Am. J. Hum. Genet. 56:623-629, 1995

A Novel Donor Splice Site in Intron I I of the CFTR Gene, Createdby Mutation 1811 + I .6kbA-G, Produces a New Exon: HighFrequency in Spanish Cystic Fibrosis Chromosomes andAssociation with Severe PhenotypeM. Chillon,' T. Dork72 T. Casals,' J. Gimenez,' N. Fonknechten,3 K. Will,2 D. Ramos,' V. Nunes,'and X. Estivill'

'Molecular Genetics Department, Cancer Research Institute, Hospital Duran Reynals, L'Hospitalet de Llobregat, Barcelona; 2Molekulare Pathologie derMukoviszidose, Medizinische Hochschule Hannover, Klinische Forschergruppe, Hannover; and 'CNRS UA 1147, INSERM U 129, Institut Cochin deGenetique Mol6culaire, Paris

Summary

mRNA analysis of the cystic fibrosis transmembrane regu-lator (CFTR) gene in tissues of cystic fibrosis (CF) patientshas allowed us to detect a cryptic exon. The new exoninvolves 49 base pairs between exons 11 and 12 and isdue to a point mutation (1811+1.6kbA-+G) that createsa new donor splice site in intron 11. SemiquantitativemRNA analysis showed that 1811+1.6kbA--G-mRNAwas 5-10-fold less abundant than AF508 mRNA. Muta-tion 1811+1.6kbA-+G was found in 21 Spanish and 1German CF chromosomes, making it the fourth-most-fre-quent mutation (2%) in the Spanish population. Individu-als with genotype AF508/1811+1.6kbA--G have only1%-3% of normal CFTR mRNA. This loss of 97% ofnormal CFTR mRNA must be responsible for the pancre-atic insufficiency and for the severe CF phenotype in thesepatients.

Introduction

Cystic fibrosis (CF) is the most common autosomal reces-sive disorder in Caucasoids. The disease, characterized bychronic pulmonary infections, pancreatic enzyme insuffi-ciency, and elevated electrolyte levels in sweat, is causedby an altered chloride secretion across the apical membraneof epithelial cells (Boat et al. 1989). The CFTR gene isassociated with CF (Kerem et al. 1989), and -400 muta-tions have been described (Tsui, 1992; Cystic Fibrosis Ge-netic Analysis Consortium [CFGAC] 1993).

In several genetically homogeneous populations, >95%of CF mutations have been characterized: 100% in Hutter-

Received May 5, 1994; accepted for publication November 29, 1994.Address for correspondence and reprints: Dr. Xavier Estivill, Molecular

Genetics Department, Cancer Research Institute, Hospital Duran i Rey-nals, Avia de Castelldefels, Km. 2.7, L'Hospitalet de Llobregat, E-08907Barcelona, Spain.© 1995 by The American Society of Human Genetics. All rights reserved.0002-9297/95/5603-0010$02.00

ites (Zielensky et al. 1993), 98.5% in Belgians (Cuppenset al. 1993), 98% in a French population of Celtic origin(Ferec et al. 1992), and 97% in Jewish Ashkenazi (Abelio-vich et al. 1992). In heterogeneous population groups, thenumber of different mutations is very large (Claustres etal. 1993; Chillon et al. 1994b). Chromosomes as yet un-characterized may contain large deletions (Morral et al.1993b), intronic mutations (Highsmith et al. 1994), or mu-tations in the promoter region (T. Bienvenu, personal com-munication to the CFGAC), which might escape detectionby the usual mutations analysis experiments (SSCP analysis;denaturant gradient-gel electrophoresis [DGGE]; chemicalcleavage; or direct sequencing).

Changes in the sequences of splice sites cause abnormalsplicing processes (Krawczak et al. 1992). The known de-terminants of splice-site selection in nuclear-precursorRNAs are the splice-donor and splice-acceptor sites, thepolypyrimidine tract, and the lariat branch point. Otherfactors, such as a minimal intron size (Wieringa et al. 1984)and specific secondary RNA structures (Estes et al. 1992),also play an essential role in splicing control and regulation.Although it has been reported for the CFTR gene (exon19b; Highsmith et al. 1994) and for several other genes(Krawczak et al. 1992), the production of a new exon bythe creation of a new splice site is an infrequent phenome-non, since it needs the other splice determinants to be inthe correct positions in order to be active.We report here the identification and characterization of

a new mutation, 1811+1.6kbA-+G, in intron 11 of theCFTR gene, which causes the appearance of a new exon(exon 11b). We also present the genotype/phenotype corre-lation of the mutation in CF patients and its frequency anddistribution in Spanish and German CF chromosomes.

Patients and Methods

PatentsA total of 520 unrelated Spanish families and 350 Ger-

man families, with at least one affected child and a con-firmed diagnosis of CF, were investigated. All patients had

623

Am. J. Hum. Genet. 56:623-629, 1995

a minimum of two positive chloride sweat tests (Cl- > 60mmol/liter). Genomic DNA was isolated from peripheralblood lymphocytes according to standard protocols.

mRNA Extraction and Reverse Transcription (RT)RNA was isolated from peripheral lymphocytes, Epstein-

Barr virus (EBV)-transformed lymphoblastoid cell lines,and a nasal polyp. Total cellular RNA was extracted usingthe guanidinium isothiocyanate procedure (Chomczynskiand Sacchi 1987). cDNA was synthesized in a 20-gl reac-tion volume from 2 ,ug of total RNA, with random hexam-ers, using the GeneAmp RNA PCR kit (Perkin Elmer;N808-0017), according to the manufacturer's instructions,except that incubation was for 30 min at 420C.

cDNA AnalysisCFTR-cDNA was amplified with primers from coding

regions. To analyze the effects on mRNA of the1811+1.6kbA-+G change in intron 11 and 3601-111 G/Cin intron 19, the CFTR-cDNA was amplified with primersM4-I-D (5'-TAAACAAAATACAGGAKTTCTFAC-3');M4-I-R (5'-CAGTFITACAGACACAGCITITCAA-3') forintron 11; M8-I-D (5'-TGGAATCTGAAGGCAGGA-GTC); and M8-I-R (5'-AAAAAATAAATACT'rTICT-GTGGTATC-3') for intron 19. PCR conditions were asfollows: denaturation at 950C for 30 s, annealing at 560Cfor 30 s, and extension at 74°C for 40 s, for 35 cycles.

For each fragment, 1 jl of the first PCR reaction wasused in a nested PCR, with the internal primers E1OD2(5'-TTCACTTCTAATGATGATTATGG-3'), E12R1 (5'-CITFCAAATAT'TFCITIT'FCT-3'), E18D1 (5'-GAG-AAGGAGAAGGAAGAGTTG-3'), and E2OR1 (5'-TGT-GGTATCACTCCAAAGGC-3'). PCR conditions were asfollows: denaturation at 95°C for 30 s, annealing at 56°Cfor 30 s, and extension at 74°C for 40 s, for 40 cycles. Thereaction mix contained 5 ,u of 10 x PCR buffer (Perkin-Elmer-Cetus; N808-0006), 200 gM of each dNTP, 20pmol of each primer, 1 ml of DNA, and 1 U of Taq DNApolymerase in a final volume of 50 pl.PCR products were purified using Stratagene PrimeErase

Quik columns (#400705) to remove primers and dNTPs.Direct automatic sequencing was performed using a TaqDye Deoxy Terminator Cycle-Sequencing kit (ABI;#401113) according to the manufacturer's instructions. Se-quencing conditions were denaturation at 96°C for 30 s,annealing at 50°C for 30 s, and extension at 60°C for 4min, for 28 cycles. Data analyses were performed with theCollection and Analysis computer programs from AppliedBiosystems.

Screening with Mutagenesis PrimerSince mutation 1811+1.6kbA-+G does not affect any

restriction enzyme site, we designed the mutagenesis primerE11bDX. The sequence of E11bDX is 5'-AGAGAATCC-TATGTACTTGlGGAT-3'. PCR conditions were as before.

The reaction mix contained 5 p1 of 10 x PCR buffer(N808-0006), 200 ,uM of each dNTP, 20 pmol of primersEllbDX and IllbR (5'-CAGTTCCCATATTAAATA-GAAATGA-3'), 1 p1 of DNA, and 1 U of Taq DNA poly-merase in a final volume of 50 p1. After PCR, a restrictionenzyme digestion was performed with FokI (normal allele,125 bp; mutated allele, 91 bp + 34 bp).

Semiquantitative mRNA AnalysisWe used total RNA extracted from the nasal polyp of

the AF508/1811+1.6kbA-,G heterozygous patient, for aquantification of CFTR mRNA transcripts from both al-leles. RT was performed using the exon 13 primer 5'-GTTAGCCATCAG'lT'ACAGACACA-3'. A cDNA re-gion spanning both the AF508 mutation and the crypticexon 1 lb (PCR primers 5'-CYFGGAGAAGGTGGAATC-ACAC-3' and 5'-CTAGGTATCCAAAAGGAGAGTC-3')was amplified by RT-PCR, taking aliquots after 22, 24,26, 28, and 30 PCR cycles. NuSieve agarose (3%) gelelectrophoresis showed the 49-bp insertion, by ethidiumbromide staining, as the larger band, which appeared witha delay of 2-4 cycles, compared with the main product ofthe expected size. For a better detection and discriminationof hetero- and homoduplexes, 2 ,uCi of 33P-dATP wereincluded in a RT-PCR reaction, and the labeled productswere separated in 6% polyacrylamide on a native 40-cmgel containing 5% glycerol and 1 x Tris-borate EDTA.The gel was fixed in 10% acetic acid, dried, and subjectedto phosphoimager analysis (Fuji). After integration of allsignals, the relative proportions of RT-PCR products fromthe AF508 and the 1811+l.6kbA-+G alleles were calcu-lated from the intensities produced by their respectivehetero- and homoduplexes.

Results

3601-1 I IGIC and 1811 + 1.6kbA-)G ChangesIn order to detect mutations responsible for CF in Span-

ish chromosomes, the whole CFTR gene has been screenedby SSCP analysis (Chillon et al. 1994a). A novel SSCP bandpattern was detected by using exon 19 and its intronicflanking regions. Sequencing of this fragment showed thatthe abnormal pattern was due to a G--C substitution at nt3601-111. This change was found in 21 Spanish and 1German CF chromosomes but was not detected in 196normal chromosomes. Similarly, SSCP analysis for theother CFTR exons showed normal migration patterns, in-dicating that the 3601-111 substitution could be the muta-tion that causes the disease.

Analysis of the nucleotide sequence around nt 3601-111 revealed that the G-+C change could activate a crypticbranch site (with putative acceptor site and polypyrimidinetract, at required locations), which would compete withthe normal branch site. Consensus values for the crypticsplice sites were similar to the normal ones, suggesting that

624

Chill6n et al.: Cryptic CFTR Exon in Cystic Fibrosis

Table I

CV of Splice Sites of 3601-I I I G/C and 181 1+I.6kbA-G

Branch Site Acceptor Sitea Donor Site

3601-111 G/C:b(G) ............................... .78.83 .84(C) ......... ........ 1.00 .83 .84

Exon 19 ............ ..... .97 .94 .841811 +1.6kbA-G:Normal (A) ................. .81 .94 .65cMutant (G) ................. .81 .94 .83

NoTE.-CVs, as defined by Senapathy et al. (1990), reflect the similar-ity of any one splice site to the consensus sequences. CVs were calculatedaccording to the Senapathy et al. tables.

a Acceptor site was calculated without considering the most upstreamintronic positions (from -7 to -14).

b 3601-111G/C (C) is in the putative branch site, but it should use acryptic acceptor site.

c It cannot be potentially active, because there is no GT signal at thedonor site.

625

To determine the ratio of normal to abnormal transcriptsfrom the 1811+1.6kbA-+G allele, we amplified the cDNAregion spanning both the AF508 mutation and the crypticexon 1 lb. We separated the radioactively labeled RT-PCRproducts on a 40-cm 6% polyacrylamide gel and detectedheteroduplexes formed by AF508/"wild-type" products.Phosphoimager quantification of all hetero- and homodu-plexes indicated a ratio of .87:.11:.02 for the three mRNA

A

Exon 11 1.6 kb Exon llb 0.8 kb Exon 12_-~ ~ ~ ~ ~~~ -_

1113-C - EllbR

EllbD- -1215-C

IllbD - - IllbR

B

aataagttacactataaaggttgttttagacttttaaagttctgccattg 50

this cryptic site could be used instead of the normal branchsite to cause abnormal splicing (table 1).To test this hypothesis, mRNA studies were performed

in one Spanish CF patient (heterozygous for G542X and3601-11G/C) and one German CF patient (heterozygousfor SF508 and 3601-11lG/C). mRNA was obtained froma nasal polyp of the German CF patient, while mRNAfrom the Spanish CF was obtained from illegitimate tran-scription in EBV-transformed lymphoblastoid cell lines andperipheral lymphocytes (Fonknechten et al. 1992).cDNA studies in both patients showed no abnormal

band pattern between exons 17b and 20. However, anextra band was detected between exons 10 and 12 in theG542X/3601-11lG/C patient. Sequencing of this extrafragment showed a 49-bp insertion between exons 11 and12 (fig. 1). To further study the cause of this insertion,primers from this sequence (El lbD and El lbR) were usedto amplify and to sequence the flanking genomic regions(with 12i5-C and 11i3-C, respectively). The 49-bp insertionwas located 1.6 kb downstream from exon 11. The nor-mal genomic sequence showed that the regions flankingthe 49-bp insertion fragment contain the putative 3' splicesites (branch site, polypyrimidine tract 10 pyrimidines long,and acceptor site) upstream of, and a putative donor site(gtaagg), 5 nt downstream from the 49-bp insertion (fig.1). Comparison of the normal and the CF patient's genomicsequences, showed an A-+G substitution in the 1st nt down-stream from the 49-bp fragment (fig. 2). In the initial cDNAanalysis of the G542X/1811+1.6kbA--G patient, we de-tected both the 49-bp insertion and the G542X allele, whilein the AF508/1811+l.6kbA-oG patient, we mainly de-tected the AF508 allele, since RNA from the 1811+1.6kbA-*G allele was 5-10-fold less abundant than theAF508 allele (fig. 3).

gtttttaaaaaaatttttaaattggctttaaaaatttcttaattgtgtgc

tgaatacaattttctttattacaaAAGTACCAACAATTACATGTATAAAC

sTOP g

AGAGAATCCTATGTACTTGAGATat-agtaaggttactatcaatcacacc

100

150

200

tgaaaatttaaatgttatgaagaaattatctcatttctatttaatatggg 250

aactgtgtct 260

c

DNA

11 llb 12

Figure I Characterization of mutation 1811+1.6kbA-G and se-quence of the 49-bp exon 1lb and flanking regions. A, Strategy for thecharacterization of exon 11b. To identify the sequence of the flankingregions of the 49-bp fragment, we used primer 1 1i3-C/EllbR and El ldD/12i5-C. l1i-3C and 12i5-C are the complementary primers of lli-3 and12i-5 from Zielenski et al. (1991). Primer sequences are 11i3-C (5'-ATT-ATGGTTACTCAGAATCTGTGC-3'); 12i5-C; I1 lbD (5'-TATAAA-GGTTGFlTFITlAGACACT1-3'); IllbR (5'-CAGTTCCCATATTAAATA-GAAATG-3'); EllbD (5'-AAGTACCAACAATTACATGTATAA-3');and El lbR (5'-ATCTCAAGTACATAGGATTCTC-3'). The other prim-ers are described in the text. B, Sequence of the 49-bp exon 1 lb (capitals).A plus sign (+) denotes putative branch point. STOP denotes terminationcodon. The 1811+1.6kbA-G substitution is denoted by the letter "g."Donor site, acceptor site, and polypyrimidine tract are underlined. Aputative donor splice cite (gtaagg) is located S nt downstream from theA-+G mutation. Accession number for the European Molecular BiologyLaboratory Data Library is Z34919. C, Schematic representation of theeffect of mutation 1811+1.6kbA-6G on CFTR-mRNA.

Am. J. Hum. Genet. 56:623-629, 1995

Control Heterozygote 1811+1.6kb A-+G

Figure 2 DNA sequence of a normal control and a

1811+1.6kbA-G heterozygote. Mutation is indicated by an arrow.

species AF508:1811+1.6kbA-*G:wild type. Therefore, themajority of mRNA derived from 1811+1.6kbA--G hasexon lib, leaving a small proportion corresponding tonormal CFTR mRNA (fig. 3B).The presence of a splice donor site, 5 nt downstream

from the 1811+1.6kbA--G mutation suggests that therecould be alternative splicing between exon 11 and 12 (exonlib'). However, we have analyzed this region extensivelyin three normal controls and in 15 CF polyps (with differentgenotypes), and we have not detected an exon 1 lb'. Thisnegative data for exon 11 b' also suggest that exon 11bis produced only in individuals carrying the 1811+1.6kbA-+G allele. We do not know why the nearbysplice donor site, 5 nt downstream from the 1811+ 1.6kbA--G mutation site, is not used. We have performedconformation analysis of this mRNA region (with theRNAFOLD program) and have found that this putativesplice site does not lie in a region with a strong secondarystructure (which could explain why it is not used as an

active splice site).

181 1 + 1.6kbA--G ScreeningTo facilitate screening for mutation 1811+1.6kbA--oG,

a mutagenesis primer was designed. We have detected thismutation in 21 Spanish and 1 German CF chromosomes.1811 +1.6kbA--G is the fourth-most-frequent mutation inthe Spanish CF population (21/1,004; estimated frequency2.0%), but it was the only mutated allele detected in a

sample of 350 German CF chromosomes (estimated fre-quency <0.2%). 1811+1.6kbA-NG has a strong associa-tion with the polymorphism 3601-l1 1G/C, since they havealways been found together. Similarly, 1811 + 1.6kbA-+Gis associated with haplotype 16-46-13 for the IVS8CA-IVS17bTA-IVS17bCA microsatellite markers (Morral et al.1993a), with haplotype 2-1-2 for the TUB9-TUB18-TUB20intragenic markers (Dork et al. 1992), and with haplotypeC (in Spanish chromosomes) and haplotype A (in the Ger-man chromosome) for the extragenic markers XV-2c andKM.19 (2-1 and 1-1, respectively).

Genotype-Phenotpe CorrelationWe have studied the phenotypic effects of mutation

1811+1.6kbA-+G, through the analysis of the clinical fea-

tures of the CF patients. We have no patients homozygousfor 1811+1.6kbA-G. Clinical data were available in 20of the 28 patients heterozygous for the mutation. We havedivided the patients carrying the 1811+1.6kbA-,G muta-tion into two groups, depending on whether the mutationon the other chromosome was known to be mild or severe

(table 2). Three CF patients carried mutation P205S on theother chromosome, which is associated with a mild CFphenotype and pancreatic sufficiency (Chillon et al. 1993).Seventeen other patients were carriers of a knownsevere CF mutation (AI507, AF508, 1609delCA, G542X,K71OX, or N1303K) on the other chromosome. When1811+1.6kbA--G was associated with a known severe mu-

tation, the clinical features were indistinguishable from

A

22 24 26 28 30 S 22 24 26 28 30

306257

AF508 / AF508 AF508 / 1811+1.6kb A-÷G

B

XT1T ~ ~4321 67 5431

Figure 3 A, RT-PCR kinetics from nasal polyp cDNA on a 3%NuSieve agarose gel. Left, AF508 homozygous control patient. Right,Index case AF508/1811+1.6kbA-oG. Note the delayed appearance andlower intensity of the larger band carrying the 49-bp insertion, which isconsistent with a 5-10-fold lower yield of product. B, Phosphoimageranalysis of labeled RT-PCR products after separation in a 6% polyacryl-amide gel. Left, Typical AF508 heterozygous profile from a patient AF508/N1303K. The peaks correspond to the AF508/wild-type heteroduplexes(3,4). Right, Profile from the index patient AF508/1811+1.6kbA-G. Theanalyzed peaks correspond to the predominant tvF508 homoduplex (1),two very faint heteroduplexes AF508/wild type (3,4), a minor homodu-plex carrying exon 1lb (5), and heteroduplexes carrying exon 1lb (6,7).After integration of the signals for the respective hetero- and homodu-plexes, the ratio of the three different cDNA species was calculated to be0.87:0.11:0.20 (AF508:exon 1 lb:wild type).

PSL PSL

000.0~~~~~~~~~~~~~~~12.

400.1050

200.0~~~~~~~~~~~~~~~0.100.0370

0a0.0 25.0 00.0 70.0 100.0 120.0 160.0 0.0 25.0 60.0 75.0 100.0 120. 150.0

626

Chill6n et al.: Cryptic CFTR Exon in Cystic Fibrosis

Table 2

Clinical Features of 20 CF Patients with Mutation 1811 + 1.6kbA-G

1811 +1.6kbA-G/Severe Mutationa 1811 +1.6kbA-G/P205Sb AF508/AF508c

No. of patients ...................... 17 3 82Age (years) ...................... 9.1 ± 5.8 12 ± 5.3 7.8 ± 5.2Age at diagnosis (years) ............... 2.8 ± 4.0 7.1 ± 5.2 2.2 ± 2.8Sweat chloride (mmolIL) ............. 98 ± 11.7 100 ± 10 104.4 ± 15.7FEV1 (% predicted)d .................... 65 ± 24.8 70.8 ± 12.8 74.8 ± 23.1Shwachman score' ...................... 74.5 ± 12.3 86.6 ± 2.3 83.1 ± 11.8Pancreatic sufficiency ................... 0/19 (0%) 3/3 (100%) 1/82 (1.2%)

a A1507, AF508, 1609delCA, G542X, K710X, and N1303K.b Mutation P205S has been described as associated with a mild CF phenotype and pancreatic sufficiency.'Clinical data from 82 Spanish AF508 homozygous patients (X. Estivill, unpublished data).d Forced expiratory volume in 1 s (% predicted); data from 9 patients with mutation 1811+1.6kbA-.G and 45 AF508/AF508 patients.'Clinical score system of Shwachman-Kulzcycki, of which 100 is the best clinical score (Shwachman and Kulzcycki 1958).

those of patients homozygous or compound heterozy-gous for severe mutations (CFGAC 1993). Comparison ofthese patients with Spanish AF508/AF508 patients alsoshowed a similar severity (table 2). Therefore, mutation1811+1.6kbA-+G must be considered to be associated witha severe CF phenotype and pancreatic insufficiency.

Discussion

Several CF alleles remain uncharacterized, even after theanalysis of the complete coding region of the CFTR gene.

The mutations responsible for CF in these chromosomesmust be located in introns or in the promoter, be largedeletions, or have escaped the point-mutation detectionsystems. At present, only one intronic mutation(3849+10kbC-+T in intron 19; Highsmith et al. 1994), onemutation in the promoter region (T. Bienvenue, personalcommunication to CFGAC), and one large deletion(CFSOkbdel#1; Morral et al. 1993b) have been describedin the CFTR gene.

By mRNA analysis, we detected a 49-bp insertion be-tween exons 11 and 12, whereas no abnormalities were

detected between exons 18 and 19, defining the 3601-111G/C change as a polymorphism. The analysis of geno-

mic sequences detected an A-+G substitution of the firstnucleotide downstream from the 49-bp fragment insertedin the CFTR mRNA, indicating that this insertion was dueto aberrant splicing caused by mutation 1811+1.6kbA-+Gand was not due to alternative splicing (because of ineffi-cient splice signals) (Will et al. 1993).

This study illustrates the relevance of mRNA analysis intesting whether changes detected at the DNA level couldhave phenotypic effects. RNA obtained from nasal polypsand illegitimate transcription allowed us to perform a rapidand easy analysis of the CFTR transcripts and, so, to detectthe extra exon 11b. Furthermore, these results show theusefulness of RNA analysis to check whether DNA muta-

tions affect normal splicing processes and transcriptionrates or whether they are solely polymorphisms. In fact,the 3601-11G/C polymorphism could be considered abranch-site mutation, since it creates a novel branch sitewith a very high consensus value (CV = 1.00) (table 1),which could compete with the normal branch site (with aCV of 0.97) (table 1) and displace it. The use of the novelbranch site (with putative polypyrimidine tract and ac-ceptor site, at required locations) would cause abnormalsplicing with a longer exon 19. However, in mRNA analy-sis, we observed no abnormalities between exons 17b and20. Moreover, all chromosomes with the 3601-111(C) se-quence also have mutation 1811+1.6kbA-+G.

Mutation 1811+1.6kbA--G may create a new donorsplice site, and be responsible for the aberrant splicing andthe production of the new exon 1lb. The splice signals ofthis new exon have CVs >0.7 (table 1) and therefore areconsidered potentially active (Krawczak et al. 1992). Asmutation 1811 +1.6kbA-+G causes a 49-bp insertion, theresult at the coding level is a frameshift, with terminationof the reading frame within the inserted sequence (fig. 1).It has been reported that levels ofmRNA bearing frameshiftor nonsense mutations are reduced (Akli et al. 1991; Ha-mosh et al. 1992; Zhang et al. 1994). mRNA analysisshowed that mutation 1811 +1.6kbA--G was present inboth CF patients studied. We could detect the two mRNAspecies in the G542X/1811 +1.6kbA-+G patient, since bothmutations lead to a reduction in levels of mRNA. In con-trast, mRNA from the 1811 + 1.6kbA-*G allele was poorlydetected in the AF508/1811+1.6kbA-+G patient, being 5-10-fold less abundant than that of the AF508 allele, whichwas preferentially amplified.

Transcripts derived from the 1811+1.6kbA-+G allele inthe AF508/1811+1.6kbA--G patient represent 13% of thetotal, the majority of which (85%) corresponds to theCFTR with exon 1lb and only 15% to the normal CFTRmRNA. The normal transcript (from the 1811+1.6kbA--G

627

628 Am. J. Hum. Genet. 56:623-629, 1995

allele) could be due to an incomplete use of the new splicesite or to the elimination of exon 11b, since it contains atermination codon and since it has recently been observedthat exons containing premature termination codons canbe eliminated from transcripts by exon skipping duringmRNA splicing. However, it is not possible to determinewhich mechanism is involved in the production of the nor-mal transcript from the 1811 +1.6kbA--G allele.The genotype-phenotype correlations, comparing the

clinical data of 20 CF patients bearing this mutation,showed that when mutation 1811 + 1.6kbA--G was associ-ated with a severe CF mutation on the other chromosome,the CF phenotype was severe and patients were pancreaticinsufficient. Therefore, genotype and phenotype are inagreement with 1811+ 1.6kb A-GG being a class I mutationthat must produce a defective CFTR protein (Tsui 1992;Welsh and Smith 1993). Although it is not usual that theinclusion of an exon carrying a premature termination co-don is the cause of the disease, this has also been foundfor other CF mutations (3849+10kbC-+T [Highsmith etal. 1994] and E92X [Will et al. 1994]). In the case ofthe 1811+1.6kb A-GG mutation, the proportion of normalmRNA is 1%-3%, while in the case of 3849+10kbC-+Tmutation, it is -5%-10%. Therefore, these two figurescould define the levels of normal CFI R mRNA associatedwith severe or mild CF phenotype, respectively.The activation of a cryptic splice site is an un-

common type of disease-causing mutation. Mutation1811 + 1.6kbA--G is the first example in the CFTR gene ofa mutation creating a donor splice site. Another mutationin CFTR (3849+10kbC-+T) has been reported that alsoactivates a cryptic exon because of the creation of an ac-ceptor site (Highsmith et al. 1994).

Mutation 1811+1.6kbA--G has a frequency of -2% inthe Spanish CF population, and its distribution is mainlyin Andalucia (southern Spain; Chillon et al. 1994b). Thissuggests that mutation 1811 +1.6kbA--G should also beanalyzed in populations from northern Africa. The identi-fication of a German chromosome bearing mutation1811+1.6kbA-+G, shows that this mutation should alsobe considered in those CF chromosomes for which analysisof their complete coding sequence has failed to reveal amutation.

AcknowledgmentsWe thank J. Ferrer, U. Stephan, and C. Vazquez for contribut-

ing clinical data; M. Lynch for his suggestions and comments; andM. Miranda for synthesis of primers. This work was supported bythe Fondo de Investigaciones Sanitarias de la Seguridad Social(grant 93/0202) and the Institut Catala de la Salut.

ReferencesAbeliovich D, Lavon IP, Lerer I, Cohen T, Springer C, Avital A,

Cutting GR (1992) Screening for five mutations detects 97%

of cystic fibrosis (CF) chromosomes and predicts a carrier fre-quency of 1:29 in the Jewish Ashkenazi population. Am J HumGenet 51:951-956

Akli S, Chelly J, Lacorte J, Poernau L, Kahn A (1991) Seven novelTay-Sachs mutations detected by chemical mismatch cleavageof PCR-amplified cDNA fragments. Genomics 11:124-134

Boat TF, Welsh MJ, Baudet AL (1989) Cystic Fibrosis. In: ScriverCR, Beaudet AL, Sly WS, Valle D (eds) The metabolic basis ofinherited disease, 6th ed. McGraw-Hill, New York, pp. 2649-2680

CFGAC (Cystic Fibrosis Genetic Analysis Consortium) (1993)Correlation between genotype and phenotype in patients withcystic fibrosis. N Engl J Med 329:1308-1313

Chill6n M, Casals T, Gimenez J, Nunes V, Estivill X (1994a)Analysis of the ClTR gene in the Spanish populations: SSCP-screening for 60 known mutations and identification of fournew mutations (Q30X, A120T, 1812-1 G-+A, and 3667del4).Hum Mut 3:223-230

Chillon M, Casals T, Gimenez J, Ramos D, Palacio A, MorralN, Estivill X (1994b) Analysis of the CFTR gene confirmsthe high genetic heterogeneity of the Spanish populationL 43mutations account for only 78% of CF chromosomes. HumGenet 93:447-451

Chillon M, Casals T, Nunes V, Gimenez J, Perez E, Estivill X(1993) Identification of a new missense mutation (P205S) inthe first transmembrane domain of the CFTR gene associatedwith a mild cystic fibrosis phenotype. Hum Mol Genet 2:1741-1742

Chomczynski P, Sacchi N (19878) Single step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloroformextraction. Anal Biochem 162:156-159

Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF,Razakatsara G, Demaille J (1993) Analysis of the 27 exonsand flanking regions of the cystic fibrosis gene: 40 differentmutations account for 91.2% of mutant alleles in southernFrance. Hum Mol Genet 2:1209-1213

Cuppens H, Marynen P, De Boeck C, Cassiman J (1993) Detec-tion of the mutations of 200 Belgian cystic fibrosis alleles byreverse dot-blot and sequencing of the complete coding regionand exon intron junctions of the CFT-R gene. Genomics18:693-697

Dork T. Neumann T, Wulbrand U, Wulf B. Kilin N, MaassG, Krawczak M, et al (1992) Intra- and extragenic markerhaplotypes of CFFR mutations in cystic fibrosis families. HumGenet 88:417-425

Estes P. Cooke N, Liebhaber S (1992) A native RNA secondarystructure controls alternative splice-site selection and generatestwo human growth hormone isoforms. J Biol Chem267:14902-14908

Ferec C, Audrezet M, Mercier B, Guillermit H, Moullier P, QuereI, Verlingue C (1992) Detection of over 98% of cystic fibrosismutations in a Celtic population. Nat Genet 1:188-191

Fonknechten N, Chelly J, Lepercq J, Kahn A, Kaplan JC, Kitzis A,Chomel JC (1992) CFTR illegitimate transcription in lymphoidcells: quantification and applications to the investigation ofpathological transcripts. Hum Genet 88:508-512

Hamosh A, Rosenstein B, Cutting G (1992) CFTR nonsense mu-tations G542X and W1282X associated with severe reductionof CFI7R mRNA in nasal epithelial cells. Hum Mol Genet1:542-544

Chill6n et al.: Cryptic CFTR Exon in Cystic Fibrosis 629

Highsmith WE, Burch LH, Boat TE, Spock A, Gorvoy J, QuittelL, Friedman KJ, et al (19940 A novel cystic fibrosis gene muta-tion is common in patients with normal sweat chloride concen-trations. N Engl J Med 331:974-980

Kerem BS, Rommens JM, Buchanan JA, Markiewicz D, Cox TK,Chakravarti A, Buchwald M, et al (1989) Identification of thecystic fibrosis gene: genetic analysis. Science 245:1073-1080

Krawczak M, Reiss J, Cooper D (1992) The mutational spectrumof single base-pair substitutions in mRNA splice junctions ofhuman genes: causes and consequences. Hum Genet 90:41-54

Morral N, Nunes V, Casals T, Chillon M, Gimenez J. BertranpetitJ, Estivill X (1993a) Microsatellite haplotypes for cystic fibrosis:mutation frameworks and evolutionary tracers. Hum MolGenet 2:1015-1022

Morral N, Nunes V, Casals T, Cobos N, Asensio 0, Dapena J,Estivill X (1993b) Uniparental inheritance of microsatellite al-leles of the cystic fibrosis gene (CFTlR): identification of a 50kilobase deletion. Hum Mol Genet 2:677-681

Schwachman H, Kulczycki L (1958) Long-term study of 105patients with cystic fibrosis. Am J Dis Child 96:6-15

Senepathy P, Shapiro M, Harris N (1990) Splice junctions, branchpoint sites, and exons: sequence statistics, identification, andapplications to genome project. Methods Enzymol 183:252-278

Tsui, L-C (1992) The spectrum of cystic fibrosis mutations.Trends Genet 8:392-398

Welsh M, Smith A (1993) Molecular mechanism of CFTR chlo-ride channel disfunction in cystic fibrosis. Cell 73:1251-1254

Wieringa B, Hofer E, Weissman C (1984) A minimal intron lengthbut no specific internal sequence is required for splicing thelarge rabbit P-globin intron. Cell 37:915-925

Will K, Dork T, Stuhrmann M, Meitinger T, Bertelle-Harms R,Tummler B, Schmidtke J (1994) A novel exon in the cysticfibrosis transmembrane conductance regulator gene activatedby the nonsense mutation E92X in airway epithelial cells frompatients with cystic fibrosis. J Clin Invest 93:1852-1859

Will K, Stuhrmann M, Dean M, Schmidtke J (1993) Alternativesplicing in the first nucleotide binding fold of CFTlR. Hum MolGenet 2:231-235

Zhang Z, Wakamatsu N, Mules E, Thomas G, Gravel R (1994)Impact of premature stop codons on mRNA levels in infantileSandhoff disease. Hum Mol Genet 3:139-145

Zielensky J, Fujiwara TM, Markiewicz D, Paradis AJ, AnacletoAl, Richards B, Schwartz RH, et al (1993) Identification ofthe M1101K mutation in the cystic fibrosis transmembraneconductance regulator (CFTR) gene and complete detection ofcystic fibrosis mutations in the Hutterite population. Am J HumGenet 52:609-615

Zielensky B, Rozmahel R, Bozon D, Kerem B, Grzelczak Z, Rior-dan J, Rommens J, et al (1991) Genomic DNA sequence ofthe cystic fibrosis transmembrane regulator (CFTR) gene. Ge-nomics 10:214-218