afab volume 3 issue 2

Volume 3, Issue 22013

ISSN: 2159-8967www.AFABjournal.com

90 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 2 - 2013 91

Sooyoun Ahn University of Florida, USA

Walid Q. AlaliUniversity of Georgia, USA

Kenneth M. Bischoff NCAUR, USDA-ARS, USA

Debabrata BiswasUniversity of Maryland, USA

Claudia S. Dunkley University of Georgia, USA

Lawrence GoodridgeColorado State University, USA

Leluo GuanUniversity of Alberta, Canada

Joshua GurtlerERRC, USDA-ARS, USA

Yong D. HangCornell University, USA

Divya JaroniOklahoma State University, USA

Weihong Jiang Shanghai Institute for Biol. Sciences, P.R. China

Michael JohnsonUniversity of Arkansas, USA

Timothy KellyEast Carolina University, USA

William R. KenealyMascoma Corporation, USA

Hae-Yeong Kim Kyung Hee University, South Korea

W.K. KimUniversity of Manitoba, Canada

M.B. KirkhamKansas State University, USA

Todd KostmanUniversity of Wisconsin, Oshkosh, USA

Y.M. Kwon University of Arkansas, USA

Maria Luz Sanz MuriasInstituto de Quimica Organic General, Spain

Melanie R. MormileMissouri University of Science and Tech., USA

Rama NannapaneniMississippi State University, USA

Jack A. Neal, Jr.University of Houston, USA

Benedict OkekeAuburn University at Montgomery, USA

John PattersonPurdue University, USA

Toni Poole FFSRU, USDA-ARS, USA

Marcos RostagnoLBRU, USDA-ARS, USA

Roni ShapiraHebrew University of Jerusalem, Israel

Kalidas ShettyNorth Dakota State University, USA

EDITORIAL BOARD


EDITOR-IN-CHIEFSteven C. RickeUniversity of Arkansas, USA

EDITORSTodd R. CallawayFFSRU, USADA-ARS, USA

Cesar CompadreUniversity of Arkansas for Medical Sciences, USA

Philip G. CrandallUniversity of Arkansas, USA

MANAGING and LAYOUT EDITOREllen J. Van LooGhent, Belgium

TECHNICAL EDITORJessica C. ShabaturaFayetteville, USA

ONLINE EDITION EDITORC.S. ShabaturaFayetteville, USA

ABOUT THIS PUBLICATION

Agriculture, Food & Analytical Bacteriology (ISSN

2159-8967) is published quarterly, beginning with

this inaugural issue.

Instructions for Authors may be obtained at the

back of this issue, or online via our website at

www.afabjournal.com

Manuscripts: All correspondence regarding pend-

ing manuscripts should be addressed Ellen Van Loo,

Managing Editor, Agriculture, Food & Analytical

Bacteriology: [email protected]

Information for Potential Editors: If you are interested

in becoming a part of our editorial board, please con-

tact Editor-in-chef, Steven Ricke, Agriculture, Food &

Analytical Bacteriology: [email protected]

Advertising: If you are interested in advertising with

our journal, please contact us at advertising@afab-

journal.com for a media kit and current rates.

Reprint Permission: Correspondence regarding re-

prints should be addressed Ellen Van Loo, Managing

Editor, Agriculture, Food & Analytical Bacteriology

[email protected]

Ordering Print Copies: print editions of this journal

may be purchased and shipped internationally from

our website order form at www.afabjournal.com

Subscription Rates: Subscriptions are not available

at this time. To be advised when subscriptions plans

are made available, please join our newsletter at

www.afabjournal.com

Mailing Address: 2138 Revere Place . Fayetteville, AR . 72701 Website: www.AFABjournal.com

EDITORIAL STAFF


Linoleic Acid Isomerase Expression in Escherichia coli BL21 (DE3) and Bacillus sppS. Saengkerdsub

145

Current and Near-Market Intervention Strategies for Reducing Shiga Toxin-Producing Escherichia coli (STEC) Shedding in Cattle.

T. R. Callaway, T. S. Edrington, G. H. Loneragan, M. A. Carr, and D. J. Nisbet

103

Potential for Rapid Analysis of Bioavailable Amino Acids in Biofuel Feed Stocks D. E. Luján-Rhenals, and R. Morawicki

121

Isolation and Initial Characterization of Acetogenic Ruminal Bacteria Resistant to Acidic ConditionsP. Boccazzi and J. A. Patterson

129

ARTICLESConsumers’ Interest in Locally Raised, Small-Scale Poultry in GeorgiaE. J. Van Loo, W. Q. Alali, S. Welander, C. A. O’Bryan, P. G. Crandall, and S. C. Ricke

94

Instructions for Authors162

Introduction to Authors

The publishers do not warrant the accuracy of the articles in this journal, nor any views or opinions by their authors.

TABLE OF CONTENTS

REVIEW


www.afabjournal.comCopyright © 2013

Agriculture, Food and Analytical Bacteriology

ABSTRACT

An online questionnaire was developed that targeted consumers with an interest in sustainable and

local poultry production in Georgia. Approximately 97% of the respondents expressed an interest in sup-

porting efforts to make sustainably raised poultry processed in Georgia available. Even for a high premium

of $5.00/lb, some respondents would shift their current chicken purchases towards these locally raised

chickens. Respondents reported some interest in attributes such as pasture raised, air chilled and Georgia

grown for their poultry. Knowledge about the demand for local pastured poultry supports the need for in-

frastructure to support Mobile Processing Units for Georgia farmers interested in locally raised small-scale

poultry production.

Keywords: consumer, small-scale poultry production, pastured poultry

InTRoduCTIon

The term pasture raised poultry refers to a pro-

duction system in which chickens or other poultry

are raised primarily on pasture, with the birds sup-

plementing their feed grain by foraging for up to 20

percent of their dietary intake. Until the 1930s, when

large concentrated animal feeding operations first

developed, almost all chickens were raised on pas-

Correspondence: Steven C. Ricke, [email protected]: +1-479-575-4678 Fax: +1-479-575-6936

ture. However, the concept of raising pastured poul-

try was never completely abandoned, and in 1993

Joel Salatin of Swoope, Virginia published Pastured

Poultry Profit$, a book in which he outlined a model

for modern pastured poultry production using small,

mobile, floorless, enclosed chicken shelters or hoop

houses. The modern pastured poultry movement

has flourished because of the increased demand of

consumers wanting to purchase pastured poultry

products (Faulkner, 2011).

Georgia produces more broilers than any other

state, more than 1.3 billion birds in 2010 (USDA,

Consumers’ Interest in Locally Raised, Small-Scale Poultry in GeorgiaE. J. Van Loo1,2, W. Q. Alali3, S. Welander4, C. A. O’Bryan1, P. G. Crandall1, S. C. Ricke1

1Department of Food Science and Center for Food Safety, University of Arkansas, Fayetteville, AR2Present address: Department of Agricultural Economics, Faculty of Bioscience Engineering,

Ghent University, Ghent, Belgium3Center for Food Safety and Department of Food Science & Technology,

University of Georgia, Griffin, GA4Georgia Organics, 200-A Ottley Drive, Atlanta, GA

Agric. Food Anal. Bacteriol. 3: 94-102, 2013


2011). However, the small-scale poultry industry in

Georgia is severely limited in growth due to regulato-

ry challenges imposed by the strict state rules, which

do not allow an exemption from federal inspection

for small farmers who process more than 1,000 birds/

year. An analysis of the Georgia consumers’ inter-

est in these small-scale farmer poultry products was

necessary to support the need for a new processing

option for these farmers. The various processing op-

tions and the preferences of the farmers were previ-

ously studied (Van Loo et al., 2013). The purpose of

this survey was to evaluate the consumer interest for

locally raised pastured poultry in Georgia. A relative-

ly high interest in these products could potentially

justify the development of new processing options

for the small-scale Georgia farmers.

MATeRIAlS And MeThodS

Notices of the pending survey were posted in the

Georgia Organics print newsletter, and in an elec-

tronic newsletter, as well as by a targeted email to

a list of interested poultry consumers based on con-

nections Georgia Organics made at conferences and

meetings. The link to the survey was also posted on

Georgia Organics’ website. A total of 508 Georgia

consumers took the survey between September of

2008 and July of 2010. Table 1 contains the ques-

tions and choice of possible answers. Frequency

tables, mean values and standard deviations were

determined using JMP (release 9.0.0: SAS Insti-

tute, Inc.).The consumer study targeted consumers

with an interest in sustainable and local foods pro-

duced in Georgia. The consumer survey consisted

of questions about (i) current poultry consumption;

(ii) consumer interest in locally pasture raised poultry

as well as their purchasing behavior if this product

would be available to them at different price levels;

and (iii) consumers’ interest in different poultry char-

acteristics/properties.

ReSulTS And dISCuSSIon

Poultry Consumption

A total of 508 consumers responded to the survey.

Among those who reported purchasing any type of

chicken in the previous 3 months, whole chicken and

Figure 1. Chicken purchasing habits of Georgia consumers (n = 508) during previous 3 months

0

100

200

300

400

500

Whole chickens Parts with skin/bones Parts skinless withbones

Partsboneless/skinless

Num

ber


Table 1. Questionnaire

1. Indicate to what degree you agree with the following statement: “I support efforts to make this new type of chicken available in Georgia.” 1 = not at all, 2 = yes, some interest, 3 = yes, absolutely

2. In the last three months, have you purchased chicken meat (any source, any type) in the following forms?

• Whole chickens• Parts (with skin/bones)• Parts (skinless) with bones• Parts (skinless and boneless)• Other (please specify)

3. How many pounds of chicken (any source, any type) do you purchase per month?

4. How many whole chickens (any source, any type) do you purchase per month?Choices: 0, 1, 2, 3, 4, 5, 6, more than 6 (please specify)

5. If this new type of chicken were available as whole chickens at your favorite place to shop, please indicate the percentage of your current chicken purchasing you’d shift.

For example, if you’d shift 40% of your purchasing to pasture raised Georgia poultry if it were available at $4.00/pound, select “40” from the drop-down menu on the $4.00 row. Price points $2.50, $3.00, $3.50, $4.00, $4.50, $5.00

6. Indicate your level of interest in the following, as it pertains to this new type of poultry. 1 = not at all interested, 5 = very interested.

• Boneless,• Georgia grown,• Air chilled• Sustainably raised• Skinless• Pasture raised• Certified organic• Soy free• Other (please specify)


skinless boneless parts were the most popular types,

75% and 73% respectively (Figure 1). A smaller per-

centage, 63%, reported purchasing chicken parts

with skin and bones in the past 3 months, and the

least popular was skinless chicken parts with bones

(32%). Other categories mentioned included ground

chicken and livers/gizzards, with less than 1% of re-

spondents each. The vast majority of the consumers

reported monthly chicken purchases of between 1

and 10 pounds (Figure 2). For whole chickens in par-

ticular, almost 1/3 (32%) reported buying only one

whole chicken per month (Figure 3).

Consumer’s interest and willingness to pay for sustainable locally raised and pro-cessed poultry in Georgia

Consumers were asked about their interest in a

new type of poultry that would be raised sustainably

on Georgia pastures, meet or exceed all current san-

itary and safety measures, be processed in Georgia,

and be available for purchase at their favorite place

to purchase chicken. Figure 4 illustrates that among

these consumers there is a great interest in this type

of poultry; 94% said that they were “absolutely” inter-

ested in being able to purchase this type of poultry.

This can be explained by the nation-wide increase

of consumers’ interest in local foods. Peer reviewed

literature in agricultural economics substantiates a

strong consumer preference for locally-produced

foods (Zepeda and Li, 2006; Keeling-Bond et al.,

2009; Carpio and Isengildina- Massa, 2009; Marti-

nez et al., 2010). When asked, consumers list diverse

reasons for their “buy local” preferences, including

preference for fresher foods, minimal food miles, re-

duction of carbon footprint, and support for the lo-

cal economy (Guptill and Wilkins, 2002; ERS, 2010).

In a 2009 national study, respondents cited reasons

for buying local food as: freshness (82%), support for

the local economy (75%), and knowing the source of

their food (58%) (Food Marketing Institute, 2009). The

2008 Farm Act defines the total distance a product

can be transported and still be eligible for marketing

as a “locally or regionally produced agricultural food

product” as less than 400 miles from its origin, or the

State in which it is produced (USDA, 2008). As such

the Georgia raised poultry sold in Georgia meets the

definition for a local product.

The price of meat is an extrinsic factor that can

affect consumer’s purchasing decisions (Lange et al.,

1999; Lockshin et al., 2006). The participating con-

sumers in our study were willing to pay premium

prices for these products. Consumers were asked

the question “If this new type of chicken were avail-

able as whole chickens at your favorite place to shop,

please indicate the percentage of your current chick-

en purchasing you would shift. For example, if you

would shift 40% of your purchasing to pastured raised

Georgia poultry if it were available at $4.00/pound,

select “40” from the drop-down menu on the $4.00

row.” Depending on the price charged for whole

pasture raised chicken, the consumers were willing

to shift a different amount of their current whole

chicken purchases (Figure 5). Van Loo et al. (2010)

reported price as the main disincentive for organic

chicken purchases. Similarly, our results indicate that

price has a negative correlation to the demand of

locally raised pastured poultry from Georgia. With

a higher price point for the locally raised pastured

poultry, the reported demand decreases. For the low

price of $2.50/lb, 213 (42%) of the respondents were

willing to shift 100% of their current whole chicken

purchases towards locally raised chicken. At a higher

price of $3.00/lb, 175 respondents were willing to

shift 100% of their current chicken purchases towards

this local product. However, even for a high premium

of $5.00/lb, 75 (15%) of the respondents would shift

100% of their current chicken purchases towards this

local product. Van Loo et al. (2011) indicated in previ-

ous research that consumers who are habitual buyers

of sustainable meat products are also willing to pay a

higher premium price for these products. Michel et

al. (2011) reported that half of the participants were

willing to pay a 30% premium for value-added chick-

en compared to conventional chicken products. Ver-

beke and Viaene (1999) conversely found that price

was ranked fifth regarding perception of pork, beef

and poultry attributes by consumers, behind qual-

ity, taste, free of hormones and healthy. Furnols et


Figure 2. Pounds of chicken purchased during previous 3 months? (n = 508)

Figure 3. Number of whole chickens purchased per month by survey respondents (n=508).

0

50

100

150

200

250

300

350

400

0 1-10 11-20 21-30 31-40 41-50 51+

Num

ber

of

cons

umer

s

Pounds purchased

0

20

40

60

80

100

120

140

160

180

0 1 2 3 4 5 6 6+

Num

ber

fo

co

nsum

ers

Number of chickens


Figure 4. Consumer support for sustainably raised, Georgia pastured poultry. 1 = no interest, 2 = some interest, 3 = absolutely.

Figure 5. Percent of respondents willing to shift chicken purchases to pasture raised Georgia poultry at different price points per pound

213175 158

135

80 75

3671 93

72

5835

17 2236

43

45

42

2340

56

74

81

94

610

1528

49 71

$2.50 $3.00 $3.50 $4.00 $4.50 $5.00

Num

ber

of

resp

ond

ents

Price point

100% 55-95% 50% 5-45% 0

1 = Not at all0%

2 = Some interest

5%

3 = Absolutely95%


al. (2011) found that lamb meat price played only

a minor role in determining consumer’s purchasing

decisions, except that when sorted by demograph-

ics men considered that the price was the most im-

portant factor. No demographic information was

collected in the survey reported here, so no such

determination can be made, but we may conclude

that price was not as big a factor for our respondents

as other factors.

Interest and relative importance of dif-ferent poultry characteristics

Respondents rated the importance of/interest in 8

different meat quality criteria using the 5 point Likert

scale, with 1 being not at all interested and 5 being

very strongly interested (Table 2). When evaluating

the average importance of the meat quality attri-

butes, the most important chicken product attribute

was “sustainably raised” (3.70) followed by “Geor-

gia grown” (3.63), “pasture raised” (3.45) and “cer-

tified organic“(3.13). These four product properties

are characteristic for local pasture or organic raised

poultry and appear to be more important than other

characteristics. These other characteristics, related

to general properties, not particularly characteris-

tic for pasture raised, locally or organically raised

poultry were found less important such as air chilled

(2.84), boneless (2.59), skinless (2.47) and soy-free

(2.42). These results indicate that the consumers who

answered this portion of the survey were interested

in sustainable locally raised and processed poultry

products and suggest that there is a strong demand

this product. Food selection and consumption can

be affected by different intrinsic and extrinsic cues

such as country of origin, price or type of feed such

as grain versus grass fed (Verlegh and van Ittersum

2001; Furnols et al., 2011). For instance, Furnols et

al. (2011) found that origin of lamb meat was one of

Table 2. The frequency distribution among the 5 levels of interest for different chicken product properties and average Likert scale value where 1 = not at all interested and 5 = very interested

Chicken product

properties1 2 3 4* N Mean St. dev.

Sustainably raised 0% 3.3% 23.0% 73.8% 61 3.70 0.53

Georgia grown 2.2% 3.3% 23.9% 70.7% 92 3.63 0.66

Pasture raised 3.8% 11.3% 20.8% 64.1% 53 3.45 0.84

Certified organic 6.8% 13.1% 40.3% 39.8% 187 3.13 0.89

Air-chilled 13.1% 15.3% 46.4% 25.2% 316 2.84 0.95

Boneless 21.4% 22.0% 33.2% 23.4% 329 2.59 1.07

Skinless 25.0% 22.3% 33.1% 19.6% 325 2.47 1.07

Soy-free 33.2% 10.2% 37.8% 18.7% 281 2.42 1.13

*No respondents answered 5


the most important factors in purchasing, with lo-

cally grown lamb being the most preferred. This is

consistent with our study where “Georgia grown” is

an attribute of high importance. The pasture raised

attribute had a higher score than organic certified.

This is similar with the study from Michel et al. (2011)

where consumers also indicated a preference for

free-range chicken over organic chicken and may

be a consequence of the associated higher price of

organic meat as compared to pasture or free-range

poultry.

However, we need to be careful drawing conclu-

sions about the ranking of the importance of the at-

tributes since varying totals for responding to these

questions makes it difficult to make a definitive

statement. For instance, “sustainably raised” has a

Likert value of 3.70 but only 61 persons in the survey

rated that attribute at any level. None of the respon-

dents claimed to be strongly interested in any of the

options. One possibility in our study is that other

attributes might be more important to the respon-

dents. In looking at comments, this has some validity

as some of the respondents mentioned “humanely

slaughtered” as an aspect they valued. Another pos-

sibility is that terms such as “sustainably raised”, “air

chilled” or “soy free” were not defined and some

respondents may not have been familiar with these

terms.

ConCluSIonS

The polled consumers have a great interest in sus-

tainable locally raised poultry products processed in

Georgia and are willing to pay extra for these prod-

ucts compared to conventional poultry products. It

is important to emphasize that the results are based

on surveying consumers currently interested in sus-

tainable and local foods and therefore cannot be

generalized for all Georgian consumers. Therefore,

we would suggest that future research not only focus

on the consumers currently involved with Georgia

Organics, but research involve a statistically repre-

sentative group of all Georgia poultry consumers.

The consumer awareness as well as their interest and

willingness to pay for local and sustainable poultry

products will help decide the future for pastured

poultry in Georgia and other regions.

ACknowledgeMenTS

The preparation of this manuscript was partially

funded by SARE grant LS11-245 and USDA-NIFSI

grant #2008-51110-04339.

RefeRenCeS

Carpio, C. E., and O. Isengildina-Massa. 2009. Con-

sumer willingness to pay for locally grown prod-

ucts: The case of South Carolina. Agribusiness

25:412–426.

Faulkner, D. 2011. Pastured chicken. Farming maga-

zine, Fall, 2011:28-29.

Food Marketing Institute. 2009. U.S. Grocery shop-

per trends. Food Marketing Institute: Arlington,

VA.

Furnols, M. F., C. Realini, F. Montossi, C. Sanudo, M.

M. Campo, M. A. Oliver, G. R. Nute, and L. Guer-

rero. 2011. Consumer’s purchasing intention for

lamb meat affected by country of origin, feeding

system and meat price: A conjoint study in Spain,

France and United Kingdom. Food Qual. Pref. 22:

443-451.

Guptill, A., and J.L. Wilkins. 2002. Buying into the

food system: Trends in food retailing in the U.S.

and implications for local foods. Agric. Human Val-

ues 19:39-51.

Keeling-Bond, J., D. Thilmany, and C. Bond. 2009.

What influences consumer choice of fresh produce

purchase location. J. Agric. Appl. Econ. 41:61-74.

Lange, C., F. Rousseau, and S. Issanchou. 1999. Ex-

pectation, liking and purchase behaviour under

economical constraint. Food Qual. Pref. 10:31–39.

Lockshin, L., W. Jarvis, F. d’Hauteville, and J-P. Per-

routy. 2006. Using simulations from discrete choice

experiments to measure consumer sensitivity to

brand, region, price, and awards in wine choice.

Food Qual. Pref. 17:166–178.


Martinez, S., M. Hand, M. Da Pra, S. Pollack, K. Ral-

son, T. Smith, S. Vogel, S. Clark, L. Lohr, S. Low,

and C. Newman. 2010. Local food systems: con-

cepts, impacts, and issues. US Dep. Agric, Econ.

Res. Serv., ERR Rep. 97. Available at http://www.

ers.usda.gov/Publications/ERR97/ERR97.pdf Ac-

cessed February 2012.

Michel, M. L., S. Anders, and W. V. Wismer. 2011.

Consumer preferences and willingness to pay for

value-added chicken product attributes. J. Food

Sci.76: S469–S477.

Salatin, J. 1996. Pastured Poultry Profit$. Chelsea

Green Pub Co. 335 p.

USDA. 2008. USDA 2008 Farm Bill. Main Outline. Ac-

cessed March 2011. http://www.5

usda.gov/wps/portal/usda/farmbill2008?navid=FAR

MBILL2008.

USDA. 2011. Poultry – Production and value. 2010

Summary. April 2011. Available at http://usda01.

library.cornell.edu/usda/current/PoulProdVa/Poul-

ProdVa-04-28-2011.pdf. Accessed 02/22/2012.

Van Loo, E. J., V. Caputo, R. M., Nayga, J. Meullenet,

P. G. Crandall, and S. C. Ricke. 2010. The effect of

organic poultry purchase frequency on consumer

attitudes toward organic poultry meat. J. Food Sci.

75: S384–S397.

Van Loo, E. J., V. Caputo, R. M. Nayga Jr., J-F. Meul-

lenet, and S .C. Ricke. 2011. Consumers’ willingness

to pay for organic chicken breast: Evidence from

choice experiment. Food Qual. Pref. 22:603-613.

Van Loo, E. J., W. Q. Alali, S. Welander, C. A. O’Bryan,

P. G. Crandall, and S. C. Ricke. 2013. Independent

poultry processing in Georgia: survey of producers’

perspective. Agric., Food, Anal. Bacteriol. 3:70-77.

Verbeke, W., and J. Viaene. 1999. Beliefs, attitudes

and behaviour towards fresh meat consumption in

Belgium: Empirical evidence from a consumer sur-

vey. Food Qual. Pref. 10:437–445.

Verlegh, P.W.J, and K. van Ittersum. 2001. The ori-

gin of spices: the impact of geographic product

origin on consumer decision making, in Frewer L.,

E. Risvik, H. Schifferstein (Eds) Food, People and

Society, Springer, New York, pp 267-279.

Zepeda, L., and J. Li. 2006. Who buys local food? J.

Food Dist. Res. 37:1-11.




ABSTRACT

Cattle can naturally contain foodborne pathogenic bacteria such as Shiga Toxin-Producing E. coli (STEC).

These foodborne pathogenic bacteria are a threat to public health through contamination of foods and

water supplies. In order to reduce human exposures and resultant illnesses, research has focused in recent

years on the development of live animal intervention strategies that can be applied to reduce the burden

of STEC entering the food chain. This review addresses the application of interventions that have been

proposed or implemented to reduce STEC in live cattle. Recent years have seen increasing development

of new interventions (e.g., vaccination, DFM, chlorate, phages) and into understanding what effect diet and

the microbial population have on the microbial populations of the gut of cattle. This research has resulted

in several novel interventions and potential dietary additions or changes that can reduce STEC in cattle,

and many of them are in, or very near to entering, the marketplace. The live animal interventions must be

designed in a coherent, complementary context as part of a multiple-hurdle scheme to reduce pathogens

entry into the food supply.

Keywords: Escherichia coli, shiga toxin, intervention, cattle, shedding, near-market, multiple hurdle

InTRoduCTIon

The beef industry has been significantly impacted

by the emergence of Shiga toxin-producing Esch-

Correspondence: Todd Callaway, [email protected]: +1-979-260-9374 Fax: +1-979-260-9332.

erichia coli (STEC) bacteria which are naturally found

in cattle (Karmali et al., 2010). STEC-caused illness-

es are a zoonotic disease (Karesh et al., 2012) that

costs the American economy more than $1 billion

each year in direct and indirect costs from more than

175,000 human illnesses (Scallan et al., 2011; Scharff,

2010). While strategies focused on the prevention

of transmission via carcasses have been largely suc-

REVIEWCurrent and near-market intervention strategies for reducing

Shiga Toxin-Producing Escherichia coli (STEC) shedding in cattle

T. R. Callaway1, T. S. Edrington1, G. H. Loneragan2, M. A. Carr3, D. J. Nisbet1

1Food and Feed Safety Research Unit, USDA/ARS, 2881 F&B Rd., College Station, TX 778452Department of Animal and Food Sciences, Texas Tech University, Lubbock, TX 79409

3Research and Technical Services, National Cattlemen’s Beef Association, Centennial, CO 80112

Proprietary or brand names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of the name by the USDA implies neither approval of the product, nor exclusion of others that

may be suitable.



cessful, they are far from perfect (Arthur et al., 2007a;

Barkocy-Gallagher et al., 2003). Thus it has been

necessary to develop animal management controls

as well as applicable intervention strategies for use in

live cattle (Callaway et al., 2004b; LeJeune and Wet-

zel, 2007; Oliver et al., 2008; Sargeant et al., 2007).

Because human STEC exposures are not limited

only to food-based routes, but include animal con-

tact, it is likely that reducing STEC in cattle can im-

prove public health in rural communities, as well as

in reducing foodborne illnesses (LeJeune and Kerst-

ing, 2010; Rotariu et al., 2012). As discussed pre-

viously (Callaway et al., 2013) the logic underlying

focusing on reducing foodborne pathogenic bacte-

ria in live cattle is straightforward: 1) reducing the

amount of pathogens entering processing plants

will reduce the burden on the plants and render the

in-plant interventions more effective; 2) reducing

horizontal pathogen spread from infected animals

(especially in “supershedders”) in transport and lai-

rage; 3) will reduce the pathogenic bacterial burden

in the environment and wastewater streams; and 4)

will reduce the direct risk to those in direct contact

with animals via petting zoos, open farms, rodeos

and to animal workers.

This present review is intended to complement

the accompanying STEC ecology and animal man-

agement-focused review (Callaway et al., 2013) and

will stress the application of external intervention

strategies focused on reducing STEC in live cattle.

We will divide the interventions into two broad cat-

egories: 1) Probiotic approaches that utilize the com-

petitive nature of the gastrointestinal microbiome,

and 2) Anti-pathogen strategies that specifically tar-

get pathogens based on their physiology and eco-

logical niches.

PRoBIoTIC APPRoACheS, hARneSS-Ing MICRoBIAl eCology

In recent years, probiotic approaches (e.g., those

that utilize live or dead cultures of microorganisms

to alter the microbial population of the gut) have

received increased interest as a method to reduce

foodborne pathogenic bacteria in cattle. Tradition-

ally, probiotic products in the cattle industry have

been used to enhance production efficiency of meat

or milk (Callaway and Martin, 2006; Fuller, 1989; Tour-

nut, 1989; Yoon and Stern, 1996). However recent

years have an increase in the use of the probiotic

types: direct fed microbials (DFM), competitive ex-

clusion cultures (CE), and prebiotics to reduce E.

coli O157:H7 populations in cattle (McAllister et al.,

2011) and can be considered part of an “organic”

approach to improving food safety (Siragusa and

Ricke, 2012).

In general it appears that probiotic products work

to alter the microbial ecology of the gastrointestinal

tract through a variety of mechanisms. As the DFM/

CE bacteria attach to the surface of the intestinal ep-

ithelium this physical binding can prevent opportu-

nistic pathogens from attaching to the intestinal wall

(Collins and Gibson, 1999; Kim et al., 2008). Volatile

fatty acids produced by microbial fermentation can

be toxic to some bacterial species (Ricke, 2003; Rus-

sell, 1992; Wolin, 1969), and other bacterial products

(such as ethanol, traditional antibiotics, or colicins/

bacteriocins [described below]) are produced by

some intestinal bacteria to eliminate competition

within the same environmental niche (Jack et al.,

1995). Collectively, these modes of action demon-

strate the complexities involved with interrupting

the cycle of transmission and colonization of cattle

with E. coli O157:H7, and emphasize that a multiple-

hurdle using complementary interventions has the

greatest chance of improving food safety at the live

animal level.

Direct Fed Microbials

Direct Fed Microbials are widely fed in beef and

dairy cattle and are typically composed of yeast,

fungal or bacterial cultures or end-products of fer-

mentation, and the cultures may be live or dead. A

DFM is fed to animals daily to improve the ruminal

fermentation and production efficiency (Martin and

Nisbet, 1992). Increasingly, companies claim some

benefit to them in reducing E. coli O157:H7 shed-


ding in cattle. Researchers compared several of

the commercially-available growth enhancement

probiotics and yeast products and found that feed-

ing these probiotics provided no effect in regards

to pathogen levels in cattle (Keen and Elder., 2000;

Swyers et al., 2011). A probiotic culture comprised

of Streptococcus bovis and Lactobacillus gallinarum

from the rumen of cattle reduced E. coli O157 shed-

ding when given to experimentally-infected calves,

and this decrease was attributed to an increase in

VFA concentration in the gut (Ohya et al., 2001). Pro-

biotic products have been developed to specifically

reduce E. coli O157:H7 shedding in cattle. A pro-

biotic that contained S. faecium or a mixture of S.

faecium, L. acidophilus, L. casei, L. fermentum and

L. plantarum significantly reduced fecal shedding

of E. coli O157:H7 in sheep, yet, a monoculture of

Lactobacillus acidophilus was found to be ineffec-

tive (Lema et al., 2001). A DFM comprised of Bacillus

subtilis did not affect the fecal prevalence or concen-

tration of E. coli O157:H7 and did not impact aver-

age daily gain in feedlot cattle (Arthur et al., 2010a).

Studies have also indicated that cultures of Lacto-

bacillus acidilacti and Pediococus could directly in-

hibit E. coli O157:H7, likely through the production

of organic acids and low pH (Rodriguez-Palacios et

al., 2009).

Other researchers demonstrated that a direct-fed-

microbial (DFM) L. acidophilus culture derived direct-

ly from the rumen of cattle reduced E. coli O157:H7

shedding by more than 50% when fed to feedlot

cattle (Brashears and Galyean, 2002; Brashears et al.,

2003a; Brashears et al., 2003b). In an independent

evaluation, this DFM reduced fecal shedding of E.

coli O157:H7 in cattle from 46% to 13% (Ransom et

al., 2003). In a further refinement of this DFM, where

the L. acidophilus cultures were combined with Pro-

pionibacterium freudenreichii (a propionate-produc-

ing commensal intestinal bacteria) a reduction in the

prevalence of E. coli O157:H7 occurred in the feces

from approximately 27% to 16% and reduced the

prevalence on hides from 14% to 4% (Elam et al.,

2003; Younts-Dahl et al., 2004). Further work with this

DFM again showed that it reduced E. coli O157:H7

and Salmonella in feces and on hides (Stephens et

al., 2007b), and it further reduced concentrations of

E. coli O157:H7 in the feces (Stephens et al., 2007a;

Stephens et al., 2007b), which may be more of a criti-

cal impactor of carcass contamination than simple

prevalence levels (Arthur et al., 2010b). Additional

studies using only the L. acidophilus DFM found no

impact of low dose DFM feeding on E. coli O157:H7

prevalence (Cull et al., 2012). It is important to note

that in this study a low dose DFM product was uti-

lized, and further research indicates that the effect

on E. coli O157:H7 prevalence and concentrations

is impacted by DFM dosage levels (Cull et al., 2012).

This Lactobacillus-based DFM is currently market-

ed as Bovamine™ and Bovamine Defend™ based

on dosing levels and both are widely used in the

cattle industry because they have been reported to

improve the growth efficiency of cattle, at least in a

feedlot ration. There will likely not be a single DFM

that can work effectively at reducing E. coli O157:H7

populations in cattle and improve production effi-

ciency in all production systems (i.e., feedlots, cow-

calf, stockers, and dairies). Therefore, alternative

DFM cultures selected specifically for each produc-

tion segment or situation need to be developed so

that the food safety improvement can occur while

economically balancing the cost of its inclusion in

cattle rations thus “paying for” the enhancement of

food safety.

Competitive exclusion

Competitive exclusion (CE) is another probiotic

approach that has been used to eliminate E. coli

O157:H7 (as well as Salmonella) from cattle gas-

trointestinal tracts (Brashears and Galyean, 2002;

Brashears et al., 2003a; Brashears et al., 2003b; Zhao

et al., 2003). Competitive exclusion as a technology,

involves the addition of a (non-pathogenic) bacterial

culture (of one or more species) to the intestinal tract

to reduce colonization or decrease populations of

pathogenic bacteria (Fuller, 1989; Nurmi et al., 1992).

An established gastrointestinal microbial population

makes an animal more resistant to transient oppor-

tunistic infections (Fuller, 1989), because the species


best adapted to occupy a particular niche within the

intestinal tract succeeds, and pathogenic bacteria

are generally viewed as opportunists.

A CE culture should be derived from the animal

of interest, thus CE cultures attempt to take advan-

tage of co-evolution of host and microorganism.

Depending on the stage of production of the ani-

mal (i.e., maturity of the gut), the goal of CE can be

the exclusion of pathogens from the naïve gut of a

neonatal animal, or the displacement of an already

established pathogenic bacterial population (Nurmi

et al., 1992). For example, many researchers have

isolated commensal (non-pathogenic) E. coli strains

that show tendencies to reduce E. coli O157:H7 pop-

ulations, at least in vitro (Fox et al., 2009a; Reissbrodt

et al., 2009; Zhao et al., 1998). Researchers used a

defined population of multiple commensal E. coli

strains that were isolated from cattle and found this

generic E. coli CE culture could displace an estab-

lished E. coli O157:H7 population from calves (Zhao

et al., 1998). In a follow up study, calves that were

colonized with the E. coli CE product shed less E.

coli O111:NM and O26:H111 (both STEC strains iso-

lated from cattle, but the CE product did not reduce

E. coli O157:H7 (Zhao et al., 2003). Other researchers

have isolated E. coli strains that display a “proximity-

dependent” killing of E. coli O157:H7 strains which

could possibly be utilized in CE cultures or as a DFM

(Sawant et al., 2011). While the mechanism of this

killing has not been defined, it does not appear to

be mediated by colicins or phages (Sawant et al.,

2011).

Colicins and colicin-producing E. coli

Colicins are antimicrobial proteins produced by

certain E. coli strains that kill or inhibit the growth

of other E. coli strains (Konisky, 1982; Lakey and

Slatin, 2001; Smarda and Smajs, 1998), including E.

coli O157:H7 (Jordi et al., 2001; Murinda et al., 1996;

Schamberger and Diez-Gonzalez, 2002). The con-

cept of using colicins as an intervention strategy to

kill food borne pathogens is not new (Joerger, 2003;

Murinda et al., 1996), but until recently has been lim-

ited by cost to use as treatment on finished meat

products (Abercrombie et al., 2006; Liu et al., 2011;

Patton et al., 2008) or vegetables (Nandiwada et al.,

2004). Recently however, the costs of production and

purification of colicins was lowered by recombination

protein expression work (Stahl et al., 2004). Because

of the increased availability of the colicins, scaled

up studies could be conducted in a mouse model,

where it was demonstrated that E. coli O157:H7 was

prevented from colonization (Leatham et al., 2009).

Recently, specific studies have examined the use of

specific colicins against E. coli O157:H7 in vitro in

gastrointestinal simulations (Callaway et al., 2004d)

and against other E. coli in vivo (Cutler et al., 2007).

In spite of the seemingly simple addition of a

protein (colicin) to animal diets to control E. coli

O157:H7, studies have indicated that the sensitivity

of E. coli O157:H7 strains to any single colicin can

be highly variable (Murinda et al., 1996; Murinda et

al., 1998; Schamberger and Diez-Gonzalez, 2002).

Because some E. coli O157:H7 strains are colicino-

genic and produce specific concomitant immunity

proteins (Murinda et al., 1998), these strains of E.

coli O157:H7 can be resistant to certain added co-

licins or even a broad category of colicins (Alonso

et al., 2000). Therefore, if colicins are to be used as

a preharvest intervention strategy, there must be si-

multaneous administration of several categories of

colicins. Furthermore, if colicins are to be a viable an-

ti-E. coli O157:H7 intervention strategy, the proteins

must be protected from gastric and intestinal deg-

radation. As a way of getting colicins into the lower

gut of cattle, researchers have proposed a specific

form of DFM/CE of feeding colicin-producing E. coli

in cattle rations (Schamberger and Diez-Gonzalez,

2002; Schamberger et al., 2004; Zhao et al., 1998).

These strains have been shown to colonize the lower

gut of cattle, but the reduction in concentration of E.

coli O157 was approximately 2 log10 CFU/g, not a

complete elimination (Nandiwada et al., 2004).

The complex nature of ruminant animal gastroin-

testinal tract, and the long (12-18 month) life span

of cattle going into a feedlot means that CE use in

cattle as a “one shot” approach may not completely

eliminate E. coli O157:H7 and other STEC shedding


throughout the lifetime of the animal. So individual

CE for various phases of production cycles or chang-

es (e.g., entry to the feedlot) may need to be de-

veloped, or an early-established CE culture may be

best supplemented over time by DFM and/or prebi-

otic feeding (synbiotics, described below).

Prebiotics

Organic compounds that are unavailable to, or in-

digestible by the host animal, but are digestible by

a specific segment of the microbial population are

generally classified as “prebiotics” (Patterson and

Burkholder, 2003; Schrezenmeir and De Vrese, 2001;

Walker and Duffy, 1998). For example, fructo-oligo-

saccharides, are sugars that are not degraded by in-

testinal enzymes that can pass down to the cecum

and colon to become “colonic food” for the host

bacterial population and provide nutrients to the in-

testinal mucosa (Houdijk et al., 1998; Willard et al.,

2000). Some prebiotics can provide a competitive

advantage to specific members of the native micro-

flora (e.g., Bifidobacteria, Butyrivibrio) that can help

to exclude pathogenic bacteria from the intestine via

direct competition for nutrients or for binding sites

through the production of “blocking factors”, or an-

timicrobial compounds in a fashion similar to that of

CE (Zopf and Roth, 1996). Other prebiotics (Celma-

nax) have been shown to have an anti-adhesive ef-

fect on E. coli O157:H7 in vitro using bovine cells,

which should be investigated further (Baines et al.,

2011).

Coupling the use of CE and prebiotics is known as

“synbiotics”, and could yield a synergistic effect in

reduction of food-borne pathogenic bacterial popu-

lations in food animals prior to slaughter (Bomba et

al., 2002). To date, prebiotics have not been widely

implemented in cattle due to their expense, and the

ability of ruminal microorganisms to degrade a wide

variety of typical prebiotic substrates, however as

costs change, their inclusion as part of a synbiotic di-

rected anti-pathogen strategy may become feasible.

AnTI-PAThogen STRATegIeS, TARgeT-ed TReATMenT

In spite of the potential of probiotic approaches,

other pathogen-reduction strategies have been de-

veloped for use in the live animal that target patho-

gens directly. Many of these treatments utilize the

host animal, natural members of the microbial eco-

system, or utilize an aspect of pathogen physiology

to inhibit pathogen survival.

Antibiotics

The use of antibiotics specifically to control E. coli

O157:H7 shedding in cattle is controversial. Few re-

searchers have delved into this area in cattle to date.

Neomycin is an antibiotic that is approved for use in

cattle to treat enteric infections and has been shown

to reduce E. coli O157:H7 populations in the gut

(Elder et al., 2002; Ransom et al., 2003) and on the

hides of cattle (Ransom et al., 2003). Other research-

ers have found that in swine artificially infected with

E. coli O157:H7, the feeding of chlortetracycline and

tylosin decreased fecal shedding, while bacitracin

did not impact E. coli O157:H7 populations (Cor-

nick, 2010). It is hypothesized that the generalized

disruption of the microbial ecosystem that is caused

by antibiotic treatment indirectly affects the E. coli

O157:H7 populations; the use of some antibiotics

thus may provide E. coli O157:H7 a competitive ad-

vantage in the ruminant gastrointestinal tract. The

use of antibiotics to reduce E. coli O157:H7 in cattle

has not been recommended because of concerns

relating to the development of antimicrobial resis-

tance.

Bacteriophages

Bacteria can be infected by naturally-occurring

bacteriophages (bacterial viruses) that are found in

many environments (Kutter and Sulakvelidze, 2005;

Lederberg, 1996), including the intestinal tract of

cattle (Callaway et al., 2006; Goodridge, 2008; Go-


odridge, 2010). Phages can have very narrow target

spectrums, and may only be active against a single

bacterial species, or even strain because they tar-

get specific receptors on the surface of the bacte-

rium (Lederberg, 1996). This specificity should allow

phages to be used as an anti-pathogen treatment,

a kind of “smart bomb” targeting on the species

we wish to eliminate, without perturbing the over-

all microbial ecosystem (Johnson et al., 2008). Lytic

phages “hijack” a targeted bacterium’s biosynthetic

machinery to produce daughter phages; when intra-

cellular nutrients are depleted, the host bacterium

bursts, releasing phages to repeat the process in a

fashion similar to a chain reaction. An exponential

increase in the number of phages continues as long

as target bacteria are present, allowing phages to

persist in the environment rather than simply de-

grade over time as a chemical treatment. However,

phage populations are self-limiting; if the targeted

bacteria are removed from the environment, then

phage populations diminish. One potential draw-

back to the use of phages is the rapid development

of bacterial resistance to a single phage, thus much

of the effort has been focused on the development

of multi-phage cocktails (Tanji et al., 2005).

Phages have been examined for use in two dif-

ferent approaches to reduce E. coli O157:H7, within

the gut of cattle before slaughter, and as a hide or

environmental decontaminant (Ricke et al., 2012).

Commercial phage-based anti-E. coli O157:H7 are

currently focused on the use of lytic phages in hide

wash and surface cleansing products; FSIS has issued

a letter of no objection to this use of phages. Phage

products for use as a hide spray have been released

into the marketplaces (Omnilytics and Elanco, Final-

yse). Company-based research indicates a signifi-

cant reduction in positive trim samples from cattle

that were sprayed with this product. Processors are

finding appropriate critical control points in which to

include phage sprays on carcasses prior to de-hiding

in relation to other hide spray intervention steps to

reduce E. coli O157:H7 on the hides of cattle as they

enter the food chain. Several phages isolated by Eu-

ropean laboratories have shown promise as E. coli

O157:H7 reduction agents sprayed on cattle hides,

but that they require an extended exposure time

(1 h) to obtain maximal effect (Coffey et al., 2011).

Interestingly, several phages have been isolated

recently that are effective both against Salmonella

spp. and E. coli O157:H7 (López-Cuevas et al., 2011;

López-Cuevas et al., 2012; Park et al., 2012), which

offers the hope of phage use as a broad-spectrum

food safety improvement.

Phages have been used successfully in several in

vivo research studies examining the effect of phage

on diseases that impact animal production efficiency

or health (Huff et al., 2002; Smith and Huggins, 1982;

1983; 1987). Bacteriophage treatment reduced en-

terotoxigenic E. coli (ETEC)-induced diarrhea and

splenic ETEC colonization in calves (Smith and Hug-

gins, 1983; 1987). With the increasing focus on im-

proving food safety throughout the food production

continuum, bacteriophages have been used to con-

trol experimentally inoculated foodborne patho-

genic bacteria, especially E. coli O157:H7 in cattle

gastrointestinal tracts (Bach et al., 2003; Bach et al.,

2009; Callaway et al., 2008; Kudva et al., 1999; Niu

et al., 2008; Rozema et al., 2009). Several different

phages have been isolated from feedlot cattle (Cal-

laway et al., 2006; Niu et al., 2009; Niu et al., 2012;

Oot et al., 2007) and other sources (Liu et al., 2012;

McLaughlin et al., 2006) and have been used to

reduce E. coli O157:H7 strains in experimentally-

infected animals as proofs of concept (Bach et al.,

2009; Callaway et al., 2008; Rivas et al., 2010). In oth-

er studies, naturally phage-infected ruminants have

been shown to be more resistant to E. coli O157:H7

colonization (Raya et al., 2006) and the presence

of these endemic phages have often confused re-

sults of intervention studies (Kropinski et al., 2012).

Commercialization studies for these on farm prod-

ucts have had mixed results (Stanford et al., 2010),

but studies focusing on the development of appro-

priate, effective multi-phage cocktails are currently

underway (Stanford and McAllister, personal com-

munication). No matter what point in the beef pro-

duction chain the phages are utilized in (e.g., hides

or in the live animal), they must be carefully selected

for: 1) action against multiple E. coli O157:H7 strains

as well as other non-O157 STEC strains, 2) members


of a cocktail must utilize different receptors to mini-

mize resistance development, and 3) must be strictly

lytic (i.e., does not transfer genetic material) because

phage-mediated transfer is the mechanism by which

STEC originally acquired their Shiga-toxin genes

(Brabban et al., 2005; Law, 2000).

Vaccination

Immunization has worked very effectively against

pathogenic bacteria, including E. coli strains that

cause edema disease in pigs and Salmonella in

poultry (Gyles, 1998; Johansen et al., 2000). Unfor-

tunately, because EHEC/STEC do not cause disease

in cattle, the immunostimulation provided by these

foodborne pathogens is not as potent, because it

appears that natural exposure to E. coli O157:H7

does not confer protection to the host (Gyles, 1998).

Thus vaccine production has specifically targeted as-

pects of the physiology of E. coli O157:H7 (Walle et

al., 2012). Vaccination is widely accepted in the cat-

tle industry, thus it is reasonable to predict that pro-

ducers will implement this pathogen reduction tech-

nique if the vaccine is economically feasible, and can

be incorporated into existing production systems.

To date, two basic targeting strategies have been

utilized to develop vaccines against E. coli O157:H7,

and both have had their successes (Snedeker et al.,

2012; Varela et al., 2013; Walle et al., 2012).

Siderophore Receptor and Porin (SRP) protein vaccines

Siderophores are proteins excreted by bacteria in

an effort to obtain iron from its environment, and E.

coli O157:H7 utilizes secreted siderophores in the in-

testinal tract of cattle. The SRP vaccine targets this

protein and disrupts iron transport into the bacte-

rium, resulting in cell death. The EpitopixTM SRP

vaccine has been conditionally approved for use in

cattle in the U.S. and is undergoing additional safety

and efficacy tests. Preliminary research results are

promising when the vaccine is utilized in a 3 dose

treatment regimen (Thornton et al., 2009). Other

researchers found that vaccination with the SRP re-

duced fecal concentrations of E. coli O157:H7 in

cattle by 98%, but the vaccine did not affect cattle

performance (Thomson et al., 2009). Vaccination

of cattle with this SRP in another study reduced the

prevalence of E. coli O157:H7 by nearly 50% (Fox et

al., 2009b). A two-dose SRP vaccination reduced the

prevalence and number of “high-shedding” cattle,

with a reported efficacy of 53% and 77%, respective-

ly (Cull et al., 2012). Vaccination of pregnant dams

along with a second vaccination of calves was shown

to reduce E. coli O157:H7 (from 25% to 15%, respec-

tively) in feedlot cattle (Wileman et al., 2011).

Bacterial Extract Vaccines

A vaccine produced from E. coli O157:H7 extracts

(type III secreted proteins) has been produced as

EconicheTM. This vaccine has been licensed in Can-

ada and is pending a conditional license in the U.S.

Preliminary experimental results indicated that this

vaccine reduced E. coli O157:H7 shedding in feedlot

cattle from 23% to less than 9% (Moxley et al., 2003;

Potter et al., 2004; Van Donkersgoed et al., 2005). In

an evaluation study, it was demonstrated that vac-

cination reduced fecal shedding from 46% to 14%

(Ransom et al., 2003). Recent studies have shown

an experimental three dose regimen reduced E. coli

O157:H7 shedding by 65%, but that a 2 dose system

was less effective (Moxley et al., 2009). However, in

a follow up study, a two dose regimen was shown

to reduce rectal colonization by E. coli O157:H7 in

feedlot cattle (Smith et al., 2009b). The benefits of

vaccinating cattle in reducing cattle hides positive

for E. coli O157:H7 can be lost by comingling with

non-vaccinated cattle during transport (Smith et al.,

2009a).

While the Econiche vaccine pioneered the use

of bacterial extracts, other extract-type vaccines

against multiple E. coli O157:H7 proteins (e.g., inti-

min and tir) have been produced that reduce fecal

shedding in experimental-infection models (Mc-

Neilly et al., 2010); vaccines against a hemolysin pro-


tein encoded in the locus of enterocyte effacement

(LEE) island has also shown promise in reducing E.

coli O157:H7 shedding in cattle (Sharma et al., 2011).

Vaccines targeting EspA, EspB, shiga-toxin 2, and In-

timin proteins have been used in pregnant cows, and

it was shown that the antibodies were transferred to

calves, but the effect of this vaccination on coloni-

zation was not determined (Rabinovitz et al., 2012).

Further multi-protein vaccines have been developed

that can reduce fecal shedding of E. coli O157:H7

in a sheep model (Yekta et al., 2011), including a

Stx2B-Tir-Stx1B-Zot protein vaccine that successfully

reduced E. coli O157:H7 shedding in a goat model

(Zhang et al., 2012). Most excitingly, because the

non-O157 STEC share the Type-III secretion system

proteins, it appears that vaccines targeting these

proteins (e.g., Tir, EspB, EspD, EspA, and NleA) can

provide some degree of cross-protection from the

non-O157 STEC (Asper et al., 2011).

Bacterial ghosts (e.g., cellular membranes) have

recently been used to produce an immune response

that reduced E. coli O157:H7 populations in mice

(Cai et al., 2010; Mayr et al., 2012) and calves (Vilte

et al., 2012). A live-attenuated Salmonella strain that

expresses the E. coli O157:H7 intimin protein has

been demonstrated to induce immune responses in

cattle (Khare et al., 2010). Others have devised chi-

meric multi-protein (eae, tir, intimin) vaccines (Amani

et al., 2010) that can be produced in plants, poten-

tially providing a source of an edible vaccine (Am-

ani et al., 2011) that can be included in cattle rations

rather than having to be injected via the stressful

handling procedures currently required that add ex-

pense to the producers. However, for this approach

to be utilized in ruminants, the proteins must be pro-

tected from the extensive proteolytic nature of the

rumen microbial ecosystem, which will obviously add

to the complexity and expense of vaccination via the

edible vaccine approach.

Cattle Hide washing

Currently, cattle hides are typically washed to re-

move visible contamination from hides. The hide

washes can contain antimicrobial compounds (e.g.,

organic acids [described in previous section], so-

dium hydroxide, trisodium phosphate [TSP], cetyl-

pyridinium chloride [CPC] , hypobromous acid, or

electrolyzed or ozonated water), which serves to re-

duce some of the bacterial contamination (including

foodborne pathogens) entering the processing plant

on the hide (Arthur et al., 2007b; Bosilevac et al.,

2004; Bosilevac et al., 2005a; Bosilevac et al., 2005b;

Schmidt et al., 2012). The most common hide/car-

cass rinse additive has been organic acids such as

lactic or acetic acid (Berry and Cutter, 2000; Loretz et

al., 2011). Hide washes significantly reduce the load

of E. coli O157:H7 entering the plant on the hide,

which has been linked to final carcass contamina-

tion levels (Arthur et al., 2007a; Arthur et al., 2010b),

thus improving food safety; but they do not reduce

the prevalence of E. coli O157:H7 entering the plant

within the animal.

Sodium chlorate

Addition of chlorate to E. coli cultures kills these

bacteria because E. coli can respire under anaero-

bic conditions by reducing nitrate to nitrite via the

dissimilatory nitrate reductase enzyme (Stouthamer,

1969). The intracellular bacterial enzyme nitrate re-

ductase does not differentiate between nitrate and

its analog, chlorate which is reduced to chlorite in

the cytoplasm; chlorite accumulation kills bacteria

(Stewart, 1988). Chlorate treatment in vitro quickly

reduced populations of E. coli O157:H7 and Salmo-

nella (Anderson et al., 2000a). Chlorate addition to

animal rations reduced experimentally inoculated

E. coli O157:H7 populations in swine and sheep in-

testinal tracts (Anderson et al., 2001; Edrington et

al., 2003) as well as Salmonella in broiler intestinal

contents (Byrd et al., 2003). Other studies indicated

that soluble chlorate administered via drinking water

significantly reduced E. coli O157:H7 ruminal, cecal

and fecal populations in both cattle and sheep (An-

derson et al., 2002; Callaway et al., 2002; Callaway et

al., 2003). Hide contamination with E. coli O157:H7

plays a significant role in carcass/product contami-


nation (Arthur et al., 2009; Arthur et al., 2010a; Arthur

et al., 2010b), and chlorate treatment reduces both

fecal and hide populations of E. coli (Anderson et

al., 2005). In vitro and in vivo results have indicated

that chlorate treatment does not adversely affect the

ruminal or the cecal/colonic fermentation (Anderson

et al., 2000b). Additional studies have demonstrated

that chlorate alters neither the antibiotic resistance,

nor toxin production by E. coli O157:H7 (Callaway et

al., 2004a; Callaway et al., 2004c). The LD50 of so-

dium chlorate is from 1.2 to 4 g/kg BW; by way of

comparison, the LD50 of sodium chloride is approxi-

mately 3 g/kg BW (Fiume, 1995). Therefore, it does

not appear that chlorate poses a severe risk for use

in animals due to inherent toxicity.

Because of the dramatic impact chlorate has on

food-borne pathogenic bacterial populations, it was

suggested that chlorate could be supplemented

in the last feeding before cattle are shipped to the

slaughterhouse. The use of chlorate to reduce food-

borne pathogenic bacteria in food animals is pres-

ently under review by the U. S. Food and Drug Ad-

ministration, but has not been approved at this time.

whAT ABouT PoTenTIAl unInTend-ed ConSequenCeS?

Before we attempt to completely eliminate STEC

from the live animal, we must consider the law of

unintended consequences, and its impact on food

safety (Callaway et al., 2007). The poultry industry

was hampered in the early part of the 20th century

by fowl typhoid/cholera which impacted productiv-

ity and efficiency of production. This disease was

caused by Salmonella Gallinarum and Pullorum,

which do not cause illness in humans, but do cause

illness solely in poultry (CDC, 2006). A concerted

effort was made to rid the national poultry flock of

these bacterial diseases, and this effort was success-

ful at eliminating these diseases which were highly

adapted to live only in their host (poultry). However,

by removing a member of the microbial ecosystem

from the intestinal meta-population, a niche in the

ecosystem was opened (Kingsley and Bäumler, 2000).

This niche was occupied by another Salmonella that

was not host-adapted and was transmitted from ro-

dents to poultry, Salmonella Enteritidis (Kingsley and

Bäumler, 2000). This foodborne pathogen has sub-

sequently become widespread in the national poul-

try flocks and represents one of the most common

serotypes isolated from human salmonellosis cases

(CDC, 2006; Scallan et al., 2011). Therefore, in all

our efforts to eliminate STEC from animals prior to

slaughter, we must be aware that some other bacte-

ria will undoubtedly fill the vacuum in the microbial

ecosystem.

ConCluSIonS

Pre-harvest interventions to reduce E. coli O157:H7

and other STEC in cattle can reduce foodborne

pathogen penetration into the food chain. How-

ever, implementation of these pre-harvest strate-

gies does not eliminate the need for best practices

in the processing plant and in the food preparation

environment. Recent years have seen an increase

in the research into developing new interventions

(e.g., vaccination, DFM, chlorate, phages) and into

understanding what effect the microbial population

and host physiology has on STEC populations in the

gut of cattle. This research has resulted in several

novel interventions and potential dietary additions

or changes that can reduce STEC in cattle, and many

of them are in, or very near to entering, the market-

place. However, it must be noted that the live-an-

imal interventions must be installed in a coherent,

complementary fashion to reduce pathogens as part

of an integrated multiple-hurdle approach that com-

plements other post-harvest strategies to minimize

pathogen contact and resultant human illnesses.

RefeRenCeS

Abercrombie, J. G., M. J. B. Paynter and S. S. Haya-

saka. 2006. Ability of colicin V to control Esche-

richia coli O157:H7 in ground beef. J. Food Safety

26:103-114.


Alonso, G., G. Vilchez and R. L. Vidal. 2000. How

bacteria protect themselves against channel-form-

ing colicins. Inter. Microbiol. 3:81-88.

Amani, J., S. L. Mousavi, S. Rafati and A. H. Salma-

nian. 2011. Immunogenicity of a plant-derived ed-

ible chimeric EspA, Intimin and Tir of Escherichia

coli O157:H7 in mice. Plant Sci. 180:620-627.

Amani, J., A. H. Salmanian, S. Rafati and S. L. Mousa-

vi. 2010. Immunogenic properties of chimeric pro-

tein from espA, eae and tir genes of Escherichia

coli O157:H7. Vaccine. 28:6923-6929.

Anderson, R. C., S. A. Buckley, L. F. Kubena, L. H.

Stanker, R. B. Harvey and D. J. Nisbet. 2000a.

Bactericidal effect of sodium chlorate on Esche-

richia coli O157:H7 and Salmonella Typhimurium

DT104 in rumen contents in vitro. J. Food Prot.

63:1038-1042.

Anderson, R. C., S. A. Buckley, L. H. Stanker, L. F.

Kubena, R. B. Harvey and D. J. Nisbet. 2000b. Ef-

fect of sodium chlorate on Escherichia coli concen-

tration in the bovine gut. Microb. Ecol. Health Dis.

12:109-116.

Anderson, R. C., T. R. Callaway, T. J. Anderson, L. F.

Kubena, N. K. Keith and D. J. Nisbet. 2002. Bacte-

ricidal effect of sodium chlorate on Escherichia coli

concentrations in bovine ruminal and fecal con-

tents in vivo. Microb. Ecol. Health Dis. 14:24-29.

Anderson, R. C., T. R. Callaway, S. A. Buckley, T. J.

Anderson, K. J. Genovese, C. L. Sheffield and D.

J. Nisbet. 2001. Effect of oral sodium chlorate

administration on Escherichia coli O157:H7 in the

gut of experimentally infected pigs. Int. J. Food

Microbiol. 71:125-130.

Anderson, R. C., M. A. Carr, R. K. Miller, D. A. King,

G. E. Carstens, K. J. Genovese, T. R. Callaway, T.

S. Edrington, Y. S. Jung, J. L. McReynolds, M. E.

Hume, R. C. Beier, R. O. Elder and D. J. Nisbet.

2005. Effects of experimental chlorate prepara-

tions as feed and water supplements on Esche-

richia coli colonization and contamination of beef

cattle and carcasses. Food Microbiol. 22:439-447.

Arthur, T. M., J. M. Bosilevac, D. M. Brichta-Harhay,

M. N. Guerini, N. Kalchayanand, S. D. Shackelford,

T. L. Wheeler and M. Koohmaraie. 2007a. Trans-

portation and lairage environment effects on prev-

alence, numbers, and diversity of Escherichia coli

O157:H7 on hides and carcasses of beef cattle at

processing. J. Food Prot. 70:280-286.

Arthur, T. M., J. M. Bosilevac, D. M. Brichta-Harhay,

N. Kalchayanand, S. D. Shackelford, T. L. Wheeler

and M. Koohmaraie. 2007b. Effects of a minimal

hide wash cabinet on the levels and prevalence of

Escherichia coli O157:H7 and Salmonella on the

hides of beef cattle at slaughter. J. Food Prot.

70:1076-1079.

Arthur, T. M., J. M. Bosilevac, N. Kalchayanand, J.

E. Wells, S. D. Shackelford, T. L. Wheeler and M.

Koohmaraieie. 2010a. Evaluation of a direct-fed

microbial product effect on the prevalence and

load of Escherichia coli O157:H7 in feedlot cattle.

J. Food Prot. 73:366-371.

Arthur, T. M., D. M. Brichta-Harhay, J. M. Bosilevac,

N. Kalchayanand, S. D. Shackelford, T. L. Wheeler

and M. Koohmaraie. 2010b. Super shedding of

Escherichia coli O157:H7 by cattle and the impact

on beef carcass contamination. Meat Sci. 86:32-

37.

Arthur, T. M., J. E. Keen, J. M. Bosilevac, D. M. Brich-

ta-Harhay, N. Kalchayanand, S. D. Shackelford,

T. L. Wheeler, X. Nou and M. Koohmaraie. 2009.

Longitudinal study of Escherichia coli O157:H7 in a

beef cattle feedlot and role of high-level shedders

in hide contamination. Appl. Environ. Microbiol.

75:6515-6523.

Asper, D. J., M. A. Karmali, H. Townsend, D. Rogan

and A. A. Potter. 2011. Serological response of

shiga toxin-producing Escherichia coli type III se-

creted proteins in sera from vaccinated rabbits,

naturally infected cattle, and humans. Clin. Vacc.

Immunol. 18:1052-1057.

Bach, S. J., R. P. Johnson, K. Stanford and T. A. McAl-

lister. 2009. Bacteriophages reduce Escherichia

coli O157:H7 levels in experimentally inoculated

sheep. Can. J. Anim. Sci. 89:285-293.

Bach, S. J., T. A. McAllister, D. M. Veira, V. P. J. Gan-

non and R. A. Holley. 2003. Effect of bacterio-

phage DC22 on Escherichia coli O157:H7 in an

artificial rumen system (RUSITEC) and inoculated

sheep. Anim. Res. 52:89-101.

Baines, D., S. Erb, R. Lowe, K. Turkington, E. Sabau,


G. Kuldau, J. Juba, L. Masson, A. Mazza and R.

Roberts. 2011. A prebiotic, Celmanax, decreases

Escherichia coli O157:H7 colonization of bovine

cells and feed-associated cytotoxicity in vitro.

BMC Res. Notes. 4:110-118.

Barkocy-Gallagher, G. A., T. M. Arthur, M. Rivera-Be-

tancourt, X. Nou, S. D. Shackelford, T. L. Wheeler

and M. Koohmaraie. 2003. Seasonal prevalence

of shiga toxin-producing Escherichia coli, includ-

ing O157:H7 and non-O157 serotypes, and Sal-

monella in commercial beef processing plants. J.

Food Prot. 66:1978-1986.

Berry, E. D. and C. N. Cutter. 2000. Effects of acid

adaptation of Escherichia coli O157:H7 on efficacy

of acetic acid spray washes to decontaminate beef

carcass tissue. Appl. Environ. Microbiol. 66:1493-

1498.

Bomba, A., R. Nemcová, D. Mudronová and P. Guba.

2002. The possibilities of potentiating the efficacy

of probiotics. Trends Food Sci. Technol. 13:121-

126.

Bosilevac, J. M., T. M. Arthur, T. L. Wheeler, S. D.

Shackelford, M. Rossman, J. O. Reagan and M.

Koohmaraie. 2004. Prevalence of Escherichia coli

O157 and levels of aerobic bacteria and entero-

bacteriaceae are reduced when hides are washed

and treated with cetylpyridinium chloride at a

commercial beef processing plant. J. Food Prot.

67:646-650.

Bosilevac, J. M., X. Nou, M. S. Osborn, D. M. Allen

and M. Koohmaraie. 2005a. Development and

evaluation of an on-line hide decontamination

procedure for use in a commercial beef processing

plant. J. Food Prot. 68:265-272.

Bosilevac, J. M., S. D. Shackelford, D. M. Brichta and

M. Koohmaraie. 2005b. Efficacy of ozonated and

electrolyzed oxidative waters to decontaminate

hides of cattle before slaughter. J. Food Prot.

68:1393-1398.

Brabban, A. D., E. Hite and T. R. Callaway. 2005. Evo-

lution of foodborne pathogens via temperate bac-

teriophage-mediated gene transfer. Foodborne

Path. Dis. 2:287-303.

Brashears, M. M. and M. L. Galyean. 2002. Testing

of probiotic bacteria for the elimination of Esch-

erichia coli O157:H7 in cattle. http://foodsafety.

ksu.edu/articles/263/probiotic_Ecoli_cattle.pdf.

26 April, Accessed 2013.

Brashears, M. M., M. L. Galyean, G. H. Loneragan, J.

E. Mann and K. Killinger-Mann. 2003a. Prevalence

of Escherichia coli O157:H7 and performance by

beef feedlot cattle given Lactobacillus direct-fed

microbials. J. Food Prot. 66:748-754.

Brashears, M. M., D. Jaroni and J. Trimble. 2003b.

Isolation, selection, and characterization of lactic

acid bacteria for a competitive exclusion product

to reduce shedding of Escherichia coli O157:H7 in

cattle. J. Food Prot. 66:355-363.

Byrd, J. A., R. C. Anderson, T. R. Callaway, R. W.

Moore, K. D. Knape, L. F. Kubena, R. L. Ziprin and

D. J. Nisbet. 2003. Effect of experimental chlorate

product administration in the drinking water on

Salmonella Typhimurium contamination of broil-

ers. Poult. Sci. 82:1403-1406.

Cai, K., X. Gao, T. Li, X. Hou, Q. Wang, H. Liu, L. Xiao,

W. Tu, Y. Liu, J. Shi and H. Wang. 2010. Intragas-

tric immunization of mice with enterohemorrhagic

Escherichia coli O157:H7 bacterial ghosts reduces

mortality and shedding and induces a Th2-type

dominated mixed immune response. Can. J. Mi-

crobiol. 56:389-398.

Callaway, T. R., R. C. Anderson, T. S. Edrington, K. M.

Bischoff, K. J. Genovese, T. L. Poole, J. A. Byrd, R.

B. Harvey and D. J. Nisbet. 2004a. Effects of sodi-

um chlorate on antibiotic resistance in Escherichia

coli O157:H7. Foodborne Path. Dis. 1:59-63.

Callaway, T. R., R. C. Anderson, T. S. Edrington, K. J.

Genovese, R. B. Harvey, T. L. Poole and D. J. Nis-

bet. 2004b. Recent pre-harvest supplementation

strategies to reduce carriage and shedding of zoo-

notic enteric bacterial pathogens in food animals.

Anim. Health Res. Rev. 5:35-47.

Callaway, T. R., R. C. Anderson, T. S. Edrington, Y. S.

Jung, K. M. Bischoff, K. J. Genovese, T. L. Poole,

R. B. Harvey, J. A. Byrd and D. J. Nisbet. 2004c.

Effects of sodium chlorate on toxin production by

Escherichia coli O157:H7. Curr. Iss. Intest. Micro-

biol. 5:19-22.

Callaway, T. R., R. C. Anderson, K. J. Genovese, T. L.

Poole, T. J. Anderson, J. A. Byrd, L. F. Kubena and


D. J. Nisbet. 2002. Sodium chlorate supplementa-

tion reduces E. coli O157:H7 populations in cattle.

J. Anim. Sci. 80:1683-1689.

Callaway, T. R., T. S. Edrington, R. C. Anderson, J. A.

Byrd and D. J. Nisbet. 2007. Gastrointestinal mi-

crobial ecology and the safety of our food supply

as related to Salmonella. J. Anim. Sci. 86:167-172.

Callaway, T. R., T. S. Edrington, R. C. Anderson, K. J.

Genovese, T. L. Poole, R. O. Elder, J. A. Byrd, K. M.

Bischoff and D. J. Nisbet. 2003. Escherichia coli

O157:H7 populations in sheep can be reduced by

chlorate supplementation. J. Food Prot. 66:194-

199.

Callaway, T. R., T. S. Edrington, A. D. Brabban, R. C.

Anderson, M. L. Rossman, M. J. Engler, M. A. Carr,

K. J. Genovese, J. E. Keen, M. L. Looper, E. M. Kut-

ter and D. J. Nisbet. 2008. Bacteriophage isolat-

ed from feedlot cattle can reduce Escherichia coli

O157:H7 populations in ruminant gastrointestinal

tracts. Foodborne Path. Dis. 5:183-192.

Callaway, T. R., T. S. Edrington, A. D. Brabban, J. E.

Keen, R. C. Anderson, M. L. Rossman, M. J. Engler,

K. J. Genovese, B. L. Gwartney, J. O. Reagan, T. L.

Poole, R. B. Harvey, E. M. Kutter and D. J. Nisbet.

2006. Fecal prevalence of Escherichia coli O157,

Salmonella, Listeria, and bacteriophage infecting

E. coli O157:H7 in feedlot cattle in the southern

plains region of the United States. Foodborne

Path. Dis. 3:234-244.

Callaway, T. R., T. S. Edrington, G. H. Loneragan,

M. A. Carr and D. J. Nisbet. 2013. Shiga Toxin-

producing Escherichia coli (STEC) ecology in cattle

and management based options for reducing fecal

shedding. Agric. Food Anal. Bacteriol. 3:39-69.

Callaway, T. R. and S. A. Martin. 2006. Use of fungi

and organic acids in production animal diets. In:

Ed. Feedstuffs Direct-fed Microbial, Enzyme and

Forage Additive Compendium, 8th Ed. Miller

Publishing, Inc., Minnetonka, MN. 25-33.

Callaway, T. R., C. H. Stahl, T. S. Edrington, K. J.

Genovese, L. M. Lincoln, R. C. Anderson, S. M.

Lonergan, T. L. Poole, R. B. Harvey and D. J. Nis-

bet. 2004d. Colicin concentrations inhibit growth

of Escherichia coli O157:H7 in vitro. J. Food Prot.

67:2603-2607.

CDC. 2006. Salmonella Annual Summary, 2005.

www.cdc.gov/ncidod/dbmd/phlisdata/salm-

tab/2005/SalmonellaTable1_2005.pdf 18 June

2007, Accessed.

Coffey, B., L. Rivas, G. Duffy, A. Coffey, R. P. Ross and

O. McAuliffe. 2011. Assessment of Escherichia

coli O157:H7-specific bacteriophages e11/2 and

e4/1c in model broth and hide environments. Int.

J. Food Microbiol. 147:188-194.

Collins, D. M. and G. R. Gibson. 1999. Probiotics,

prebiotics, and synbiotics: approaches for modu-

lating the microbial ecology of the gut. Amer. J.

Clin. Nutr. 69:1052S-1057S.

Cornick, N. A. 2010. Tylosin and chlorotetracycline

decrease the duration of fecal shedding of E. coli

O157:H7 by swine. Vet. Microbiol. 143:417-419.

Cull, C. A., Z. D. Paddock, T. G. Nagaraja, N. M. Bel-

lo, A. H. Babcock and D. G. Renter. 2012. Efficacy

of a vaccine and a direct-fed microbial against fe-

cal shedding of Escherichia coli O157:H7 in a ran-

domized pen-level field trial of commercial feedlot

cattle. Vaccine. 30:6210-6215.

Cutler, S. A., S. M. Lonergan, N. Cornick, A. K. John-

son and C. H. Stahl. 2007. Dietary inclusion of

colicin E1 is effective in preventing postweaning

diarrhea caused by F18-positive Escherichia coli in

pigs. Antimicrob. Ag. Chemother. 51:3830-3835.

Edrington, T. S., T. R. Callaway, R. C. Anderson, K. J.

Genovese, Y. S. Jung, R. O. Elder, K. M. Bischoff

and D. J. Nisbet. 2003. Reduction of E. coli

O157:H7 populations in sheep by supplementa-

tion of an experimental sodium chlorate product.

Small Ruminant Res. 49:173-181.

Elam, N. A., J. F. Gleghorn, J. D. Rivera, M. L. Galy-

ean, P. J. Defoor, M. M. Brashears and S. M. Younts-

Dahl. 2003. Effects of live cultures of Lactobacillus

acidophilus (strains NP45 and NP51) and Propioni-

bacterium freudenreichii on performance, carcass,

and intestinal characteristics, and Escherichia coli

strain O157 shedding of finishing beef steers. J.

Anim. Sci. 81:2686-2698.

Elder, R. O., J. E. Keen, T. E. Wittum, T. R. Callaway,

T. S. Edrington, R. C. Anderson and D. J. Nisbet.

2002. Intervention to reduce fecal shedding of

enterohemorrhagic Escherichia coli O157:H7 in


naturally infected cattle using neomycin sulfate. J.

Anim. Sci. 80 (Suppl. 1):15 (Abstr.).

Fiume, M. Z. 1995. Final report on the safety assess-

ment of potassium chlorate. J. Amer. Coll. Toxicol.

14:221-230.

Fox, J. T., J. S. Drouillard and T. G. Nagaraja. 2009a.

Competitive exclusion Escherichia coli cultures on

E. coli O157 growth in batch culture ruminal or fe-

cal microbial fermentation. Foodborne Path. Dis.

6:193-199.

Fox, J. T., D. U. Thomson, J. S. Drouillard, A. B. Thorn-

ton, D. T. Burkhardt, D. A. Emery and T. G. Naga-

raja. 2009b. Efficacy of Escherichia coli O157:H7

siderophore receptor/porin proteins-based vac-

cine in feedlot cattle naturally shedding E. coli

O157. Foodborne Path. Dis. 6:893-899.

Fuller, R. 1989. Probiotics in man and animals. J.

Appl. Bacteriol. 66:365-378.

Goodridge, L. D. 2008. Phages, bacteria, and food.

In: Abedon, S. T. Ed. Bacteriophage Ecology.

Nova Publishers, New York. 302-331.

Goodridge, L. D. 2010. Designing phage therapeu-

tics. Curr. Pharmaceut. Biotechnol. 11:15-27.

Gyles, C. L. 1998. Vaccines and shiga toxin-produc-

ing Escherichia coli in animals. In: Kaper, J. B. and

A. D. O’Brien Ed. Escherichia coli O157:H7 and

other shiga toxin-producing E. coli strains. Amer.

Soc. Microbiol. Press, Washington, DC. 434-444.

Houdijk, J. G. M., M. W. Bosch, M. W. A. Verstegen

and H. J. Berenpas. 1998. Effects of dietary oli-

gosaccharides on the growth and faecal charac-

teristics of young growing pigs. Anim. Feed Sci.

Technol. 71:35-48.

Huff, W. E., G. R. Huff, N. C. Rath, J. M. Balog, H.

Xie, P. A. Moore and A. M. Donoghue. 2002. Pre-

vention of Escherichia coli respiratory infection

in broiler chickens with bacteriophage (SPR02).

Poult. Sci. 81:437-441.

Jack, R. W., J. R. Tagg and B. Ray. 1995. Bacteriocins

of gram-positive bacteria. Microbiol. Rev. 59:171-

200.

Joerger, R. D. 2003. Alternatives to antibiotics:

Bacteriocins, antimicrobial peptides and bacterio-

phages. Poult. Sci. 82:640-647.

Johansen, M., L. O. Andresen, L. K. Thomsen, M. E.

Busch, H. Wachmann, S. E. Jorsal and C. L. Gyles.

2000. Prevention of edema disease in pigs by pas-

sive immunization. Can. J. Vet. Res. 64:9-14.

Johnson, R. P., C. L. Gyles, W. E. Huff, S. Ojha, G. R.

Huff, N. C. Rath and A. M. Donoghue. 2008. Bac-

teriophages for prophylaxis and therapy in cattle,

poultry and pigs. Anim. Health Res. Rev. 9:201-

215.

Jordi, B. J. A. M., K. Boutaga, C. M. E. Van Heeswijk,

F. Van Knapen and L. J. A. Lipman. 2001. Sensitiv-

ity of shiga toxin-producing Escherichia coli (STEC)

strains for colicins under different experimental

conditions. FEMS Microbiol. Lett. 204:329-344.

Karesh, W. B., A. Dobson, J. O. Lloyd-Smith, J. Lu-

broth, M. A. Dixon, M. Bennett, S. Aldrich, T. Har-

rington, P. Formenty, E. H. Loh, C. C. Machalaba,

M. J. Thomas and D. L. Heymann. 2012. Ecology

of zoonoses: natural and unnatural histories. Lan-

cet. 380:1936-1945.

Karmali, M. A., V. Gannon and J. M. Sargeant. 2010.

Verocytotoxin-producing Escherichia coli (VTEC).

Vet. Microbiol. 140:360-370.

Keen, J. and R. Elder. 2000. Commercial probiot-

ics are not effective for short-term control of en-

terohemorrhagic Escherichia coli O157 infection in

beef cattle. In: Proc.s 4th Intl. Symp. Works. Shiga

Toxin (Verocytotoxin)-producing Escherichia coli

Infect., Kyoto, Japan. 92 (Abstr.).

Khare, S., W. Alali, S. Zhang, D. Hunter, R. Pugh, F.

C. Fang, S. J. Libby and L. G. Adams. 2010. Vac-

cination with attenuated Salmonella enterica Dub-

lin expressing E. coli O157:H7 outer membrane

protein Intimin induces transient reduction of fecal

shedding of E. coli O157:H7 in cattle. BMC Vet.

Res. 6:35-47.

Kim, Y., S. H. Kim, K. Y. Whang, Y. J. Kim and S. Oh.

2008. Inhibition of Escherichia coli O157:H7 at-

tachment by interactions between lactic acid bac-

teria and intestinal epithelial cells. J. Microbiol.

Biotechnol. 18:1278-1285.

Kingsley, R. A. and A. J. Bäumler. 2000. Host adapta-

tion and the emergence of infectious disease: The

Salmonella paradigm. Molec. Microbiol. 36:1006-

1014.

Konisky, J. 1982. Colicins and other bacteriocins


with established modes of action. Ann. Rev. Mi-

crobiol. 36:125-144.

Kropinski, A. M., E. J. Lingohr, D. M. Moyles, H. W.

Ackermann, S. Ojha, A. Mazzocco, Y. M. She, S. J.

Bach, E. A. Rozema, K. Stanford, T. A. McAllister

and R. P. Johnson. 2012. Endemic bacteriophages:

A cautionary tale for evaluation of bacteriophage

therapy and other interventions for infection con-

trol in animals. Virol. J. 9:207-216.

Kudva, I. T., S. Jelacic, P. I. Tarr, P. Youderian and C. J.

Hovde. 1999. Biocontrol of Escherichia coli O157

with O157-specific bacteriophages. Appl. Environ.

Microbiol. 65:3767-3773.

Kutter, E. and A. Sulakvelidze. 2005. Bacterio-

phages: Biology and Applications. CRC Press,

New York.

Lakey, J. H. and S. L. Slatin. 2001. Pore-forming coli-

cins and their relatives. In: Van Der Goot, F. G. Ed.

Pore-forming toxins. Springer-Verlag GmbH & Co.

KG, Berlin. pp. 131-161.

Law, D. 2000. The history and evolution of Esche-

richia coli O157 and other shiga toxin-producing E.

coli. World J. Microbiol. Biotechnol. 16:701-709.

Leatham, M. P., S. Banerjee, S. M. Autieri, R. Mer-

cado-Lubo, T. Conway and P. S. Cohen. 2009.

Precolonized human commensal Escherichia coli

strains serve as a barrier to E. coli O157:H7 growth

in the streptomycin-treated mouse intestine. In-

fect. Immun. 77:2876-2886.

Lederberg, J. 1996. Smaller Fleas...ad infinitum:

Therapeutic bacteriophage redux. Proc. Natl.

Acad. Sci. USA. 93:3167-3168.

LeJeune, J. and A. Kersting. 2010. Zoonoses: An oc-

cupational hazard for livestock workers and a pub-

lic health concern for rural communities. J. Agric.

Safe. Health. 16:161-179.

LeJeune, J. T. and A. N. Wetzel. 2007. Preharvest

control of Escherichia coli O157 in cattle. J. Anim.

Sci. 85:e73-80.

Lema, M., L. Williams and D. R. Rao. 2001. Reduc-

tion of fecal shedding of enterohemorrhagic Esch-

erichia coli O157:H7 in lambs by feeding microbial

feed supplement. Small Rum. Res. 39:31-39.

Liu, S. M., D. M. Miller and R. F. Roberts. 2011. Clon-

ing of genes encoding colicin E2 in Lactococcus

lactis subspecies lactis and evaluation of the coli-

cin-producing transformants as inhibitors of Esch-

erichia coli O157:H7 during milk fermentation. J.

Dairy Sci. 94:1146-1154.

Liu, Y., J. H. Li, H. Y. Shi, J. P. Wen and Y. B. Sun. 2012.

Biological characteristics of enterohemorrhagic E.

coli O157-specific bacteriophages isolated from

raw sewage. J. Jilin Univ. Med. Ed. 38:79-83.

López-Cuevas, O., N. Castro-del Campo, J. León-

Félix, A. González-Robles and C. Chaidez. 2011.

Characterization of bacteriophages with a lytic

effect on various Salmonella serotypes and Esch-

erichia coli O157:H7. Can. J. Microbiol. 57:1042-

1051.

López-Cuevas, O., N. Castro-Del Campo, J. León-

Félix, B. Valdez-Torres and C. Chaidez. 2012. Eval-

uation of bacteriophage av-08 for simultaneous

biocontrol of Salmonella Montevideo and Esch-

erichia coli O157: H7 in experimentally contami-

nated chicken skin. J. Food Safety 32:305-310.

Loretz, M., R. Stephan and C. Zweifel. 2011. An-

tibacterial activity of decontamination treatments

for cattle hides and beef carcasses. Food Control.

22:347-359.

Martin, S. A. and D. J. Nisbet. 1992. Effect of direct-

fed microbials on rumen microbial fermentation.

J. Dairy Sci. 75:1736-1744.

Mayr, U. B., P. Kudela, A. Atrasheuskaya, E. Bukin, G.

Ignatyev and W. Lubitz. 2012. Rectal single dose

immunization of mice with Escherichia coli O157:

H7 bacterial ghosts induces efficient humoral and

cellular immune responses and protects against

the lethal heterologous challenge. Microb. Bio-

technol. 5:283-294.

McAllister, T. A., K. A. Beauchemin, A. Y. Alazzeh, J.

Baah, R. M. Teather and K. Stanford. 2011. Re-

view: The use of direct fed microbials to mitigate

pathogens and enhance production in cattle. Can.

J. Anim. Sci. 91:193-211.

McLaughlin, M. R., M. F. Balaa, J. Sims and R. King.

2006. Isolation of Salmonella bacteriophages from

swine effluent lagoons. J. Environ. Qual. 35:522-

528.

McNeilly, T. N., M. C. Mitchell, T. Rosser, S. McAteer,

J. C. Low, D. G. E. Smith, J. F. Huntley, A. Mahajan


and D. L. Gally. 2010. Immunization of cattle with

a combination of purified intimin-531, EspA and

Tir significantly reduces shedding of Escherichia

coli O157:H7 following oral challenge. Vaccine.

28:1422-1428.

Moxley, R. A., D. Smith, T. J. Klopfenstein, G. Erick-

son, J. Folmer, C. Macken, S. Hinkley, A. Potter and

B. Finlay. 2003. Vaccination and feeding a com-

petitive exclusion product as intervention strate-

gies to reduce the prevalence of Escherichia coli

O157:H7 in feedlot cattle. In: Proc.s Proc. 5th Int.

Symp. on Shiga Toxin-Producing Escherichia coli

Infections, Edinburgh, UK. 23 (Abstr.).

Moxley, R. A., D. R. Smith, M. Luebbe, G. E. Erickson,

T. J. Klopfenstein and D. Rogan. 2009. Escherichia

coli O157:H7 vaccine dose-effect in feedlot cattle.

Foodborne Path. Dis. 6:879-884.

Murinda, S. E., S. M. Liu, R. F. Roberts and R. A. Wil-

son. 1998. Colicinogeny among Escherichia coli

serotypes, including O157:H7, representing four

closely related diarrheagenic clones. J. Food Prot.

61:1431-1438.

Murinda, S. E., R. F. Roberts and R. A. Wilson. 1996.

Evaluation of colicins for inhibitory activity against

diarrheagenic Escherichia coli strains, includ-

ing serotype O157:H7. Appl. Environ. Microbiol.

62:3192-3202.

Nandiwada, L. S., G. P. Schamberger, H. W. Schafer

and F. Diez-Gonzalez. 2004. Characterization of

an E2-type colicin and its application to treat alfal-

fa seeds to reduce Escherichia coli O157:H7. Int. J.

Food Microbiol. 93:267-279.

Niu, Y. D., T. A. McAllister, Y. Xu, R. P. Johnson, T.

P. Stephens and K. Stanford. 2009. Prevalence

and impact of bacteriophages on the presence of

Escherichia coli O157:H7 in feedlot cattle and their

environment. Appl. Environ. Microbiol. 75:1271-

1278.

Niu, Y. D., K. Stanford, H. W. Ackermann and T. A.

McAllister. 2012. Characterization of 4 T1-like lytic

bacteriophages that lyse Shiga-toxin Escherichia

coli O157:H7. Can. J. Microbiol. 58:923-927.

Niu, Y. D., Y. Xu, T. A. McAllister, E. A. Rozema, T. P.

Stephens, S. J. Bach, R. P. Johnson and K. Stanford.

2008. Comparison of fecal versus rectoanal mu-

cosal swab sampling for detecting Escherichia coli

O157:H7 in experimentally inoculated cattle used

in assessing bacteriophage as a mitigation strat-

egy. J. Food Prot. 71:691-698.

Nurmi, E., L. Nuotio and C. Schncitz. 1992. The

competitive exclusion concept: development and

future. Int. J. Food Microbiol. 15:237-240.

Ohya, T., M. Akiba and H. Ito. 2001. Use of a trial

probiotic product in calves experimentally infect-

ed with Escherichia coli O157. Japan Agric. Res.

Quart. 35:189-194.

Oliver, S. P., D. A. Patel, T. R. Callaway and M. E. Tor-

rence. 2008. ASAS Centennial Paper: Develop-

ments and future outlook for preharvest food safe-

ty. J. Anim. Sci. 87:419-437.

Oot, R. A., R. R. Raya, T. R. Callaway, T. S. Edrington,

E. M. Kutter and A. D. Brabban. 2007. Prevalence

of Escherichia coli O157 and O157:H7-infecting

bacteriophages in feedlot cattle feces. Lett. Appl.


Park, M., J. H. Lee, H. Shin, M. Kim, J. Choi, D. H.

Kang, S. Heu and S. Ryu. 2012. Characterization

and comparative genomic analysis of a novel bac-

teriophage, SFP10, simultaneously inhibiting both

Salmonella enterica and Escherichia coli O157:H7.

Appl. Environ. Microbiol. 78:58-69.

Patterson, J. A. and K. M. Burkholder. 2003. Appli-

cation of prebiotics and probiotics in poultry pro-

duction. Poult. Sci. 82:627-631.

Patton, B. S., S. M. Lonergan, S. A. Cutler, C. H. Stahl

and J. S. Dickson. 2008. Application of colicin E1

as a prefabrication intervention strategy. J. Food

Prot. 71:2519-2522.

Potter, A. A., S. Klashinsky, Y.Li, E. Frey, H. Townsend,

D. Rogan, G. Erickson, S. Hinkley, T. Klopfenstein,

R. A. Moxley, D. R. Smith and B. B. Finlay. 2004.

Decreased shedding of Escherichia coli O157:H7

by cattle following vaccination with type III secret-

ed proteins. Vaccine. 22:362-369.

Rabinovitz, B. C., E. Gerhardt, C. Tironi Farinati, A.

Abdala, R. Galarza, D. A. Vilte, C. Ibarra, A. Cataldi

and E. C. Mercado. 2012. Vaccination of pregnant

cows with EspA, EspB, γ-intimin, and Shiga toxin

2 proteins from Escherichia coli O157: H7 induc-

es high levels of specific colostral antibodies that


are transferred to newborn calves. J. Dairy Sci.

95:3318-3326.

Raya, R. R., P. Varey, R. A. Oot, M. R. Dyen, T. R. Cal-

laway, T. S. Edrington, E. M. Kutter and A. D. Brab-

ban. 2006. Isolation and characterization of a new

T-even bacteriophage, CEV1, and determination

of its potential to reduce Escherichia coli O157:H7

levels in sheep. Appl. Environ. Microbiol. 72:6405-

6410.

Reissbrodt, R., W. P. Hammes, F. Dal Bello, R. Prager,

A. Fruth, K. Hantke, A. Rakin, M. Starcic-Erjavec

and P. H. Williams. 2009. Inhibition of growth of

Shiga toxin-producing Escherichia coli by non-

pathogenic Escherichia coli. FEMS Microbiol. Lett.

290:62-69.

Ricke, S. C. 2003. Perspectives on the use of organic

acids and short chain fatty acids as antimicrobials.

Poult. Sci. 82:632-639.

Ricke, S. C., P. Hererra and D. Biswas. 2012. Bacte-

riophages for potential food safety applications in

organic meat production. In: S. C. Ricke, E. J. Van

Loo, M. G. Johnson and C. A. O’Bryan Ed. Organ-

ic meat production and processing. John Wiley &

Sons, Inc., New York. 407-424.

Rivas, L., B. Coffey, O. McAuliffe, M. J. McDonnell,

C. M. Burgess, A. Coffey, R. P. Ross and G. Duffy.

2010. In vivo and ex vivo evaluations of bacterio-

phages e11/2 and e4/1c for use in the control of

Escherichia coli O157:H7. Appl. Environ. Micro-

biol. 76:7210-7216.

Rodriguez-Palacios, A., H. R. Staempfli, T. Duffield

and J. S. Weese. 2009. Isolation of bovine intes-

tinal Lactobacillus plantarum and Pediococcus aci-

dilactici with inhibitory activity against Escherichia

coli O157 and F5. J. Appl. Microbiol. 106:393-401.

Rotariu, O., I. Ogden, L. MacRitchie, K. Forbes, A.

Williams, P. Cross, C. Hunter, P. Teunis and N. Stra-

chan. 2012. Combining risk assessment and epi-

demiological risk factors to elucidate the sources

of human E. coli O157 infection. Epidemiol. Infect.

140:1414-1429.

Rozema, E. A., T. P. Stephens, S. J. Bach, E. K. Okine,

R. P. Johnson, K. I. M. Stanford and T. A. McAllister.

2009. Oral and rectal administration of bacterio-

phages for control of Escherichia coli O157:H7 in

feedlot cattle. J. Food Prot. 72:241-250.

Russell, J. B. 1992. Another explanation for the

toxicity of fermentation acids at low pH: anion ac-

cumulation versus uncoupling. J. Appl. Bacteriol.

73:363-370.

Sargeant, J. M., M. R. Amezcua, A. Rajic and L. Wad-

dell. 2007. Pre-harvest interventions to reduce the

shedding of E. coli O157 in the faeces of weaned

domestic ruminants: a systematic review. Zoonos.

Pub. Health. 54:260-277.

Sawant, A. A., N. C. Casavant, D. R. Call and T. E.

Besser. 2011. Proximity-dependent inhibition in

Escherichia coli isolates from cattle. Appl. Environ.

Microbiol. 77:2345-2351.

Scallan, E., R. M. Hoekstra, F. J. Angulo, R. V. Tauxe,

M.-A. Widdowson, S. L. Roy, J. L. Jones and P. L.

Griffin. 2011. Foodborne illness acquired in the

United States—major pathogens. Emerg. Infect.

Dis. 17:7-15.

Schamberger, G. P. and F. Diez-Gonzalez. 2002.

Selection of recently isolated colicinogenic Esch-

erichia coli strains inhibitory to Escherichia coli

O157:H7. J. Food Prot. 65:1381-1387.

Schamberger, G. P., R. L. Phillips, J. L. Jacobs and

F. Diez-Gonzalez. 2004. Reduction of Escherichia

coli O157:H7 populations in cattle by addition of

colicin E7-producing E. coli to feed. Appl. Environ.

Microbiol. 70:6053-6060.

Scharff, R. L. 2010. Health-related costs from

foodborne illness in the United States. http://

www.publichealth.lacounty.gov/eh/docs/Report-

Publication/HlthRelatedCostsFromFoodborneIlli-

nessUS.pdf. 3 May, Accessed 2010.

Schmidt, J. W., R. Wang, N. Kalchayanand, T. L.

Wheeler and M. Koohmaraie. 2012. Efficacy of hy-

pobromous acid as a hide-on carcass antimicrobial

intervention. J. Food Prot. 75:955-958.

Schrezenmeir, J. and M. De Vrese. 2001. Probiotics,

prebiotics, and synbiotics-approaching a defini-

tion. Am. J. Clin. Nutr. 73(Suppl.):354s-361s.

Sharma, V. K., E. A. Dean-Nystrom and T. A. Casey.

2011. Evaluation of hha and hha sepB mutant

strains of Escherichia coli O157:H7 as bacterins for

reducing E. coli O157:H7 shedding in cattle. Vac-

cine. 29:5078-5086.


Siragusa, G. R. and S. C. Ricke. 2012. Probiotics as

pathogen control agents for organic meat produc-

tion. In: S. C. Ricke, E. J. Van Loo, M. G. Johnson

and C. A. O’Bryan Ed. Organic meat production

and processing. John Wiley & Sons, Inc., New

York. 331-349.

Smarda, J. and D. Smajs. 1998. Colicins- Exocellular

lethal proteins of Escherichia coli. Folia Microbiol.

43:563-582.

Smith, D. R., R. A. Moxley, T. J. Klopfenstein and G. E.

Erickson. 2009a. A randomized longitudinal trial

to test the effect of regional vaccination within a

cattle feedyard on Escherichia coli O157:H7 rectal

colonization, fecal shedding, and hide contamina-

tion. Foodborne Path. Dis. 6:885-892.

Smith, D. R., R. A. Moxley, R. E. Peterson, T. J. Klop-

fenstein, G. E. Erickson, G. Bretschneider, E. M.

Berberov and S. Clowser. 2009b. A two-dose regi-

men of a vaccine against type III secreted proteins

reduced Escherichia coli O157:H7 colonization of

the terminal rectum in beef cattle in commercial

feedlots. Foodborne Path. Dis. 6:155-161.

Smith, H. W. and R. B. Huggins. 1982. Successful

treatment of experimental E. coli infections in mice

using phage: its general superiority over antibiot-

ics. J. Gen. Microbiol. 128:307-318.

Smith, H. W. and R. B. Huggins. 1983. Effectiveness

of phages in treating experimental Escherichia coli

diarrhoea in calves, piglets and lambs. J. Gen. Mi-

crobiol. 129:2659-2675.

Smith, H. W. and R. B. Huggins. 1987. The control of

experimental E. coli diarrhea in calves by means of

bacteriophage. J. Gen. Microbiol. 133:1111-1126.

Snedeker, K. G., M. Campbell and J. M. Sargeant.

2012. A systematic review of vaccinations to re-

duce the shedding of Escherichia coli O157 in the

faeces of domestic ruminants. Zoono. Pub. Health.

59:126-138.

Stahl, C. H., T. R. Callaway, L. M. Lincoln, S. M. Loner-

gan and K. J. Genovese. 2004. Inhibitory activities

of colicins against Escherichia coli strains respon-

sible for postweaning diarrhea and edema disease

in swine. Antimicrob. Ag. Chemother. 48:3119-

3121.

Stanford, K., T. A. McAllister, Y. D. Niu, T. P. Stephens,

A. Mazzocco, T. E. Waddell and R. P. Johnson.

2010. Oral delivery systems for encapsulated bac-

teriophages targeted Escherichia coli O157: H7 in

feedlot cattle. J. Food Prot. 73:1304-1312.

Stephens, T. P., G. H. Loneragan, L. M. Chichester

and M. M. Brashears. 2007a. Prevalence and enu-

meration of Escherichia coli O157 in steers receiv-

ing various strains of Lactobacillus-based direct-

fed microbials. J. Food Prot. 70:1252-1255.

Stephens, T. P., G. H. Loneragan, E. Karunasena and

M. M. Brashears. 2007b. Reduction of Escherichia

coli O157 and Salmonella in feces and on hides of

feedlot cattle using various doses of a direct-fed

microbial. J. Food Prot. 70:2386-2391.

Stewart, V. J. 1988. Nitrate respiration in relation to

facultative metabolism in enterobacteria. Micro-

biol. Rev. 52:190-232.

Stouthamer, A. H. 1969. A genetical and biochemi-

cal study of chlorate-resistant mutants of Salmo-

nella typhimurium. Antoine van Leeuwenhoek.

35:505-521.

Swyers, K. L., B. A. Carlson, K. K. Nightingale, K. E.

Belk and S. L. Archibeque. 2011. Naturally colo-

nized beef cattle populations fed combinations of

yeast culture and an ionophore in finishing diets

containing dried distiller’s grains with solubles had

similar fecal shedding of Escherichia coli O157:H7.

J. Food Prot. 74:912-918.

Tanji, Y., T. Shimada, H. Fukudomi, K. Miyanaga, Y.

Nakai and H. Unno. 2005. Therapeutic use of

phage cocktail for controlling Escherichia coli

O157:H7 in gastrointestinal tract of mice. J. Biosci.

Bioeng. 100:280-287.

Thomson, D. U., G. H. Loneragan, A. B. Thornton, K.

F. Lechtenberg, D. A. Emery, D. T. Burkhardt and T.

G. Nagaraja. 2009. Use of a siderophore recep-

tor and porin proteins-based vaccine to control

the burden of Escherichia coli O157:H7 in feedlot

cattle. Foodborne Path. Dis. 6:871-877.

Thornton, A. B., D. U. Thomson, G. H. Loneragan, J.

T. Fox, D. T. Burkhardt, D. A. Emery and T. G. Naga-

raja. 2009. Effects of a siderophore receptor and

porin proteins-based vaccination on fecal shed-

ding of Escherichia coli O157:H7 in experimentally

inoculated cattle. J. Food Prot. 72:866-869.


Tournut, J. 1989. Applications of probiotics to ani-

mal husbandry. Rev. Sci. Tech. Off. Int. Epiz. 8:551-

566.

Van Donkersgoed, J., D. Hancock, D. Rogan and A.

A. Potter. 2005. Escherichia coli O157:H7 vaccine

field trial in 9 feedlots in Alberta and Saskatche-

wan. Can. Vet. J. 46:724-728.

Varela, N. P., P. Dick and J. Wilson. 2013. Assess-

ing the existing information on the efficacy of bo-

vine vaccination against Escherichia coli O157: H7

- a systematic review and meta-analysis. Zoonos.

Pub. Health. 60:253-268.

Vilte, D. A., M. Larzábal, U. B. Mayr, S. Garbaccio, M.

Gammella, B. C. Rabinovitz, F. Delgado, V. Meikle,

R. J. C. Cantet, P. Lubitz, W. Lubitz, A. Cataldi and

E. C. Mercado. 2012. A systemic vaccine based

on Escherichia coli O157:H7 bacterial ghosts (BGs)

reduces the excretion of E. coli O157:H7 in calves.

Vet. Immunol. Immunopathol. 146:169-176.

Walker, W. A. and L. C. Duffy. 1998. Diet and bacte-

rial colonization: Role of probiotics and prebiotics.

J. Nutr. Biochem. 9:668-675.

Walle, K. V., D. Vanrompay and E. Cox. 2012. Bovine

innate and adaptive immune responses against

Escherichia coli O157:H7 and vaccination strate-

gies to reduce faecal shedding in ruminants. Vet.

Immunol. Immunopathol. 152:109-120.

Wileman, B. W., D. U. Thomson, K. C. Olson, J. R.

Jaeger, L. A. Pacheco, J. Bolte, D. T. Burkhardt, D.

A. Emery and D. Straub. 2011. Escherichia coli

O157:H7 shedding in vaccinated beef calves born

to cows vaccinated prepartum with Escherichia coli

O157:H7 SRP vaccine. J. Food Prot. 74:1599-1604.

Willard, M. D., R. B. Simpson, N. D. Cohen and J. S.

Clancy. 2000. Effects of dietary fructooligosaccha-

ride on selected bacterial populations in feces of

dogs. Amer. J. Vet. Res. 61:820-825.

Wolin, M. J. 1969. Volatile fatty acids and the in-

hibition of Escherichia coli growth by rumen fluid.

Appl. Microbiol. 17:83-87.

Yekta, M. A., B. M. Goddeeris, D. Vanrompay and E.

Cox. 2011. Immunization of sheep with a combi-

nation of intiminγ, EspA and EspB decreases Esch-

erichia coli O157:H7 shedding. Vet. Immunol. Im-

munopathol. 140:42-46.

Yoon, I. K. and M. D. Stern. 1996. Effects of Saccha-

romyces cerevisiae and Aspergillus oryzae cultures

on ruminal fermentation in dairy cows. J. Dairy Sci.

79:411-417.

Younts-Dahl, S. M., M. L. Galyean, G. H. Loneragan,

N. A. Elam and M. M. Brashears. 2004. Dietary

supplementation with Lactobacillus- and Propioni-

bacterium-based direct-fed microbials and preva-

lence of Escherichia coli O157 in beef feedlot cattle

and on hides at harvest. J. Food Prot. 67:889-893.

Zhang, X. H., K. W. He, P. D. Zhao, Q. Ye, X. T. Luan,

Z. Y. Yu, L. B. Wen, Y. X. Ni, B. Li, X. M. Wang, R.

L. Guo, J. M. Zhou and A. H. Mao. 2012. Intrana-

sal immunisation with Stx2B-Tir-Stx1B-Zot protein

leads to decreased shedding in goats after chal-

lenge with Escherichia coli O157:H7. Vet. Rec.

170:178-186.

Zhao, T., M. P. Doyle, B. G. Harmon, C. A. Brown,

P. O. E. Mueller and A. H. Parks. 1998. Reduc-

tion of carriage of enterohemorrhagic Escherichia

coli O157:H7 in cattle by inoculation with probiotic

bacteria. J. Clin. Microbiol. 36:641-647.

Zhao, T., S. Tkalcic, M. P. Doyle, B. G. Harmon, C. A.

Brown and P. Zhao. 2003. Pathogenicity of entero-

hemorrhagic Escherichia coli in neonatal calves

and evaluation of fecal shedding by treatment with

probiotic Escherichia coli. J. Food Prot. 66:924-

930.

Zopf, D. and S. Roth. 1996. Oligosaccharide anti-

infective agents. The Lancet (North America).

347:1017-1021.




ABSTRACT

As the biofuels industry continues to grow and technologies to recover fermentable sugars from feed-

stocks improve, the leftover byproducts are becoming richer in proteins. These byproducts could poten-

tially serve as sources of dietary protein for food animals. However, the uneven quality as well as the poten-

tially large quantities would need the assessment of bioavailability of the amino acid content for the proper

formulation of these for animal diets, which would require in vitro assays that best approximated animal

bioavailability response. Among the in vitro methods, Escherichia coli – based biosensors show promise to

fulfill this need. With the bulk of the work done on lysine and methionine, considerable research has been

conducted on E. coli – based biosensors to optimize culture conditions and improve detection sensitivities.

This review will discuss the current knowledge on E. coli – based biosensors and potential research direc-

tions for the future.

Keywords: Escherichia coli, biosensors, amino acids, biofuels, feedstocks, rapid, bioassay

InTRoduCTIon

In recent years the emergence of cereal crops as

biofuel feedstocks has grown to the extent that for

some cereal grains, such as corn, bioethanol produc-

tion has directly competed with its more traditional

use as food and feed (Wisner and Baumel, 2004;

Mayday, 2007). This competition has generated con-

Correspondence: Ruben Morawicki, [email protected]: +1 -479-575-4923 Fax: +1-479-575-6936

siderable debate on the economics on further devel-

opment of grain crops to generate ethanol (Wisner

and Baumel, 2004; Johnson, 2007; Mayday, 2007;

Buyx and Tait, 2011).

Biofuel economic issues are reflected in not only

the price and availability of the cereal grain sub-

strates but also in the availability and efficiency of

the fermentation (Somma et al., 2010). In addition,

the efficiency of ethanol production by yeasts can

be compromised by the presence of other unde-

sirable microorganisms, which not only compete

REVIEWPotential for Rapid Analysis of

Bioavailable Amino Acids in Biofuel Feed StocksD. E. Luján-Rhenals1,2 and Ruben Morawicki1

1 Food Science Department, 2650 Young Ave., University of Arkansas, Fayetteville, AR

2 Current address: Universidad de Córdoba, sede Berástegui. Km. 12 vía Cereté-Ciénaga de Oro, Córdoba, Colombia



for substrates but potentially inhibit yeasts by pro-

ducing organic acids with antimicrobial properties

(Ricke, 2003; Muthaiyan and Ricke, 2010; Muthaiyan

et al., 2011; Limayen and Ricke, 2012). Some of the

inhibition issues can be resolved with further im-

provements on the genetics of ethanol-producing

microorganisms (Ragauskas et al., 2006; Limayen

and Ricke, 2012). Several opportunities exist for ei-

ther genetically modifying microorganisms to utilize

more diverse carbon substrates or isolating microor-

ganisms with these capabilities (Limayen and Ricke,

2012). However, for ethanolic fermentations, achiev-

ing better carbon/sugar extraction efficiencies is

only part of the solution.

Despite the apparent competing interests be-

tween the biofuel industry and the livestock agri-

cultural sector, the opportunities for a more syner-

gistic relationship are possible. As the development

of more sophisticated biofuel processes continues,

it is anticipated that a more efficient extraction of

carbon for biofuel generation will become more

pronounced, which will leave carbon-poor-protein-

enriched byproducts that are of limited use as bio-

fuel substrates. However, these byproducts offer

proteins that can serve as amino acid sources for

meeting animal nutritional requirements. Besides

the fact that these protein sources may have variable

availability, there are other potential problems in-

cluding non-optimal levels of essential amino acids

and imbalances in amino acid profiles, which can be

problematic when fed to animals as excess dietary

protein. This can result in environmental nitrogen

emission that can not only be an economic waste

but also result in the contamination of surface and

ground water sources from excess animal nitrogen

emissions (Kim et al., 2006; Chalova et al., 2009a;

Hunde et al., 2012). Some of these problems can be

solved via supplementation of the deficient amino

acids identified in the dietary formulation. However,

the key for correct supplementation depends on

both the identification of deficient amino acids and

the quantification of their availability. The remainder

of this review focuses on defining amino acid avail-

ability in general with particular emphasis on lysine,

which is one of the most critical amino acids. To con-

clude, a discussion will cover the emergence of rapid

methods for quantifying amino acids in general, par-

ticularly lysine.

BIoAvAIlABIlITy of AMIno ACIdS

Bioavailability of a particular dietary amino acid is

the fraction of the ingested amino acid that is ab-

sorbed in a chemical form suitable for metabolism or

protein synthesis (Batterham, 1992; Johnson, 1992;

Lewis and Bayley, 1995; Zebrowski and Buraczewski,

1998; Gabert et al., 2001). Traditionally, the gold stan-

dard to estimate amino acid availability has been the

use of in vivo assays (Sauer and Ozimek, 1986; Apple-

gate et al., 2004). Another traditional method uses

a slope-ratio assay to estimate the bioavailability, in

which the response—whole body protein deposition

(Batterham, 1992) or amino acid oxidation (Moehn et

al., 2005)—is correlated with the amino acid intake.

Amino acid availability is determined by comparing

the regression line of the test diet with a reference

protein diet. The ratio of the slope of the test feed

ingredient to the slope of the reference protein rep-

resents the relative bioavailability of the amino acid

in question.

Unfortunately, these animal-based bioavailability

and digestibility methods are expensive, tedious,

and time-consuming (2 to 4 weeks) and do not lend

themselves well to high-throughput analyses that

would be needed for large numbers of samples (Er-

ickson et al., 2002). Additionally, they require special

facilities and large amounts dietary materials. In ad-

dition, these in vivo methods are limited in the num-

ber of feed ingredients that can be compared simul-

taneously and increasing animal welfare concerns

make it more difficult to conduct the trials (Erickson

et al., 2002; Chalova et al., 2009a).

There are no direct in vitro measures of amino

acid bioavailability that duplicate exactly in vivo tests

because of the complexity of the intestinal system

and animal variability (Ravindran and Bryden., 1999;

Erickson et al., 2002; Applegate et al., 2004; Chalova

et al., 2009a, b, 2010). Although chemical separation-

based methods, for instance high performance liq-


uid chromatography (HPLC) or gas chromatography,

are rapid and easily available, the determination of

amino acid concentrations in feed ingredients does

not reflect the actual amounts of amino acids ab-

sorbed under physiological conditions (Kivi, 2000;

Ericksonet al., 2002; Froelich and Ricke, 2005). How-

ever, some of the in vitro methods that are available,

such as amino acid enzyme-based digestibility and

microbiological (biosensor) assays, can approximate

values generated from animal studies (Erickson et

al., 1999a; Chalova et al., 2007, Schasteen et al.,

2007; Stein et al., 2007). Among them, microbiologi-

cal assays for amino acid bioavailability are consid-

ered one of the most effective approaches in terms

of time, cost and variability (Erickson et al., 2002; Fro-

elich and Ricke, 2005; Chalova et al., 2009a,b, 2010).

MICRoBIAl-BASed AMIno ACId BIo-SenSoRS

Rapid tools with high specificity for food and fer-

mentation analysis, such as new biosensor- based

assays, are continually being developed to detect

and quantify nutritional components, food additives,

and contaminants. Biosensors consist of microor-

ganisms—mainly bacteria due to rapid growth—or

enzymes that can interact either physiologically or

chemically with low concentrations of a compound

of interest (Lei et al., 2006). Biosensors are very spe-

cific, sensitive, and flexible to use, and do not re-

quire large and expensive instrumentation as chemi-

cal analyses do (Chalova et al., 2009a, b). Common

applications of bacterial-based biosensors include

detection of antibiotics, ethanol, metals, phenolic

compounds, sugars, urea and vitamins, as well as

other compounds (Ricke and Zabala-Díaz, 2001; Lei

et al., 2006; Chalova et al., 2009a, b).

A microbial cell-based biosensor, also referred to

as a whole cell sensor, consists of a viable bacterial

cell that has been selected or genetically modified

to quantify a particular metabolite. It is followed by

a detection device that typically uses a colorimetric

enzymatic response, a bioluminescence reaction, or

fluorescence mediated by a green fluorescent pro-

tein (Lei et al., 2006; Chalova et al., 2009a). The abil-

ity of a microorganism to grow on a particular nutri-

ent is the basis for detection and the extent of the

growth provides data for quantification.

Quantification can be done by following the opti-

cal density with a spectrophotometer, the lumines-

cence in cells containing the lux gene, or the fluo-

rescence in cells containing genes that synthesize

green fluorescence proteins (GFP). The levels of

growth are consistently proportional to the external

concentration of the metabolite of interest (Erickson

et al., 2000, 2002; Froelich and Ricke, 2005; Chalo-

va et al., 2007; 2008b, 2009a, b, 2010; Bertels et al.,

2012). More direct biosensor assays are possible by

constructing gene fusions between promoter genes,

which recognize a particular external metabolite,

and a structural gene element responsible for syn-

thesizing lux gene-based proteins or GFP (Lei et al.,

2006; Zabala-Díaz et al., 2007; Chalova et al., 2008a,

2009c).

E. coli-BASed AMIno ACId BIoSen-SoRS

Microbial methods for quantification of amino acid

bioavailability are generally considered user friendly,

relatively precise, specific, and economical (Shock-

man, 1963; Erickson et al., 2002). They include differ-

ent assay microorganisms, which are based on their

nutritive requirements for the respective amino acid

(Shockman, 1963). E. coli has been one of the most

highly investigated microorganisms for amino acid

bioavailability quantification because this bacterium

offers several advantages over other microorganisms

as originally outlined by Payne and Tuffnell (1980).

These advantages include: (1) it has one of the low-

est doubling times (one of the fastest growth rates)

among bacteria; (2) it is relatively easy to growth with

minimal nutritional supplementation of the media;

(3) the genetics are extremely well established and

universally recognized; and (4) it can be easily ma-

nipulated to produce desired phenotypic responses

for each respective nutrient to be assayed, such as

amino acids. Additionally, E. coli is naturally found in


the majority of animals and human intestine with a

similar absorption of amino acids and peptides, attri-

butes that make E. coli very functional as a biosensor

microorganism for these substances (Ingraham et al.,

1983; Chalova et al., 2009b).

Several studies have been conducted over the

years to develop specific E. coli-based assays for

amino acids (Payne and Tuffnell, 1980; Hitchins et al.,

1989; Erickson et al., 2002; Froelich and Ricke, 2005,

Chalova et al., 2009a, b, 2010; Bertels et al., 2012).

The basis for most of these E. coli sensors is that cell

growth correlates with amino acid concentrations.

However, since all the 20 essential amino acids can

be synthesized by the wild type E. coli in a medium

containing only a carbon source and inorganic salts

(Neidhardt et al., 1990), this wildtype strain can-

not be used directly for amino acid quantification.

Instead, multiple mutants of E. coli have been cre-

ated by genetic manipulation and studied for the

purpose of quantifying amino acid bioavailability

(Payne and Tuffnell, 1980; Hitchins et al., 1989; Erick-

son et al., 2002; Froelich and Ricke, 2005; Bertels et

al., 2012). As a result, the genetically modified E. coli

becomes an auxotroph, for a particular amino acid,

and is consequently incapable of synthesizing that

amino acid. Thus, the cell growth of the auxotroph

is a direct function of the concentration of the amino

acid evaluated (Gavin, 1957; Erickson et al., 2002),

and its quantity can be determined by the extent of

cell growth.

MICRoBIAl BIoSenSoR foR MeThIo-nIne AvAIlABIlITy ASSAyS

Extensive characterization and modification of

microbial biosensors have been conducted for the

essential amino acid methionine (Schwab, 1996;

Webel and Baker, 1999; Boisen et al. 2000; Froelich

and Ricke, 2005; Chalova et al., 2009a, b). Froelich

et al. (2002a) determined that the growth kinetics of

E. coli methionine mutant was not influenced by the

presence of antibiotics or antifungal agents, which

could potentially be used to eliminate interfereing

background microflora during E. coli growth assays.

This was similar to the previous result observed by

Erickson et al. (1999b) for an E. coli lysine auxotroph.

This auxotroph was demonstrated to work as an OD-

based assay for estimating crystalline methionine in

poultry feeds (Zabala Díaz et al., 2004). It was found

that it produced similar growth kinetics with either

methionine or a commercial source of a nutritional

methionine analogue supplement (Froelich et al.,

2002b). Further improvements included adaptation

to a microtiter-based assay and construction of lumi-

nescent and GFP-based strains (Zabala Díaz et al.,

2003; Froelich et al., 2002c, 2005; Bertels et al., 2012).

By deleting genes involved in amino acid biosyn-

thesis, Bertels et al. (2012) developed E. coli biosen-

sors able to quantify eleven amino acids—arginine,

histidine, isoleucine, leucine, lysine, methionine,

phenylalanine, proline, threonine, tryptophan, and

tyrosine—at a sensitive level comparable to HPLC

analysis.

MICRoBIAl BIoSenSoR foR lySIne BIoAvAIlABIlITy ASSAyS

Lysine is nutritionally one of the most important

amino acids and is often the first limiting amino acid

for humans and monogastric animals (Hurrell and

Carpenter, 1981; Jørgensen et al., 1997; Chalova et

al., 2009a). A variety of microorganisms have been

used over the years as lysine biosensors, but E. coli

has been one of the most extensively examined

microbial-based assays for quantification of lysine

bioavailability (Tuffnell and Payne, 1985; Ananthara-

man et al., 1983; Hitchins et al., 1989; Erickson et al.,

2002). Early on, a high correlation (>0.9) between

the microbiological and chemical methods in the

quantification of available lysine was achieved (An-

antharaman et al., 1983); and therefore E. coli esti-

mates appear to be an accurate predictor of lysine

bioavailability in a variety of protein sources (Tuffnell

and Payne, 1985; Hitchins et al., 1989; Erickson et al.

1999a). Several studies were focused on improve-

ments on growth response by modifications of the

growth protocol, including agitation to reduce the

time of incubation, increasing the number of cells in


the inocula, determining the level of growth inter-

ference by the presence of Maillard-lysine products,

and developing cryopreservation procedures (Li et

al., 1999, 2000; Li and Ricke 2002a,b, 2004). Initially

genetic refinement focused on constructing more

precise lysine auxotrophic E. coli mutants by inser-

tion mutagenesis; but since then more stable de-

letion mutants have been generated (Li and Ricke,

2003a,b,c, Bertels et al., 2012). Increasing detection

sensitivity was originally based on bioluminescent

emitting lysine auxotrophs but due to the require-

ment for multiple reagents later work focused on

using fluorescent dyes and eventually generation of

GFP expressing lysine auxotrophs (Erickson et al.,

2000; Zabala Díaz and Ricke, 2003; Zabala Díaz et al.,

2007; Chalova et al., 2004,2006, 2007, 2008a; Bertels

et al., 2012).

ConCluSIonS

Protein-rich byproducts from the biofuel industry

have the potential to be valuable sources of dietary

protein for food animal feed. However, the uneven

quality of these byproducts as well as their large

quantities generated would require a systematic

evaluation of the amino acids bioavailability almost

on batch-to-batch basis. Unfortunately, animal-

based bioavailability assays would not be able to

accommodate this need, thus requiring the devel-

opment of rapid in vitro assays. The construction of

E. coli whole-cell-biosensors offer an opportunity to

satisfy this need; but, further refinement, such as de-

velopment of solid phase or bead anchored systems,

are still needed to make these biosensors more user

friendly and have a broader application spectrum.

Given the advancements made in other biologi-

cal detection systems, such as those for foodborne

pathogens, the adaptation of these systems to E.

coli could be a fairly straight forward process.

ACknowledgeMenTS

This review was partially supported by the Arkan-

sas Soybean Promotion Board. Deivis Enrique Luján-

Rhenals was supported in part by Colciencias of Co-

lombia and the Universidad de Córdoba (Colombia).

RefeRenCeS

Anantharaman K, C. Parard, B. Decarli, P. Reinhardt,

E. Graf and P. Finot. 1983. The microbiological es-

timation of available lysine in industrial milk prod-

ucts using a lysine- Escherichia coli, M. 26-26. In: J.

V. McLoughlin and B. M. McKenna (eds). Research

in Food Science and Nutrition, Boole Press Ltd.,

Dublin, pp 81-82.

Applegate, T.G., K. Thompson, and W.A. Dudley-

Cash. 2004. Amino acid digestibilities needed for

poultry rations . Feedstuffs 30:15-17.

Batterham, E. S. 1992. Availability and utilization of

AA for growing pigs. Nutr. Res. Rev. 5:1–18.

Bertels, F., H. Merker, and C. Kost. 2012. Design and

characterization of auxotrophy based amino acid

biosensors. PLoS ONE 7: e41349.

Boisen, S., T. Hyelplund, and M.R. Weisbjerg. 2000.

Ideal amino acid profile as a basis for feed protein

evaluation. Livestock Prod. Sci. 64: 239–251.

Buyx, A. and J. Tait, 2011. Ethical framework for bio-

fuels. Science 332:540-541.

Chalova, V.I., C.A. Froelich, Jr., and S.C. Ricke. 2010.

Potential for development of an Escherichia coli–

based biosensor for assessing bioavailable methi-

onine: A review. Sensors 10: 3562-3584.

Chalova, V.I., R.C. Anderson, D.J. Nisbet and S.C.

Ricke 2009a. Chapter 5. Biosensors in the animal

industry - the need for better nutritional manage-

ment in the face of rising corn costs and increased

ethanol demand. In: S. Biswas, N. Kaushik and A.

Pandey. Eds. Bioprocess & Bioproducts - Technol-

ogy Trends & Opportunities. Asiatech Publishers,

Inc., New Delhi India, pp. 66-87.

Chalova, V.I, S.A. Sirsat, C.A. O’Bryan, P.G. Crandall,

and S.C. Ricke. 2009b. Escherichia coli, an intesti-

nal microorganism, as a biosensor for quantifica-

tion of amino acid bioavailability. Sensors 9:7038-

7057.


Chalova, V.I., C.L. Woodward, and S.C. Ricke. 2009c.

CadBA induction of an Escherichia coli lysine auxo-

troph transformed with a plasmid carrying cad-gfp

transcriptional fusion. Antonie van Leeuwenhoek

J. Gen. Mol. Microbiol. 95:305-310.

Chalova, V.I., C.L. Woodward, and S.C. Ricke. 2008a.

Construction of a cad-gfpmut3 plasmid-construct

in Escherichia coli for gene induction-based quan-

tification of lysine in acid hydrolysates of feed-

stuffs. Lett. Appl. Microbiol. 46:107-112.

Chalova, V., I.B. Zabala-Díaz, C.L. Woodward, and

S.C. Ricke. 2008b. Development of a whole cell

sensor - green fluorescent sensor method for ly-

sine quantitification. World J. Microbiol. Biotech-

nol. 24:353-359.

Chalova, V.I., Kim, W.K., Woodward, C.L., Ricke, S.C.

2007. Quantification of total and bioavailable ly-

sine in feed protein sources by a whole-cell green

fluorescent protein growth based Escherichia coli

biosensor. Appl. Microbiol. Biotechnol. 76: 91-99.

Chalova, V., C.L. Woodward, and S.C. Ricke. 2006.

Assessment of an Escherichia coli lysine auxotroph

containing green fluorescent protein for quantify-

ing bioavailable lysine in animal protein samples

under nonsterile and autofluorescence back-

ground. Lett. Appl. Microbiol. 42:625-270.

Chalova, V., C.L. Woodward, and S.C. Ricke. 2004.

Fluorescent DNA binding dye-based approach for

measuring the growth of an Escherichia coli lysine

auxotroph and quantifying lysine. J. Rapid Meth.

Automation Microbiol. 11:313-324.

Erickson, A.M.. X. Li, I.B. Zabala-Diaz, and S.C. Ricke.

2002. Potential for measurement of lysine bioavail-

ability in poultry feeds by microbiological assays-

A Review. J. Rapid Methods Automation Micro-

biol.10:1-8.

Erickson, A.M., Zabala-Diaz, I.B., Kwon, Y.M., Ricke,

S.C. 2000. A bioluminescent Escherichia coli auxo-

troph for use in an in vitro lysine availability assay,

J. Microbiol Methods 40:207-212.

Erickson, A.M., X. Li, C.L. Woodward and S.C. Ricke.

1999a. Optimisation of enzyme treatment for the

degradation of feed proteins for an Escherichia

coli auxotroph lysine availability assay. J. Sci. Food

Agric. 79:1929-1935.

Erickson, A.M., I.B. Zabala Díaz and S.C. Ricke.

1999b. Antibiotic amendment for suppression of

indigenous microflora in feed sources for an Esch-

erichia coli auxotroph lysine assay. J. Appl. Bacte-

riol. 87:125-130.

Froelich Jr., C.A. and S.C. Ricke. 2005. Rapid bac-

terial-based bioassays for quantifying methionine

bioavailability in animal feeds: A review. J. Rapid

Meths. Auto. Microbiol. 13:1-10.

Froelich, Jr., C.A., I.B. Zabala Díaz, V.I. Chalova, W.-K.

Kim, and S.C. Ricke. 2005. Quantifying methionine

with a green fluorescent Escherichia coli methio-

nine auxotroph. J. Rapid Meth. Auto. Microbiol.

13:193-203.

Froelich, C.A., I.B. Zabala Diaz and S.C. Ricke. 2002a.

Methionine auxotroph Escherichia coli growth ki-

netics in antibiotic and antifungal amended me-

dia. J. Environ. Sci. Health 37B:485-492.

Froelich, C.A., I.B. Zabala Diaz and S.C. Ricke. 2002b.

Potential rapid bioassay for alimet using a methio-

nine Escherichia coli auxotroph. J. Rapid Meth.

Automation Microbiol. 10:161-172.

Froelich, C.A., I.B. Zabala Diaz and S.C. Ricke. 2002c.

Construction of a bioluminescent methionine

auxotroph Escherichia coli strain for potential use

in a methionine bioassay. J. Rapid Meth. Automa-

tion Microbiol. 10:69-82.

Gabert, V.M., Jorgensen, H., Nyachoti, C.M. 2001.

Bioavailability of amino acids in feedstuffs for

swine. In: A. J. Lewis and L. L. Southern. Eds. Swine

Nutrition, 2nd ed. CRC Press, New York, NY. p

151–186.

Gavin, J.J. 1957. Analytical microbiology: III. Turbidi-

metric methods. Appl. Microbiol. 5:235-243.

Hitchins, A.D., F.E. McDonough, and P.A. Wells.

1989. The use of Escherichia coli mutants to mea-

sure the bioavailability of essential amino acids in

foods. Plant Foods for Human Nutr. 39:109-120.

Hunde, A.R., P.H. Patterson, S.C. Ricke and W.K. Kim.

2012. Supplementation of poultry feeds with di-

etary zinc and other minerals and compounds to

mitigate nitrogen emissions – A review. Biol. Trace

Element Res. 147:386-394.

Hurrell, R.F. and K.J. Carpenter. 1981. The estima-

tion of available lysine foodstuffs after Maillard


reactions, Progress in Food & Nutrition Science

5:159-176.

Ingraham, J.L., O. Maaloe, F. C. Neidhardt. 1983.

Growth of the bacterial cell; Sinauer Associates,

Inc. Sunderland, MA, USA.

Johnson, J. 2007. Ethanol—is it worth it? Chem. Eng.

News 85:19–21.

Johnson, R.J. 1992. Principles, problems and appli-

cation of amino acid digestibility in poultry. World’s

Poult. Sci. J. 48:232-246.

Jørgensen H, V.M. Gabert, and B.O. Eggum. 1997,

The nutritional value of high-lysine barley deter-

mined in rats, young pigs and growing pigs, J. Sci.

Food Agric. 73: 287-295.

Kim, W.K., C.A. Froelich, Jr., P.H. Patterson, and S.C.

Ricke. 2006. The potential to reduce poultry nitro-

gen emissions with dietary methionine or methio-

nine analogues supplementation. World’s J. Poult.

Sci. 62: 338-353.

Kivi, J.T. 2000. Amino acids. In: L. M. L. Nollet. Ed.

Food analysis by HPLC. Marcel Dekker Inc., New

York, NY, USA; p. 55.

Lei, Y., W. Chen, and A. Mulchandani. 2006. Micro-

bial biosensors. Anal. Chim. Acta 568:200-210.

Lewis, A. J., and H. S. Bayley. 1995. Amino acid bio-

availability. p 35–65. In: C. B. Ammerman, D. H.

Baker, and A. J. Lewis. Eds. Bioavailability of nutri-

ents for animals, amino acids, minerals, and vita-

mins. Academic Press, New York, NY.

Li, X. and S.C. Ricke. 2003a. A suicide vector for con-

structing a lysA insertion mutation in Escherichia

coli. J. Rapid Meth. Automation Microbiol. 10:281-

290.

Li, X. and S.C. Ricke. 2003b. Characterization of Esch-

erichia coli lysA insertion targeted mutant using

phenotype arrays. Bioresource Technol. 89:249-

253.

Li, X. and S.C. Ricke. 2003c.Generation of an Esch-

erichia coli lysA targeted deletion mutant by dou-

ble cross-over recombination for potential use in a

bacterial growth-based lysine assay. Letts. Appl.


Li, X. and S.C. Ricke. 2004. Comparison of cryopro-

tectants for Escherichia coli lysine bioavailability

assay culture. J. Food Proc. and Pres. 28:39-50.

Li, X. and S.C. Ricke. 2002a. Influence of soluble ly-

sine Maillard reaction products on Escherichia coli

amino acid lysine auxotroph growth based-assay.

J. Food Sci. 67:2126-2128.

Li, X. and S.C. Ricke. 2002b. Specificity of Escherichia

coli amino acid lysine auxotroph growth kinetics

and lysine assay response to various soluble Mail-

lard reaction products. J. Food Proc. Pres. 26:279-

294.

Li, X., A.M. Erickson, and S.C. Ricke. 2000. Agitation

during incubation reduces the time required for a

lysine microbiological growth assay using an Esch-

erichia coli auxotrophic mutant. J. Rapid Meth. Au-

tomation Microbiol. 8:83-94.

Li, X., A.M. Erickson, and S.C. Ricke. 1999. Compari-

son of minimal media and inoculum concentration

to decrease the lysine growth assay response time

of an Escherichia coli lysine auxotroph mutant. J.

Rapid Methods Automation Microbiol. 7:279-290.

Limayen, A. and S.C. Ricke. 2012. Lignocellulosic

biomass for bioethanol production: Current per-

spectives, potential issues and future prospects.

Prog. Energy Comb. Sci. 38:449-467.

Mayday, J. 2007. Food, feed, or fuel: ethanol boom

reverberates throughout the food system. Meat &

Poultry 53:10–12.

Moehn, S., R. F. P. Bertolo, P. B. Pencharz, and R. O.

Ball. 2005. Development of the indicator AA oxi-

dation technique to determine the availability of

AA from dietary protein in pigs. J. Nutr. 135:2866–

2870.

Muthaiyan, A. and S.C. Ricke. 2010. Current per-

spectives on detection of microbial contamination

in bioethanol fermentors. Bioresource Technol.

101:5033-5042.

Muthaiyan, A., A. Limayen, and S.C. Ricke. 2011.

Antimicrobial strategies for limiting bacterial con-

taminants in fuel bioethanol fermentations. Prog.

Energy Comb. Sci. 37:351-370.

Neidhardt, F.C., Ingraham, J.L.; Schaechter, M. 1990.

Growth of cells and populations. In: F. C. Nei-

dhardt, J. L. Ingraham, M. Schaechter. Eds. Physi-

ology of the bacterial cells: a molecular approach;

Sinauer Associates, Sunderland, UK; p. 197.

Payne, J.W., and J. M. Tuffnell. 1980. Assays for ami-


no acids, peptides and proteins. In: J. W. Payne.

Ed. Microorganisms and nitrogen sources; John

Wiley & Sons: New York, NY, USA; p. 727.

Ragauskas A.J., C.K. Williams, B. H. Davison, G. Brit-

ovsek, J. Cairney, C. A. Eckert, W.J. Frederick, Jr.,

J.P. Hallett, D.J. Leak, C.L. Liotta, J.R. Mielenz, R.

Murphy, R. Templer and T. Tschaplinski, 2006, The

path forward for biofuels and biomaterials, Sci-

ence 311:484-489.

Ravindran, V. and W. L. Bryden. 1999. Amino acid

availability in poultry-in vitro and in vivo measure-

ments. Aust. J. Agric. Res. 50:889-908.

Ricke, S.C. 2003. Perspectives on the use of organic


Poultry Sci. 82:632-639.

Ricke, S.C., and I. B. Zabala-Díaz. 2001. A potential

need for development of rapid microbiological as-

says to quantify folate concentrations in foods. Re-

cent Developments in Nutrition 4 (Research Sign-

post, Trivandrum, India):1-5.

Sauer, W. C., and L. Ozimek. 1986. Digestibility of AA

in swine: Results and their practical applications. A

review. Livest. Prod. Sci. 15:367–388.

Schasteen, C.S., J. Wu, M.G. Schulz, and C.M. Par-

sons. 2007. Correlation of an immobilized diges-

tive enzyme assay with poultry true amino acid di-

gestibility for soybean meal. Poult. Sci. 86:343–348.

Schwab, C.G. 1996. Rumen-protected amino ac-

ids for dairy cattle: Progress toward determining

lysine and methionine requirements. Anim. Feed

Sci.Technol. 59:87–101.

Shockman, D. 1963. Amino acids. In Analytical micro-

biology; F. Kavanagh, Ed.; Academic Press: New

York, NY, USA; p. 567.

Somma, D. H. Lobkowicz, and J.P. Deason. 2010.

Growing America’s fuel: An analysis of corn and

cellulosic ethanol in the United States. Clean

Techn. Environ. Policy 12:373-380.

Stein, H.H., Sève, B. Fuller, M. F., Moughan, P. J. , and

De Lange, C. F. M. 2007. Amino acid bioavailability

and digestibility in pig feed ingredients: terminol-

ogy and applications. J. Anim. Sci. 85:172-180.

Tuffnell, J.M., and Payne, J.W. 1985. A colorimetric

enzyme assay using Escherichia coli to determine

nutritionally available lysine in biological materials.

J. Appl. Bact. 58:333-341.

Webel, D.M. and D.H. Baker. 1999. Cysteine is the

first limiting amino acid for utilization of endog-

enous amino acids in chicks fed a protein free diet.

Nutr. Res. 19:569–577.

Wisner, R. N., and C. P. Baumel. 2004. Ethanol, ex-

ports and livestock: will there be enough corn to

supply future needs? Feedstuffs 30:1-20.

Zabala Díaz, I.B., V.I. Chalova, and S.C. Ricke. 2007.

Generation of a green fluorescent protein gene

chromosomal insertion containing Escherichia

coli strain for gene-induction-based quantification

of bioavailable lysine. Sensing Instrument. Food

Quality Safety 1:55-61.

Zabala Díaz, I.B. and S.C. Ricke. 2003. Quantitative

detection of crystalline lysine supplemented in

poultry feeds using a rapid bacterial biolumines-

cence assay. Appl. Microbiol. Biotechnol. 62:268-

273.

Zabala- Díaz, I., F.O.C. Carreon, W.C. Ellis, and S.C.

Ricke. 2004. Assessment of an Escherichia coli

methionine auxotroph growth assay for quantify-

ing crystalline methionine supplemented in poul-

try feeds. J. Rapid Meth. Automation Microbiol.

12:155-167.

Zabala Díaz, I.B., C.A. Froelich, and S.C. Ricke. 2003.

Adaptation of a methionine auxotroph Escherichia

coli growth assay to microtiter plates for quantitat-

ing methionine. J. Rapid Meth. Automation Micro-

biol. 10:217-229.

Zebrowski, T. and S. Buraczewski. 1998. Methods

for determination of amino acids bioavailability in

pigs – A review. AJAS 11:620-633.




ABSTRACT

Methanogenesis is a predominant fermentation reaction in the gut ecosystem of ruminants. A functional

replacement of methanogenesis with acetogenesis in the rumen could potentially decrease energy losses

and increase the efficiency of ruminant production. Hydrogen limited continuous cultures, at pH 6.0, were

used to isolate over 40 potentially acetogenic bacteria from ruminal contents of a fistulated dairy cow. The

dairy cow was at mid-lactation, consuming a 56% hay and 44% corn silage-concentrate diet. Eight bacterial

isolates had the ability to grow on CO2 and H2 as their sole carbon and energy source producing acetate as

the main end product.

Keywords: acetogen, ruminal buffer, acetate production, H2 utilization

InTRoduCTIon

During rumen fermentation, complex carbohy-

drates (e.g., cellulose) are degraded to monomeric

carbohydrates (e.g., glucose and other soluble car-

bohydrates) which are primarily fermented to py-

ruvate via the Embden-Meyerhof-Parnas pathway

(Pinder et al., 2012; Weimer et al., 2009). Pyruvate

Correspondence: J. A. Patterson, [email protected]: +1 -765-494-4826 Fax: +1-765-494-9347

is subsequently metabolized to volatile fatty ac-

ids (VFA; acetate, propionate, and butyrate), CO2,

H2, microbial cells and intermediate endproducts

which can serve as crossfeeding substrates for other

ruminal microorganisms such as Selenomonas rumi-

nantium (Ricke et al., 1996). While fermentation acids

provide 60 to 80% of the daily metabolizable energy

intake of ruminants (Annison and Armstrong, 1970),

microbial cells provide an important source of amino

acids, vitamins, and cofactors (Hungate, 1966).

Interspecies H2 transfer is a syntrophic interac-

Isolation and Initial Characterization of Acetogenic Ruminal Bacteria Resistant to Acidic Conditions

P. Boccazzi1,2 and J. A. Patterson1

1 Department of Animal Sciences, Purdue University. West Lafayette, IN 479072 Current address: Pharyx Inc., 801 Albany st, Ste 112C. Boston, Ma 02140



tion between H2-producing and H2-consuming or-

ganisms, that plays an important role in regulating

fermentation environments (McInerney et al., 2011).

Hydrogen produced by fermentative microorgan-

isms is consumed by H2 utilizing microorganisms

(methanogens, sulfidogens, and acetogens). The

decrease in H2 concentration, due to interspecies

H2 transfer, influences VFA fermentation patterns of

many ruminal microorganisms. When H2 concen-

trations are high, pyruvate is utilized as a reducing

equivalent acceptor and more reduced fermentation

products (e.g., propionate, lactate, and ethanol) are

produced. When H2 concentrations are low, there

is an increase in acetate and ATP production that

could be converted into an increase in overall micro-

bial cell yields.

Since energy lost as methane has been estimated

to be 2.4 to 7.4% of the gross energy intake (Branine

and Johnson 1990) or 10 to 15% of the apparent di-

gestible energy of the diet of ruminants (Blaxter and

Clapperton, 1965), there has been an interest to spe-

cifically inhibit methanogenesis to enhance animal

productivity. Direct inhibition of methanogenesis,

however, also results in loss of energy in the form of

H2, and reduced microbial proteins (Chalupa, 1980).

Maintaining the beneficial effects of interspecies

H2 transfer while minimizing loss of energy as meth-

ane could enhance energy provided to ruminants by

22% (Schaefer, D., personal communication; Thauer,

et al., 1977). However, an alternative electron sink is

required to trap electrons into a form utilizable by

the animal if methanogens are to be directly inhib-

ited. Historically, the major method used to ma-

nipulate rumen fermentation and influence ruminant

animal production has been the use of ionophore

antibiotics such as monensin and lasalocid (Raun et

al., 1976; Richardson et al., 1976; Berger et al., 1981;

Ricke et al., 1984; Newbold et al., 2013). These com-

pounds improve the efficiency of animal production

by decreasing methane production and increasing

ruminal propionate concentration by 15%. Methane

production decreases primarily because monensin

inhibits H2-producing microorganisms, therefore

decreasing the amount of H2 available for methano-

genesis.

Acetogenesis has been demonstrated to be the

predominant fate of H2 in some humans, swine, xy-

lophagus termites, cockroaches and rats (Breznak

and Blum, 1991; Ljoie et al., 1988). Replacing metha-

nogenesis with acetogenesis in the rumen may have

potential in decreasing energy losses in ruminants.

Blautia producta (Peptostreptococcus productus,

Bryant et al., 1958), Eubacterium limosum (Sharak-

Genthner, 1981), and Acetitomaculum ruminis

(Greening and Leedle, 1989) are chemolithoauto-

trophic acetogenic bacteria that have been isolated

from the bovine rumen. However they are not con-

sidered the primary H2 consuming organisms in this

environment, since their numbers are consistently

lower than methanogens.

Factors dictating whether acetogenesis or metha-

nogenesis will predominate in anaerobic environ-

ments are not well understood. Breznak and Kane

(1990) suggested several possible factors that may

influence the competitiveness of acetogens with

methanogens. One factor is that methanogenesis

has a higher energy yield than acetogenesis (Breznak

and Blum, 1991).

Another important factor is that methanogens

have a higher affinity for H2 than acetogens. The

normal rumen H2 concentration is between 10-5 and

10-6 atm (Robinson et al., 1981). Ruminal methano-

gens have an affinity for H2 between 1 and 4x10-6 atm

(Greening et al., 1989). Different acetogenic isolates

have been shown to have affinities for H2 between

10-4 and 10-5 atm (Greening et al., 1989; LeVan et al.,

1998). In general, methanogens have been found

to have H2 thresholds 10 to 40 fold lower than ace-

togens (Greening et al., 1989; Breznak and Blum,

1991). However, in our laboratory, acetogens with

H2 thresholds only 2 to 4 fold higher than those of

methnogens were isolated from ruminal contents

(Boccazzi and Patterson, 2011). Finally, tolerance of

bacteria to lower pH levels can also be a key factor

in determining competitiveness in gastrointestinal

environments including the rumen (Ricke, 2003; Rus-

sell, 1992). The objective of this study was to isolate

chemolithoautotrophic acetogenic bacteria from

ruminal contents of a dairy cow at low pH (5.5 to 6.0)

and under H2-limiting conditions in order to select


for bacterial strains with low H2 thresholds resistant

to acidic environments.


Source of Organisms

Acetobacterium woodii (ATCC 29683) was ob-

tained from the American Type Culture Collection

(Rockville, MD). Acetogenic bacterial strains A10

and 3H (previously referred to as H3HH) were iso-

lated and characterized previously in our laboratory

(Boccazzi and Patterson, 2011; Pinder and Patterson,

2011, 2012, 2013; Jiang et al., 2012). This research

was conducted prior to IACUC protocols being re-

quired for farm animal research. However animals

were treated in accordance with currently approved

IACUC protocols.

Media and Growth Conditions

Growth and H2 threshold experiments were con-

ducted with a basal rumen fluid based acetogen

medium or with Mac-20 medium containing casein

hydrolysate and no rumen fluid (Table 1). Both me-

dia were prepared as described in Table 1 with the

anaerobic techniques of Hungate (1966) as modified

by Bryant (1972) and Balch and Wolfe (1976). The

prepared medium was dispensed anaerobically into

60 mL or 120 mL serum bottles (West Company,

Phoenixville, PA) or 20 mL serum tubes (Bellco Inc.,

Vineland, NJ) in an anaerobic glove box (Coy Labo-

ratories, Ann Arbor, MI) containing a H2:CO2 (5:95)

gas phase. Serum tubes and bottles were sealed

with butyl rubber serum stoppers and aluminum

seals (Bellco Inc., Vineland, NJ).

All stock solutions utilized to formulate media

were prepared anaerobically by boiling and cooling

distilled water under CO2 and sterilized either by au-

toclaving or by injecting the solution through a 0.2

μm filter (Nalgene, Nalge Company, Rochster, NY).

For chemolithoautotrophic growth in broth me-

dium, bacterial cultures were grown in serum bottles

closed with butyl rubber stoppers and aluminum

seals. The bottles were first flushed for 30 sec with

an appropriate gas mixture by inserting both a gas-

sing and a release needle through the serum stop-

pers and then they were pressurized to 200 kPa by

removing the release needle. Oxygen traces were

removed from gas mixtures by passing the gas

through a reduced copper column. Pressurized

bottles, unless otherwise specified, were incubated

on their side on a rotatory shaker (New Brunswick

Scientific Co. Inc., Model M52) operating at 200 rpm.

For growth on solid medium, plates were incubated

in an anaerobic growth vessel (made by the Agricul-

tural and Biological Systems Department. Purdue

University, IN) able to withstand high gas pressures.

Prior to incubation the container was flushed for 2

min and then pressurized to 16 psi with gas mixtures

specified in the text for each experiment.

Isolation of Acetogenic Bacteria

Determination of buffer capacity: MES versus ci-

trate plus phosphate

A batch culture experiment was performed to de-

termine the best buffer system to use for isolating

acetogenic bacteria at a pH range between 5.5 to

6.0. The experiment was conducted with the ace-

togen A10 (Boccazzi and Patterson, 2011). The four

duplicate treatments were control plus 2-(N-morpho-

lino)ethanesulfonic acid (MES), control plus citrate,

A10 plus MES and A10 plus citrate. Serum bottles

(60 mL) were anaerobically filled with 0.35 g alfalfa, 6

ml acetogen medium, 4 mL ruminal contents, 4 mL

of A10 culture, or 4 mL of acetogen medium (con-

trol). MES was added to give a final concentration

of 40 mM, citrate and KH2PO4 were added to a fi-

nal concentration of 20 and 40 mM, respectively and

2-bromoethanesulfonic acid (BES) was added, to in-

hibit methanogens, to a final concentration of 5 mM.

The alfalfa was dried at 60°C and ground through a

1 mm screen. Ruminal contents were collected an-

aerobically from a Holstein Friesian dairy cow prior

to morning feeding and set on ice during transport-


a All components, except Na2CO3 and Cysteine.HCl, were added to distilled water and brought to a volume of 1,000 mL. The resulting solution was mixed thoroughly and the pH adjusted to 7.0 with 1 M NaOH then gently heated and brought to a boil. Boiling was continued for 1 min., Na2CO3 added and cooled rapidly to 25°C under 100% CO2. Finally, cysteine.HCl was added, mixed thoroughly and autoclaved anaerobically for 12 min at 121°C and 15 psi.

b Modification of AC-19 medium by Breznak et al. (1988)

c Mineral 1 (g/liter): 6.00 K2HPO4

d Mineral 2 (g/liter): 12.00 NaCl, 6.00 K2HPO4, 6.00(NH4)2SO4, 2.45 MgSO4.7H20, 1.60 CaCl2.2H2O

e Additional Trace Mineral Solution (g/Liter): 0.10 NiCl2.6H2O, 0.01 H2SeO3

f Wolfe’s Trace Mineral Solution (g/liter): 3.00 Mg SO4.7H20, 1.00 NaCl, 0.50 MnSO4.H20, 0.10 CoCl2.6H20, 0.10 FeSO4.7H20, 0.10 CaCl2.2H20, 0.18 CoSO4.6H20, 0.19 ZnSO4.7H20, 0.02 AlK(SO4)2.12H20, 0.01 CuSO4.5H20, 0.01Na2MoO4.2H20

g Vitamin Solution (g/liter): 0.10 pyridoxine.HCl, 0.056 ascorbic acid, 0.05 choline chloride, 0.05 thiamine.HCl, 0.05 D,L-6,8-thioctic acid, 0.05b riboflavin, 0.05 D-calcium panthotenic acid, 0.05 p-amino benzoic acid, 0.05 niacinamide, 0.05 nicotinic acid, 0.05 pyridoxal.HCl, 0.05 pyridoxamine, 0.05 myo-inositol, 0.02 biotin, 0.02 folic acid, 0.001 cynocobalamin.

Table 1. Media compositiona

Acetogen Medium

(amounts per liter)

MAC-19 Mediumb

(amounts per liter)

Rumen Fluid 50.0 mL ---

Mineral 1c 40.0 mL 40.0 mL

Mineral 2d 40.0 mL 40.0 mL

Additional Trace Min. Sol.e 10.0 mL 10.0 mL

Wolfe’s Trace Min. Sol.f 10.0 mL 10.0 mL

Vitamin Solutiong 10.0 mL 10.0 mL

Na2CO3 4.0000 g 4.0000 g

Yeast Extract 0.5400 g 2.0000 g

Casein Hydrolysate --- 1.0000 g

Betaine --- 1.0000 g

NH4Cl 0.5400 g 0.5400 g

Cysteine.HCl 0.5000 g 0.5000 g

Resazurin solution 0.0010 g 0.0010 g

Hemin solution 0.0001 g 0.0001 g


ing to the lab. Serum bottles were incubated on a

rotatory shaker at 37°C. Strain A10 was grown in se-

rum bottles (120 mL) filled with 50 mL of acetogen

medium plus 10 mM glucose (0.5% inoculum) under

200 kPa of a H2:CO2:N2 (1:24:75:) gas mixture for 72

h. Measurements were final pH, headspace gas vol-

ume, and H2 and CH4 concentrations at 0 and 72 h of

incubation.

Isolation of acetogenic bacteria from bovine ruminal contents using a continu-ous culture at pH 6.0

The continuous culture system used to isolate

acetogenic bacteria is shown in Figure 1. The con-

tinuous culture system included two 20 L reservoirs

filled with 16 L of sterile medium, four 500 mL growth

vessels (450 mL working volume), a Plexiglas water

bath, a water heater/circulator (Vankel Heater/Circu-

lator Bench SaverTM- Series VK 650A, Edison, NJ), a

four channel peristaltic pump (Gilson Medical Elec-

tronics Inc., Middleton, WI), a magnet system oper-

ated by an electrical motor was used to turn stirrers

in growth vessels and four 3.8 L plastic containers

were used to collect culture effluent.

The isolation medium was the acetogen medium

(Table 1) modified by the addition of 40 mM MES (fi-

nal concentration), 2.5 % (v/v), instead of 5% of clari-

fied ruminal contents (Greening and Leedle, 1989)

and 5 mM BES (final concentration). The pH of the

medium was adjusted to 6.0 with 1 M HCl. Monensin

was also added to two of the four growth vessels to

a final concentration of 5 μM. Monensin and BES

Figure 1. Continuous culture system utilized to isolate acetogenic bacteria, at low pH, from ruminal contents and to study the possibility to functionally replace methanogenesis with reduc-tive acetogenesis in the rumen.


were added to the medium reservoirs as anaerobic

sterile stock solutions. The medium in each reser-

voir was continuously stirred and gassed with a 100%

CO2 gas.

Two different dilution rates (D) were used to simu-

late ruminal dilution rates of animals on a high forage

diet (D=0.06 h-1) or a high concentrate diet (D=0.28

h-1). The four isolation treatments utilized are sum-

marized in Figure 2.

Ruminal contents utilized as inoculum were col-

lected prior to the morning feeding from a Holstein

Friesian dairy cow producing a daily average of 55

lb of milk and eating a 56:44 concentrate:forage

diet. Ruminal contents were collected anaerobically

from 3 sites in the rumen and immersed in ice dur-

ing transporting to the lab. In the lab, ruminal con-

tents were blended for 1 min and filtered through

a double layer of cheesecloth under CO2. Each

growth vessel, already containing 200 ml of reduced

isolation medium, received 250 mL of ruminal con-

tents as inoculum. Each growth vessel was continu-

ously stirred and gassed with limited H2:CO2 (80:20)

through stainless steel needles.

After 8 turnovers, 1 mL of fermentation fluid was

Figure 2. Continuous culture system utilized for the isolation of acetogenic bacteria from bovine ruminal contents.

R 1= reservoir 1 with acetogen medium and 5 mM BES

R 2= reservoir 2 with acetogen medium, 5 mM BES and 5 μM monensin

GV 1 and GV 3= growth vessels 1 and 3 at dilution rate = 0.28 h-1

GV 2 and GV 4= growth vessels 2 and 4 at dilution rate = 0.06 h-1


withdrawn with a sterile syringe, from each growth

vessel and then serially diluted to 10-8 with anaerobic

dilution solution (ADS, Table 2). From each dilution

tube, 250 μL were plated on solid isolation medium

in triplicate 60 mm petri plates. The solid medium

was the same as the isolation medium plus 2% of

washed agar (Leedle and Hespell, 1980). Plates were

incubated in an anaerobic growth vessel, pressur-

ized to 16 psi with a H2:CO2 (80:20) gas mixture, at

37°C for 5 days.

Approximately ten single colonies for each treat-

ment were anaerobically transferred into serum

bottles (120 mL) containing 10 mL acetogen medium

plus 5 mM BES (final concentration). The bottles

were pressurized to 200 kPa with a H2:CO2 (80:20)

gas mixture and incubated on a rotatory shaker for

5 days at 37°C.

Initial screening of newly isolated po-tential acetogenic bacteria

Potential acetogen isolates G1.4b, G1.5a, G1.5c,

G1.5d, G1.5e, G2.4a, G3.2a, G4.4a, acetogenic bac-

teria Acetobacterium woodii, Sporomusa termitida,

and strains A10 and 3H were grown in duplicate se-

rum bottles (60 or 120 mL) containing 10 mL of ace-

togen medium (Table 1), and pressurized to 200 kPa

with a H2:CO2 (80:20) or N2:CO2 (80:20) gas mixtures.

The inoculum was 10% of a third transfer of each

bacterium grown for 48 h in acetogen medium under

200 kPa of H2:CO2 (80:20) at 37°C. After 72 h incuba-

tion, 3 mL of culture from each bottle was transferred

to 5 mL glass tubes and growth was determined by

optical density (660 nm). Potential acetogenic iso-

lates were identified by difference in growth under

H2 and N2.

Hydrogen threshold concentrations were mea-

sured in a separate experiment. To increase cell

mass, cultures (2% inoculum) were grown initially for

12 h at 37°C, in duplicate serum bottles (60 mL), in

acetogen medium (5ml) containing 2.5 mM glucose

under 200 kPa of a H2:CO2 (80:20) gas mixture. Bot-

tles were then brought inside the glove box where 5

ml of fresh acetogen medium, without glucose, was

added to each bottle. Serum bottles were then re-

sealed with sterile butyl rubber stoppers and alumi-

num seals, pressurized to 200 kPa with a H2:CO2:N2

(1:24:75) gas mixture and incubated at 37°C on a ro-

tatory shaker for 7 days. At the end of this period,

Table 2. Anaerobic dilution solution (ADS) compositiona

a All components, except Cysteine.HCl, were added to distilled water and brought to a volume of

1,000 mL. These components were mixed thoroughly and the pH adjusted to 7.0 with 1 M NaOH

followed by gently heating and brought to a boil. Boiling was continued for 1 min., Cysteine.HCl was

added under 100% CO2, mixed thoroughly and autoclaved anaerobically for 12 min at 121°C and 15

psi. Leedle and Hespell, 1980.b Mineral 1 (g/liter): 6.00 K2HPO4c Mineral 2 (g/liter): 12.00 NaCl, 6.00 K2HPO4, 6.00(NH4)2SO4, 2.45 MgSO4.7H20, 1.60 CaCl2.2H2O

Component (amounts per liter)

Mineral 1b 75.0 mL

Mineral 2c 75.0 mL

Cysteine.HCl 0.5000 g

Resazurin solution 0.0010 g


headspace gas volume and gas composition in each

bottle was measured as described previously (Boc-

cazzi and Patterson, 2011).

Potential acetogenic isolates G1.5a, G1.5c,

G1.5d, G1.5e, G2.4a, G3.2a, and acetogenic bacte-

ria A.woodii and strain 3H were further screened for

acetate production. Bacterial cultures were grown

in single serum bottles (60 mL) containing 10 mL

acetogen medium, modified by the addition of 0.75

g/L instead of 0.5 g/L (w/v) of yeast extract, under

200 kPa of a H2:CO2 (80:20) or a N2:CO2 (80:20) gas

mixture. Serum bottles were incubated at 37°C on a

rotatory shaker for 3 days. Growth was measured by

optical density (660 nm) and acetate concentrations

were measured enzymatically (Boeringer Mannheim,

Indianapolis, IN). Growth and acetate production

values of the N2:CO2 incubations were subtracted

from the values of the H2:CO2 incubations of the

same strain.

Growth curves of newly isolated acetogenic bac-

teria G1.4b, G2.4a and G3.2a were obtained by

growing the bacteria in duplicate serum bottles (275

mL, Bellco Inc., Vineland, NJ) modified by the addi-

tion of a side arm for optical density measurements.

Bacteria were grown in 20 mL acetogen medium,

modified by the addition of 0.75 g/L (w/v) of yeast

extract, plus or minus 2.5 mM of glucose under 200

kPa of a H2:CO2 (80:20) gas mixture. Serum bottles

were incubated vertically in a water bath (Precision

Scientific Company, Model 50, Chicago, IL) shaking

at 80 rpm at 37°C. Growth was measured by optical

density (660 nm) at 0, 1, 2, 3, 4, 5.5, 7.5, 9.0, 11, 20, 22,

24, 27, 32, and 48 h after inoculation.

Analytical Methods

Bacterial growth: optical density was measured

Figure 3. Comparison of buffering capacity between citrate (20 mM) and MES (40 mM) in ruminal contents in presence or absence (C) of the acetogen strain A10. Methanogens were inhibited by 5 mM BES.


Figure 4. The effect of citrate (20 mM) and MES (40 mM) on initial H2 concentration (0 h) and on H2 uptake by ruminal contents in the presence or absence of the acetogen strain A10. Methano-gens were inhibited by 5 mM BES.

at 660nm using a Spectronic 70 spectrophotometer

(Bausch and Lomb, Rochster, NY). VFA analysis:

volatile fatty acid concentrations were measured by

gas-liquid chromatography (GLC; Holdeman et al.,

1977). At sampling time, samples were acidified

by adding 20% (v/v) of meta-phosphoric acid (25%

w/v) and then frozen. Samples to be analyzed were

thawed, centrifuged at 15,000 rpm for 5 min, and

the supernatant was analyzed. A 3 foot long column,

packed with SP1220 (Supelco, Bellefonte, PA, USA),

was used in a Hewlett Packard 5890 GLC equipped

with a flame ionization detector. Oven temperature

was 130°C (isothermal), injector temperature was

170°C, detector temperature was 180°C, the carrier

gas was N2 flowing at a rate of 30 mL per minute.

Gas Analysis

For the measurements of H2 and methane concen-

trations, gas samples were analyzed using a Varian

3700 Gas Chromatograph equipped with a thermal

conductivity detector, and a 6 feet silica gel column

(Supelco). Temperatures of the injector, oven, and

detector were room temperature, 130°C, and 120°C

respectively. The carrier gas was N2 flowing at a rate

of 30 mL per minute. The volume of gas injected

for standards and samples was 0.5 mL. The GC was

standardized with 5 different concentrations of H2

(400 to 25,000 ppm) and CH4 (900 to 32,000 ppm). A

regression line was obtained from the output values

of the standard concentrations. The regression line

was then utilized to calculate H2 and CH4 concentra-

tions in experimental samples. All gas mixtures were

purchased from Airco (Indianapolis, IN).


ReSulTS

Isolation of Acetogenic Bacteria

A batch culture experiment with ruminal contents

was performed to determine which buffer system

to use for the isolation of acetogenic bacteria from

ruminal contents at pH 6.0. After 72 h of incuba-

tion, both control and strain A10 treatments that

were buffered with citrate had higher pH values than

the same treatments buffered with MES (Figure 3).

Hydrogen concentrations were also lower for the ci-

trate buffered treatments than for the MES buffered

treatments (Figure 4).

The isolation of acetogenic bacteria from bovine

ruminal contents at pH 6.0 was performed with a

continuous culture system. The experiment resulted

in the isolation of 40 potential acetogenic bacteria.

Eight new isolates and 3 known acetogens grew at

least 3 times to a higher yield under a H2:CO2 than a

N2:CO2 atmosphere, indicating capability of chemo-

lithoautotrophic growth (Table 3). Strains G1.4b,

G1.5a, G1.5c, G1.5d, and G1.5e were isolated from

growth vessel (GV) 1 that received acetogen medi-

um plus BES with a dilution rate (D)= 0.28 h-1. Strain

G2.4a was isolated from GV 2 that received acetogen

medium plus BES with a D= 0.06 h-1. Strain G3.2a

was isolated from GV 3 that received acetogen me-

dium plus BES and monensin with a D= 0.28 h-1.

Table 3. Growtha and H2 utilizationb of potential and known acetogenic bacteria grown in aceto-gen medium under 200 kPa of a H2:CO2 (80:20) or N2:CO2 (80:20) gas mixture

a Growth was measured after 72 h of incubation at 37°C by optical density (OD 660 nm): Ranges of OD values

are given to indicate relative amounts of growth. b H2 utilization was determined in a different experiment where bacteria were incubated in acetogen medium

under 200 Kpa of a H2:CO2:N2 (1:24:74) gas mixturec Uninoculated acetogen mediumd Not determined

Strain H2:CO2 N2:CO2 ppm H 2 SD

Controlc >0.1 – <0.2 <0.1 8085.5 85.6

G1.4b >0.4 <0.1 1062.0 120.2

G1.5a >0.4 <0.1 800.5 19.1

G1.5c >0.4 >0.1 – <0.2 NDd ND

G1.5d >0.4 >0.1 – <0.2 ND ND

G1.5e >0.4 >0.1 – <0.2 635.0 186.7

G2.4a >0.4 <0.1 908.5 44.5

G3.2a >0.4 <0.1 960.5 184.6

G4.4a >0.2 - < 0.4 >0.1 – <0.2 ND ND

Acetobacterium woodii >0.4 >0.1 – <0.2 1007.0 17.0

Sporomusa termitida >0.4 >0.2 - < 0.4 643.5 6.4

strain 3H >0.4 >0.1 – <0.2 951.5 94.0


Strain G4.4a was isolated from GV 4 that received

acetogen medium plus BES and monensin with a D=

0.06 h-1. In a subsequent batch culture study, with

8 of the new acetogen isolates, strain G1.5e had

the lowest H2 threshold at 635 ppm, while the other

isolates had H2 thresholds ranging from 800 to 1062

ppm (Table 3).

Initial screening of newly isolated ace-togenic bacteria

Growth and acetate production of 6 new and

two known acetogenic bacteria was determined in

a batch culture experiment. Isolate G3.2a had the

highest yield of acetate per OD unit (Yacetate= mM ac-

etate per OD= 1) of 206.2 mM. Strains G1.5e, G1.5a,

G1.5d, G2.4a and G1.5c had a Yacetate of 137.4, 114.9,

95.1, 88.2 and 67.6 mM, respectively (Figure 5). The

two known acetogens A. woodii and strain 3H had a

Yacetate of 77.7 and 146.6 mM, respectively (Figure 5).

The acetogenic strains G1.4b, G2.4a, and G3.2a

were considered to be the most promising of the

new acetogen isolates. Strains G1.4b, G2.4a, and

G3.2a had growth rates (μ) of 0.094, 0.029 and 0.025

h-1, respectively, growing on H2:CO2 alone and of

0.86, 0.37 and 0.35 h-1, respectively, growing on glu-

cose plus H2:CO2 (Figures 6 through 8).

Figure 5. Growth (OD 660 nm) and acetate production of six new potential acetogen isolates and of the acetogens Acetobacterium woodii and 3H. Bacteria were grown in single serum bottles for 72 h in acetogen medium under 200 kPa of a H2:CO2:N2 (1:24:75) gas mixture. Values for the same bacteria growing in acetogen medium under 200 kPa of a N2:CO2 gas mixture were sub-tracted from the data.


Figure 6. Growth of acetogen isolate G1.4b in acetogen medium under 200 kPa of a H2:CO2 (80:20) gas mixture plus (circles) or minus (squares) 2.5 mM glucose.

Figure 7. Growth of acetogen isolate G2.4a in acetogen medium under 200 kPa of a H2:CO2 (80:20) gas mixture plus (triangles) or minus (squares) 2.5 mM glucose.


dISCuSSIon

A preliminary batch culture experiment demon-

strated that citrate plus phosphate was a better buf-

fer system than MES for the isolation of acetogenic

bacteria from ruminal contents. However, when the

citrate plus phosphate was used as buffer in continu-

ous culture, citrate utilizing bacteria were selected

(data not reported). Therefore, MES was utilized as

the buffer system for isolation of acetogenic bacteria

in continuous culture.

In many beef operations, monensin is used to ma-

nipulate rumen fermentations; therefore, monensin

was included in the medium used to isolate aceto-

gens. A preliminary study was performed to deter-

mine the minimum inhibitory concentration (MIC)

of monensin on acetogenic bacteria that had been

previously isolated by our lab. Both gram positive

acetogens, strain A10 and strain 3H, were insens-

tive to the highest concentration of monensin tested

(60 μM). This concentration of monensin is higher

than the concentration (3 to 5 μM) normally found in

the rumen (Russell and Strobel, 1989). Our results,

thus indicated that monensin may not inhibit some

acetogens.

The second experiment on the isolation of aceto-

genic bacteria resulted in the isolation of ten poten-

tial acetogenic strains from each of the four growth

vessels utilized. Post-isolation studies were conduct-

ed to determine the ability of these strains to grow

on a H2:CO2 gas mixture and to produce acetate. A

total of eight isolates were identified as acetogenic

bacteria. After further studies comparing growth

and acetate production on H2:CO2 versus N2:CO2 gas

mixtures, three of the eight isolates were selected for

further study because of their greater H2 utilization

and acetate production. The three isolates chosen

were strains G1.4b, from growth vessel one; G2.4a,

from growth vessel 2; G3.2a, from growth vessel 3.

Of these three isolates, G3.2a had higher growth and

produced more acetate than the other two.

Figure 8. Growth of acetogen isolate G3.2a in acetogen medium under 200 kPa of a H2:CO2 (80:20) gas mixture plus (triangles) or minus (circles) 2.5 mM glucose.


BES was used to inhibit methanogenesis, since

the results of batch culture experiments indicated

that BES was a more effective inhibitor than 9,10-an-

thraquinone, or lumazine. Also, due to the results

obtained in batch culture experiments, the inoculum

of acetogenic bacteria at each turnover was set to

give a final concentration of 5x108 CFU/mL in the

first experiment, and 3x108 CFU/mL in the second

experiment. While in the first experiment, aceto-

gens were grown on glucose plus H2:CO2, in the

second experiment the acetogens were grown only

on H2:CO2. This change in growth conditions was

made so that acetogenic cultures were growing to-

tally chemolithoautotrophicly. The dilution rate was

set to 0.084 h-1 in the first experiment and 0.06 h-1 in

the second. The change in the second experiment

was made, because in the first experiment the con-

trol culture did not produce CH4 as expected. This

could have been an indication that methanogens

were not able to reproduce fast enough, and were

washed out of the system when no acetogen was

added. The amount of CH4 produced by the other

four growth vessels that received BES was minimal or

zero. In these treatments, the H2 concentration was

lower in the control culture that did not receive ace-

togens than in the cultures that received acetogens.

This was also unexpected, since in batch culture ex-

periments cultures that received the acetogen strain

A10 had lower H2 concentrations than did the con-

trol cultures. The treatment that received a mixture

of the acetogens strains A10 and G3.2a had a higher

H2 concentration than the control and A10 treat-

ments, but not significantly different. The growth

vessel that received the acetogen strain G3.2a had

the highest H2 concentration. The pH averages over

seven turnovers for each growth vessel ranged from

6.26 to 6.61, with no significant difference among the

six growth vessels. Acetate production was not sig-

nificantly different among the six treatments. How-

ever, the control which received BES and no aceto-

gen had the lowest concentration of acetate, and

propionate and highest concentration of butyrate.

In conclusion, a total of 8 isolates were identified

as acetogenic bacteria. Among these strain G3.2a,

isolated with a dilution rate of 0.28 h-1 in the presence

of monensin had the highest acetate production per

unit of OD growing with H2/CO2. In batch culture

studies acetogen bacteria G1.5a, G2.4a, G3.2a, A10

and 3H could effectively reduce H2 concentrations in

ruminal contents in the presence of BES as the meth-

anogenesis inhibitor.

ACknowledgeMenTS

We would like to thank the College of Agriculture

and Department of Animal Sciences for financial

support for this project.

RefeRenCeS

Annison, E.F., and D.G. Armstrong. 1970. Volatile

fatty acids metabolism and energy supply. In: A. T.

Phillipson (eds). Physiology of digestion and me-

tabolism in the ruminant. Oriel Press, Newcastle,

England, pp 422-437.

Balch, W.E. and R.S. Wolfe. 1976. A new approach to

the cultivation of methanogenic bacteria: 2-mer-

captoethanesulfonic acid (HS-CoM)-dependent

growth of Methanobacterium ruminantium in a

pressurized atmosphere. Appl. Environ. Microbiol.

32: 781-791.

Berger, L.L., S.C. Ricke and G.C. Fahey, Jr. 1981.

Comparison of two forms and two levels of lasalo-

cid with monensin of feedlot cattle performance.

J. Anim. Sci. 53:1440-1445.

Blaxter, K.L. and J.L. Clapperton. 1965. Prediction

of the amount of methane produced by ruminants.

Br. J. Nutr. 19: 511-522.

Boccazzi, P. and J.A. Patterson. 2011. Using hydro-

gen limited anaerobic continuous culture to iso-

late low hydrogen threshold ruminal acetogenic

bacteria. Agric. Food Anal Bacteriol. 1: 33-44.

Branine, M.E. and D.E. Johnso. 1990. Level of intake

effects on ruminant methane loss across a wide

range of diets. J. Anim. Sci. 68 (Suppl.1):509.

Breznak, J.A., J.M. Switzer, and H.-J. Seitz. 1988.

Sporomusa termitida sp.nov., an H2/CO2-utilizing

acetogen isolated from termites. Arch. Microbiol.


150:282-288.

Breznak, J.A. and M.D. Kane. 1990. Microbial H2/CO2

acetogenesis in animal guts: nature and nutritional

significance. FEMS Microbiol. Rev. 87:309-314.

Breznak, J.A. and J.S. Blum. 1991. Mixotrophy in the

termite gut acetogen, Sporomusa termitida. Arch.

Microbiol. 156:105-110.

Bryant, M.P. 1972. Commentary on the Hungate

technique for culture of anaerobic bacteria. Amer.

J. Clin. Nutr. 25: 1324-1328.

Chalupa, W. 1980. Chemical control of rumen mi-

crobial metabolism. In: Y. Ruckebusch, P. Thivend.

(eds). Digestive Physiology and Metabolism in Ru-

minants. MTP Press, Lancaster, England.Green-

ing, R.C., and J.A.Z. Leedle. 1989. Enrichment and

isolation of Acetitomaculum ruminis, gen. nov., sp.

nov.: acetogenic bacteria from the bovine rumen.

Arch. Microbiol. 151:399-406.

Hungate, R.E. 1966. The rumen and its microbes.

Academic Press, New York, NY.

Jiang, W.H., J.A. Patterson, and L.R. Steenson. 1995.

Isolation and characterization of a temperate bac-

teriophage from a ruminal acetogen. Current Mi-

crobiology. 32:336-339.

Jiang, W., R.S., Pinder, and J.A. Patterson. 2012. In-

fluence on growth conditions and sugar substrate

on sugar phosphorylation activity in acetogenic

bacteria. Agric. Food Anal. Bacteriol. 2:94-102.

Lajoie, S.F., S. Bank, T.L. Miller, and M.J. Wolin.

1988. Acetate production from hydrogen and [14]

carbon dioxide by the microflora of human feces.

Appl. Environ. Microbiol. 54: 2723-2737.

Leedle, J.A.Z. and R.B. Hespell. 1980. Differential

carbohydrate media and anaerobic replica plating

techniques in delineating carbohydrate-utilizing

subgroups in rumen bacterial populations. Appl.

Environ. Microbiol. 39:709-719.

LeVan, T.D., J.A. Robinson, J. Ralph, R.C. Greening,

W.J. Smolenski, J.A.Z. Leedle, and D.M. Schaefer.

1998. Assessment of reductive acetogenesis with

indigenous ruminal bacterium populations and

Acetitomaculum ruminis. Appl. Microbiol. Biotech-

nol. 64: 3429-3436.

McInerney, M.J., J.R. Sieber, and R.P. Gunsalus. 2011.

Microbial syntrophy: Ecosytem-level biochemical

cooperation. Microbe 6:479-485.

Newbold, C.J., R.J. Wallace, and N.D. Walker-Bax.

2013. Potentiation by metal ions of the efficacy of

the ionophores, monensin and tetronasin, towards

four species of ruminal bacteria. FEMS Microbiol

Lett 338:161-167.

Pinder, R.S. and J.A. Patterson. 2011. Isolation and

initial characterization of plasmids in an acetogen-

ic ruminal isolate. Agric. Food Anal. Bacteriol. 1:

186-192.

Pinder, R.S. and J.A. Patterson. 2012. Glucose and

hydrogen utilization by an acetogenic bacterium

isolated from ruminal contents. Agric. Food Anal.

Bacteriol. 2:253-274.

Pinder, R.S. and J.A. Patterson. 2013. Growth of

acetogenic bacteria in response to varying pH or

carbohydrate concentration. Agric. Food Anal.

Bacteriol. 3:6-16.

Pinder, R.S., J.A. Patterson, C.A. O’Bryan, P.G.

Crandall, and S.C. Ricke. 2012. Dietary fiber con-

tent influences soluble carbohydrate levels in

ruminal fluids. J. Environ. Health Sci. Part B 47:710-

717.

Raun, A.P., C.O. Cooley,, E.L. Potter, R.P. Rathmacher,

and L.F. Richardson. 1976. Effect of monensin on

feed efficiency of feedlot cattle. J. Anim. Sci. 43:

670-677.

Richardson, L.F., A.P. Raun, E.L. Potter, C.O. Cooley,

and R.P. Rathmacher. 1976. Effect of monensin on

rumen fermentation in vitro and in vivo. J. Anim.

Sci. 43:657-664.

Ricke, S.C. 2003. Perspectives on the use of organic


Poultry Sci. 82:632-639.

Ricke, S.C., S.A.Martin, and D.J. Nisbet, D.J. 1996.

Ecology, metabolism, and genetics of ruminal

selenomonads. Crit Rev Microbiol. 22: 7-56.

Ricke, S.C., L.L. Berger, P.J. van der Aar and G.C. Fa-

hey, Jr. 1984. Effects of lasalocid and monensin on

nutrient digestion, metabolism and rumen charac-

teristics of sheep. J. Anim. Sci. 58:194-202.

Robinson, J.A., J.M. Strayer, and J.M. Tiedje. 1981.

Method for measuring dissolved hydrogen in an-

aerobic ecosystems: application to the rumen.

Appl. Environ. Microbiol. 41:545-548.


Russell, J. B. 1992. Another explanation for the tox-

icity of fermentation acids at low pH: anion accu-

mulation versus uncoupling. J. Appl. Microbiol.

73:363-370.

Russell, J.B. and H.J. Strobel. 1989. Effect on iono-

phores on ruminal fermentation. Appl. Environ.

Microbiol. 55:1-6.

Sharak-Genthner, B.R., C.L. Davies, and M.P. Bry-

ant. 1981. Features of rumen and sewage sludge

strains of Eubacterium limosum, a methanol and

H2-CO2-utilizing species. Appl. Environ. Microbiol.

42:12-19.

Thauer, R.K., K. Jungermann, and K. Decker. 1977.

Energy conservation in chemotrophic bacteria.

Bacteriol. Rev. 41:100-180.

Weimer, P.J., J.B. Russell, and R.E. Muck. 2009. Les-

sons from the cow: What the ruminant animal can

teach us about consolidated bioprocessing of cel-

lulosic biomass. Bioresour. Technol. 100:5323-5331.




ABSTRACT

Linoleic acid isomerase (LAI) is responsible for converting linoleic acid conjugated linoleic acids (LAs),

which are believed to lower cancer risk and enhance immunity. In this study, the Bifidobacterium LAI gene

was cloned into Escherichia coli BL21 (DE3) using pET24a(+) as the expression vector while Propionibac-

terium acnes LAI gene fused with pSSBm97 derivatives was expressed in Bacillus species. The protein

expressed by Bifidobacterium LAI was found in E. coli, but no activity was detectable. By changing cys-

teine residues to alanine, P. acnes LAI activity was present in B. megaterium YYBm1 but activity was not

improved. Prepropeptide B. subtilis amyE fused with P. acnes LAI at N-terminus resulted in unstable pro-

teins. By transferring plasmids carrying prepropeptide Staphylococcus hyicus lipase and prepropeptide B.

subtilis amyE fused with P. acnes LAI into B. licheniformis NRRLB-14212, LAI was not found due to possible

proteolytic degradation.

Keywords: Bacillus, Bifidobacterium, heterologous expression, linoleic acid isomerase,

conjugated linoleic acid

InTRoduCTIon

Conjugated linoleic acids (CLA) are a family of iso-

mers of linoleic acid (LA) found mainly in the meat

and dairy products derived from ruminants (Banni,

2002). Therefore, CLA is found in foods such as

beef and lamb, as well as dairy foods derived from

these ruminant sources (Chin et al., 1992; Griinari et

Correspondence: Suwat Saengkerdsub, [email protected]

al., 2000; Ma et al., 1999). As the name implies, the

double bonds of CLAs are conjugated, with only one

single bond between them. The three-dimensional

stereo-isomeric configuration of CLA may be in

combinations of cis and/or trans configurations. The

predominant geometric isomer in foods is the cis-

9, trans-11-CLA isomer, also known as rumenic acid

(Fritsche et al., 1999; Kramer et al., 1998, Ma et al.,

1999), followed by trans-7,cis-9-CLA, cis-11,trans-13-

CLA, cis-8, trans-10-CLA, and trans-10, cis-12-CLA

(Fritsche et al., 1999).

Linoleic Acid Isomerase Expression in Escherichia coli BL21 (DE3) and Bacillus spp

S. Saengkerdsub

1 Center for Poultry Excellence, University of Arkansas, Fayetteville, AR 72701



Numerous health benefits have been attributed to

CLAs. Several studies have demonstrated that CLA

changes body composition, especially by reducing

the accumulation of adipose tissue in mice, rats,

pigs, and humans, (Dugan et al., 1999, Park et al.,

1997, Sisk et al 2001; Smedman and Vessby, 2001).

The role of CLA as an aid in the management of type

2 diabetes in humans was examined by Belury (2002),

who found that those receiving a CLA supplement

(6.0 g CLA/day) had significantly decreased fasting

blood glucose, plasma leptin, body mass index, and

weight (Belury, 2002). Dietary CLA has also been

shown to inhibit numerous cancer models in experi-

mental animals, particularly skin tumor initiation and

neoplasias in the forestomach (Ha et al., 1987, 1990),

as well as mammary and colon tumorigenesis (Belury

et al., 1996; Ip et al., 1991; Liew et al., 1995). There

is also evidence that CLA reduces atherosclerotic

plaque formation in experimental animals, including

rabbits (Lee et al., 1994) and hamsters (Nicolosi et

al., 1996).

However, concerns have emerged that the use of

CLA supplements by the morbidly obese may tend

to cause or to aggravate insulin resistance, which may

increase their risk of developing diabetes (Risérus et

al., 2002). CLA is currently marketed as a dietary sup-

plement, and these commercially available supple-

ments contain equal mixtures of two CLA isomers:

the cis-9, trans-11 isomer as well as the trans-10,

cis-12 isomer. It is the trans-10, cis-12 isomer that is

linked to this and other adverse side effects (Poirier

et al., 2006). The CLA dietary supplements are pro-

duced by alkaline isomerization of linoleic acid (LA)

or vegetable oils containing triglyceride esters of LA

(Peng et al., 2007); however, chemical synthesis pro-

duces a mixture of CLA (Reaney et al., 1999; Sehat et

al., 1998) and the processes required to separate the

respective single isomers are expensive (Berdeaux

et al., 1998; Chen et al., 1999; Hass et al., 1999).

In contrast to chemical processes, biological pro-

cesses originating from microorganisms can provide

production of a single isomer of CLA (Deng et al.,

2007). The LA C12 isomerase has been detected in

a variety of bacteria (Coakley et al., 2003; Peng et

al., 2007; Rosson et al., 2001; Verhulst et al., 1985).

Biotransformation of LA using microbial cells and

enzyme extracts has been explored for the produc-

tion of cis-9, trans-11 CLA (Ando et al., 2004; Rainio

et al., 2001). Propionibacterium acnes was reported

to contain an LA C9 isomerase for converting LA to

trans-10, cis-12 CLA (Deng et al., 2007). There is an

interest in developing commercial processes for the

production of single isomers of CLA by biotrans-

formation of LA using microbial cells and enzymes

(Ando et al., 2004; Kim et al., 2000; Rainio et al.,

2001). However, the evaluation of these strains sug-

gested that growth and linoleic acid isomerase (LAI)

production levels by these anaerobes are insufficient

to support economic commercial production of sin-

gle CLA isomers (Peng et al., 2007). A better alterna-

tive would be to clone the LAI gene and generate

new production strains using recombinant technol-

ogy. The aim of this study was to clone the linoleate

isomerase gene from Bifidobacterium species and

Propionibacterium acnes into E. coli BL21 (DE3) and

Bacillus species.


Bacterial strains

The bacterial strains used in this study are de-

scribed in Table 1. All Bifidobacterium strains were

grown in anaerobic jars (BD Diagnostics, Franklin

Lake, NJ) with anaerobic generator (GasPak en-

velope, BD Diagnostics, Franklin Lake, NJ) in de

Man Rogosa Sharp (MRS) broth (EMD Chemicals,

Gibbstown, NJ) supplemented with 0.05% (w/v) L-

cysteine (98% pure; Sigma, St. Louis, MO) and incu-

bated at 37°C overnight.

DNA preparation

Genomic DNA was prepared from Bifidobacte-

rium strains by using a QIAamp DNA Stool Mini Kit.

Oligonucleotide primers were synthesized by Inte-

grated DNA Technologies (Coralville, IA).


Table 1. Bacterial strains used in this study

Bacterial strain Description Source

E. coli BL21 (DE3)

This strain lacks the lon and opmT proteases and contains a copy of RNA the T7 RNA polymerase gene under the control of the lacUV5 promoter. These modifications en-able stable expression of proteins using T7 promoter driven constructs

Novagen, Darmstadt, Germany

Bifidobacteria

B. longum ATCC15700

Wild type Center for Food Safety, University of Arkansas

B. breve ATCC15700 Wild type ATCC, Manassas, VA

B. adolescentis ATCC15703

Wild type ATCC, Manassas, VA

B. infantis ATCC25962

Wild type ATCC, Manassas, VA

Bacillus spp

B. subtilis Wild typeCenter for Food Safety, University of Arkansas

B. licheniformis NRRLB-14212

Wild type Center for Food Safety, University of Arkansas

B. megaterium YYBm1

This strain is deficient in the major extracel-lular protease NprM and xylose metabolism XylA.

Stammnen et al. (2010)


Cloning of LA gene into pET24a(+)

The linoleic acid isomerase (LAI) gene from B.

breve (accession number AX647943) and two fin-

ished genome sequences, B. longum NC004307

(accession number AE014295) and B. adolescentis

ATCC15703 (accession number AP009256), were

aligned by using T-coffee (Notredame et al., 2000).

Primers (Table 2) were designed according to the po-

tential linoleic acid (LA) sequences. The PCR condi-

tions (30 cycles) were: initial denaturation 95°C, 120

sec; denaturation, 95°C, 30 sec, annealing, 45°C, 30

sec, extension 72°C, 120 sec, final extension, 72°C, 7

min. PCR conditions were identical for all primer sets,

except the annealing temperature (40°C) for primers

Bifido1F and Bifido1RHis. The 1990-bp PCR prod-

ucts were confirmed by agarose gel electrophore-

sis. PCR products were digested with XhoI and NdeI

and were ligated to vector pET24a(+). Recombinant

plasmids pET2 to pETH5 (Table 3) were transformed

into E. coli BL21 (DE3) by electroporation. Individual

colonies from LB agar plates containing 50 μg/mL of

kanamycin were selected.

Table 2. Oligonucleotides used in this study

Primer name Sequence Application

Bifido1F5’-CAG ACA TAT GTA CTA CAG CGG CAA YTA T-3’

Forward primer containing an NdeI site for cloning LA from B. breve ATCC 15700

Bifido1R

5’-CTA TCT CGA GTC AGA TYA CRY GGT ATY CGC GTA-3’

Reverse primer containing an XhoI site for cloning LA from B. breve ATCC 15700

Bifido R1His5’- CTA TCT CGA GGA TYA CRY GGT ATY CGC GTA-3’

Reverse primer containing an XhoI site for cloning LA from B. breve ATCC 15700 with a C-terminal His6-tag

longumF15’-CAGA CAT ATG TAC TAC AGC AGC GGC AAT-3’

Forward primer containing an NdeI site for cloning LA from B. longum ATCC 15707 or B. infantis ATCC 25962

longumR15’-CTAT CTC GAG TCA GAT TAC GCG GTA TTC GCG-3’

Reverse primer containing an XhoI site for cloning LA from B. longum ATCC 15707 or B. infantis ATCC 25962

longumR1His5’-CTAT CTC GAG GAT TAC GCG GTA TTC GCG-3’

Reverse primer containing an XhoI site for cloning LA from B. longum ATCC 15707 or B. infantis ATCC 25962 with a C-terminal His6-tag

adolesF15’-CAGA CAT ATG TAC TAT TCC AAC GGC AAT-3’

Forward primer containing an NdeI site for cloning LA from B. adolescentis ATCC 15703

adolesR15’-CTAT CTC GAG TCA GAT CAC GCC GTA TTC CTT-3’

Reverse primer containing an XhoI site for cloning LA from B. adolescentis ATCC 15703

adolesR1His5’-CTAT CTC GAG GAT CAC GCC GTA TTC CTT-3’

Reverse primer containing an XhoI site for cloning LA from B. adolescentis ATCC 15703 with a C-terminal His6-tag


Table 3. Plasmids used in this study

plasmid Description Source

pCR® 4-TOPO® Cloning vector for PCR products, Ampr, Kanr Invitrogen

pET24a(+) Expression vector with an N-terminal His6-tag, Kanr Novagen

pET2 pET24a(+) with NdeI-XhoI LA gene from B.longum ATCC 15707 This work

pETH2pET24a(+) with NdeI-XhoI LA gene with His6-tag from B.longum ATCC 15707

This work

pET3 pET24a(+) with NdeI-XhoI LA gene from B. breve ATCC 15700 This work

pETH3pET24a(+) with NdeI-XhoI LA gene with His6-tag from B. breve ATCC 15700

This work

pET4pET24a(+) with NdeI-XhoI LA gene from B. adolescentis ATCC 15703

This work

pETH4pET24a(+) with NdeI-XhoI LA gene with His6-tag from B. ado-lescentis ATCC 15703

This work

pET5 pET24a(+) with NdeI-XhoI LA gene from B. infantis ATCC 25962 This work

pETH5pET24a(+) with NdeI-XhoI LA gene with His6-tag from B. infantis ATCC 25962

This work

pLPPLP. acnes linoleate isomerase inserted into SpeI and EagI sites of pPPlip; PxylA-(-35+ rbs+)-prepeptidelipA-propeptidelipA- LAI P. acnes

This work

pA1 pLPPL derivative, C46A This work





pA6 pLPPL derivative, C46A, C154A, C286A, C344A, C412A This work

pE0Prepropeptide B. subtilis amyE inserted into BsrGI and SpeI sites of pLPPL; PxylA-(-35+ rbs+)-prepeptideamyE-propeptideamyE-LAI P. acnes

This work

pE1 pE0 derivative, C46A This work

pE2 p E0 derivative, C154A This work

pE3 p E0 derivative, C286A This work



pE6 pE0 derivative, C46A, C154A, C286A, C344A, C412A This work


For Propionibacterium acnes LAI, the new DNA

sequence was designed by JCat software (http://

www.jcat.de/) (Grote et al., 2005) and was synthe-

sized by Integrated DNA Technologies, Coralville,

IA. The P. acnes LAI was used as the template and

primers LF to A5F were used to change from 5 cys-

teine positions to alanine (Table 4). The PCR prod-

ucts were flanked by SpeI-EagI restriction sites, were

digested with these enzymes, and subsequently in-

serted into pLPPL after SpeI-EagI digestion, creating

the plasmids pA1, pA2, pA3, pA4, pA5, and pA6.

For prepropeptide B. subtilis amyE fused with P.

acnes LAI, PCR product was amplified by using prim-

ers amyEF and amyER (amyEF: 5’tat atg taca ATG

TTT GCA AAA CGA TTC AAA ACC TC -3’; AmyER:

5’ tat aag atc tac tagt CTC ATT CGA TTT GTT CGC

CGT-3’). The PCR products were flanked by BsrGI-

SpeI restriction sites, were digested with these en-

zymes, and subsequently inserted into pLPPL, pA1,

pA2, pA3, pA4, pA5, pA6 after BsrGI-SpeI digestion,

creating the plasmids pE0, pE1, pE2, pE3, pE4, pE5,

pE6.

Protoplast B. megaterium YYBm1 cells were trans-

formed with the appropriate expression plasmids

using a polyethylene glycol-mediated procedure

described by Christie et al. (2008) while plasmids

were transferred into B. licheniformis NRRLB-14212

by electroporation as described in Xue et al. (1999).

Enzymatic activity measurements

For E. coli BL21 (DE3), 50 mL of Luria-Bertani (LB)

broth containing 50 μg/mL kanamycin (Sigma, St.

Louis, MO) was inoculated (1:100 v/v) with a freshly

grown overnight culture of strains hosting an isom-

erase expression plasmid. After growing at 37°C for

3 hr, cultures were induced with 1 mM isopropylthio-

β-D-galactoside (IPTG) for 2 hr at 26°C.

Cultures were harvested by centrifugation at

10,000 x g for 10 min at 4°C. Cells were suspended

in BugBuster (Novagen, Darmstadt, Germany). The

subcellular localization of heterologous protein pro-

duction was separated following the protocol de-

scribed in pET System Manual 11th edition (Novagen,

Darmstadt, Germany) and the protein samples were

analyzed by SDS-PAGE.

All Bacillus plasmid strains were grown in baffled

shake flasks at 30°C in LB medium at 200 rpm. Re-

combinant expression of genes under transcrip-

tional control of the xylose-inducible promoter was

induced by the addition of 0.5% (w/v) xylose when

OD578 reached 0.4. The secreted proteins were sepa-

rated from cells by centrifugation at 10,000 x g at 4°C

for 10 min. After separation by SDS-PAGE, proteins

were transferred to a nitrocellulose membrane and

detected with 6X his tag antibody (Abcam, Cam-

bridge, MA) and horseradish peroxidase–anti-rabbit

immunoglobulin G conjugates.

Determination of linoleate isomerase activity

Determination of linoleate isomerase activity was

carried out as described by Peng et al. (2007). Briefly,

appropriate dilutions were made in 0.1M Tris, pH 7.5

(total volume of 2 mL) in glass tubes (15×100 mm)

with screw caps. Linoleic acid was added to 140μM

and tubes were shaken for 1 h at 200 rpm at room

temperature. Changes in LA and CLA concentra-

tions were determined by GC analysis. reactions

were extracted with 1ml of hexane and analyzed on

a HP 8452A diode array spectrophotometer. The ab-

sorbance spectrum was between 200 and 400 nm.

Preparation of fatty acid methyl esters

The preparation of fatty acid methyl esters (FAME)

was described in Lewis et al. (2000). Briefly Cells were

weighed into clean, 10 mL screw capped tubes and

a fresh solution of transesterification reaction mix

(methanol:hydrochloric acid:chloroform (10:1:1 v/v/v,

3 mL)) was added. Cells were suspended by vortex

mixing and immediately placed at 90°C for 60 min

for transesterification. Tubes were removed from the

heat and cooled; water (1 mL) was added and the

FAME extracted with a hexane/chloroform mix (4:1,

v/v). Samples were diluted with chloroform contain-


ing a known concentration of tridecanoic acid as an

internal standard. Chromatography was performed

with a Shimadzu GC2010 chromatography system

(Shimadzu Scientific Instruments, Columbia, MA,

USA) equipped with a flame ionization detector. He-

lium was used as carrier and make-up gas. The in-

jection volume was 1 μL which was used with a split

ratio of 1:50. The injection port and detector tem-

peratures were 240 and 250°C, respectively. The col-

umn temperature program was as follows: tempera-

ture was held at 30°C for 2 min, increased to 180°C

at 20°C/min, held at 180°C for 2 min, increased to

207°C at 4 °C/min, held at 207°C for 3 min, increased

to 220°C at 2°C/min, held at 220°C for 2 min, and

then increased to 240°C at 2°C/min before finally be-

ing held at 240°C for 2 min.

Table 4. Oligonucleotides used for LAI engineering in this study

Primer Sequence 5’ to 3’

LF tat aag atc t act agt ATGTCTATTTCTAAAGATTCTCG

LR tat aag atc t CGG CCG TTA GTG ATG GTG

A1R GAG AGT GAG CTT TAC CAC CTA CGT GAT CTG TAC G

A1F GGT GGT AAA GCT CAC TCT CCA AAC TAC CAC G

A2R CAG CTT CAG CAC CGT TTA AAG CTA AGA ATT CAT CGA A

A2F TTA AAC GGT GCT GAA GCT GCT CGT GAT TTA TG

A3R TTA CTA AAG CAG CAT CTA CCA TGT ATT GTT GGT

A3F GTA GAT GCT GCT TTA GTA AAA GAA TAC CCA ACA ATT TCT GG

A4R TTT GAC GAG CTT CTT CTT GTG TTT TAT CAG CGT AAT C

A4F AAG AAG AAG CTC GTC AAA TGG TAT TAG ATG ATA TGG AAA

A5R AGT AGT GAG CTA CTT CAT CGA AGT TAC CGA AAG AC

A5F ATG AAG TAG CTC ACT ACT CTA AAG ATT TAG TAA CAC GTT


Matrix-Assisted Laser Desorption Ion-ization Time-of-Flight Mass Spectrometry (MALDI-TOF-MS)

After Sephadex LH-20 cleanup, the extract was

mixed with a 1 M solution of dihydroxybenzoic acid

(DHB) in 90% methanol in a 1:1 ratio, and 1 μL of

the mixture was spotted onto a ground stainless

steel MALDI target for MALDI analysis using the dry

droplet method. A Bruker Reflex III MALDI-TOF-MS

(Billerica, MA) equipped with a N2 laser (337 nm) was

used in the MALDI analysis, and all the data were

obtained in positive ion reflectron TOF mode.

ReSulTS And dISCuSSIon

LA expression in E. coli BL21 (DE3) as the host

In this study, E. coli BL21 (DE3) was chosen as the

host. Among expression systems, E. coli is consid-

ered to be the first choice since numerous vectors,

readily available engineered strains, and minimal

technical requirements are already in place. In ad-

dition, this system is rapid due to short doubling

times of approximately 20 minutes per generation

(Brondyk, 2009). In this system it was suggested

that the target protein would be synthesized to an

Figure 1. Total cell protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LA gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag

Figure 2. Soluble cytoplasmic protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962.


Figure 4. Soluble (S) and insoluble (I) cytoplasmic protein fraction from E. coli clones contain-ing LAI gene originated from Bifidobacterium strains after adding IPTG 4 hours at 25°C incuba-tion. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag.

Figure 3. Soluble cytoplasmic protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene originated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag.

equivalent of more than 50% of the total cell pro-

tein within a few hours after induction (pET system

manual 11th edition, 2006). By using SDS-PAGE, our

results showed that the expression of LAI in E. coli

was tightly controlled by IPTG (Figure 1). The sol-

uble cytoplasm proteins in E. coli carrying plasmids

were collected and detected by SDS-PAGE (Figure 2

and 3). The results demonstrated that these proteins

were unstable in the cytoplasm and some strains,

particularly strains H3 and H5, did not produce sol-

uble cytoplasm proteins. The soluble and insoluble

cytoplasm proteins were collected to identify the

localization of proteins (Figure 4). The results dem-

onstrated that the 6X His tag adversely affected the

solubility of LAI, particularly LAI originating from B.

longum ATCC15707 (clones 2 versus H2, Figure 4).

Since expressed proteins were sequestered in inclu-

sion bodies, the lower temperature incubation might

have enhanced enzymatic folding. At an incubation

temperature of 21.5°C, the results from SDS-PAGE

did not show improved folding of the enzyme (Figure

5). Deng et al. (2007) reported that the folding of P.

acnes LAI expressed in E. coli was interfered with by

the C-terminal 6X His tag. The activities of LAI from

these clones were undetectable due to possible im-

proper folding of the enzyme or very low enzyme ac-

tivities. Deng et al. (2007) reported that the activity

of P. acnes LAI expressed in E. coli BL21 (DE3) was

only 1 nmol/min/mL. The primary method for mini-

mizing inclusion body formation and maximizing the


formation of soluble, properly folded proteins in the

cytoplasm is lowering the incubation temperature to

15 to 30°C during the expression period because the

reduced temperature reduces the rate of transcrip-

tion, translation, refolding and thus increases proper

folding (Brondyk, 2009). In this study, the incubation

temperature was reduced to 21.5°C; however, this

method did not enhance enzymatic activity. In ad-

dition, protein accumulated in inclusion bodies as

observed in this study is one of the disadvantages of

protein expression in E. coli (Terpe, 2006).

LA expression in B. megaterium YYBm1 and B. licheniformis NRRLB-14212 as the host

Because of these known limitations of E. coli, oth-

er hosts, such as Bacillus spp, have gained interest

(Schmidt, 2004; Wong, 1995;). Bacillus megaterium

is known for its high protein secretion potential, and

strains have the advantage of highly stable, freely

replicating plasmids and the lack of alkaline proteas-

es (Vary, 1994). The plasmidless B. megaterium strain

MS941 was generated from the wild-type strain

DSM319 by directed gene deletion, then the xylA

gene for xylose metabolism was inactivated leading

to the strain YYBm1, which does not metabolize the

inducer of gene activation (Stammen et al., 2010). B.

licheniformis was chosen due to its ability to secrete

large quantities of extracellular enzymes (Schallmey

et al., 2004).

B. megaterium YYBm1 carrying pLPPL secreted

P. acnes LAI; however, no activity was detectable.

Based on P. acnes LAI amino acid sequence, there

are 5 cysteine residues (Figure 6). All five cysteine

residues were changed to alanine by using primers

LF to A5F (Table 4) with P. acnes LAI as the template

but no activity in B. megaterium YYBm1 carrying pA1

to pA6 was detectable. Liu and Escher (1999) report-

ed that the bioluminescence activity of the secreted

Renilla luciferase could be improved after selective

removal of sulfhydryl groups by substitution of cys-

teine residues. Since wild type Renilla luciferase pro-

tein contains an odd number of cysteine residues in

its amino acid sequence, they proposed that a free

cysteine residue and/or unfavorable disulfide bond

in secreted Renilla luciferase could affect its biolu-

minescence activity and alanine, an amino acid con-

sidered to be one of the most neutral, was used for

this purpose.

Based on matrix-assisted laser desorption ioniza-

tion–time of flight mass spectrometry (MALDI-TOF

MS), propeptide S. hyicus lipase was still attached to

Figure 5. Soluble (S) and insoluble (I) cytoplasmic protein fraction isolated from E. coli clones containing LAI gene originated from Bifidobacterium strains after adding IPTG 4 hours at 21.5°C incubation. 2: LAI gene originated from B. longum ATCC1570; 3: LAI gene originated from B. breve ATCC15700; 4: LAI gene originated from B. adolescentis ATCC15703; 5: LAI gene origi-nated from B. infantis ATCC25962; H: LAI gene fused with 6X His tag.


Figure 6. P. acnes LAI amino acid sequence. The underlines show the positions of cysteine

M S I S K D S R I A I I G A G P A G L A A G M Y L E Q A G F H D Y T I L E R T D H V G G

K C H S P N Y H G R R Y E M G A I M G V P S Y D T I Q E I M D R T G D K V D G P K L R

R E F L H E D G E I Y V P E K D P V R G P Q V M A A V Q K L G Q L L A T K Y Q G Y D A

N G H Y N K V H E D L M L P F D E F L A L N G C E A A R D L W I N P F T A F G Y G H F

D N V P A A Y V L K Y L D F V T M M S F A K G D L W T W A D G T Q A M F E H L N A T

L E H P A E R N V D I T R I T R E D G K V H I H T T D W D R E S D V L V L T V P L E K F L

D Y S D A D D D E R E Y F S K I I H Q Q Y M V D A C L V K E Y P T I S G Y V P D N M R P

E R L G H V M V Y Y H R W A D D P H Q I I T T Y L L R N H P D Y A D K T Q E E C R Q M

V L D D M E T F G H P V E K I I E E Q T W Y Y F P H V S S E D Y K A G W Y E K V E G M

Q G R R N T F Y A G E I M S F G N F D E V C H Y S K D L V T R F F V

the P. acnes LAI and might impede enzymatic activ-

ity. In the next step, propeptide B. subtilis amplase

(amyE) was chosen since this propeptide enhanced

the secreted human interferon-α in B. subtilis as the

host. In addition, the propeptide B. subtilis amyE is

only 8 amino acids in length, as compared to 207

amino acids in length for propeptide S. hyicus li-

pase. The plasmids pE0 to pE6 were transferred

into B. megaterium YYBm1. Based on Western blot

detected with 6X his tag antibody, no secreted pro-

teins were found in these strains. The results dem-

onstrated that the protein fused with propeptide B.

subtilis amyE was unstable in B. megaterium YYBm1

as the host (data not shown), compared to human

interferon-α in B. subtilis.

Since attempts with B. megaterium YYBm1 were

unsuccessful, B. licheniformis NRRLB-14212 was ex-

amined as a possible expression host. The plasmids

pLPPL and pE0 were transferred into B. licheniformis

NRRLB-14212 by electroporation. The plasmid pE0

constructed in E. coli could not be successfully trans-

ferred into the expression strain B. licheniformis, in-

dicating a lethal effect. This result agrees with Brock-

meier et al. (2006) that 25 of 173 prepeptides could

not be transferred into B. subtilis TEB1030. The

secreted protein in B. licheniformis NRRLB-14212

carrying pLPPL could not be detected by West-

ern blot (data not shown). Possibly, B. licheniformis

NRRLB-14212, a wild type strain, has extracellular

proteases or propeptide S. hyicus lipase was unable

to protect P. acnes LAI from proteolytic degradation.

ConCluSIonS

Bifidobacterium LAI expressed in E. coli BL21

(DE3) did not function due to insoluble formation in

inclusion bodies. Amino acid modification of P. acnes

LAI expressed in B. megatreium YYBm1 did not im-

prove the activity. Also, the propeptide of B. subti-

lis amyE and both propeptides could not protect P.

acnes LAI from proteolytic degradation in B. mega-


terium YYBm1 and B. licheniformis NRRLB-14212 as

the hosts, respectively.

ACknowledgeMenTS

Author Saengkerdsub was supported by an Ar-

kansas Biosciences Institute Grant. I would like to

thank Simon Stammen, Rebekka Biedendieck, and

Dieter Jahn of Institute of Microbiology, Technische

Universitat Braunschweig for providing plasmids and

B. megterium YYBm1. I appreciate Robert Preston

Story Jr. at the Center for Food Safety in the Depart-

ment of Food Science, the University of Arkansas

for providing Bidifobacterium longum ATCC15707,

Bacillus subtilis, Bacillus licheniformis NRRL B-14212.

RefeRenCeS

Ando, A., J. Ogawa, S. Kishino, and S. Shimizu. 2004.

Conjugated linoleic acid production from castor

oil by LactoBacillus plantarum JCM 1551. Enzyme

Microb. Technol. 35:40-45.

Banni, S. 2002. Conjugated linoleic acid metabolism.

Curr. Opin. Lipidol. 13:261-266.

Belury, M. A. 2002. Dietary conjugated linoleic acid

in health: physiological effects and mechanisms of

action. Annu. Rev. Nutr. 22:505-531.

Belury, M. A., K. P. Nickel, C. E. Bird, and Y. Wu. 1996.

Dietary conjugated linoleic acid modulation of

phorbol ester skin tumor promotion. Nutr. Cancer.

26:149-57.

Berdeaux, O., L. Voinot, E. Angioni, P. Juaneda, and

J. L. Sebedio. 1998. A simple method of prepa-

ration of methyl trans-10,cis-12- and cis-9,trans-

11-octadecadienoates from methyl linoleate. J.

Am. Oil Chem. Soc. 75:1749-1755.

Brockmeier, U., M. Caspers, R. Freudl, A. Jockwer,

T. Noll, and T. Eggert. 2006. Systematic screening

of all signal peptides from Bacillus subtilis: a pow-

erful strategy in optimizing heterologous protein

secretion in Gram-positive bacteria. J. Mol. Biol.

362:393-402.

Brondyk, W. H. 2009. Selecting an appropriate meth-

od for expressing a recombinant protein. Methods

Enzymol. 463:131-147.

Chen, C.-A., W. Lu, and C. Sih. 1999. Synthesis of

9Z,11E-octadecadienoic and 10E,12Z-octadecadi-

enoic acids, the major components of conjugated

linoleic acid. Lipids 34:879-884.

Chin, S. F., W. Liu, J. M. Storkson, Y. L. Ha, and M.

W. Pariza. 1992. Dietary sources of conjugated di-

enoic isomers of linoleic acid, a newly recognized

class of anticarcinogens. J. Food Compost. Anal.

5:185-197.

Christie, G., M. Lazarevska, and C. R. Lowe. 2008.

Functional consequences of amino acid substitu-

tions to GerVB, a component of the Bacillus mega-

terium spore germinant receptor. J. Bacteriol.

190:2014-2022.

Coakley, M., R. P. Ross, M. Nordgren, G. Fitzgerald,

R. Devery, and C. Stanton. 2003. Conjugated lin-

oleic acid biosynthesis by human-derived Bifido-

bacterium species. J. Appl. Microbiol. 94:138-145.

Deng, M. D., A. D. Grund, K. J. Schneider, K. M.

Langley, S. L. Wassink, S. S. Peng, and R. A. Ros-

son. 2007. Linoleic acid isomerase from Propioni-

bacterium acnes: purification, characterization,

molecular cloning, and heterologous expression.

Appl. Biochem. Biotechnol. 143:199-211.

Dugan, M. E. R., J. L. Aalhus, L. E. Jeremiah, J. K.

G. Kramer, and A. L. Schaefer. 1999. The effects of

feeding conjugated linoleic acid on subsequent

pork quality. . Can. J. Anim. Sci. 79:45-51.

Fritsche, J., R. Rickert, and H. Steinhart. 1999. For-

mation, contents, and estimation of daily intake of

conjugated linoleic acid isomers and trans-fatty ac-

ids in foods., In: M. P. Yurawecz, M. M. Mossobo, J.

K. G. Kramer, M. W. Pariza, and G. J. Nelson. Eds.

Advances in Conjugated Linoleic Acid Research.

AOCS, Champaign, IL. p. 378-396.

Griinari, J. M., B. A. Cori, S. H. Lacy, P. Y. Chouinard,

K. V. V. Nurmela, and D. E. Bauman. 2000. Conju-

gated linoleic acid is synthesized endogenously in

lactating dairy cows by delta(9)-desaturase. J. Nutr.

130:2285-2291.

Grote, A., K. Hiller, M. Scheer, R. Münch , B. Nörte-

mann, D. C. Hempel, and D. Jahn. 2005. JCat: a

novel tool to adapt codon usage of a target gene


to its potential expression host. Nucleic Acids

Res.33:W526-W531.

Ha, Y. L., N. K. Grimm, and M. W. Pariza. 1987. Anti-

carcinogens from fried ground beef: heat-altered

derivatives of linoleic acid. Carcinogenesis 8:1881-

1887.

Ha, Y. L., J. Storkson, and M. W. Pariza. 1990. Inhibi-

tion of benzo(a)pyrene-induced mouse forestom-

ach neoplasia by conjugated dienoic derivatives

oflinoleic acid. Cancer Res. 50:1097-1101.

Haas, M., J. Kramer, G. McNeill, K. Scott, T. Foglia, N.

Sehat, J. Fritsche, M. Mossoba, and M. Yurawecz.

1999. Lipase-catalyzed fractionation of conjugated

linoleic acid isomers. Lipids 34:979-987.

Ip, C., S. F. Chin, J. A. Scimeca, and M. W. Pariza.

1991. Mammary cancer prevention by conjugated

dienoic derivative of linoleic acid. Cancer Res.

51:6118-6124.

Kim, Y. J., R. H. Liu, D. R. Bond, and J. B. Russell. 2000.

Effect of linoleic acid concentration on conjugated

linoleic acid production by Butyrivibrio fibrisolvens

A38. Appl. Environ. Microbiol. 66:5226-5230.

Kramer, J. K., P. W. Parodi, R. G. Jensen, M. M. Mos-

soba, M. P. Yurawecz, and R. O. Adlof. 1998. Ru-

menic acid: a proposed common name for the ma-

jor conjugated linoleic acid isomer found in natural

products. Lipids. 33:835.

Lee, K. N., D. Kritchevsky, and M. W. Pariza. 1994.

Conjugated linoleic acid and atherosclerosis in

rabbits. Atherosclerosis. 108:19-25.

Lewis, T., P. D. Nichols, and T. A. McMeekin. 2000.

Evaluation of extraction methods for recovery

of fatty acids from lipid-producing microhetero-

trophs. J. Microbiol. Methods. 43:107-116.

Liew, C., H. A. Schut, S. F. Chin, M. W. Pariza, and R.

H. Dashwood. 1995. Protection of conjugated lin-

oleic acids against 2-amino-3- methylimidazo[4,5-

f]quinoline-induced colon carcinogenesis in the

F344 rat: a study of inhibitory mechanisms. Carci-

nogenesis. 16:3037-3043.

Liu, J., and A. Escher. 1999. Improved assay sensi-

tivity of an engineered secreted Renilla luciferase.

Gene. 237:153-159.

Ma, D. W., A. A. Wierzbicki, C. J. Field, and M. T.

Clandinin. 1999. Conjugated linoleic acid in ca-

nadian dairy and beef products. J. Agric. Food

Chem. 47:1956-1960.

Nicolosi, R. J., E. J. Rogers, D. Kritchevsky, J. A.

Scimeca, and P. J. Huth. 1997. Dietary conjugat-

ed linoleic acid reduces plasma lipoproteins and

early aortic atherosclerosis inhypercholesterolemic

hamsters. Artery. 22:266-277.

Notredame, C., D. G. Higgins, and J. Heringa.

2000. T-Coffee: A novel method for fast and ac-

curate multiple sequence alignment. J. Mol. Biol.

302:205-217.

Pariza, M. W. 2004. Perspective on the safety and ef-

fectiveness of conjugated linoleic acid. Am. J. Clin.

Nutr. 79:1132S-1136S.

Pariza, M. W., Y. Park, and M. E. Cook. 2001. The bio-

logically active isomers of conjugated linoleic acid.

Prog. Lipid Res. 40:283-298.

Park, Y., K. J. Albright, W. Liu, J. M. Storkson, M. E.

Cook, and M. W. Pariza. 1997. Effect of conjugated

linoleic acid on body composition in mice. Lipids.

32:853-858.

Peng, S. S., M.-D. Deng, A. D. Grund, and R. A. Ros-

son. 2007. Purification and characterization of a

membrane-bound linoleic acid isomerase from

Clostridium sporogenes. Enzyme Microb. Technol.

40:831-839.

Poirier, H., J. S. Shapiro, R. J. Kim, and M. A. Lazar.

2006. Nutritional supplementation with trans-10,

cis-12-conjugated linoleic acid induces inflamma-

tion of whiteadipose tissue. Diabetes. 55:1634-

1641.

Rainio, A., M. Vahvaselkä, T. Suomalainen, and S.

Laakso. 2001. Reduction of linoleic acid inhibition

in production of conjugated linoleic acid by Propi-

onibacterium freudenreichii ssp. shermanii. Can. J.


Reaney, M. J. T., L. Ya-Dong, and N. D. Westcott.

1999. Commercial production of conjugated lin-

oleic acid. Adv. Conjugat. Linoleic Acid Res. 1:39-

54.

Risérus, U., S. Basu, S. Jovinge, G. N. Fredrikson, J.

Arnlöv, and B. Vessby. 2002. Supplementation with

conjugated linoleic acid causes isomer-dependent

oxidative stress and elevated C-reactive protein:

a potential link to fatty acid-induced insulin resis-


tance. Circulation. 106:1925-1929.

Rosson, R. A., M.-D. Deng, A. D. Grund, and S. S.

Peng. 2001. Linoleate isomerase. PCT Patent #

WO0100846-A.

Schallmey, M., A. Singh, and O. P. Ward. 2004. Devel-

opments in the use of Bacillus species for industrial

production. Can. J. Microbiol. 50:1 - 17.

Schmidt, F. R. 2004. Recombinant expression sys-

tems in the pharmaceutical industry. Appl. Micro-

biol. Biotechnol. 65:363-372.

Sehat, N., M. P. Yurawecz, J. A. Roach, M. M. Mos-

soba, J. K. Kramer, and Y. Ku. 1998. Silver-ion high-

performance liquid chromatographic separation

and identification of conjugated linoleic acid iso-

mers. Lipids 33:217-221.

Sisk, M. B., D. B. Hausman, R. J. Martin, and M. J.

Azain. 2001. Dietary conjugated linoleic acid re-

duces adiposity in lean but not obese Zucker rats.

J. Nutr. 131:1668-1674.

Smedman, A., and B. Vessby. 2001. Conjugated lin-

oleic acid supplementation in humans-metabolic

effects. Lipids. 36:773-781.

Stammen, S., B. K. Müller, C. Korneli, R. Biedendi-

eck, M. Gamer, E. Franco-Lara, and D. Jahn. 2010.

High-yield intra- and extracellular protein produc-

tion using Bacillus megaterium. Appl. Environ. Mi-

crobiol. 76:4037-4046.

Terpe, K. 2006. Overview of bacterial expression

systems for heterologous protein production:

from molecular and biochemical fundamentals to

commercial systems. Appl. Microbiol. Biotechnol.

72:211-222.

Vary, P. S. 1994. Prime time for Bacillus rnegateriurn.

Microbiology. 140:1001-1013.

Verhulst, A., G. Semjen, U. Meerts, G. Janssen, G.

Parmentier, S. Asselberghs, H. Vanhespen, and H.

Evssen. 1985. Biohydrogenation of linoleic acid by

Clostridium sporogenes, Clostridium bifermen-

tans, Clostridium sordellii and Bacteroides sp.

FEMS Microbiol. Ecol. 31:255-259.

Wong, S. L. 1995. Advances in the use of Bacillus

subtilis for the expression and secretion of heterol-

ogous proteins. Curr. Opin. Biotechnol. 6:517-522.

Xue, G. P., J. S. Johnson, and B. P. Dalrymple. 1999.

High osmolarity improves the electro-transforma-

tion efficiency of the gram-positive bacteria Bacil-

lus subtilis and Bacillus licheniformis. J. Microbiol.

Methods. 34:183-191.


Shiga Toxin-Producing Escherichia coli (STEC) Ecology in Cattle and Management Based Options for Reducing Fecal Shedding T. R. Callaway, T. S. Edrington, G. H. Loneragan, M. A. Carr, D. J. Nisbet

39

Can Salmonella Reside in the Human Oral Cavity?S. A. Sirsat

30

Growth of Acetogenic Bacteria In Response to Varying pH, Acetate Or Carbohydrate Concentration

R. S. Pinder, and J. A. Patterson

6

Independent Poultry Processing in Georgia: Survey of Producers’ PerspectiveE. J. Van Loo, W. Q. Alali, S. Welander, C. A. O’Bryan, P. G. Crandall, S. C. Ricke

70

ARTICLES

Greenhouse Gas Emissions from Livestock and PoultryC. S. Dunkley and K. D. Dunkley

17

REVIEW

Instructions for Authors79

Introduction to Authors

The publishers do not warrant the accuracy of the articles in this journal, nor any views or opinions by their authors.

VOLUME 3 ISSUE 1


MAnuSCRIPT SuBMISSIon

Authors must submit their papers electronically

([email protected]). According to instruc-

tions provided online at our site: www.afabjournal.

com. Authors who are unable to submit electroni-

cally should contact the editorial office for assistance

by email at [email protected].

INSTRUCTIONS TO AUTHORS

• Aerobic microbiology

• Aerobiology

• Anaerobic microbiology

• Analytical microbiology

• Animal microbiology

• Antibiotics

• Antimicrobials

• Bacteriophage

• Bioremediation

• Biotechnology

• Detection

• Environmental microbiology

• Feed microbiology

• Fermentation

• Food bacteriology

• Food control

• Food microbiology

• Food quality

• Food Safety

• Foodborne pathogens

• Gastrointestinal microbiology

• Microbial education

• Microbial genetics

• Microbial physiology

• Modeling and microbial kinetics

• Natural products

• Phytoceuticals

• Quantitative microbiology

• Plant microbiology

• Plant pathogens

• Prebiotics

• Probiotics

• Rumen microbiology

• Rapid methods

• Toxins

• Veterinary microbiology

• Waste microbiology

• Water microbiology

ConTenT of MAnuSCRIPT

We invite you to consider submitting your re-

search and review manuscripts to AFAB. The jour-

nal serves as a peer reviewed scientific forum for to

the latest advancements in bacteriology research

on Agricultural and Food Systems which includes

the following fields:


With an open access publication model of this

journal, all interested readers around the world can

freely access articles online. AFAB publishes origi-

nal papers including, but not limited to the types

of manuscripts described in the following sections.

Papers that have been, or are scheduled to be, pub-

lished elsewhere should not be submitted and will

not be reviewed. Opinions or views expressed in pa-

pers published by AFAB are those of the author(s)

and do not necessarily represent the opinion of the

AFAB or the editorial board.

MAnuSCRIPT TyPeS

Full-Length Research Manuscripts

AFAB accepts full-length research articles con-

taining four (4) figures and/or tables or more. AFAB

emphasizes the importance of sound scientific ex-

perimentation on any of the topics listed in the focus

areas followed by clear concise writing that describes

the research in its entirety. The results of experi-

ments published in AFAB must be replicated, with

appropriate statistical assessment of experimental

variation and assignment of significant difference.

Major headings to include are: Abstract, Introduc-tion, Materials and Methods, Results, Discussion (or Results and Discussion), Conclusion, Acknowl-edgements (optional), Appendix for abbreviations (optional), and References.

Manuscripts clearly lacking in language will be re-

turned to author without review, with a suggestion

that English editing be sought before the paper is

reconsidered. AFAB offers a fee based language

service upon request. Please contact [email protected] for more information about our fees

and services.

Rapid Communications

Under normal circumstances, AFAB aims for re-

ceipt-to-decision times of approximately one month or less. Accepted papers will have priority for publi-

cation in the next available issue of AFAB. However,

if an author chooses or requires a much more rapid

peer review, the journal editorial office has the capa-

bility to shorten the review timing to one week or less.

Any type of manuscript whether it be a full length

manuscript, brief communication or review paper can

be submitted as a rapid communication. There will be

additional costs for processing and page charges will

be double the normal rate. Authors who choose this

option must select Rapid Communications as the pa-

per type when submitting the paper and the editors

will judge whether a rapid review is possible and let

the author know immediately.

Brief Communications

Brief communications are short research notes giv-

ing the results of complete experiments but are con-

sidered less comprehensive than full-length articles

with three (3) figures and/or tables or less. Manuscripts

should be prepared with the same subheadings as full

length research papers. The running head above the

title of the paper is “Brief Communications.”

Unsolicited Review Papers

Review papers are welcome on any topic listed in

the focus section and have no page limits. Reviews

are assessed the same pages charges as all other

manuscripts. All AFAB guidelines for style and form

apply. Major headings to include are: Abstract, In-troduction, Main discussion topics and appropri-ate subheadings, Conclusions, Acknowledgements (optional) and References. Review papers shorter

than 20 pages of double spaced text and references

will be considered mini-reviews with the subhead-

ing above the title on the first page. The running

head above the title of the paper is either “Review”

or “Mini-review”.

Solicited Review Papers

Solicited reviews will have no page limits. The

editor-in-chief will send invitations to the authors

and then review these contributions when they are

submitted. Nominations or suggestions for potential

timely reviews are welcomed by the editors or edito-


rial board members and should be sent to submit@

afabjournal.com. There will be no page charges for

solicited review papers but the solicitation must origi-

nate from the editor-in-chief or one of the editors. Re-

quests from authors will automatically be classified as

unsolicited review papers. The running head above

the title of the paper will be “Invited Review.”

Conference and Special Issues Reviews

AFAB welcomes opportunities to publish papers

from symposia, scientific conference, and/or meet-

ings in their entirety. Conference organizers need

simply to contact AFAB at [email protected]

and a rapid decision is guaranteed. If in agreement,

the conference organizers must guarantee delivery

of a set number of peer reviewed manuscripts within

a specified time and submitted in the same format

as that described for unsolicited review papers. Con-

ference papers must be prepared in accordance with

the guidelines for review articles and are subject to

peer review. The conference chair must decide

whether or not they wish to serve as Special Issue

Editor and conduct the editorial review process. If

the conference chair/organizer chooses to serve as

special issue editor, this will involve review of the pa-

pers and, if necessary, returning them to the authors

for revision. The conference organizer then submits

the revised manuscripts to the journal editorial of-

fice for further editorial examination. Final revisions

by the author and recommendations for acceptance

or rejection by the chair must be completed by a

mutually agreed upon date between the editor and

the conference organizer. Manuscripts not meeting

this deadline will not be included in the published

symposium proceedings but if submitted later can

still be considered as unsolicited review papers. Al-

though offprints and costs of pages are the same

as for all other papers, the symposium chair may be

asked to guarantee an agreed upon number of hard

copies to be purchased by conference attendees. If

the decision is not to publish the symposium as a

special issue, the individual authors retain the right

to submit their papers for consideration for the jour-

nal as ordinary unsolicited review manuscripts.

Book Reviews

AFAB publishes reviews of books considered to

be of interest to the readers. The editor-in-chief ordi-

narily solicits reviews. Book reviews shall be prepared

in accordance to the style and form requirements of

the journal, and they are subject to editorial revision.

No page charges will be assessed solicited reviews

while unsolicited book reviews will be assigned the

regular page charge rate.

Opinions and Current Viewpoints

The purpose of this section will be to discuss, cri-

tique, or expand on scientific points made in articles

recently published in AFAB. Drafts must be received

within 6 months of an article’s publication. Opinions

and current perspectives do not have page limits.

They shall have a title followed by the body of the

text and references. Author name(s) and affiliation(s)

shall be placed between the end of the text and list

of references. If this document pertains to a par-

ticular manuscript then the author(s) of the original

paper(s) will be provided a copy of the letter and of-

fered the opportunity to submit for consideration a

reply within 30 days. Responses will have the same

page restrictions and format as the original opinion

and current viewpoint, and the titles shall end with

“Opinions.” They will be published together. Letters

and replies shall follow appropriate AFAB format

and may be edited by the editor-in-chief and a tech-

nical editor. If multiple letters on the same topic are

received, a representative set of opinions concern-

ing a specific article will be published. A disclaimer

will be added by the editorial staff that the opinion

expressed in this viewpoint is the authors alone and

does not necessarily represent the opinion of AFAB

or the editorial board.

CoPyRIghT AgReeMenT

The copyright form is published in AFAB as space

permits and is available online (www.afabjournal.com).


AFAB grants to the author the right of re-publication

in any book of which he or she is the author or edi-

tor, subject only to giving proper credit to the original

journal publication of the article by AFAB. AFAB re-

tains the copyright to all materials accepted for pub-

lication in the journal. If an author desires to reprint

a table or figure published from a non-AFAB source,

written evidence of copyright permission from an au-

thority representing that source must be obtained by

the author and forwarded to the AFAB editorial office.

PeeR RevIew PRoCeSS

Authors will be requested to provide the names

and complete addresses including emails of five (5) potential reviewers who have expertise in the research

area and no conflict of interest with any of the authors.

Except for manuscripts designated as Rapid Commu-

nication each reviewer has two (2) weeks to review

the manuscript, and submit comments electronically

to the editorial office. Authors have three (3) weeks

to complete the revision, which shall be returned to

the editorial office within six (6) weeks after which the

authors risk having their manuscript removed from

AFAB files if they fail to ask the editorial office for

an extension by email. Deleted manuscripts will be

reconsidered, but they will have to be processed as

new manuscripts with an additional processing fee as-

sessed upon submission. Once reviewed, the author

will be notified of the outcome and advised accord-

ingly. Editors handle all initial correspondence with

authors during the review process. The editor-in chief

will notify the author of the final decision to accept or

reject. Rejected manuscripts can be resubmitted only

with an invitation from the editor or editor-in chief. Re-

vised versions of previously rejected manuscripts are

treated as new submissions.

PRoduCTIon of PRoofS

Accepted manuscripts are forwarded to the edito-

rial office for technical editing and layout. The manu-

script is then formatted, figures are reproduced, and

author proofs are prepared as PDFs. Author proofs

of all manuscripts will be provided to the correspond-

ing author. Author proofs should be read carefully and

checked against the typed manuscript, because the

responsibility for proofreading is with the author(s).

Corrections must be returned by e-mail. Changes

sent by e-mail to the technical editor must indicate

page, column, and line numbers for each correction

to be made on the proof. Corrections can also be

marked using “track changes” in Microsoft Word or

using e-annotation tools for electronic proof correc-

tion in Adobe Acrobat to indicate necessary chang-

es. Author alterations to proofs exceeding 5% of the

original proof content will be charged to the author. All

correspondence of proofs must be agreed to by the

editorial office and the author within 48 hours or proof

will be published as is and AFAB will assume no re-

sponsibility for errors that result in the final publication.

PuBlICATIon ChARgeS

AFAB has two publication charge options: conven-

tional page charges and rapid communication. The

current charge for conventional publication is $25 per printed page in the journal. There is no additional

charge for the publication of pages containing color

images, micrographs or pictures. For authors who

wish to have their papers processed as a rapid com-

munication, authors will pay the rapid communication

fee when proofs are returned to the editorial office

in addition to twice the conventional page charges.

Charges for rapid communications are $1000 per manuscript for guaranteed peer review within one

week and $100 per journal page.

hARd CoPy offPRInTS

If you are wishing to obtain a physical hard copy of

the AFAB journal, offprints are available in any quan-

tity at an additional charge: $100/page for black-white

and $150/page for color prints. You may order your

offprints at any time after publication on our website.

Scientific conference organizers may be expected to

agree to a set number of offprints as a part of their

agreement with AFAB.


MAnuSCRIPT ConTenT RequIReMenTS

Preparing the Manuscript File

Manuscripts must be written in grammatically

correct English. AFAB offers a fee based language

service upon request ([email protected]).

Manuscripts should be typed double-spaced, with

lines and pages numbered consecutively. All docu-

ments must be submitted in Microsoft Word (.doc or

.docx, PC or Mac). All special characters (e.g., Greek,

math, symbols) should be inserted using the sym-

bols palette available in this font. Tables and figures

should be placed in separate sections at the end of

the manuscript (not placed in the text). Failure to fol-

low these instructions will cause delays of the pro-

cessing and review of the manuscript.

Title Page

At the very top of the title page, include a title of

not more than 100 characters. Format the title with

the first letter of each word capitalized. No abbre-

viations should be used. Under the title, the authors

names are listed. Use the author’s initials for both first

and middle names with a period (full-stop) between

initials (e.g., W. A. Afab). Underneath the authors, a

list affiliations must be listed. Please use numerical

superscripts after the author’s names to designate

affiliation. If an authors address has changed since

the research was completed, this new information

must be designated as “Current address:”. The cor-

responding author should be indicated with an aster-

isk e.g., * Corresponding author. The title page shall

include the name and full address of the correspond-

ing author. Telephone and e-mail address must also

be provided for the corresponding author, and email-addresses must be provided for all authors.

Editing

Author-derived abbreviations should be defined

at first use in the abstract and again in the body of

the manuscript. If abbreviations are extensive au-

thors may need to provide a list of abbreviations

at the beginning of the manuscript. In vivo, in vitro

and bacterial names must be italicized (obligatory).

Authors must avoid single sentence paragraphs and

merge such paragraphs appropriately. Authors must

not begin sentences with “Figure or Table shows…”

as these are inanimate objects and cannot “show”

anything. When number are reported in text or in ta-

bles, always put a zero in front of decimal numbers:

“0.10” instead of “.10”.

MAnuSCRIPT SeCTIonS

Abstract

The abstract provides an abridged version of the

manuscript. Please submit your abstract on a sepa-

rate page after the title page. The abstract should

provide a justification of your work, objectives, meth-

ods, results, discussion and implications of study or

review findings . Your abstract must consist of com-

plete sentences without references to other work or

footnotes and must not exceed 250 words. On the

same page as your abstract, please provide at least ten (10) keywords to be used for linking and index-

ing. Ideally, these keywords should include signifi-

cant words from the title.

Introduction

The introduction should clearly present the foun-

dation of the manuscript topic and what makes the

research or the review unique. The introduction

should validate why this topic is important based on

previously published literature, and the relevance of

the current research. Overall goals and project ob-

jectives must be clearly stated in the final sentence

of the last paragraphs of the introduction.

Materials and Methods

Information on equipment and chemicals used

must include the full company name, city, and state

(country if outside the United States or Province if

in Canada) [i.e., (Model 123, ACME Inc., Afab, AR)].


Variability, Replication, and Statistical Analysis

To properly assess biological systems indepen-

dent replication of experiments and quantification

of variation among replicates is required by AFAB.

Reviewers and/or editors may request additional

statistical analysis depending on the nature of the

data and it will be the responsibility of the authors

to respond appropriately. Statistical methods com-

monly used in the bacteriology do not need to be

described in detail, but an adequate description

and/or appropriate references should be provided.

The statistical model and experimental unit must

be designated when appropriate. The experimen-

tal unit is the smallest unit to which an individual

treatment is imposed. For bacterial growth stud-

ies, the average of replicate tubes per single study

per treatment is the experimental unit; therefore,

individual studies must be replicated. Repeated

time analyses of the same sample usually do not

constitute independent experimental units. Mea-

surements on the same experimental unit over time

are also not independent and must not be consid-

ered as independent experimental units. For analy-

sis of time effects, assess as a rate of change over

time. Standard deviation refers to the variability

in the biological response being measured and is

presented as standard deviation or standard error

according to the definitions described in statistical

references or textbooks.

Results

Results represent the presentation of data in

words and all data should be described in same

fashion. No discussion of literature is included in

the results section.

Discussion

The discussion section involves comparing the

current data outcomes with previously published

work in this area without repeating the text in the

results section. Critical and in-depth dialogue is

encouraged.

Results and Discussion

Results and discussion can be under combined or

separate headings.

Conclusions

State conclusions (not a summary) briefly in one

paragraph.

Acknowledgments

Acknowledgments of individuals should include

institution, city, and state; city and country if not U.S.;

and City or Province if in Canada. Copies being re-

viewed shall have authors’ institutions omitted to re-

tain anonymity.

References

a) Citing References In Text

Authors of cited papers in the text are to be pre-

sented as follows: Adams and Harry (1992) or Smith

and Jones (1990, 1992). If more than two authors of

one article, the first author’s name is followed by the

abbreviation et al. in italics. If the sentence structure

requires that the authors’ names be included in pa-

rentheses, the proper format is (Adams and Harry,

1982; Harry, 1988a,b; Harry et al., 1993). Citations to a

group of references should be listed first alphabeti-

cally then chronologically. Work that has not been

submitted or accepted for publication shall be listed

in the text as: “G.C. Jay (institution, city, and state,

personal communication).” The author’s own un-

published work should be listed in the text as “(J.

Adams, unpublished data).” Personal communica-

tions and unsubmitted unpublished data must not

be included in the References section. Two or more

publications by the same authors in the same year

must be made distinct with lowercase letters after

the year (2010a,b). Likewise when multiple author ci-

tations designated by et al. in the text have the same

first author, then even if the other authors are differ-

ent these references in the text and the references

section must be identified by a letter. For example


“(James et al., 2010a,b)” in text, refers to “James,

Smith, and Elliot. 2010a” and “James, West, and Ad-

ams. 2010b” in the reference section.

b) Citing References In Reference Section

In the References section, references are listed in

alphabetical order by authors’ last names, and then

chronologically. List only those references cited in the

text. Manuscripts submitted for publication, accepted

for publication or in press can be given in the refer-

ence section followed by the designation: “(submit-

ted)”, “(accepted)’, or “(In Press), respectively. If the

DOI number of unpublished references is available,

you must give the number. The year of publication fol-

lows the authors’ names. All authors’ names must be

included in the citation in the Reference section. Jour-

nals must be abbreviated. First and last page num-

bers must be provided. Sample references are given

below. Consult recent issues of AFAB for examples

not included in the following section.

Journal manuscript:

Examples:

Chase, G., and L. Erlandsen. 1976. Evidence for a

complex life cycle and endospore formation in the

attached, filamentous, segmented bacterium from

murine ileum. J. Bacteriol. 127:572-583.

Jiang, B., A.-M. Henstra, L. Paulo, M. Balk, W. van

Doesburg, and A. J. M. Stams. 2009. A typical

one-carbon metabolism of an acetogenic and

hydrogenogenic Moorella thermioacetica strain.

Arch. Microbiol. 191:123-131.

Book:

Examples:

Hungate, R. E. 1966. The rumen and its microbes

Academic Press, Inc., New York, NY. 533 p.

Book Chapter:

Examples:

O’Bryan, C. A., P. G. Crandall, and C. Bruhn. 2010.

Assessing consumer concerns and perceptions

of food safety risks and practices: Methodologies

and outcomes. In: S. C. Ricke and F. T. Jones. Eds.

Perspectives on Food Safety Issues of Food Animal

Derived Foods. Univ. Arkansas Press, Fayetteville,

AR. p 273-288.

dissertation and thesis:

Maciorowski, K. G. 2000. Rapid detection of Salmo-

nella spp. and indicators of fecal contamination

in animal feed. Ph.D. Diss. Texas A&M University,

College Station, TX.

Donalson, L. M. 2005. The in vivo and in vitro effect

of a fructooligosacharide prebiotic combined with

alfalfa molt diets on egg production and Salmo-

nella in laying hens. M.S. thesis. Texas A&M Uni-

versity, College Station, TX.

Van Loo, E. 2009. Consumer perception of ready-to-

eat deli foods and organic meat. M.S. thesis. Uni-

versity of Arkansas, Fayetteville, AR. 202 p.

web sites, patents:

Examples:

Davis, C. 2010. Salmonella. Medicinenet.com.

http://www.medicinenet.com/salmonella /article.

htm. Accessed July, 2010.

Afab, F. 2010, Development of a novel process. U.S.

Patent #_____

Author(s). Year. Article title. Journal title [abbreviated].

Volume number:inclusive pages.

Author(s) [or editor(s)]. Year. Title. Edition or volume (if

relevant). Publisher name, Place of publication. Number

of pages.

Author(s) of the chapter. Year. Title of the chapter. In:

author(s) or editor(s). Title of the book. Edition or vol-

ume, if relevant. Publisher name, Place of publication.

Inclusive pages of chapter.

Author. Date of degree. Title. Type of publication, such

as Ph.D. Diss or M.S. thesis. Institution, Place of institu-

tion. Total number of pages.


Abstracts and Symposia Proceedings:

Fischer, J. R. 2007. Building a prosperous future in

which agriculture uses and produces energy effi-

ciently and effectively. NABC report 19, Agricultural

Biofuels: Tech., Sustainability, and Profitability. p.27

Musgrove, M. T., and M. E. Berrang. 2008. Presence

of aerobic microorganisms, Enterobacteriaceae and

Salmonella in the shell egg processing environment.

IAFP 95th Annual Meeting. p. 47 (Abstr. #T6-10)

Vianna, M. E., H. P. Horz, and G. Conrads. 2006. Op-

tions and risks by using diagnostic gene chips. Pro-

gram and abstracts book , The 8th Biennieal Con-

gress of the Anaerobe Society of the Americas. p.

86 (Abstr.)

Data Presentation in Tables and Figures

Figures and tables to be published in AFAB must

be constructed in such a fashion that they are able

to “stand alone” in the published manuscript. This

means that the reader should be able to look at

the figure or table independently of the rest of the

manuscript and be able to comprehend the experi-

mental approach sufficiently to interpret the data.

Consequently, all statistical analyses should be very

carefully presented along with variation estimates

and what constitutes an independent replication

and the number of replicates used to calculate the

averages presented in the table or figure.

Each table and figure must be on a separate

page in the submitted paper. In addition, you will

need to submit all data for charts, tables and

figures in native format when possible (e.g., Mi-

crosoft excel, Powerpoint). Photographs should

be submitted as high-resolution (600 dpi) .jpg or

tif. files. All figures should be clearly presented with

well defined axis and units of measurement. Sym-

bols, lines, and bars must be made distinct as “stand

alone” black and white presentations. Stippling,

dashed lines etc. are encouraged for multiple com-

parison but shades of gray are discouraged. Color

images, micrographs, pictures are recommended

and there is no additional fee for their submission.

AFAB Online Edition is Now Available!

www.AFABjournal.com

• Free Access

• Print PDFs

• Flip Through Issues

• Search Article Archives

• Order Reprints

• Submit a Paper

Online Publication: www.AFABjournal.com

afab volume 3 issue 2

Documents

hangcornell university

university of houston

kirkhamkansas state

kwon university of arkansas

dunkley university of

inaugural issue

crandalluniversity of

rickeuniversity of arkansas