and the

residues in bovine S!tag involved in the S!tag/S!protein interaction (Dwyer et al., 2001) are con-

served in human S!tag, making bovine and human

S!tag fragments functionally interchangeable (Dubel,

1999; Backer et al., 2004).

In this study, we replaced the avidin moiety of

anti-rat TfR IgG3–avidin with human S!protein. We

also replaced P67 in the enzyme–P67 fusion protein

with human S!tag, connecting it to the well-

characterized enzyme, E. coli purine nucleoside

phosphorylase (PNP; for a review, see Bzowska et

al., 2000). PNP cleaves the relatively nontoxic

prodrug 2-fluoro-2V-deoxyadenosine (F-dAdo) to

produce the highly cytotoxic drug 2-fluoroadenine

(F-Ade) (Parker et al., 2003). We found that, when

these two fusion proteins were mixed, human S!tagand S!protein interacted specifically to produce

homogeneous antibody/PNP complexes. The com-

plexes retained the ability to bind the rat TfR and

greatly increased the toxicity of F-dAdo to Y3-

Ag1.2.3 cells. These results suggest that human

T. Asai et al. / Journal of Immunological Methods 299 (2005) 63–76 65

RNase-based site-specific conjugation can be used

for targeted drug delivery in vivo.

2. Materials and methods

2.1. Construction and purification of E. coli PNP

connected to human S!tag

A DNA fragment carrying the deoD gene encod-

ing PNP was amplified from E. coli genomic DNA

using the following PCR primers: 5V-GAGAGG-TACCATGGCTACCCCACACATTAATGC-3V and

5V-CCTTAGGCCTGCTCTTTATCGCCCAGCA-

GAACG-3V. The amplified fragment was digested

with NcoI and StuI, and inserted, together with the

(Gly4-Ser)3 linker (a StuI–BamHI fragment; Trinh et

al., 2004) and human S!tag (a BamHI–SalI frag-

ment), into pET16b-BS between the NcoI and SalI

sites. The human S!tag fragment was generated by

annealing the following oligomers: 5V-GATCCA-AGGAATCCCGGGCCAAGAAATTCCAGCGG-

CAGCATATGGACTCATAAGCGGCCGCG-3V and

5 V- TCGACGCGGCCGCTTATGAGTCCA -

TATGCTGCCGCTGGAATTTCTTGGCCCGG-

GATTCCTTG-3V. pET16b-BS was constructed by

modifying pET16b (Novagen, Madison, WI) to

contain a short DNA fragment carrying the BamHI

and SalI sites within the multiple cloning site

immediately downstream from the NdeI site; the

original BamHI site was destroyed. The plasmid

expressing E. coli PNP-(Gly4-Ser)3-human S!tag(called PNP-HuS!tag) was named pET9832.

To obtain PNP-HuS!tag, the E. coli strain

BL21(DE3) (Novagen) transformed with pET9832

was inoculated into LB broth containing Ampicillin

(100 Ag/ml) to give an initial optical density of 0.05

OD600. Cultures were grown at 37 8C to an OD600 of

0.9, at which time isopropyl-h-d-thiogalactopyrano-side was added to a concentration of 1 mM and the

growth temperature was lowered to 30 8C. Four hourslater, cells were harvested by centrifugation and stored

at �20 8C. Frozen cells were thawed at 37 8C,resuspended in 1:35 of the original culture volume of

ice-cold lysis buffer [50 mM Tris–HCl (pH 7.5), 150

mM NaCl, 5% glycerol, and 0.1 mM phenylmethyl-

sulfonyl fluoride] containing 1 mM DTT and 5 mM

EDTA, and incubated on ice for 10 min with

lysozyme (1 mg/ml). The cells were further incubated

on ice with 0.1% Triton X-100 for 10 min, followed

by a 15-min incubation with deoxyribonuclease I (50

Ag/ml), ribonuclease A (50 Ag/ml), and MgCl2 (10

mM). The lysate was clarified by centrifugation,

added to 0.5–1 ml of a 50% agarose bead slurry

carrying immobilized bovine S!protein (Novagen),

and incubated overnight at 4 8C with gentle agitation

to capture S!tagged proteins. The beads were then

sedimented by a brief centrifugation and washed

thoroughly with lysis buffer containing 1 mM DTT

until the A280 reached b0.01. To elute captured

proteins, washed beads were resuspended in 1.5�resin volumes of lysis buffer containing 10 mM DTT

and 3 M MgCl2 and incubated at 4 8C for 30 min with

gentle agitation. The beads were then sedimented by a

brief centrifugation and the supernatant was saved.

The elution process was repeated two more times and

the pooled supernatants were desalted by ultrafiltra-

tion against phosphate-buffered saline (PBS, pH 7.2)

containing 10 mM DTT until the magnesium concen-

tration reached b100 mM. The sample was then

desalted against PBS until the magnesium concen-

tration reached b5 mM and concentrated. The con-

centration and purity of the purified proteins were

determined immediately and the proteins were used

for various applications without delay. A typical yield

was ~30 mg protein per liter.

2.2. Construction and purification of anti-rat TfR

IgG3 connected to human S!protein

A DNA fragment carrying the human S!proteinsequence was amplified by PCR with the genomic

DNA isolated from 293T cells using the following

primers: 5V-GAAGGGATCCTCCCCCAGCAG-

CAGCTCCACCTAC-3V and 5V-CCTTGAATTCTCA-CACAGTAGCATCAAAGTGGAC-3V. The fragment

was digested with BamHI and EcoRI, and connected,

via the (Gly4-Ser)3 linker, to the 3V end of a chimeric

heavy chain gene that consists of the variable region

of the mouse anti-rat TfR monoclonal antibody OX26

(Jefferies et al., 1985) and the constant region of a

human IgG3 mutated (R435H) to contain a protein A-

binding site. The plasmid carrying this anti-rat TfR

IgG3 heavy chain-human S!protein fusion gene under

the control of the CMV promoter was named

pAH9830.


To obtain anti-rat TfR IgG3 fused to human

S!protein (anti-rat TfR IgG3-HuS!pro), pAH9830

was introduced by electroporation into a derivative

of the mouse cell line P3X63Ag8.653 expressing a

chimeric mouse/human n light chain with the variable

region of OX26 (Penichet et al., 1999). Stable

transfectants were selected and the fusion protein

was purified using protein A immobilized on Sephar-

ose beads (Sigma, St. Louis, MO) as previously

described (Penichet et al., 1999). A typical yield was

1–3 mg protein per liter.

2.3. PNP assay

PNP activity was determined by measuring the

difference in absorbance between 2-amino-6-mer-

capto-7-methylpurine ribonucleoside (MESG; Molec-

ular Probes, Eugene, OR) and the purine base product

of its reaction with inorganic phosphate catalyzed by

the enzyme (Webb, 1992). This reaction gives an

absorbance increase at 360 nm with an extinction

coefficient value of 11,000 M�1 cm�1 at pH 7.6. The

assay was carried out at room temperature in PBS (pH

7.6) in the final reaction volume of 500 Al. Initialsteady-state rates were calculated from the linear

portion of the reaction curve. In each enzyme assay,

PBS was added in place of the enzyme to measure the

spontaneous degradation of the substrate and the value

obtained was subtracted.

2.4. RNase assay

A fixed concentration of free or PNP-fused S!tagwas incubated with varying concentrations of free or

antibody-fused S!protein. The reconstituted RNase

activity was measured at room temperature in 20 mM

Tris–HCl (pH7.5), 100 mM NaCl, 0.1% Triton X-100

containing the ArUAA substrate (Novagen) consisting

of a short, mixed ribo/deoxyribo oligonucleotide with

a fluorophore on the 5V end and a quencher on the 3Vend. The reaction (10 Al final volume) was carried out

in a black microtiter plate. Fluorescence from cleaved

substrate was detected by Synergy HT (excitation/

emission = 485/528 nm; BIO-TEK Instruments,

Winooski, VT). Initial steady-state rates were calcu-

lated from the linear portion of the reaction curve.

Bovine S!protein and S!tag were purchased from

Novagen. In each enzyme assay, free or PNP-fused

S!tag and free or antibody-fused S!protein were

separately mixed with PBS (pH 7.2) to measure

contaminating RNase activity and the values obtained

were subtracted.

2.5. Gel filtration chromatography

Chromatography of purified proteins and their

complexes was performed at 4 8C on a Superose 6

10/300 GL column (Amersham Biosciences, Piscat-

away, NJ) at a flow rate of 0.25 ml/min with PBS (pH

7.2) containing 0.05% sodium azide. The total amount

of protein applied to the column was ~100 Ag and the

sample volume was ~100 Al. To generate the anti-

body/PNP complex, anti-rat TfR IgG3-HuS!pro and

PNP-HuS!tag were mixed at a molar ratio of 1:6 (3.1

and 18.6 AM, respectively). Proteins were detected by

absorbance at 280 nm. The column was calibrated

with aldolase (158 kDa), ferritin (440 kDa), and

thyroglobulin (669 kDa) (Amersham Biosciences).

The partition coefficients of these standard proteins

were plotted against the logarithm of the correspond-

ing molecular mass as described (Buchanan and

Walker, 1996; Huang et al., 2000) and the molecular

masses of the proteins and complexes used in this

study were calculated from the standard curve.

2.6. Antigen binding assay

In a microtiter plate, Y3-Ag1.2.3 cells [5�105

cells in 20 Al PBS (pH 7.2) per well] were mixed

with varying amounts of OX26 or an isotype matched

control antibody (mouse IgG2a; Southern Biotech,

Birmingham, AL) (50 Al/well). The cells were

incubated at 4 8C for 60 min before being mixed

with anti-rat TfR IgG3, anti-rat TfR IgG3-HuS!pro,or anti-rat TfR IgG3-HuS!pro complexed with PNP-

HuS!tag (30 Al/well). The final concentration of these

antibodies was 500 ng/ml. After a 2-h incubation at 4

8C, the cells were washed three times with 200 Al ofPBS, mixed with an anti-human heavy chain anti-

body conjugated to alkaline phosphatase (AP)

(Sigma) or bovine S!protein conjugated to AP

(Novagen), and incubated at 4 8C for another 2 h.

The cells were then washed as before and mixed with

the AP substrate p-nitrophenyl phosphate (Sigma).

The AP activity was determined by measuring

absorbance at 410 nm.


2.7. Pull-down analysis of antibody/PNP complexes

Anti-rat TfR IgG3-HuS!pro (182 pmol) was mixed

with varying amounts of PNP-HuS!tag in a total

volume of 113 Al PBS (pH 7.6). Each mixture was

added to protein A immobilized on Sepharose beads

(~25 Al resin volume) that had been pre-equilibrated

with PBS and incubated at 4 8C for 4 h with gentle

agitation. The beads were pelleted by a brief

centrifugation, washed four times with 1 ml PBS,

and resuspended in 200 Al of PBS. Aliquots of the

suspension were used to determine PNP activities. In

blocking experiments, anti-rat TfR IgG3-HuS!pro(18.2 pmol) and PNP-HuS!tag (109.2 pmol) were

mixed in the presence of varying amounts of free

bovine S!protein (Novagen) in a total volume of

100 Al PBS.

2.8. In vitro cytotoxicity assay

The antibody/PNP complex generated by mixing

anti-rat TfR IgG3-HuS!pro (4.2 AM) and PNP-

HuS!tag (25.2 AM) was serially diluted with Iscove’s

Modified Dulbecco’s Medium (IMDM; Irvine Scien-

tific Inc., Irvine, CA) supplemented with 20% fetal

bovine serum (FBS; Atlas Biologicals, Fort Collins,

CO). The diluted complexes (50 Al each) were mixed

with Y3-Ag1.2.3 cells (1.6�105 cells in 50 Al IMDM

supplemented with 20% FBS) and incubated at 37 8Cfor 90 min. The cells were washed three times with 3

ml of IMDM supplemented with 20% FBS to remove

unbound complexes, resuspended in IMDM supple-

mented with 10% FBS, and plated into microtiter

plates (5�103 cells/well). F-dAdo (Berry and Asso-

ciates, Dexter, MI) dissolved in IMDM supplemented

with 10% FBS was then added at varying concen-

trations and after 3 days cell viability was determined

by the MTS assay (CellTiter 96 AQueous Non-

Radioactive Cell Proliferation Assay; Promega, Mad-

ison, WI). For controls, anti-rat TfR IgG3-HuS!proand PNP-HuS!tag were independently mixed with

PBS (pH 7.2) and processed as described above. In

blocking experiments, the cells were similarly treated

with the anti-rat TfR IgG3-HuS!pro/PNP-HuS!tagcomplex or medium in the presence of 2.5 mg/ml of

the mouse monoclonal antibody OX26, the same

concentration of an isotype-matched control antibody

(mouse IgG2a), or medium. To determine the toxicity

of anti-rat TfR IgG3-HuS!pro, PNP-HuS!tag, and

their complex, Y3-Ag1.2.3 cells were mixed inde-

pendently with these proteins and incubated at 37 8Cfor 24 h. Cell viability was determined as described

above and compared to the viability of untreated cells.

To remove surface-bound conjugates, Y3-Ag1.2.3

cells incubated at 37 8C for 90 min with the anti-rat

TfR IgG3-HuS!pro/PNP-HuS!tag complex were trea-

ted with a mixture of proteinase K and chymotrypsin

(50 Ag/ml each in IMDM supplemented with 10%

FBS) as described previously (Ng et al., 2002). The

cells were then washed twice with 3 ml of IMDM

supplemented with 20% FBS and processed as

described above.

3. Results

3.1. Characterization of the enzyme–S!tag fusion

protein

The 15-amino-acid human S!tag fragment (1.9

kDa) was genetically fused, via the flexible (Gly4-

Ser)3 linker (1.0 kDa), to the carboxyl terminus of E.

coli PNP (26.0 kDa) and the fusion protein (PNP-

HuS!tag; see Fig. 1A) was expressed in E. coli cells.

The protein was then affinity-purified using bovine

S!protein immobilized on agarose beads. The purified

protein possessed the expected size (~29 kDa) and

was N 98% pure as assessed by sodium dodecyl

sulphate polyacrylamide gel (SDS-PAGE; Fig. 2A).

This suggested that human S!tag connected to PNP

could form the correct structure to specifically interact

with bovine S!protein. To further characterize the

enzyme–S!tag fusion protein, we mixed PNP-HuS!tagand free bovine S!protein at varying molar ratios and

measured the reconstituted RNase activities. The

equilibrium dissociation constant (KD) of the human

S!tag/bovine S!protein interaction was then calculated

with the assumption that the initial RNase activity was

proportional to the concentration of the S!tag/S!protein complex. The result indicated that human

S!tag fused to PNP bound free bovine S!protein with

a KD of 29.3F2.9 nM (Fig. 3). Using the same

method, we found that the KD of the interaction

between free bovine S!tag and free bovine S!proteinwas 31.1F3.7 nM (Fig. 3), which is in agreement

with the values obtained by different techniques under

Fig. 2. SDS-PAGE analysis of purified proteins. The proteins were

visualized by Coomassie blue staining. (A) PNP-HuS!tag (lane 1)

and anti-rat TfR IgG3-HuS!pro (lane 4) were analyzed on a 12.5%

gel in the presence of 2-mercaptoethanol. The sizes (kDa) of

molecular weight markers (lane 2) are shown to the left of the gel.

Anti-rat TfR IgG3 was also run as a control (lane 3). The heavy (H)

and light (L) chains of the antibodies are indicated. (B) Anti-rat TfR

IgG3 (lane 2) and anti-rat TfR IgG3-HuS!pro (lane 3) were analyzedon a 5% gel under nonreducing conditions to show the correct

assembly (H2L2) of the heavy and light chains. The sizes (kDa) of

molecular weight markers (lane 1) are shown to the left of the gel.

RN

ase A

ctivity

(Arb

itra

ry U

nits)

0

25

50

75

100

0 250 500 750 1000 1250

S • protein (nM)

Fig. 3. Affinity of S!tag/S!protein interactions. A fixed concen-

tration (0.5 nM) of free or PNP-fused S!tag was incubated with

varying concentrations of free or antibody-fused S!protein. Recon-stituted RNase activities (arbitrary units) were then measured. Each

symbol represents the average enzyme activity [F standard

deviation (SD)] obtained from three independent assays. To obtain

the KD value for each S!tag/S!protein complex, the data were fitted,

using the computer program DYNAFIT (Kuzmic, 1996; http://

www.biokin.com/dynafit/index.html), to the one-to-one model:

S!tag +S!proteinfS!tag/S!protein, as described previously

(Lacourciere et al., 2000; Backer et al., 2003). PNP-HuS!tag+freebovine S!protein (E, KD=29.3F2.9 nM); free bovine S!tag+freebovine S!protein (., KD=31.1F3.7 nM); free bovine S!tag+anti-rat TfR IgG3-HuS!pro (n, KD=60.7F6.3 nM).

A

DC

B

IgG3

LinkerHuS• pro

Linker

PNP

HuS• tag

Fig. 1. Schematic diagrams of PNP-HuS!tag and anti-rat TfR IgG3-

HuS!pro. Diagrams are not drawn to scale. (A) The monomeric

structure of PNP-HuS!tag. Human S!tag (black oval) is genetically

fused, via the (Gly4-Ser)3 linker (wavy line), to the carboxyl

terminus of E. coli PNP. (B) The hexameric structure of PNP-

HuS!tag. E. coli PNP is a disc-shaped hexamer which can be

viewed as a trimer of dimers. The position of the carboxyl terminus

in each monomer is based on the crystal structures of E. coli PNP

(Mao et al., 1997; Koellner et al., 1998). (C) The monomeric

structure of anti-rat TfR IgG3-HuS!pro. Each oval represents a

single domain of the heavy (dark gray) and light (light gray) chains

of the antibody. Human S!protein (black circle) is genetically fused,

via the (Gly4-Ser)3 linker (wavy line), to the carboxyl terminus of

each heavy chain. (D) A model of the antibody/PNP complex that is

presumed to form when anti-rat TfR IgG3-HuS!pro and PNP-

HuS!tag are mixed at a molar ratio of 1:6.


similar temperature, pH, and ionic strength (Connelly

et al., 1990; Park and Raines, 1997). These results

suggest that human S!tag fused to PNP and free

bovine S!tag can bind to free bovine S!protein with

similar affinities.

E. coli PNP exists as a homohexamer (see Fig. 1B)

and only the hexameric structure is enzymatically

active (Jensen and Nygaard, 1975; Bzowska et al.,

2000). When purified PNP-HuS!tag was applied to a

gel filtration column, most of the protein eluted in a

peak corresponding to a molecular mass of ~170 kDa

(Fig. 4A). Furthermore, the purified fusion protein

catalyzed the phosphorolysis of the guanosine analog

2-amino-6-mercapto-7-methylpurine ribonucleoside

(MESG) with ~5 Amol of MESG cleaved/min/mg of

protein. These results suggest that the human S!tagdoes not interfere with the formation of functional

enzyme.

http://www.biokin.com/dynafit/index.html

Fig. 4. Gel filtration chromatography. Elution profiles of PNP-

HuS!tag (A), anti-rat TfR IgG3-HuS!pro (B), and their complex (C)

obtained with Superose 6 10/300 GL column are shown. Proteins

were detected by absorbance at 280 nm. The elution volumes of

thyroglobulin (669 kDa), ferritin (440 kDa), aldolase (158 kDa), and

BSA (67 kDa) are indicated at the top of the figure.

OX26 or Control Antibody (µg/ml)

O.D

. (41

0 nm

)(%

Con

trol

)

0

50

100

0.1 1 10 100

Fig. 5. Recognition of the rat TfR present on Y3-Ag1.2.3 cells

Anti-rat TfR IgG3 (5,n), anti-rat TfR IgG3-HuS!pro (o,.), and

anti-rat TfR IgG3-HuS!pro complexed with PNP-HuS!tag at a

molar ratio of 1:6 (4,E) were mixed with Y3-Ag1.2.3 cells in

the presence of varying concentrations of OX26 (open symbols) o

an isotype matched control antibody (filled symbols). Cell surface

bound anti-rat TfR IgG3 and anti-rat TfR IgG3-HuS!pro were

detected using an anti-human heavy chain antibody conjugated to

alkaline phosphatase. Cell surface-bound anti-rat TfR IgG3

HuS!pro/PNP-HuS!tag complexes were detected using bovine

S!protein conjugated to alkaline phosphatase. Each symbo

represents the average absorbance at 410 nm obtained from three

independent assays expressed as the percent of the average

absorbance obtained when the antibodies or the antibody/enzyme

complex was mixed with Y3-Ag1.2.3 cells in the absence o

OX26 or the control antibody. The largest SD was F 8.6%.


3.2. Characterization of the antibody–S!protein fusionprotein

We genetically fused human S!protein (11.8 kDa

without glycosylation), via the (Gly4-Ser)3 linker, to

the chimeric antibody anti-rat TfR IgG3 (~170 kDa) at

the carboxyl terminus of the heavy chain (anti-rat TfR

IgG3-HuS!pro; see Fig. 1C). The antibody-HuS!profusion protein was expressed in mouse myeloma cells

and purified from culture supernatants using protein A

immobilized on Sepharose beads. When analyzed by

SDS-PAGE using anti-rat TfR IgG3 as a control, the

purified fusion protein was N 95% pure and assembled

to form an H2L2 molecule (Fig. 2B). The heavy chain

of anti-rat TfR IgG3-HuS!pro was of increased

molecular weight as expected (Fig. 2A); however, it

was not possible to determine how many of the three

potential N-glycosylation sites on human RNase 1

(Yamashita et al., 1986; Beintema et al., 1988; Ribo et

al., 1994) were used. Glycosylation is not essential for

the RNase activity or the interaction between S!tagand S!protein (Dubel, 1999; Backer et al., 2003). Gel

filtration chromatography also confirmed the size

(~200 kDa) and the purity of the fusion protein (Fig.

4B). To determine whether human S!protein con-

nected to the antibody can bind to S!tag, anti-rat TfRIgG3-HuS!pro was mixed with free bovine S!tag at

varying molar ratios and the KD value of the human

S!protein/bovine S!tag complex determined as

described above. The result indicated that antibody-

fused human S!protein bound to free bovine S!tagwith a KD of 60.7F6.3 nM (Fig. 3). This is ~2-fold

higher than the KD values obtained with the free

bovine S!tag/free bovine S!protein and PNP-fused

human S!tag/free bovine S!protein interactions (Fig.

3). This may indicate that antibody-fused human

S!protein is functional but slightly misfolded.

We next determined whether human S!proteinconnected to anti-rat TfR IgG3 affects the antigen-

binding activity of the antibody. As shown in Fig. 5,

anti-rat TfR IgG3-HuS!pro bound to rat Y3-Ag1.2.3

myeloma cells overexpressing the TfR, and the

binding was specifically blocked by the mouse anti-

rat TfR monoclonal antibody OX26 with the same

variable regions. Importantly, the binding of anti-rat

.

r

-

-

l

f

A

B

0 10 20 30 40 50

PN

P A

ctiv

ity(n

mol

es/m

in)

0

25

50

75

100

PNP/Antibody

PN

P A

ctiv

ity(%

Con

trol

)

0

25

50

75

100

0.1 1 10Bovine S•protein (µM)

Fig. 6. Interaction of anti-rat TfR IgG3-HuS!pro with PNP-HuS!tag.(A) Anti-rat TfR IgG3-HuS!pro (1.6 AM) was incubated with

varying concentrations of PNP-HuS!tag and the antibody was

precipitated using protein A-Sepharose beads. After washing the

beads, the coprecipitated PNP activity (nmol of MESG cleaved/min)

was measured and plotted against the corresponding PNP-HuS!tag/anti-rat TfR IgG3-HuS!pro molar ratio (PNP/Antibody). Each

symbol represents the average enzyme activity (F SD) obtained

from three independent assays. (B) Anti-rat TfR IgG3-HuS!pro(0.18 AM) and PNP-HuS!tag (1.08 AM) were incubated in the

presence of varying concentrations of free bovine S!protein. Theantibody was then precipitated as described above and the

coprecipitated PNP activities were plotted against the concentration

of bovine S!protein. Each symbol represents the average PNP

activity (F SD) obtained from three independent assays expressed

as the percent of the average PNP activity precipitated when the

antibody and enzyme were mixed in the absence of bovine

S!protein.


TfR IgG3-HuS!pro and of anti-rat TfR IgG3 were

similarly blocked by OX26 (Fig. 5). Thus, anti-rat

TfR IgG3 and anti-rat TfR IgG3-HuS!pro bind the

cell surface-expressed TfR with similar affinities.

3.3. Characterization of the antibody/enzyme complex

generated through the interaction between human

S!protein and S!tag

We found that a mixture of anti-rat TfR IgG3-

HuS!pro and PNP-HuS!tag exhibited RNase activity

(data not shown), suggesting that these two fusion

proteins can form a complex using the S!protein/S!taginteraction. To determine whether the antibody-

HuS!pro fusion protein can bind functional PNP,

anti-rat TfR IgG3-HuS!pro and PNP-HuS!tag were

mixed at varying molar ratios, the antibody precipi-

tated with protein A-Sepharose beads, and the

associated PNP activity measured. This assay protocol

mimics the molecular events that occur during

ADEPT and thus would indicate the efficiency of

enzyme delivery through the RNase-based conjuga-

tion method. The coprecipitated PNP activity corre-

lated linearly with the amount of the PNP molecules

mixed with the antibody until the molar ratio of PNP-

HuS!tag to anti-rat TfR IgG3-HuS!pro reached 6:1,

after which no significant increase was seen (Fig. 6A).

PNP exists as a homohexamer (Jensen and Nygaard,

1975; Bzowska et al., 2000), and it appears that under

these conditions, one molecule of anti-rat TfR IgG3-

HuS!pro can bind only one hexamer of PNP (see Fig.

1D; also see below for further analysis of the

complex). PNP activity was not precipitated when

protein A-Sepharose beads were mixed with PNP-

HuS!tag in the absence of anti-rat TfR IgG3-HuS!pro(data not shown). Furthermore, free bovine S!proteinblocked the precipitation of PNP with anti-rat TfR

IgG3-HuS!pro in a concentration-dependent manner

(Fig. 6B). Taken together, these results suggest that an

antibody-HuS!pro fusion protein can deliver catalyti-

cally active PNP using the human S!protein/S!taginteraction.

When anti-rat TfR IgG3-HuS!pro (~200 kDa) and

PNP-HuS!tag (~29 kDa) mixed at a molar ratio of 1:6

were analyzed by size exclusion chromatography,

most of the proteins eluted in a peak corresponding to

a molecular mass of ~400 kDa (Fig. 4C). A minor

peak of smaller molecular mass probably represents

unconjugated anti-rat TfR IgG3-HuS!pro, PNP-

HuS!tag hexamer, or the mixture of both. Although

there is a small amount of high-molecular-weight

complexes or aggregates, under the conditions used

for this assay, the majority of the proteins form a

complex in which one hexamer of PNP-HuS!tag is

bound by one molecule of anti-rat TfR IgG3-HuS!pro.

A 100ct

ivity


When the molar ratio of anti-rat TfR IgG3-HuS!pro to

the PNP-HuS!tag hexamer exceeded 1, the amount of

high-molecular-weight complexes or aggregates sig-

nificantly increased and their elution profiles were not

reproducible (data not shown). Therefore, we con-

cluded that the optimum molar ratio of anti-rat TfR

IgG3-HuS!pro to PNP-HuS!tag is 1:6.

3.4. In vitro cytotoxicity of PNP-HuS!tag complexed

with anti-rat TfR IgG3-HuS!pro

Since the antigen-binding activity of anti-rat TfR

IgG3-HuS!pro conjugated to PNP-HuS!tag appeared

similar to that of unconjugated anti-rat TfR IgG3-

HuS!pro (Fig. 5), we assessed the ability of the

antibody/PNP complex to specifically target the

enzyme to tumor cells and generate cytotoxicity by

prodrug conversion. To form the antibody/PNP

complex, anti-rat TfR IgG3-HuS!pro and PNP-

HuS!tag were mixed at a molar ratio of 1:6. In the

Fig. 7. In vitro cytotoxicity assays. (A) Y3-Ag1.2.3 cells were

treated for 90 min with the anti-rat TfR IgG3-HuS!pro (n, 1000

nM; o, 333 nM; ., 111 nM; 4, 37 nM; E, 12 nM) complexed

with PNP-HuS!tag at a molar ratio of 1:6, anti-rat TfR IgG3-

HuS!pro (�, 1000 nM), or medium (5). The cells were then washed

and incubated in the presence of varying concentrations of F-dAdo.

The survival of the cells was determined by measuring the

dehydrogenase activity using a colorimetric (MTS) assay and

expressed as the percent of the enzymatic activity of control cells

treated with the medium alone and incubated in the absence of F-

dAdo. Each value is the average of three assays. The largest SD was

F 9.8%. (B) Y3-Ag1.2.3 cells were treated for 90 min with medium

(�Complex) or anti-rat TfR IgG3-HuS!pro (1 AM) complexed with

PNP-HuS!tag (+Complex) in the presence of 2.5 mg/ml of the

blocking antibody OX26, the same concentration of an isotype-

matched control antibody (Cont), or medium (No). The cells were

then washed and incubated in the presence of F-dAdo (1 AM). The

survival of the cells was determined as described above and

expressed as the percent of the enzymatic activity of cells treated

only with the medium and incubated in the absence of F-dAdo.

Each bar represents the average enzymatic activity (F SD) obtained

from three independent assays. (C) Y3-Ag1.2.3 cells incubated for

90 min with anti-rat TfR IgG3-HuS!pro (1 AM) complexed with

PNP-HuS!tag were treated with proteases to remove surface-bound

complexes. For a control, half of the cells incubated with the

complex were treated only with the medium that was used to

dissolve the proteases. The cells were then washed and incubated in

the presence (1 AM) or absence of F-dAdo. Each bar represents the

average enzymatic activity (F SD) obtained from three independent

assays expressed as the percent of the activity of cells treated only

with the medium and incubated in the absence of F-dAdo.

absence of the complex, F-dAdo was cytotoxic to Y3-

Ag1.2.3 cells only at high concentrations, with an

IC50 of ~10 AM (Fig. 7A). The complex showed a

dose-dependent cytotoxic effect and when the cells

were treated with 1 AM of the complex for 90 min

and then extensively washed, the cytotoxicity of F-

dAdo was increased by ~50-fold (IC50 ~0.2 AM).

Under the same conditions, 1 AM of anti-rat TfR

IgG3-HuS!pro (Fig. 7A) or PNP-HuS!tag (data not

shown) did not significantly affect the cytotoxicity of

F-dAdo to Y3-Ag1.2.3 cells (IC50 ~10 AM). In the

absence of F-dAdo, no cytotoxic effect was observed

when the cells were incubated for 24 h with 1 AM of

anti-rat TfR IgG3-HuS!pro, PNP-HuS!tag, or the

0

50

0.1 1 10 100

F-dAdo (µM)

% C

ontr

ol A

B

Complex0

50

100

% C

ontr

ol A

ctiv

ity

No OX26 Cont+ ++

C

F-dAdo (µM)

Proteases

0 0 1

+

0

50

100

% C

ontr

ol A

ctiv

ity

1


complex (data not shown). Furthermore, the excess

amount of OX26, but not an isotype-matched control

antibody, eliminated the cytotoxicity of the complex

(Fig. 7B). Similarly, cell death was almost completely

eliminated when Y3-Ag1.2.3 cells incubated for 90

min with 1 AM of the complex were treated with

proteases to remove cell surface-associated conjugates

and then mixed with F-dAdo (Fig. 7C). These results

suggest that anti-rat TfR IgG3-HuS!pro retains its

antigen-binding activity after being complexed with

PNP-HuS!tag and can specifically deliver functional

PNP to the surface of the tumor cells where the

enzyme generates the cytotoxic agent from the

prodrug F-dAdo.

4. Discussion

The treatment of disseminated disease is a central

problem in cancer therapy (Ross, 1998; Patel et al.,

2003). The effective use of chemotherapy, the stand-

ard treatment, is limited by the toxicity of antiproli-

ferative drugs to normal tissues. One solution is to use

ADEPT in which a tumor specific antibody is used to

target an enzyme that can convert a non-toxic prodrug

to a cytotoxic agent (Bagshawe, 1987; Senter et al.,

1988; Bagshawe et al., 1999; Syrigos and Epenetos,

1999; Xu and McLeod, 2001). When the prodrug is

administered systemically, the enzyme located at the

site of the tumor can generate multiple molecules of

active drug, resulting in a high concentration of

cytotoxic drug only at the site of tumors, minimizing

systemic toxicity. The activated small drug diffuses

throughout the tumor mass, killing not only antigen

expressing cells but also neighboring antigen-negative

tumor cells (bystander effect). The tumor cells killed

as a result of ADEPT can also induce antitumor

immunity (Chen et al., 2001). Consequently, the

antibody/enzyme conjugate does not have to bind to

all metastatic tumor cells to elicit an effective

response.

Although having great theoretical appeal, the

current approaches to ADEPT have many problems

(Bagshawe et al., 1999; Syrigos and Epenetos, 1999;

Xu and McLeod, 2001). A significant limitation in the

use of ADEPT is the difficulty of producing func-

tionally active antibody/enzyme conjugates. The most

commonly used conjugation technique (i.e. chemical

cross-linking) results in products that differ in the

amount and position of cross-links, resulting in

heterogeneous conjugates and inconsistent recovery

of antibody and enzyme activities (Haisma et al.,

1998). As an alternative, recombinant DNA technol-

ogy could be used to prepare antibody/enzyme fusion

proteins yielding a uniform product with predictable

properties (Xu and McLeod, 2001). However, for

unknown reasons, production levels of such fusion

proteins are often very low, limiting clinical (or

sometimes even animal) studies (Haisma et al.,

1998; Helfrich et al., 2000; Deckert et al., 2003). A

further limitation of this approach is that separate

proteins must be produced for each antibody/enzyme

combination and for some enzymes it may be difficult

to produce the appropriate functional multimers.

Our solution is to produce the antibody and the

enzyme separately so that their production can be

optimized independently. The antibody and the

enzyme are modified so that they exhibit strong,

non-covalent interactions. The subsequent site-spe-

cific association of those proteins would reproducibly

generate homogeneous products. Using the avidin/

biotin technology, we have recently demonstrated the

potential of this new concept (Asai et al., 2005). We

demonstrated that an antibody–avidin fusion protein

could be used as a universal delivery vehicle to target

biotinylated enzymes to tumor cells. However,

because of the presence of the foreign protein chicken

avidin, there are concerns that this fusion protein will

be immunogenic in immune competent individuals

and that the use of these therapies would be limited to

immunocompromised cancer patients.

To address this problem, we have now developed a

novel enzyme delivery system based on human

RNase. In addition to being less immunogenic, the

RNase-based system retains most of the advantages of

the avidin/biotin-based ADEPT (Asai et al., 2005).

For example, large quantities of highly purified

antibodies and enzymes can be readily obtained by

independently optimizing their production protocols.

Like the antibody–avidin fusion protein, the anti-

body–S!protein fusion protein can be used as a

universal delivery vehicle to target various S!taggedenzymes to tumor cells with the site-specific associ-

ation of the antibody and enzyme reproducibly

generating homogeneous products. In both delivery

systems, the enzyme is linked to the carboxyl


terminus of the antibody where it does not signifi-

cantly hinder the binding of the antibody to its target.

An additional advantage of the RNase-based system is

that the S!tag can be used both as an affinity

purification tag as well as a docking tag, eliminating

the need to develop a separate purification scheme for

each enzyme.

A potential disadvantage of the RNase-based

system is that the affinity of the S!tag/S!proteininteraction (KD=10

�7–10�8 M; see Fig. 3 and

Connelly et al., 1990; Park and Raines, 1997; Backer

et al., 2003) is much lower than that of the avidin/

biotin complex (KD=~10�15 M; Green, 1990). How-

ever, such an extraordinarily high affinity interaction

may not be required for effective targeted anti-tumor

therapies. When Y3-Ag1.2.3 cells were treated with

780 nM of anti-rat TfR IgG3–avidin complexed with

mono-biotinylated PNP-P67, F-dAdo inhibited cell

proliferation with an IC50 of ~0.2 AM (Asai et al.,

2005). When anti-rat TfR IgG3-HuS!pro was used in

this study to deliver PNP-HuS!tag, a similar level of

growth inhibition was achieved (Fig. 7). Since PNP-

P67 and PNP-HuS!tag possess comparable levels of

enzyme activity (data not shown), it appears that, at

least in vitro, the avidin/biotin-based and RNase-

based delivery systems can target similar amounts of

PNP to the tumor cells. Importantly, when a vascular

endothelial growth factor-human S!tag fusion protein

was complexed with radiolabeled human S!proteinthrough the S!tag/S!protein interaction, the complex

successfully visualized tumor neovasculature in

mouse models (Blankenberg et al., 2004), suggesting

that the human RNase-based enzyme delivery system

developed in this study will also be effective in vivo

for targeted chemotherapy of cancer.

We have previously shown that anti-rat TfR

IgG3-avidin can deliver chemically biotinylated h-galactosidase to the inside of Y3-Ag1.2.3 cells

through receptor-mediated endocytosis and that the

enzyme remains active after internalization, suggest-

ing that at least a fraction escaped lysosomal

degradation (Ng et al., 2002). Since RNases are

powerful toxins when delivered to the cytoplasm of

tumor cells (Rybak and Newton, 1999), we consid-

ered the possibility that the RNase activity of the

antibody/enzyme complex created through the S!tag/S!protein interaction could directly kill tumor cells.

However, the complex killed Y3-Ag1.2.3 cells only

in the presence of F-dAdo (Fig. 7A), suggesting that

regenerated RNase molecules were not delivered to

the cytoplasm of the tumor cells. When cell surface-

associated complexes were removed by protease

treatment, cell death was almost completely elimi-

nated even in the presence of F-dAdo (Fig. 7C).

Since F-dAdo is freely diffusible across cell

membranes and PNP exhibits 30–50% of the

maximum activity at the pH of the early endosome

(~pH 6) (Jensen and Nygaard, 1975; Lee et al.,

2001), the result suggests that active PNP was not

delivered to the inside of the cells. The RNase-

based conjugation system may block the receptor-

mediated endocytosis of the antibody/PNP complex.

Alternatively, it may facilitate the delivery of the

endocytosed complex to the lysosome.

As mentioned above, the immunogenicity of non-

human proteins limits the efficiency of targeted anti-

cancer therapies (Bagshawe et al., 1999; Syrigos and

Epenetos, 1999; Xu and McLeod, 2001). Phase I trials

of ADEPT in patients with advanced colorectal

carcinoma indicated the potential efficacy of this

therapy for the treatment of solid tumors (Napier et

al., 2000; Francis et al., 2002). However, the trials

were conducted with a murine antibody and the

bacterial enzyme carboxypeptidase G2 that elicited

strong immune responses that precluded multiple

rounds of therapy. In the present study, we developed

a delivery system in which the targeting moiety that

should be minimally immunogenic by connecting

human S!protein to a humanized antibody. However,

we used the E. coli enzyme PNP as the effector

molecule since it allows us to directly compare the

efficiency of two different enzyme delivery systems

(see above). To develop an effective ADEPT agent,

the effector enzyme must also not elicit a strong

immune response. It has been shown that certain

mutants of mammalian PNPs exhibit altered substrate

specificity and catalyze the phosphorolysis of 2,6-

diaminopurine-2V-deoxyribonucleoside, leading to the

production of the cytotoxic agent 2,6-diaminopurine

(Stoeckler et al., 1997; Maynes et al., 2000). If E. coli

PNP can be replaced by mutant human PNP, the

resulting ADEPT agent should show significantly

reduced immunogenicity. In addition, to further

decrease immunogenicity in humans, it may be

necessary to produce antibody–S!protein and

enzyme–S!tag fusion proteins in human cell lines


such as 293T that would attach human-specific

carbohydrate structures.

An alternative way to avoid the host immune

response may be the consecutive use of different non-

human enzymes (Syrigos and Epenetos, 1999). The

RNase-based conjugation system would be ideal for

this strategy since it eliminates the need to make a

different antibody fusion protein for every enzyme.

During therapy, the immunogenicity of non-human

enzymes may be reduced by modifying them with

polyethylene glycol or dextran (Wilkinson et al.,

1987; Mikolajczyk et al., 1996), although such

modifications may reduce the efficacy of ADEPT. In

the clinical trials of ADEPT, coinjection of the

immunosuppressant drug cyclosporin has been used

to delay the onset of the adverse immune responses,

thus allowing multiple cycles of therapy (Ledermann

et al., 1991; Bagshawe et al., 1999).

ADEPT shows great promise for the development

of non-toxic chemotherapy for the treatment of

metastatic cancer. The present need is to increase its

efficacy while reducing immunogenicity. Our

approach addresses these needs and should result in

the expanded use of ADEPT for the treatment of

cancer.

Acknowledgements

We thank Ryan Trinh for technical assistance and

David Beenhouwer for critical reading of the manu-

script. This work was supported by National Institutes

of Health Grant CA87990, the UCLA Jonsson

Comprehensive Cancer Center Interdisciplinary

Grant, and Cancer Center Core Grant CA-16042

(UCLA).

References

Asai, T., Trinh, R., Ng, P.P., Penichet, M.L., Wims, L.A., Morrison,

S.L., 2005. A human biotin acceptor domain allows site-specific

conjugation of an enzyme to an antibodyavidin fusion protein

for targeted drug delivery. Biomol. Eng. 21, 145.

Backer, M.V., Gaynutdinov, T.I., Gorshkova, I.I., Crouch, R.J., Hu,

T., Aloise, R., Arab, M., Przekop, K., Backer, J.M., 2003.

Humanized docking system for assembly of targeting drug

delivery complexes. J. Control. Release 89, 499.

Backer, M.V., Elliot, J., Gaynutdinov, T.I., Backer, J.M., 2004.

Assembly of targeting complexes driven by a single-chain

antibody. J. Immunol. Methods 289, 37.

Bagshawe, K.D., 1987. Antibody directed enzymes revive anti-

cancer prodrugs concept. Br. J. Cancer 56, 531.

Bagshawe, K.D., Sharma, S.K., Burke, P.J., Melton, R.G., Knox,

R.J., 1999. Developments with targeted enzymes in cancer

therapy. Curr. Opin. Immunol. 11, 579.

Beintema, J.J., Blank, A., Schieven, G.L., Dekker, C.A., Sorrentino,

S., Libonati, M., 1988. Differences in glycosylation pattern of

human secretory ribonucleases. Biochem. J. 255, 501.

Blankenberg, F.G., Mandl, S., Cao, Y.A., O’Connell-Rodwell, C.,

Contag, C., Mari, C., Gaynutdinov, T.I., Vanderheyden, J.L.,

Backer, M.V., Backer, J.M., 2004. Tumor imaging using a

standardized radiolabeled adapter protein docked to vascular

endothelial growth factor. J. Nucl. Med. 45, 1373.

Buchanan, S.K., Walker, J.E., 1996. Large-scale chromatographic

purification of F1F0-ATPase and complex I from bovine heart

mitochondria. Biochem. J. 318, 343.

Bzowska, A., Kulikowska, E., Shugar, D., 2000. Purine nucleoside

phosphorylases: properties, functions, and clinical aspects.

Pharmacol. Ther. 88, 349.

Chapman-Smith, A., Cronan, J.E., 1999. In vivo enzymatic protein

biotinylation. Biomol. Eng. 16, 119.

Chen, B.M., Cheng, T.L., Tzou, S.C., Roffler, S.R., 2001.

Potentiation of antitumor immunity by antibody-directed

enzyme prodrug therapy. Int. J. Cancer 94, 850.

Connelly, P.R., Varadarajan, R., Sturtevant, J.M., Richards, F.M.,

1990. Thermodynamics of protein–peptide interactions in the

ribonuclease S system studied by titration calorimetry. Bio-

chemistry 29, 6108.

Deckert, P.M., Renner, C., Cohen, L.S., Jungbluth, A., Ritter, G.,

Bertino, J.R., Old, L.J., Welt, S., 2003. A33scFv-cytosine

deaminase: a recombinant protein construct for antibody-

directed enzyme-prodrug therapy. Br. J. Cancer 88, 937.

Dqbel, S., 1999. Reconstitution of human RNase from two separate

fragments fused to different single chain antibody fragments: on

the way to binary immunotoxins. Tumor Target. 4, 37.

Dwyer, J.J., Dwyer, M.A., Kossiakoff, A.A., 2001. High affinity

RNase S-peptide variants obtained by phage display have a

novel bhot-spotQ of binding energy. Biochemistry 40, 13491.

Francis, R.J., Sharma, S.K., Springer, C., Green, A.J., Hope-Stone,

L.D., Sena, L., Martin, J., Adamson, K.L., Robbins, A.,

Gumbrell, L., O’Malley, D., Tsiompanou, E., Shahbakhti, H.,

Webley, S., Hochhauser, D., Hilson, A.J., Blakey, D., Begent,

R.H., 2002. A phase I trial of antibody directed enzyme

prodrug therapy (ADEPT) in patients with advanced colorectal

carcinoma or other CEA producing tumours. Br. J. Cancer 87,

600.

Galfre, G., Milstein, C., Wright, B., 1979. Rat x rat hybrid

myelomas and a monoclonal anti-Fd portion of mouse IgG.

Nature 277, 131.

Green, N.M., 1990. Avidin and streptavidin. Methods Enzymol.

184, 51.

Haisma, H.J., Sernee, M.F., Hooijberg, E., Brakenhoff, R.H.,

Meulen-Muileman, I.H., Pinedo, H.M., Boven, E., 1998.

Construction and characterization of a fusion protein of


single-chain anti-CD20 antibody and human beta-glucuroni-

dase for antibody-directed enzyme prodrug therapy. Blood 92,

184.

Helfrich, W., Haisma, H.J., Magdolen, V., Luther, T., Bom, V.J.,

Westra, J., van der Hoeven, R., Kroesen, B.J., Molema, G., de

Leij, L., 2000. A rapid and versatile method for harnessing scFv

antibody fragments with various biological effector functions.

J. Immunol. Methods 237, 131.

Huang, S., Beresten, S., Li, B., Oshima, J., Ellis, N.A., Campisi, J.,

2000. Characterization of the human and mouse WRN 3VY5Vexonuclease. Nucleic Acids Res. 28, 2396.

Jefferies, W.A., Brandon, M.R., Williams, A.F., Hunt, S.V., 1985.

Analysis of lymphopoietic stem cells with a monoclonal

antibody to the rattransferrin receptor. Immunology 54, 333.

Jensen, K.F., Nygaard, P., 1975. Purine nucleoside phosphorylase

from Escherichia coli and Salmonella typhimurium. Purification

and some properties. Eur. J. Biochem. 51, 253.

Koellner, G., Luic, M., Shugar, D., Saenger, W., Bzowska, A., 1998.

Crystal structure of the ternary complex of E. coli purine

nucleoside phosphorylase with formycin B, a structural ana-

logue of the substrate inosine, and phosphate (Sulphate) at 2.1 A

resolution. J. Mol. Biol. 280, 153.

Kuzmic, P., 1996. Program DYNAFIT for the analysis of enzyme

kinetic data: application to HIV proteinase. Anal. Biochem. 237,

260.

Lacourciere, K.A., Stivers, J.T., Marino, J.P., 2000. Mechanism of

neomycin and Rev peptide binding to the Rev responsive

element of HIV-1 as determined by fluorescence and NMR

spectroscopy. Biochemistry 16, 5630.

Ledermann, J.A., Begent, R.H., Massof, C., Kelly, A.M., Adam, T.,

Bagshawe, K.D., 1991. A phase-I study of repeated therapy with

radiolabelled antibody to carcinoembryonic antigen using

intermittent or continuous administration of cyclosporin A to

suppress the immune response. Int. J. Cancer 47, 659.

Lee, J., Filosa, S., Bonvin, J., Guyon, S., Aponte, R.A., Turnbull,

J.L., 2001. Expression, purification, and characterization of

recombinant purine nucleoside phosphorylase from Escherichia

coli. Protein Expr. Purif. 22, 180.

Leon-Del-Rio, A., Gravel, R.A., 1994. Sequence requirements for

the biotinylation of carboxyl-terminal fragments of human

propionyl-CoA carboxylase alpha subunit expressed in Escher-

ichia coli. J. Biol. Chem. 269, 22964.

Mao, C., Cook, W.J., Zhou, M., Koszalka, G.W., Krenitsky, T.A.,

Ealick, S.E., 1997. The crystal structure of Escherichia coli

purine nucleoside phosphorylase: a comparison with the human

enzyme reveals a conserved topology. Structure 5, 1373.

Maynes, J.T., Yuan, R.G., Phipps, B.M., Litster, S.A., Leung, K.,

Snyder, F.F., 2000. Further refinement on the engineering of

adenosine phosphorylase from purine nucleoside phosphorylase.

Adv. Exp. Med. Biol. 486, 107.

Mikolajczyk, S.D., Meyer, D.L., Fagnani, R., Hagan, M.S., Law,

K.L., Starling, J.J., 1996. Dextran modification of a FabV-beta-lactamase conjugate modulated by variable pretreatment of FabVwith amine-blocking reagents. Bioconjug. Chem. 7, 150.

Napier, M.P., Sharma, S.K., Springer, C.J., Bagshawe, K.D., Green,

A.J., Martin, J., Stribbling, S.M., Cushen, N., O’Malley, D.,

Begent, R.H., 2000. Antibody-directed enzyme prodrug ther-

apy: efficacy and mechanism of action in colorectal carcinoma.

Clin. Cancer Res. 6, 765.

Ng, P.P., Dela Cruz, J.S., Sorour, D.N., Stinebaugh, J.M., Shin,

S.U., Shin, D.S., Morrison, S.L., Penichet, M.L., 2002. An

anti-transferrin receptor–avidin fusion protein exhibits both

strong proapoptotic activity and the ability to deliver various

molecules into cancer cells. Proc. Natl. Acad. Sci. U. S. A. 99,

10706.

Park, S.H., Raines, R.T., 1997. Green fluorescent protein as a signal

for protein–protein interactions. Protein Sci. 6, 2344.

Parker, W.B., Allan, P.W., Hassan, A.E., Secrist, J.A., Sorscher, E.J.,

Waud, W.R., 2003. Antitumor activity of 2-fluoro-2V-deoxy-adenosine against tumors that express Escherichia coli purine

nucleoside phosphorylase. Cancer Gene Ther. 10, 23.

Patel, J.D., Krug, L.M., Azzoli, C.G., Gomez, J., Kris, M.G., Miller,

V.A., 2003. Targeting lethal minimal residual disease in small

cell lung cancer. Semin. Oncol. 30, 79.

Penichet, M.L., Kang, Y.S., Pardridge, W.M., Morrison, S.L., Shin,

S.U., 1999. An antibody–avidin fusion protein specific for the

transferrin receptor serves as a delivery vehicle for effective

brain targeting: initial applications in anti-HIV antisense drug

delivery to the brain. J. Immunol. 163, 4421.

Pous, J., Mallorqui-Fernandez, G., Peracaula, R., Terzyan, S.S.,

Futami, J., Tada, H., Yamada, H., Seno, M., de Llorens, R.,

Gomis-Ruth, F.X., Coll, M., 2001. Three-dimensional structure

of human RNase 1 delta N7 at 1.9 A resolution. Acta

Crystallogr., D Biol. Crystallogr. 57, 498.

Raines, R.T., McCormick, M., Van Oosbree, T.R., Mierendorf,

R.C., 2000. The S-Tag fusion system for protein purification.

Methods Enzymol. 326, 362.

Ribo, M., Beintema, J.J., Osset, M., Fernandez, E., Bravo, J., De

Llorens, R., Cuchillo, C.M., 1994. Heterogeneity in the

glycosylation pattern of human pancreatic ribonuclease. Biol.

Chem. Hoppe-Seyler 375, 357.

Ross, A.A., 1998. Minimal residual disease in solid tumor

malignancies: a review. J. Hematother. 7, 9.

Rybak, S.M., Newton, D.L., 1999. Natural and engineered

cytotoxic ribonucleases: therapeutic potential. Exp. Cell Res.

253, 325.

Senter, P.D., Saulnier, M.G., Schreiber, G.J., Hirschberg, D.L.,

Brown, J.P., Hellstrom, I., Hellstrom, K.E., 1988. Anti-tumor

effects of antibody-alkaline phosphatase conjugates in combi-

nation with etoposide phosphate. Proc. Natl. Acad. Sci. U. S. A.

85, 4842.

Stoeckler, J.D., Poirot, A.F., Smith, R.M., Parks, R.E., Ealick, S.E.,

Takabayashi, K., Erion, M.a., 1997. Purine nucleoside phos-

phorylase: 3. Reversal of purine base specificity by site-directed

mutagenesis. Biochemistry 36, 11749.

Syrigos, K.N., Epenetos, A.A., 1999. Antibody directed enzyme

prodrug therapy (ADEPT): a review of the experimental and

clinical considerations. Anticancer Res. 19, 605.

Trinh, R., Gurbaxani, B., Morrison, S.L., Seyfzadeh, M., 2004.

Optimization of codon pair use within the (GGGGS)3 linker

sequence results in enhanced protein expression. Mol. Immunol.

40, 717.

Webb, M.R., 1992. A continuous spectrophotometric assay for

inorganic phosphate and for measuring phosphate release


kinetics in biological systems. Proc. Natl. Acad. Sci. U. S. A.

89, 4884.

Wilkinson, I., Jackson, C.J., Lang, G.M., Holford-Strevens, V.,

Sehon, A.H., 1987. Tolerance induction in mice by conjugates

of monoclonal immunoglobulins and monomethoxypolyethy-

lene glycol. Transfer of tolerance by T cells and by T cell

extracts. J. Immunol. 139, 326.

Xu, G., McLeod, H.L., 2001. Strategies for enzyme/prodrug cancer

therapy. Clin. Cancer Res. 7, 3314.

Yamashita, K., Hitoi, A., Irie, M., Kobata, A., 1986. Fractionation

by lectin affinity chromatography indicates that the glycosyla-

tion of most ribonucleases in human viscera and body fluids is

organ specific. Arch. Biochem. Biophys. 250, 263.

an interaction between s•tag and s•protein derived from human ribonuclease 1 allows...

Documents