ii

The dissertation of Mankit Law was reviewed and approved* by the following:

Avery August

Professor of Immunology

Dissertation Advisor

Chair of Committee

Pamela A. Hankey

Associate Professor of Immunology

Robert F. Paulson

Associate Professor of Veterinary and Biomedical Sciences

Anthony Schmitt

Assistant Professor of Molecular Immunology and Infectious Diseases

Graham Thomas

Associate Professor of Biology and of Biochemistry and Molecular Biology

Margherita T. Cantorna

Professor of Molecular Immunology

Co-chair of Intercollege Graduate Degree Program in Immunology and Infectious

Diseases

*Signatures are on file in The Graduate School.

iii

ABSTRACT

Calcium ions (Ca2+

) are important secondary messengers in signaling pathways of mast

cell activation. Mast cells are central effector cells of allergic inflammation. Therefore,

impaired calcium signaling, which correlates with decreased activation, in mast cells results in

markedly attenuated allergic responses. Nonetheless, the molecular mechanisms of how calcium

homeostasis is regulated in mast cells remain poorly characterized. In particular, the identity of

the players involved in the gating of store-operated Ca2+

channels has eluded biochemical

definition.

A tool that could potentially elucidate the regulatory mechanisms of store-operated Ca2+

entry (SOCE) is the immunosuppressant compound 3,5-bis-trifluoromethyl pyrazole (BTP).

Recently, our laboratory identified the actin-reorganizing protein drebrin as a target of BTP and

demonstrated a novel role for this protein in the regulation of SOCE in T cells. These findings

implicate the involvement of actin-binding proteins in the regulation of Ca2+

mobilization in

mast cells and downstream allergic responses. Nevertheless, the effects of BTP on mast cells

have yet to be properly characterized, and the role of its target drebrin in the biology of these

immune cells has not been determined.

Here, we demonstrate that treatment with the BTP derivative N-(4-(3,5-

bis(trifluoromethyl)-1H-pyrazol-1-yl)phenyl)-4-methyl-1,2,3-thiadiazole-5-carboxamide (BTP2)

potently inhibits the release of mast cell-specific inflammatory mediators that initiate and

propagate allergic responses. In the context of in vitro and in vivo models, our studies have

determined that BTP2 suppresses the release of preformed mediators, such as histamine, and

cytokines through the attenuation of SOCE. Moreover, our analysis of the structure-activity

iv

relationship of BTP identified the trifluoromethyl group at the carbon 3 (C3) position of the core

BTP pyrazole ring as the chemical moiety principally responsible for its inhibitory activity on

mast cell activation and effector responses.

In corroboration, using a novel knockout murine model, we show that the BTP-targeted

protein drebrin is required for Ca2+

-dependent allergic responses. In vivo, sensitized drebrin-/-

mice release less histamine upon antigenic challenge. Importantly, in drebrin-/-

mice, the

development of mast cells from bone marrow precursors is intact, but the survival of bone

marrow-derived mast cells (BMMCs) is reduced in vitro. Levels of serum immunoglobulin E

(IgE) are normal in these mice, and drebrin-/-

BMMCs express normal levels of surface high-

affinity receptor for IgE (FcεRI). Moreover, drebrin deficiency does not alter phosphorylation

events downstream of the FcεRI. The activation of tyrosine kinases and the mitogen-activated

protein kinases Erk1/2, JNK, and p38 is unchanged. However, drebrin is involved in FcεRI-

induced Ca2+

mobilization. In mast cells from drebrin-/-

mice, FcεRI-induced degranulation, as

well as cytokine secretion, is diminished. Thus, drebrin is selectively required for the mast cell-

mediated allergic response, and it is is a novel player in Ca2+

mobilization and mast cell

activation.

We propose that, upon depletion of intracellular Ca2+

stores, drebrin aggregates into

macromolecular complexes that induce cytoskeletal rearrangement. In conjunction with other

modulators of the cytoskeleton in these complexes, drebrin facilitates the juxtaposition of the

endoplasmic reticulum (ER) and plasma membrane (PM) and the subsequent interaction of

SOCE-associated components and insertion of store-operated Ca2+

channels into lipid raft

domains of the PM. Through this role, drebrin plays an integral part of the calcium signaling

pathway in mast cells.

v

TABLE OF CONTENTS

LIST OF FIGURES……………………………………………………………………..... viii

LIST OF TABLES………………………………………………………………………... xi

ABBREVIATIONS……………………………………………………………………….. xii

ACKNOWLEDGEMENTS……………………………………………………………... xv

CHAPTER 1. Introduction……………………………………………………………… 1

Mast Cell Biology………………………………………………………………….. 3

Morphology and phenotype………………………………………………... 3

Development……………………………………………………………….. 4

Activation…………………………………………………………………... 5

FcεRI pathway……………………………………………………... 7

Mediators and effector function………………………………………….… 10

Preformed mediators………………………………………………. 11

Lipid mediators/Eicosanoids………………………………………. 12

Cytokines and chemokines………………………………………… 12

Role in health and disease…………………………………………………. 13

Ca2+

Signaling……………………………………………………………………… 19

Regulation of Ca2+

homeostasis…………………………………………… 19

Store-operated Ca2+

entry…………………………………………………. 24

Activation of store-operated Ca2+

channels……………………………….. 28

Ca2+

signaling and the actin cytoskeleton…………………………………. 31

Drebrin……………………………………………………………………………... 33

Structure……………………………………………………………………. 33

Function……………………………………………………………………. 35

3,5-bis-trifluoromethyl pyrazole (BTP)……………………………………………. 37

Objective of thesis…………………………………………………………………..40

Hypothesis…………………………………………………………………. 40

CHAPTER 2. Materials and Methods………………………………………………….. 41

Mice………………………………………………………………………………... 42

Cell culture and reagents…………………………………………………… ……... 42

Genotyping of mice………………………………………………………………... 43

Quantitative real-time PCR analysis……………………………………………….. 44

Western blotting……………………………………………………………………. 45

Histological staining……………………………………………………………….. 46

Transmission electron microscopy………………………………………………… 47

vi

Flow cytometry…………………………………………………………………….. 47

Apoptosis assay……………………………………………………………..……… 48

Degranulation assay………………………………………………………………... 48

In vivo histamine release assay…………………………………………………….. 50

Serum IgE ELISA…………………………………………………………….……. 51

Cytokine secretion assay…………………………………………………………… 51

Measurements of intracellular Ca2+

concentration………………………………… 52

Analysis of NFAT localization…………………………………………………….. 54

Statistical analysis………………………………………………………………….. 54

CHAPTER 3. Effect of BTP2 on mast cell biology……………………………………. 55

Rationale…………………………………………………………………………… 56

Effects of BTP2 on Ca2+

mobilization in RBL-2H3 cells and BMMCs…… ……... 57

Effects of BTP2 on FcεRI-mediated signaling in BMMCs………………………... 59

BTP2 inhibits degranulation in RBL-2H3 cells……………………………………. 61

BTP2 inhibits histamine release in mice in response to antigenic challenge……… 64

BTP2 inhibits cytokine secretion from mast cells…………………………………. 66

BTP2 inhibits NFAT nuclear localization in mast cells…………………………… 70

BTP2 inhibits de novo synthesis of cytokines in mast cells……………………….. 70

Discussion………………………………………………………………………….. 73

CHAPTER 4. Structure-Activity Relationship of BTP2……………………………..... 76

Rationale…………………………………………………………………………… 77

The trifluoromethyl group at the C3 position is required for the inhibitory

effect of BTP2 on the degranulation of BMMCs……………………………… 78

Effects of 3T5M-P on Ca2+

mobilization in BMMCs…………………….……....... 79

Discussion………………………………………………………………………….. 83

CHAPTER 5. Role of drebrin in mast cell biology…………………………………….. 85

Rationale…………………………………………………………………………… 86

Generation of Drebrin-/-

mice………………………………………………………. 87

Cellular morphology but not distribution of drebrin-/-

mast cells in skin tissue

is normal………………………………………………………………………...94

Drebrin is not required for development but is necessary for survival of

drebrin-/-

BMMCs in vitro……………………………………………………… 96

Drebrin is required for degranulation of BMMCs…………………………………. 101

Drebrin is required for histamine release in mice in response to antigenic

challenge……………………………………………………………………….. 102

Drebrin is required for cytokine secretion of BMMCs…………………………….. 105

Drebrin-/-

BMMCs exhibit normal levels of FcεRI surface expression……………. 108

Phosphorylation events downstream of FcεRI are normal in drebrin-/-

BMMCs….. 110

Drebrin is required for Ca2+

mobilization in mast cells……………………………. 114

vii

Discussion………………………………………………………………………….. 118

Drebrin regulates the mast cell-mediated allergic response………………. 118

Drebrin is required for FcεRI-mediated Ca2+

mobilization……………….. 122

CHAPTER 6. Conclusion and Future Direction……………………………………...... 124

BIBLIOGRAPHY………………………………………………………………………… 132

viii

LIST OF FIGURES

Figure 1.1. Principal signaling cascade of mast cell activation………………………… 9

Figure 1.2. Early phase of allergic inflammation………………………………………. 15

Figure 1.3. Late phase of allergic inflammation……………………………………….. 16

Figure 1.4. Activation of store-operated Ca2+

entry……………………………………. 21

Figure 1.5. Principal pathways of Ca2+

movement…………………………………….. 22

Figure 1.6. Domain structures of STIM1 and Orai1…………………………………… 25

Figure 1.7. Models of CRAC channel activation………………………………………. 30

Figure 1.8. Domain structure of drebrin………………………………………………... 34

Figure 1.9. Chemical structure of BTP2………………………………………………...39

Figure 3.1. BTP2 blocks intracellular Ca2+

mobilization in RBL-2H3

cells and BMMCs……………………………………………………… 58

Figure 3.2. BTP2 does not affect tyrosine kinase nor MAP kinase activation

following FcεRI triggering…………………………………………….. 60

Figure 3.3. BTP2 inhibits mast cell degranulation in vitro…………………………….. 62

Figure 3.4. BTP2 inhibits mast cell degranulation and release of

β-hexosaminidase in vitro……………………………………………… 63

Figure 3.5. BTP2 inhibits FcεRI-mediated histamine release in vivo………………...... 65

Figure 3.6. BTP2 inhibits cytokine secretion of PMA/ionomycin-activated

BMMCs……………………………………………………………....... 67

Figure 3.7. BTP2 inhibits cytokine secretion of IgE/anti-IgE-activated mast cells……. 68

Figure 3.8. BTP2 inhibits cytokine secretion of IgE/antigen-activated mast cells.......... 69

Figure 3.9. BTP2 inhibits stimulus-induced NFAT nuclear translocation……………... 71

Figure 3.10. BTP2 does not affect preformed cytokine mRNA expression……………...72

ix

Figure 4.1. Chemical structures of BTP analogs……………………………………….. 80

Figure 4.2. The 3-trifluoromethyl group is critical for the inhibitory activity

of BTP2 on BMMC degranulation…………………………………….. 81

Figure 4.3. 3T5M-P blocks intracellular Ca2+

mobilization in BMMCs……………….. 82

Figure 5.1. Strategy for simultaneous inactivation and rapid identification of

the disrupted Dbn1 gene by gene-trapping in mouse ES cells………..... 88

Figure 5.2. Mapping of genomic insertion site of the gene-trap vector in intron

8 of the Dbn1 gene……………………………………………………... 91

Figure 5.3. Verification of genetic disruption of the Dbn1 gene by gene-trap

insertion with RT-PCR………………………………………………… 92

Figure 5.4. Verification of ablation of protein expression of the disrupted Dbn1

gene by western blot…………………………………………………… 93

Figure 5.5. Mast cells retain normal cellular morphology but not distribution in

the skin of drebrin-/-

mice………………………………………………. 95

Figure 5.6. Drebrin-/-

BMMCs and basophils show normal development in

vitro…………………………………………………………………….. 98


BMMCs show less viability in vitro….......................................... 100


mice exhibit impairment in mast cell degranulation in vitro……. 103


mice exhibit impairment in FcεRI-mediated histamine

release in vivo…………………………………………………………... 104


BMMCs exhibit impairment in PMA/ionomycin-induced

cytokine secretion…………………………………………………….... 106


BMMCs exhibit impairment in FcεRI-mediated cytokine

secretion………………………………………………………………... 107

Figure 5.12. Cell surface expression of FcεRI on drebrin-/-

BMMCs is normal………… 109

Figure 5.13. Tyrosine kinase activation following FcεRI triggering is not affected

in drebrin-/-

BMMCs………………………………………………….... 111

x

Figure 5.14. MAP kinase activation following FcεRI triggering is not affected in

drebrin-/-

BMMCs…………………………………………………….... 113

Figure 5.15. Ca2+

mobilization is impaired in drebrin-/-

BMMCs……………………….. 116

Figure 5.16. Activation of PLCγ1 is not affected in drebrin-/-

BMMCs………………… 117

Figure 5.17. BTP2 inhibits ionomycin-induced degranulation of Drebrin-/-

BMMCs…... 121

Figure 6.1. Model for the involvement of drebrin in store-operated Ca2+

entry……….. 130

xi

LIST OF TABLES

Table 1.1. Mast cell mediators………………………………………………………… 10

xii

ABBREVIATIONS

2-APB- Aminoethoxydiphenyl borate

3T-P- 3-trifluoromethyl pyrazole

3T5M-P- 3-trifluoromethyl-5-methyl pyrazole

3M5M-P- 3,5-bis-methyl pyrazole

5T-P- 5-trifluoromethyl pyrazole

5T3M-P- 5-trifluoromethyl-3-methyl pyrazole

ADF-H- Actin-depolymerizing factor-homology

AP-1- Activator Protein-1

ATP- Adenosine triphosphate

BMMC- Bone marrow-derived mast cell

BTP- 3,5-bis-trifluoromethyl pyrazole

BTP2- N-(4-(3,5-bis(trifluoromethyl)-1H-pyrazol-1-yl)phenyl)-4-methyl-1,2,3-thiadiazole-5-

carboxamide

C3- Carbon at 3’ position

C3a- Complement component 3a

Ca2+

- Calcium ion

CaV channel- Voltage-gated Ca2+

channel

CCR- C-C chemokine receptor

CHO cells- Chinese hamster ovary cells

CXCR- C-X-C chemokine receptor

COX- Cyclooxygenase

CRAC channel- Ca2+

release-activated Ca2+

channel

CsA- Cyclosporin A

CTMC- Connective tissue mast cell

CysLT- Cysteinyl leukotrienes

DAG- Diacylglycerol

Dbn1- Mus musculus drebrin 1

DMSO- Dimethyl sulfoxide

DNP-HSA- Dinitrophenyl-human serum albumin

Drebrin-/-

- Drebrin knockout

Drebrin A- Drebrin adult form

Drebrin E- Drebrin embryonal form

EAE- Experimental autoimmune encephalitis

EB1- Microtubule end-binding protein 1

ER- Endoplasmic reticulum

Erk1/2- Extracellular-regulated kinase 1/2

ES cells- Embryonic stem cells

F-actin- Filamentous actin

FcεRI- High-affinity receptor for IgE

G-actin- Globular actin

GADS- Grb2-related adaptor protein

GAPDH- Glyceraldehyde 3-phosphate dehydrogenase

xiii

GDP- Guanosine diphosphate

GEF- guanine nucleotide-exchange factor

GM-CSF- Granulocyte-macrophage colony stimulating factor

Grb2- Growth factor receptor-bound protein 2

GTP- Guanosine triphosphate

HIP-55- HPK1-interacting Protein of 55 kDa

HPK1- Hematopoietic progenitor kinase 1

HRP- Horseradish peroxidase

IC50- Half maximal inhibitory concentration

ICRAC- Ca2+


current

IgE- Immunoglobulin E

IL- Interleukin

IL-3R- Interleukin-3 receptor

IFN-γ- Interferon-γ

i.p.- Intraperitoneally

IP3- Inositol-1,4,5-triphosphate

IP3R- IP3 receptor

ITAM- Immunoreceptor tyrosine-based activation motif

i.v.- Intravenously

JNK- JUN amino-terminal kinase

LAT- Linker for Activated T cells

LT- Leukotriene

LTR- Long terminal repeat

mAbp1- Mammalian actin-binding protein 1

MAPK- Mitogen-activated protein kinase

MCT- Tryptase+ mast cell

MCTC- Tryptase+ Chymase

+ mast cell

MFI- Mean fluorescence intensity

MMC- Mucosal mast cell

NCX- Na2+

-Ca2+

exchanger

NF-κB- Nuclear factor-κB

NFAT- Nuclear factor of activated T cells

NFATc1- Nuclear factor of activated T cells, cytoplasmic 1

OST- Omnibank sequence tag

OVA- Ovalbumin

PAF- Platelet-activating factor

PAMP- Pathogen-associated molecular pattern

pFv- Protein Fv

PG- Prostaglandin

PIP2- Phosphoinositol-4,5-bisphosphate

PKC- Protein kinase C

PLA2- Phospholipase A2

PLCγ1- Phospholipase γ1

PM- Plasma membrane

PMA- Phorbol myristic acid

xiv

PMCA pump- Plasma membrane Ca2+

-ATPase pump

PSD-95- Post-synaptic density-95

Pyr- Pyrazole

RBL-2H3 cells- Rat basophil leukemia-2H3 cells

RF- Relative fluorescence

RyR- Ryanodine receptor channel

SCF- Stem cell factor

SCID- Severe combined immunodeficiency

SERCA pump- Sarcoplasmic/endoplasmic reticulum Ca2+

-ATPase pump

SH2- Src-homology 2

SHC- SH2 domain-containing transforming protein C

siRNA- Small interfering RNA

SLP-76- SH2-domain-containing leukocyte protein of 76 kDa

SNARE- Soluble N-ethylmaleimide-sensitive factor attachment proteins receptor

SOCE- Store-operated Ca2+

entry

SOS- Son of Sevenless homologue

STIM1- Stromal interactional molecule 1

Syk- Spleen tyrosine kinase

TCR- T cell receptor

TGF-β- Transforming growth factor-β

Th1/2- T helper 1/2

TLR- Toll-like receptor

TNF- Tumor necrosis factor

TRP- Transient receptor potential

TRPC- Transient receptor potential cation

TRPM4- TRP channel, melastatin subfamily 4

WASP- Wiskott-Aldrich syndrome protein

WAVE-2- WASP family member 2

WT- Wild-type

xv

ACKNOWLEDGEMENTS

First of all, I wish to extend my appreciation to my advisor Avery August for his support

and guidance throughout my years of graduate education. He has provided me with an

outstanding work environment to develop my potential as a scientist. He has been an invaluable

source of knowledge and expertise. Most importantly, he has been a living example of education

through his commitment to mentorship of the next generation of scientists and his solid work

ethic. I will always value him as a role model and friend.

I would also like to thank Andrew Henderson, the Immunology and Infectious Diseases

program chair Margherita Cantorna, and my committee members Robert Paulson, Pamela

Hankey, Anthony Schmitt, and Graham Thomas for their intellectual input into the development

of my thesis project and words of counsel.

I thank Blake Peterson and Laurie Mottram for their collaborative efforts in providing me

with the library of BTP analogs that are utilized in this study. I also thank Gang Ning for his

technical help with histology and electron microscopy. A special thanks is offered to Elaine

Kunze, Susan Magargee, Nicole Bem, Walter Iddings, and Rodman Getchell for their technical

support and assistance during the transition to Cornell.

I would like to acknowledge my colleagues at Penn State and Cornell for providing a

collegial and stimulating workplace. In particular, I would like to thank past and present

members of the August laboratory for their scientific discussion and friendship.

Lastly, I would like to thank my family for their constant encouragement. I thank my

wife Julia for her understanding, patience, and smiles. And, to my parents, I dedicate this thesis

for instilling a love of learning in their children and giving us the courage to pursue our dreams.

1

CHAPTER 1

Introduction

2

In 1878, Paul Ehrlich, a Nobel laureate whose studies pioneered the modern-day medical

sciences of hematology and immunology, publicized his descriptions of the tissue mast cell (1).

For the majority of the time thereafter, mast cells have been exclusively associated with the

mediation of pathological secondary responses to allergens in sensitized hosts. In addition to this

classical role, recent evidence implicates their participation in the regulation of host responses to

pathogens, autoimmune diseases, fibrosis, and wound healing (2, 3). These roles for mast cells

in allergy, infection, autoimmunity, and homeostasis implicate additional pharmaceutical targets

for the prevention of the development of allergic disease, as well as allergic exacerbations of

established disease.

Mast cells utilize diverse signaling mechanisms to transmit information between different

compartments of the cell. These mechanisms integrate the action of a myriad of proteins that

perform enzymatic and structural functions in the signal transduction process. Associated

signaling cascades culminate in the production of cellular changes, which range from

cytoskeletal reorganization to transcriptional activation. Frequently, one messenger is involved

in the activation of a variety of functional outcomes. A rise in intracellular Ca2+

levels triggers

the activation of a disparate array of mast cell responses. Nonetheless, though Ca2+

signaling is

an ancient and conserved mechanism in multicellular organisms, the processes that regulate Ca2+

remain poorly understood.

In this thesis, I present work which incorporates a unique group of immunosuppressant

compounds in the identification of drebrin as an integral component of the cellular processes that

regulate Ca2+

mobilization in mast cells. As a result, I provide insight for the development and

design of new research tools that could facilitate the elucidation of regulatory mechanisms of

3

Ca2+

signaling, and I provide support for the advancement of potential therapeutic strategies for

mast-cell mediated disease.

Mast cell biology

Mast cell: Morphology and phenotype

Based upon his observations from the histological application of basic aniline dyes to

human tissues, Ehrlich first described mast cells as aniline-positive cells with large granules in

connective tissues. With the belief that the granules were involved in the nourishment of

surrounding tissue, he named them “Mastzellen”, wherein the German word “mast” denotes a

“fattening” or “suckling” function. He ascribed mast cells to the nutritional requirements of

tissues in states of chronic inflammation and tumors. In addition, he recognized that mast cells

were located in association with blood vessels in connective tissues but were not part of the

perivascular system. As a whole, his conclusions were partially, but not totally, correct (1).

The current thinking of the scientific community recognizes mast cells as tissue-based

inflammatory cells. Generally, they are localized in association with blood vessels and at

epithelial surfaces. With the capacity to be up to 20 µm in diameter, mast cells are characterized

as ovoid or irregularly elongated cells with an ovoid nucleus. They are rich in cytoplasmic

granules, which can be identified with metachromatic staining due to ample sulfated

proteoglycan content in the granules. With electron microscopy, granules are identified based

upon their crystalline content (2).

Depending upon the protease content of their granules, human mast cells can be classified

into the following 2 major subtypes: 1) tryptase-positive (MCT) or 2) tryptase- and mast cell-

4

specific chymase-positive (MCTC). Each subtype predominates in a distinct set of locations.

MCT are located within the mucosa of the respiratory and gastrointestinal tracts. MCTC are

localized within connective tissues. MCTC are the outstanding mast cell subtype in the dermis,

submucosa of the gastrointestinal tract, heart, conjunctivae, and perivascular tissues (2). In

rodents, 2 similar subtypes of mast cells exist. Mucosal mast cells (MMC) are located in

mucosal tissue; serosal mast cells (CTMC) reside in connective tissue (2, 4).

Canonically, mast cells are identified by surface expression of the receptors c-kit/CD117

and FcεRI. Based upon their stage of differentiation, location, and activation, they can also

express other receptors on their cell surface. For example, in the resting state, mast cells express

the activating IgG receptor FcγRIIa/CD32a. The β2-adrenergic receptor, the adenosine receptor

A2B, and the prostaglandin (PG) E2 receptor EP2 compromise a group of inhibitory G protein-

coupled receptors that can be expressed on mast cells. Mast cells can express the following

cytokine and chemokine receptors: interleukin (IL)-3 receptor (IL-3R), IL-4R, IL-5R, IL-9R,

IL10-R, granulocyte-macrophage colony stimulating factor receptor (GM-CSFR), interferon-γ

receptor (IFN-γR), C-C chemokine receptor 3 (CCR3), CCR5, C-X-C chemokine receptor 2

(CXCR2), and CXCR4. In addition, amongst others, mast cells can express complement

receptors, nerve growth factor receptors, and Toll-like receptors (TLRs) (2, 4).

Mast cell: Development

Mast cells originate from pluripotent hematopoietic stem cells in the bone marrow.

CD34+ mast cell precursors circulate in the blood until they migrate into tissues where they

mature into long-living effector cells. According to common paradigm, maturation of precursors

in the tissues is dependent upon binding of their cell surface-bound c-kit receptors to stem cell

5

factor (SCF). Interaction with fibroblasts, stromal cells, and endothelial cells, which express

SCF on their surface, drives mast cell maturation. Thus, SCF and c-kit signaling are considered

to be central for both human and murine mast cell development (2). Importantly, murine mast

cell hyperplasia requires IL-3 (5). In addition to SCF and IL-3, the cytokines IL-4, IL-9, IL-10,

and IL-13 are regarded as mast cell growth factors. In the presence of SCF or IL-3, they act

synergistically to drive mast cell proliferation and differentiation. These cytokines alone,

however, cannot support the differentiation or survival of mast cells (5).

Hu et al. have determined that, as triggers or regulators, inflammatory mediators and

cytokines function as crucial determinants of mast cell development. As a result, they advance

the idea that mast cell development cannot be defined only in terms of mast cell growth factors

(5). Consistent with this, recent evidence indicates that IL-3 stimulation of bone marrow cells

induces the production of tumor necrosis factor (TNF), an important mast cell survival factor

both in vitro and in vivo (6). Moreover, cytokines, such as IL-4, IL-5, and IFN-γ, influence mast

cell phenotype and behavior. IL-4 upregulates the expression of FcεRI. In the presence of SCF,

IL-5 enhances proliferation, whereas exposure to IFN-γ correlates with a decrease in mast cell

number. Therefore, differential expression of homing receptors, tissue-specific expression of

SCF, and the cytokine milieu together likely define the heterogeneity of differentiation and

distribution of mast cells in specific tissues (2).

Mast cell: Activation

The best characterized pathway of mast cell activation is that ensuing IgE-mediated

crosslinking of the membrane-bound FcεRI. Crosslinking can be mediated by polyvalent antigen

specifically recognized by membrane-bound IgE molecules. Alternatively, unspecific

6

crosslinking can be mediated through interaction with superantigens (4). For example, the

endogenous superallergen protein Fv (pFv), which is a human sialoprotein that is found in

normal liver and largely released in the intestinal tract in patients with viral hepatitis, induces

histamine from human lung mast cells (7). Interestingly, in the presence of increased free IgE

levels or IL-4, the surface expression of FcεRI on mast cells is upregulated, thereby enhancing

the activation of these cells (2). Independent of crosslinking of FcεRIs, mast cell activation

induced by IgE binding alone is a matter of debate (4, 8). Nonetheless, Kalesnikoff et al. have

demonstrated that engagement of a single FcεRI with monomeric IgE stimulates signaling

pathways that induce cytokine production and regulate survival (9). Along with the FcεRI, mast

cells express activating immunoglobulin G (IgG) receptors. In mice, Fcγ receptor-mediated

activation is driven by engagement with primarily IgG1 antibodies. On the other hand, studies

have shown that the IgG receptor FcγRIIB negatively regulates IgE-mediated mast cell

activation. In support of this, FcγRIIB-deficient mice are characterized by increased

anaphylactic reactions and higher susceptibility to allergic rhinitis (4).

In addition to immunoglobulins, mast cells can be activated by exogenous and

endogenous stimuli, such as pFv (7). Mast cells are activated by neurotrophin through the high-

affinity nerve growth factor receptor TRKA and by complement component 3a (C3a) and C5a

through C3a receptor (C3aR) and C5aR. They express TLR-1, -2, -3, -4, -6, -7, and -9 and

consequently are activated by corresponding ligands (2, 4). Based upon the ligand, associated

intensity of signal, and the cytokine milieu, the profile, as well as amount, of mediators released

by mast cells can change drastically. This is exemplified by increased mediator release

associated with the presence of increasing amounts of SCF (2).

7

FcεRI pathway

FcεRI-mediated signaling is integral to the activation of mast cells and downstream

effector functions. The canonical signal transduction pathway originates with the binding of

multivalent antigen to IgE-occupied FcεRIs. Upon engagement of the FcεRI α chain (FcεRIα)

subunit with antigen, Lyn kinase is recruited into closer proximity of the FcεRI. As a result,

phosphorylation of the tyrosine residues of the immunoreceptor tyrosine-based activation motifs

(ITAMs) in the FcεRI β- and γ-chains occurs. These ITAMs are responsible for tethering of

Spleen tyrosine kinase (Syk) to the FcεRI. The Src-homology 2 (SH2) domains of Syk are

involved in this interaction with ITAMs. Subsequently, in addition to phosphorylation by Lyn,

trans- and auto-phosphorylation of the catalytic domain of Syk enhances the catalytic activity of

the kinase. Thereafter, Lyn and Syk phosphorylate the transmembrane adaptor molecule Linker

for Activated T cells (LAT), allowing for the association of a protein complex that includes the

cytosolic adaptor molecules SH2-domain-containing Leukocyte Protein of 76 kDa (SLP-76),

SH2 domain-containing transforming protein C (SHC), Growth factor receptor-bound protein 2

(Grb2), and Grb2-related Adaptor protein (GADS), the guanine nucleotide-exchange factors

(GEFs) Vav and Son of Sevenless homologue (SOS), and the signaling enzyme phospholipase

Cγ1 (PLCγ1). Hydrolysis of phosphoinositol-4,5-bisphosphate (PIP2) by PLCγ1 generates the

secondary messengers inositol-1,4,5-triphosphate (IP3) and diacylglycerol (DAG) that induce the

mobilization of Ca2+

and the activation of Protein Kinase C (PKC), respectively. Together, these

events stimulate degranulation. Concurrently, the activation of the mitogen-activated protein

kinase (MAPK) pathway is stimulated through the GEF-mediated exchange of guanosine

diphosphate (GDP) for guanosine triphosphate (GTP) with the small GTPase Ras. Activated Ras

can then transmit signals to Raf and other downstream elements of the MAPK pathway.

8

Activation of the mitogen-activated protein kinases (MAPKs) extracellular-regulated kinase 1

(Erk1) and Erk2, JUN amino-terminal kinase (JNK), and p38 induce the activation of

phospholipase A2 (PLA2) and transcription factors that are linked to eicosanoid generation and

the production of cytokines, respectively. In addition, increases in intracellular Ca2+

levels can

activate transcription factors, thereby leading to increased cytokine secretion (Fig. 1.1) (10-13).

9

Principal Signaling Cascade of Mast Cell Activation

Figure 1.1. Binding of multivalent antigen to IgE-occupied FcεRIs leads to the activation of a

myriad of proteins. The phosphorylation of LAT allows for the formation of a multi-protein

complex, encompassing cytosolic adaptors, guanine nucleotide exchange factors, and the

signaling enzyme PLCγ1. The hydrolysis of PIP2 by activated PLCγ1 generates secondary

messengers that induce Ca2+

mobilization and the activation of PKC. Thereafter, the effector

response of degranulation follows. In parallel, the GEF-mediated exchange of GDP for GTP

with Ras promotes the activation of Raf and downstream MAPK elements, which are involved in

eicosanoid generation and cytokine production. Reprinted by permission from Macmillan

Publishers Ltd: Nat. Rev. Immunol., Vol. 6, Issue 3, pp. 218-30, copyright 2006.

10

Mast cell: Mediators and effector function

Depending upon the type and strength of stimulation, mast cells release different patterns

of inflammatory mediators. Some of these mediators are stored in cytoplasmic granules. Others

are produced de novo following activation. Overall, mast cell mediators can be categorized into

the following classes: 1) preformed substances, 2) newly synthesized lipid mediators, and 3)

cytokines and chemokines (Table 1.1). Importantly, some cytokines cannot be exclusively

categorized, for they are stored in granules as preformed molecules. For example, TNF-α occurs

both preformed and in a newly synthesized form (2, 4).

Category Specific Molecules

Preformed mediators Histamine

Neutral proteases (tryptase, chymase,

cathepsin G, carboxypeptidase A)

Proteoglycans (heparin and chondroitin

sulfates)

Cytokines (IL-4, TNF-α)

Lipid mediators/Eicosanoids Leukotrienes (LTA4, LTB4, LTC4,

LTD4, and LTE4)

Prostaglandins (PGD2, 9α,11β-PGF2)

Platelet-activating factor

Cytokines/Chemokines Cytokines (IL-3, IL-4, IL-5, IL-6, IL-8,

IL-10, IL-13, GM-CSF, TNF-α)

Chemokines (IL-8/CXCL8, CCL2,

CCL3, CCL5)

Table 1.1. Mast cell mediators. The 3 main categories of mediators (left) are divided into

subclasses of mediators (right). Representative examples of each subclass are presented in

parentheses.

11

Preformed mediators

Proteoglycans, neutral proteases, and amines are stored as preformed mediators in

cytoplasmic granules. Proteoglycans include heparin and chondroitin sulfates. In great quantity

in granules, proteoglycans complex with histamine, proteases, and other granule contents due to

their negative charge. The physiological role of heparin is not well understood. In medicine, it

is generally utilized as an anti-coagulant; however, because anti-coagulation of blood is

principally mediated by endothelial cell-derived heparan sulfate proteoglycans, the exact role of

heparin stored within the granules of mast cells remains poorly defined (14). Recently, a role for

heparin in immune defense against bacterial pathogens and other foreign particles has been

proposed (15). Upon release into the extracellular environment, proteoglycans dissociate from

histamine in the cytoplasmic granules, exchanging sodium ions in its place. Histamine

modulates smooth muscle contraction and mucus secretion. It also has effects on endothelial

cells and nerve endings (2). Depending upon the pattern of histamine receptor expression in T

cells, histamine can stimulate the production of T helper 1 (Th1) cytokines, such as IFN-γ, or

Th2-specific cytokines, such as IL-4 and IL-13. Thus, through its influence on cytokine

production, histamine can have pro-inflammatory, as well as anti-inflammatory, effects.

Interestingly, recent evidence has suggested that mast cell-derived histamine mediates its pro-

inflammatory effects via suppression of CD4+ CD25

+ regulatory T cells (4). Neutral proteases,

which compose the majority of preformed content in granules, include tryptase, chymase,

cathepsin G, and carboxypeptidase. Unlike MCTC, MCT contain granules that are composed of

tryptase alone. In vivo, the function of tryptase has yet to be discovered. Reports have indicated

that, in vitro, it plays a role in the digestion of fibrinogen, fibronectin, prourokinase, pro-matrix

metalloproteinase 3, protease-activated receptor 2, and complement component C3.

12

Additionally, it has the capacity to activate fibroblasts, promote the accumulation of

inflammatory cells, and potentiate histamine-induced airway bronchoconstriction (2).

Lipid mediators/Eicosanoids

Rapidly synthesized proceeding mast cell activation, eicosanoid mediators are generated

from endogenous membrane stores of arachidonic acid, which is released by PLA2. PLA2 is

activated downstream of the MAPK family of serine/threonine kinases (10). Arachidonic acid

can be converted into prostaglandin 2 (PGD2) through the action of cyclooxygenase (COX) and

PGD endoperoxide synthase-1 and -2. PGD2 functions as a bronchoconstrictor and

chemoattractant for eosinophils and basophils. Its metabolite 9α,11β-PGF2 plays a role in the

constriction of coronary arteries. Alternatively, arachidonic acid can be converted into

leukotriene A4 (LTA4) via the 5-lipoxygenase pathway in partnership with 5-lipoxygenase

activating protein. LTA4 can be further metabolized to LTB4 or conjugated with glutathione to

form LTC4. LTC4 is the parent compound of the cysteinyl leukotrienes (CysLTs). The CysLT

subfamily includes LTD4 and LTE4. LTB4 regulates the chemotaxis of neutrophils and effector

T cells. CysLT1 and CysLT2 act as potent bronchoconstrictors. They also increase vascular

permeability, trigger mucus production, and attract eosinophils. All of these effects are mediated

through the binding of LTs to G protein-coupled receptors (2). Collectively, prostaglandins and

LTs are central for the regulation and attraction of immunocompetent cells (Figs. 1.2 and 1.3).

Cytokines and chemokines

As a key effector cell of inflammation, mast cells secrete a spectrum of cytokines and

chemokines. One of the major cytokines stored and secreted by mast cells is TNF-α. Besides its

13

anti-tumor activity, TNF-α enhances bronchial responsiveness and leads to the upregulation of

adhesion molecules on endothelial and epithelial cells (2). In murine models, TNF-α has also

been implicated in the upregulation of mucus gene expression (4). Amongst a multitude of other

cytokines, mast cells secrete IL-3, IL-5, and GM-CSF that contribute to eosinophil development

and survival. They also secrete IL-6, IL-10, and IL-13. CCL3 and CXCL8 are some of the

chemokines produced by mast cells (Figs. 1.2 and 1.3) (2).

Mast cell: Role in health and disease

Mast cells are integral members of the immune system. Mast cells are central effector

cells in allergic inflammation. Central to the pathogenesis of allergic diseases, including

anaphylaxis, allergic rhinitis, and allergic asthma, is mast cell activation through the FcεRI.

Aggregation of FcεRIs by polyvalent antigen recognized by bound IgE activates mast cells,

subsequently initiating an immediate hypersensitivity reaction, as well as a late-phase reaction.

Occurring within minutes, the immediate reaction is determined by the degranulation of

preformed mediators, including histamine, serine proteases (tryptase and chymase),

carboxypeptidase A, and proteoglycans, and the release of rapidly synthesized lipid mediators.

In the extracellular environment, these mediators contribute to a variety of allergic symptoms.

According to the site of the reaction, these symptoms broadly range from erythema and edema to

bronchospasm and mucus production in the lower airways (2, 4, 10, 16, 17). Clinical hallmarks

encompass vasodilation, markedly increased vascular permeability, contraction of bronchial

smooth muscle, and increased mucus secretion. Vasodilation results from the action of

mediators on local nerves, producing erythema of the skin or conjunctiva. Tissue swelling and

tear production in the eyes are consequences of increased vascular permeability. The contraction

14

of bronchial smooth muscle can cause the obstruction of airflow and wheezing. Airflow

obstruction in the lower respiratory tract can be further worsened by increased mucus secretion.

Mediators can also stimulate nociceptors of sensory nerves of the nose, skin, and airways. As a

result, sneezing, itching, and coughing occur respectively (Fig. 1.2) (18). Late-phase reactions

are mediated by cytokines and chemokines and occur 6 to 24 hours after the immediate reaction.

During this step, mast cells also release growth factors. TNF-α, CCL2, CXCL8, and other

chemokines are involved in the recruitment of other immune cells. TNF-α and IL-5 activate

innate immune cells, and TNF-α, IL-10, and transforming growth factor-β (TGF-β) affect many

aspects of the biology of dendritic cells, T cells, and B cells. Nonetheless, other mast cell-

derived products can have anti-inflammatory or immunosuppressive effects. These include IL-

10 and TGF-β. Mast cell-derived products can also alter structural cells, including vascular

endothelial cells, fibroblasts, smooth muscle cells, and nerve cells (18). Characterized by edema

and leukocytic influx, late-phase reactions contribute to persistent asthma (Fig. 1.3) (2).

15

Early Phase of Allergic Inflammation

Figure 1.2. In this model of the early phase of allergen-induced airway inflammation, FcεRI

aggregation mediated by antibody-antigen complexes activates mast cells, thereby inducing the

immediate release of granule-associated preformed mediators and lipid-derived mediators and

the de novo synthesis of cytokines, chemokines, and growth factors. The rapid secretion of

preformed mediators and eicosanoids promotes bronchoconstriction, vasodilation, increased

vascular permeability, and increased mucus production. Mast cells also contribute to the

transition to the late phase reaction (Fig. 1.3) via recruitment of inflammatory leukocytes.

Reprinted by permission from Macmillan Publishers Ltd: Nature, Vol. 454, Issue 7203, pp. 445-

54, copyright 2008.

16

Late Phase of Allergic Inflammation

Figure 1.3. In this model of the late phase of allergen-induced airway inflammation, activated

mast cells mediate many of the features of early phase reactions (Fig. 1.2). Occurring hours after

allergen exposure, this step of allergic reactions is regulated by the influx of immune cells from

the circulation and the secretion of inflammatory mediators by tissue-resident cells. In

particular, mast cell-derived products upregulate adhesion molecules on vascular endothelial

cells and secrete chemotactic mediators and chemokines. In conjunction with cytokines that

regulate survival, these promote further influx of inflammatory leukocytes into the site of allergic

inflammation. Reprinted by permission from Macmillan Publishers Ltd: Nature, Vol. 454, Issue

7203, pp. 445-54, copyright 2008.

17

In addition to this classical role as an effector cell during the allergic response, mast cells

are also implicated in host responses to pathogens (2). Localized preferentially at sites bordering

bodily surfaces, mast cells are ideally positioned to be the first responder cells during attack by

incoming pathogens. As cells of immune surveillance, mast cells recognize microbial pathogens

through a variety of mechanisms. First, mast cells can directly interact with pathogens or their

components through their cell surface receptors that recognize pathogen-associated molecular

patterns (PAMPs). Such receptors include TLRs. Second, complement receptors or

immunoglobulin receptors on mast cells can bind opsonized bacteria or related products. Lastly,

mast cells can detect endogenous peptides derived from host cells that have been infected or

injured. A prime illustration of this is the induction of histamine release from human lung mast

cells by the endogenous superallergen pFv, which is predominantly released in the intestinal tract

in patients diagnosed with viral hepatitis (7). Upon binding to these elements, mast cell

activation occurs. Consequently, cytokines and chemokines are released, thereby facilitating the

recruitment of immune cells to sites of infection and the elimination of invading pathogens. In

support of this, investigations have shown that mast cell-deficient mice have diminished immune

responses in lung infection models that involve Klebsiella pneumoniae and Francisella

tularensis. Mast cells also eliminate pathogens directly. Opsonized bacteria can be endocytosed

and subsequently killed by mast cells. Through the release of antimicrobial peptides, such as

LL37, mast cells can eliminate invading pathogens (19, 20). In addition, mast cells exhibit

extracellular killing activity in the form of extracellular structures that trap bacteria. These

structures consist of DNA, histones, tryptase, and LL37 (21, 22). In summary, through the

recruitment and activation of immunocompetent cells and direct killing of pathogens, mast cells

play critical roles in the innate immune response against infection. In the context of adaptive

18

immunity, mast cells initiate and coordinate this arm of the immune response through the

recruitment and maturation of dendritic cells and the secretion of T cell polarizing cytokines.

The mast cell-derived product TNF-α upregulates dendritic cell expression of CCR7. This

chemokine receptor is central to the homing of dendritic cells to lymph nodes, where its ligands

CCL19 and CCL21 are produced. TNF-α also drives the maturation of dendritic cells.

Similarly, upon activation, mast cells drive the differentiation of Th2 cells through the secretion

of polarizing cytokines, such as IL-4, IL-10, and IL-13. Another potential role for mast cells in

the adaptive immune response involves their ability to interact with T cells as antigen-presenting

cells. However, this possibility is clouded with controversy (4, 19).

Lastly, recent studies have associated mast cells with autoimmune diseases, fibrosis, and

wound healing. In particular, research on experimental allergic encephalomyelitis (EAE), an

animal model of multiple sclerosis, has incited interest in the role of mast cells in the initiation or

propagation of autoimmune disease. Past observations have provided suggestive evidence for a

role for mast cells in autoimmune diseases of the central nervous system. These include data

providing an association between mast cell numbers and distribution with the development of

multiple sclerosis or EAE. However, the association remained indirect until recent studies

performed by Brown and colleagues. This group demonstrated that W/WV mice, which lack

mast cells, develop EAE less severely and later. Moreover, the reconstitution of W/WV mice

with immature mast cells rescued EAE susceptibility. Thus, this line of evidence highly suggests

an essential role for mast cells in the pathogenesis of autoimmune diseases. Because of their

ability to shape the cytokine milieu, mast cells have also been implicated in arthritis and bullous

pemphigoid. As in the case of fibrosis and wound healing, the autoimmune skin disease of

19

bullous pemphigoid requires neutrophil recruitment, which can be regulated by mast cell-derived

cytokines (23, 24).

Ca2+

Signaling

Regulation of Ca2+

homeostasis

A myriad of hormones, neurotransmitters, paracrine signals, and other stimuli impinge on

the surface membrane of cells. A broad array of intracellular secondary messengers is generated

to orchestrate cellular responses induced thereafter. Of these signaling molecules, Ca2+

is a

universal messenger that regulates a variety of physiological responses (25, 26). In immune

cells, calcium signals are involved in the control of cell activation, differentiation, proliferation,

transcriptional programs, and effector functions (27). They can also activate pathways that

culminate in cell death (26). Therefore, the use of Ca2+

for intracellular signaling requires tight

local and global control of cytosolic Ca2+

concentration. Cells have resultantly evolved intricate

cellular mechanisms for maintaining the balance of net intracellular Ca2+

levels (25).

To elucidate these complex systems that maintain a balance of Ca2+

uptake, intracellular

storage, and efflux, proteins involved in Ca2+

transport have been identified (26). In immune

cells, following the engagement of immunoreceptors with antigen or antigen-antibody

complexes, the enzyme PLC is activated and drives the rapid production of IP3. Binding of IP3

to the IP3 receptor (IP3R) localized in the ER stimulates the emptying of ER Ca2+

stores into the

cytosol. This event is correlated to a very small, transient cytosolic Ca2+

rise. SOCE from the

extracellular space occurs following this influx of Ca2+

from intracellular stores. SOCE through

Ca2+


(CRAC) channels is an important mechanism to sustain an increased

20

intracellular Ca2+

concentration (Fig. 1.4). Importantly, increases in cytosolic Ca2+

are critical

for the activation of the transcription factor Nuclear Factor of Activated T cells (NFAT) and the

altered expression of cytokines, chemokines, and many other NFAT-targeted genes, all of which

are important for the development of a productive immune response (28, 29). In the case of mast

cells, the aggregation of FcεRIs by IgE and antigen initiates the signaling pathway leading to the

activation of PLC. The resultant FcεRI-triggered biphasic increase in cytosolic Ca2+

is an

essential step during mast cell activation and in the generation of productive mast cell responses,

particularly degranulation. The close correlation between Ca2+

mobilization and gene expression

of cytokines and chemokines underscores the importance of cytosolic Ca2+

increases for mast

cell function. Moreover, Ca2+

mobilization is central for driving the degranulation of preformed

mediator-containing vesicles and de novo synthesis of lipid mediators (30-32).

In addition to the aforementioned mechanism of immunoreceptor-induced Ca2+

mobilization, several pathways for Ca2+

movement between the cytoplasm and ER and between

the cytoplasm and extracellular space exist to regulate intracellular Ca2+

concentration. Like

IP3R channels, ryanodine receptor channels (RyR) release Ca2+

from the ER. On the other hand,

sarcoplasmic/endoplasmic reticulum Ca2+

-ATPase (SERCA) pumps take up Ca2+

from the

cytoplasmic space. Ca2+

is also removed from the cytoplasm by plasma membrane Ca2+

-ATPase

(PMCA) pumps and, in select cells, via a Na2+

-Ca2+

exchanger (NCX). Dependent upon cell-

type, Ca2+

can enter the cytoplasm from the extracellular fluid through a wide spectrum of Ca2+

channels. For example, voltage-gated Ca2+

(CaV) channels execute a disparate array of functions

in electrically excitable cells; however, their role in electrically non-excitable cells, such as

lymphocytes and mast cells, remains controversial (Fig. 1.5) (25).

21

Activation of Store-operated Ca2+

Entry

Figure 1.4. Activated cell surface receptors stimulate the activity of PLC, thereby promoting the

hydrolysis of PIP2 and the concomitant generation of IP3. Thereafter, a decrease in ER Ca2+

levels results from the depletion of IP3-sensitive ER Ca2+

stores. This fall in Ca2+

concentration

is sensed by STIM1, which transmits an activation signal to Orai1, the pore-forming subunit of

the CRAC channel. CRAC channels are highly selective for Ca2+

and mediate the influx of Ca2+

from the extracellular space. Reprinted by permission from Macmillan Publishers Ltd: Nat. Rev.

Drug Discov., Vol. 9, Issue 5, pp. 399-410, copyright 2010.

22

Principal Pathways of Ca

2+ Movement

Figure 1.5. Ca2+

release from the ER is released through RyR or physiologically stimulated

IP3R channels. Ca2+

uptake is mediated via SERCA pumps. From the extracellular fluid, Ca2+

flows into the cytoplasmic space through store-operated Ca2+

channels and a variety of other

Ca2+

channels. The removal of Ca2+

occurs through PMCA pumps and, in select cell types, via

NCX. Overall, the generation of IP3 by PLC leads to depletion of ER Ca2+

reserves and the

subsequent activation of store-operated Ca2+

channels. Importantly, the representative Ca2+

transporters participate in modulating the balance between stimulation and inactivation of store-

operated Ca2+

channel activity by shaping the intracellular Ca2+

gradient. Reprinted from Trends

Biochem. Sci., Vol. 32, P.G. Hogan and A. Rao, Dissecting ICRAC, a store-operated calcium

current, pp. 235-45, copyright 2007, with permission from Elsevier.

23

Importantly, the rate at which Ca2+

enters into the cell through open CRAC channels is

determined by the Ca2+

concentration gradient and membrane potential. Various channels can,

therefore, modulate calcium signals through their capacity to change the membrane potential.

Although they lack the ability to directly conduct Ca2+

, K+ channels and the non-selective cation

channel transient receptor potential (TRP) channel, melastatin subfamily 4 (TRPM4) serve such

a purpose. TRPM4 is activated by Ca2+

(33). Mitochondria can also modulate CRAC channel

activity through sequestration of Ca2+

and concomitant buffering of intracellular Ca2+

concentration. In support of this, studies have shown that uptake and release of Ca2+

by

mitochondria are necessary for store depletion-induced sustained increases in intracellular Ca2+

concentration in human T cells. The mitochondrion rapidly withdraws Ca2+

from the cytosol

because of the negative potential across its inner membrane. In particular, recent investigation

proposes that mitochondria facilitate CRAC channel opening by promoting increasing levels of

store depletion and, thereafter, by sustaining the opening of these channels through the

prevention of Ca2+

-dependent inactivation. Potential mechanisms implicate a direct role for

mitochondria in decreasing free Ca2+

in the proximity of the inactivation site or an indirect role

through the local production of adenosine triphosphate (ATP), a Ca2+

buffer (25, 30, 33).

24

Store-operated Ca2+

entry

One of the principal mechanisms of Ca2+

influx into cells of the peripheral immune

system is the cellular process, known as SOCE. In 1986, James Putney proposed that, in non-

excitable cells, the depletion of ER Ca2+

stores stimulates sustained Ca2+

influx across the PM

independently of receptor engagement, production of secondary messengers, or the transient

peak in intracellular Ca2+

concentration induced by the release of Ca2+

from intracellular stores.

Since then, biophysical experiments have characterized the unique electrophysiological profile of

CRAC channels and confirmed their expression in lymphocytes and mast cells. However, for a

long time, the molecular identity of the players which mediate the Ca2+


current (ICRAC) eluded biochemical definition (33).

In recent years, the identification of Stromal Interaction Molecule 1 (STIM1) and the

Orai1 protein as integral parts of the ER-to-PM signaling system, necessary for SOCE, has

accelerated research in the field of calcium signaling (25). Anchored in the ER, STIM1 is a

single-spanning membrane protein with a Ca2+

-binding EF-hand motif. Investigations indicate

that STIM1 functions as the sensor of ER luminal Ca2+

levels and that its reorganization in the

ER allows it to transduce information directly to the PM. In specific, it migrates within the ER

membrane to sites closely apposed to the PM and reorganizes into punctae that interact with Ca2+

influx channels and activate them. At the PM, its interactions with the CRAC channel open the

gates for SOCE. The Orai1 protein is described as a tetra-spanning PM protein that functions as

the pore-forming subunit of the highly selective CRAC channel in the PM (Fig. 1.6) (25, 26).

25

Domain Structures of STIM1 and Orai1

Figure 1.6. Anchored in the ER, STIM1 contains a single-spanning transmembrane domain.

The luminal portion of STIM1 is characterized by a Ca2+

-binding EF hand sequence, a vestigial

EF hand motif, and a sterile α motif (SAM) domain that is central to STIM1 oligomerization.

The cytoplasmic portion of STIM1 contains a number of predicted functional domains, including

two coiled-coil domains, an ezrin-radixin-moesin (ERM) domain, and serine or proline-rich and

lysine-rich segments. In addition, it contains the CRAC activation domain (CAD) that is

essential for the gating of Orai1. In the case of Orai1, it is a PM-embedded protein with four

transmembrane segments (TM1-TM4). Represented by a purple dot is the point mutation

(R91W) responsible for Severe Combined Immunodeficiency of CRAC channel-deficient

patients. The red dot represents glutamate 106, which has been implicated in ion permeation.

The yellow dots represent aspartate residues 112 and 114 and glutamate residue 190 that are

crucial determinants of ion selectivity. Reprinted by permission from Macmillan Publishers Ltd:

Nat. Rev. Drug Discov., Vol. 9, Issue 5, pp. 399-410, copyright 2010.

26

Despite experimental evidence showing that STIM1 and Orai1 are necessary and

sufficient for SOCE, many questions linger about the details of the coupling mechanism between

these proteins (34). A structural analysis, conducted by Varnai and colleagues, of STIM1-Orai1

interactions has implicated the presence of additional molecular components within the STIM1-

Orai1 complex (35).

To further complicate the matter, recent findings have supported the idea that TRP cation

(TRPC) channels function as store-operated channels. TRPC channels are non-selective, Ca2+

-

permeable cation channels which are activated through stimulation of G protein-coupled

receptors, as well as tyrosine-phosphorylated receptors. Reports have indicated that silencing of

TRPC1 and TRPC3 by antisense RNA correlates with diminished Ca2+

influx under stimulation

conditions of receptor triggering or passive store depletion. Consistent with this, siRNA-

mediated knockdown of these channels in combination or individually markedly inhibits SOCE.

Of interest, Orai1 forms a complex with STIM1 and TRPC1. STIM1 itself binds to TRPC

channels TRPC1, TRPC2, TRPC4, and TRPC5 but not TRPC3, TRPC6, and TRPC7, and it is

involved in the gating of TRPC1. In line with this, knockdown of STIM1 by siRNA inhibits the

activity of TRPC1. Parallel investigation with other TRPC channels demonstrates their

regulation by STIM1 (36-38). Collectively, these data suggest that all TRPC channels, with the

exception of TRPC7, function as store-operated channels (36). Nonetheless, controversy

remains, considering that the properties of native TRPC channels are different from those of the

channels mediating the ICRAC (36-38).

Therefore, the identification of other molecules, which regulate the operation of CRAC

channels, will allow us to better understand how the interactions between STIM1, Orai1, and

27

TRPC channels occur and where they take place within cells. Most importantly, this will allow

us to have an impact on the diseases that associate with malfunctioning states of SOCE.

The absence of Ca2+

influx through CRAC channels can severely compromise immune

cell activation, proliferation, and effector functions. This is underscored by the existence of one

form of severe-combined immunodeficiency (SCID) syndrome, whose pathological roots trace to

defective CRAC channel function. In T lymphocytes from the patients who are affected by this

form of SCID, a missense mutation and an Arginine-to-Tryptophan amino acid (a.a.) substitution

at a.a. position 91 in the first transmembrane domain of the Orai1 protein result in the ablation of

all CRAC channel activity (28, 29). Along with the devastating consequences of CRAC channel

impairment in some patients with severe-combined immunodeficiencies, the significance of

SOCE in the pathogenesis of immune-related disease is underscored by its role in

hypersensitivity disorders of the immune system, particularly with a focus on mast cell activation

and the generation of allergic reactions. In mast cells, FcεRI stimulation induces the liberation of

intracellular Ca2+

stores and the phenomenon called “SOCE”. The consequential rise in

cytoplasmic Ca2+

is central for driving the release of a battery of paracrine signals, chemokines,

and cytokines, which help to sculpt subsequent allergic inflammation. Murine models which

lack SOCE signaling components exhibit defective mast cell function and allergic responses.

For example, mice lacking STIM1 or Orai1 are characterized by severely impaired histamine

release and leukotriene production, reduced TNF-α secretion, and an inability to mount a

subcutaneous anaphylactic response (39, 40).

28

Activation of store-operated Ca2+

channels

As discussed earlier, despite the intensive efforts of early investigations, the identity of

the molecular players that participate in the mechanism of CRAC channel activation have

remained shrouded in mystery until recent years. The identification of STIM1 and Orai1 as

major components of the SOCE pathway has significantly advanced the field of Ca2+

signaling

research (28, 29). It has provided the molecular “bridges” for the search for accessory proteins

that are involved in the molecular communication between STIM1 and Orai1. Moreover, it is

driving researchers to reevaluate some of the models, which were proposed in the period

predating the discovery of STIM1 and Orai1, of CRAC channel activation (41, 42).

To explain the mechanism of communication between intracellular Ca2+

stores and the

PM, the following three models have been proposed: 1) the diffusible messenger hypothesis, 2)

the vesicular fusion hypothesis, and 3) the secretion-like conformational coupling hypothesis

(Fig. 1.7) (41, 42). The diffusible messenger hypothesis proposes the existence of a small

molecular messenger that transmits an activation signal, which links intracellular stores to CRAC

channels in the PM (43-45). Predicted to be stored within the ER, this messenger is released into

the cytosol upon store depletion (41, 43, 44). On the other hand, the vesicular fusion hypothesis

proposes that this activation signal may be synthesized de novo in the cytosol upon store

depletion. This model suggests that, at resting stages, CRAC channels are absent in the PM but,

upon depletion of Ca2+

stores, are integrated into the PM via exocytosis (46, 47). Past evidence

shows that inhibitors of exocytosis block the ICRAC. Nonetheless, recent studies report that Orai1

is constitutively present in the PM and, thus, indicate that trafficking of the CRAC channel to the

PM after the emptying of stores is not essential for the activation of SOCE. Whether the

trafficking of STIM1 or the ER to the PM necessitates the molecular machinery of exocytosis

29

has not been determined though. Strikingly, genetic analyses indicate that the molecular

candidates, which are involved in the inhibition of Ca2+

influx but not ICRAC, are classically

associated with vesicular transport. These potential regulators include soluble N-

ethylmaleimide-sensitive factor attachment proteins receptor (SNARE) proteins, which have

established roles in vesicle transport, membrane docking, and fusion (41, 45-47). Like the

vesicular fusion hypothesis, the secretion-like conformational coupling model implicates a

potential role for SNARE proteins in the activation of CRAC channels. This model proposes

that emptying of intracellular Ca2+

stores triggers a migratory process of the peripheral ER to the

PM (48-52). In early versions of this model, the optimum juxtaposition between the membranes

of these two compartments results in a coupling reaction between IP3Rs in the ER and CRAC

channels in the PM. Recently, some scientists have proposed that STIM1 mediates this coupling

reaction (45). Some have also suggested a role for the peripheral actin cytoskeleton, as well as

SNARE proteins, in the regulation of this coupling reaction (42). Importantly, studies show that

stabilization of the cytoskeleton inhibits the coupling reaction between IP3Rs to Ca2+

channels

but that disruption of the cytoskeleton assists the binding of these molecular components.

Experimental evidence also shows that actin-stabilizing agents interfere with the activation of

SOCE (41). Overall, researchers have demonstrated that the cortical actin network modulates

SOCE in numerous cell types. Consequently, it will be important to test whether the

cytoskeleton prevents the coupling reaction between intracellular Ca2+

stores and the PM or the

fusion of vesicles, harboring CRAC channels, with the PM. In addition, it will be important to

determine if actin-reorganizing proteins and SNARE proteins direct the precise interaction

between the membranes of transported organelles or vesicles and the PM. Defining such roles is

central to the clarification of many aspects of the models presented above (42).

30

Models of CRAC Channel Activation

Figure 1.7. (A) The conformational coupling hypothesis proposes that, upon ER Ca2+

store

depletion, physical interactions occur between the ER and PM, inducing the activation of CRAC

channels. Importantly, researchers have suggested that reorganization of the actin cytoskeleton

could regulate when, where, and how these interactions take place. (B) The vesicular fusion

model postulates that whole CRAC channels or components of them may be sequestered in

cytoplasmic vesicles that are trafficked to the PM either for integration into the PM or for

transient interactions that activate Ca2+

influx upon intracellular Ca2+

store depletion. (C) The

diffusible messenger model hypothesizes that a secondary messenger, which is released from the

ER upon Ca2+

reservoir depletion, diffuses to the PM, where it is involved in the gating of CRAC

channels. [With kind permission from Springer Science+Business Media: <Pflugers Arch., On

the activation mechanism of store-operated calcium channels, Vol. 453, 2006, pp. 303-11, A.B.

Parekh, Fig. 2>.].

31

Ca2+

Signaling and the Actin Cytoskeleton

In the cell, actin exists in two forms: 1) globular (G-actin) and 2) filamentous (F-actin).

In an ATP-dependent manner, monomeric G-actin is polymerized to form microfilaments of F-

actin. Central to the regulation of the actin cytoskeleton is Ca2+

signaling. In the absence of

activated PLC, which can be considered a starter molecule of the Ca2+

mobilization process, PIP2

suppresses the activity of the actin-severing proteins gelsolin and profilin (53-55). In a

potentially related mechanism, the binding of Ca2+

to gelsolin activates this protein’s actin-

severing activity (55). The function of actin-stabilizing proteins, including α-actinin, is

suppressed in the context of higher intracellular Ca2+

levels (56, 57). Also, select interactions

that stable actin filaments are differentially regulated at varying concentrations of intracellular

Ca2+

. For example, low Ca2+

concentrations promote the interaction between caldesmon and

tropomyosin, whereas high concentrations impede the interaction (57). In summary, these data

suggest that the reorganization of the actin cytoskeleton is highly sensitive to localized changes

in intracellular Ca2+

concentration. A prime example of this concept in action is chemotaxis

during which the leading edge of cells is governed by microdomains of high Ca2+

concentration,

which catalyzes the breakdown of actin by actin-severing proteins, and the trailing end of cells

consists of less Ca2+

-concentrated sites, which permit the maintenance of adhesive structures and

overall cell shape (58).

Actin cytoskeletal reorganization has been implicated in models of CRAC channel

regulation. Nonetheless, little is known about actin-modulatory proteins that are involved in this

process or how actin regulates CRAC channel function and, thereby, downstream immune cell

responses. Classic experiments that have analyzed the effect of cytoskeleton disruption on

SOCE have provided conflicting evidence. Though the majority of reports have indicated that

32

actin depolymerization agents do not affect SOCE, studies with cytochalasins have shown that

this group of actin depolymerizing agents attenuates SOCE (59). Equally intriguing, mast cells

of mice deficient in Wiskott-Aldrich syndrome protein (WASP), a key regulatory protein of F-

actin assembly, are characterized by diminished Ca2+

mobilization, degranulation, and cytokine

secretion (60). These results strongly suggest that unidentified actin-binding members of a store-

operated calcium influx complex are waiting to be discovered.

33

Drebrin

Structure of Drebrin

Characterized by unique protein domains and an ability to induce dramatic cytoskeletal

rearrangements, drebrin can be considered one of the molecular candidates, which potentially

plays a role in the communication between STIM1 and Orai1. Most of our knowledge about

drebrin has been gathered from neuroscience studies. Also termed developmentally regulated

brain protein, drebrin is fittingly defined by pronounced expression in neurons. Nonetheless, it is

expressed in numerous non-neuronal cell types. Drebrin is a member of the actin-

depolymerizing factor-homology (ADF-H)/cofilin family of actin-binding proteins. In

mammals, drebrin is found in the following two splice-variant isoforms: 1) an adult form

(Drebrin A) and 2) an embryonal form (Drebrin E). Drebrin A mRNA differs from drebrin E

mRNA only by the presence of an internal 138-nucleotide sequence insert, which is absent from

drebrin E mRNA. As a result, drebrin E is detected at an approximate molecular weight of 115

kilodaltons (kDa), whereas drebrin A is traced at approximately 125 kDa. Drebrin is

distinguished by the following 4 major protein domains/motifs: 1) an amino-terminal ADF-H

domain, which allows it to interact with actin, 2) a proline-rich region, 3) a Homer-binding

domain, and 4) a carboxyl-terminal putative SH2-binding domain. Importantly, a central 85-a.a.

sequence, spanning a.a. residues 233-317, has been attributed with being necessary and sufficient

for drebrin to bind and remodel F-actin (Fig. 1.8) (61). On a related note, drebrin shares

sequence homology with mammalian actin-binding protein 1, which is marked by a Src-

homology 3 domain (62).

34

Domain Structure of Drebrin

Figure 1.8. Drebrin A and E are distinguished by the presence or absence of an internal insert,

respectively. A member of the ADF-H/cofilin family of actin-binding proteins, the protein

drebrin is characterized by an ADF-H domain that mediates binding to F-actin. The actin-

binding domain is a central 85 a.a. sequence that is both sufficient and required for the binding

and remodeling activity of drebrin. Drebrin also contains a proline-rich (P-rich) region, which

may potentially bind the SH3 domains of interacting proteins, and a homer-binding motif.

35

Function of Drebrin

In terms of function, biochemical studies have demonstrated that drebrin attaches to the

side of F-actin. Drebrin blocks the interaction between actin and myosin. In addition, it

competes with tropomyosin, fascin, and α-actinin, decreasing their actin-binding activity.

Fascinatingly, unlike F-actin that is bound to tropomyosin, F-actin which is bound to drebrin is

susceptible to being taken apart by the actin-severing protein gelsolin. This correlates with

observations of drebrin-transfected fibroblasts. The morphology of these cells transforms

dramatically, likely involving an outstanding change in the arrangement of F-actin. In these

cells, F-actin forms thick curving bundles, and exogenous drebrin directly interacts with F-actin.

This evidence supports a role for drebrin in actin dynamics (63). Other studies have established

a role for drebrin in the shaping of neuronal dendrites and in the recruitment of F-actin and post-

synaptic density-95 (PSD-95) to dendritic filopodia (64-71). Dependent upon Ras activation,

drebrin-induced spine destabilization is involved in the maintenance of stability and plasticity of

dendritic spines (72). Decreased drebrin expression correlates with the morphological changes

of spines in neurodegenerative diseases, such as Alzheimer’s disease and Down’s syndrome (73).

Interestingly, drebrin A-specific knockout mice exhibit impairment in context-dependent

freezing after fear conditioning, thereby implicating an important role for drebrin A in learning

behavior and generation of memory (74). Additionally, interactions between drebrin and the

microtubule plus-tip protein EB3 are required for neuritogenesis (75). In this light, the loss of

drebrin expression or function may play a role in the pathogenesis of other neurological

disorders.

Recent evidence demonstrates that drebrin stabilizes Connexin-43-containing gap

junctions at the PM (61, 76, 77). This implicates a potential role for drebrin in the establishment

36

of PM domains. In support of this, through knockdown experiments in T cells, recent

investigation has shown that drebrin participates in the polymerization of actin at the

immunological synapse and recruitment of CXCR4. Resultantly, in the absence of drebrin, IL-2

production is decreased. These data provide strong evidence for a functional role for drebrin

during the generation of an immune response. Additional studies with T cells have highlighted a

role for drebrin in Ca2+

signaling and, therefore, immune cell activation. In past studies, we

identified drebrin as a molecular target of 3,5-bis-trifluoromethyl pyrazole (BTP), a known

inhibitor of SOCE. We showed that BTP inhibits the ability of drebrin-overexpressing Chinese

hamster ovary (CHO) cells to develop long filopodia-like membrane extensions, indicating that

BTP inhibits the ability of drebrin to induce plasticity in the actin cytoskeleton. Moreover, we

demonstrated that loss of drebrin protein expression prevents SOCE in T cells at levels similar to

treatment with BTP. In line with this, small interfering RNA (siRNA)-mediated knockdown of

drebrin expression in T cells correlates with decreased NFAT activation. Our identification of

drebrin as a mediator of SOCE has provided insight into the interaction between actin

rearrangement and stimulus-induced Ca2+

mobilization (78).

37

3,5-bis-trifluoromethyl pyrazole (BTP)

Recently, a class of immunosuppressant compounds, that were termed BTPs, was

discovered. Predominantly, the pharmacological profiling of BTPs has been performed with

focus on the BTP derivative BTP2 (Fig. 1.9). Initial studies showed that BTP2 inhibits T cell

activation. Mechanistic exploration revealed that BTP2 blocks the activation of NFAT though it

does not affect other transcription factors, such as Nuclear Factor-κB (NF-κB) or Activator

Protein-1 (AP-1). Interestingly, unlike other NFAT inhibitors, such as FK506 and cyclosporine

A (CsA), BTP2 does not inhibit NFAT activation through direct ablation of calcineurin

phosphatase activity. Instead, BTP2 modulates CRAC channel activity (79, 80). The functional

outcome of this effect is inhibition of the production of Th1 and Th2 cytokines, particularly IL-2,

IL-5, and IFN-γ (79, 80). Through impeding SOCE, BTP2 also attenuated superoxide anion

production in human neutrophils (81). To further understand the mechanism of action of BTP2,

Takezawa et al. have demonstrated that BTP2 decreases Ca2+

influx by depolarizing

lymphocytes with the enhancement of TRPM4 activity (82). In contrast, He et al. have shown

that BTP2 blocks TRPC3 activity in medium devoid of monovalent cations. They have

concluded that BTP2 does not inhibit divalent cation entry through depolarization mediated by

activated monovalent cation entry channels. Moreover, their recordings of single TRPC3

channels suggested that BTP2 diminishes the probability of the channel to open rather than its

pore properties (83). In addition to these findings, our past studies identified the actin-binding

protein drebrin as a target of BTP. We demonstrated that BTP inhibits actin reorganization

mediated by the actin-binding protein and that loss of drebrin protein expression prevents SOCE,

similar to BTP treatment, in T cells (78).

38

Because of the unique ability of BTP2 to modulate SOCE, researchers have tested it as a

potential therapeutic for allergic disease. Scientists at Astellas Pharma have demonstrated that

BTP2 treatment inhibits the production of Th2 cytokines and leukotrienes, both of which are

important in the induction of allergic responses. They have also shown that BTP2 inhibits

eosinophil infiltration into airways in vivo. Observed clinical manifestations of these effects are

decreased bronchoconstriction and airway hyperresponsiveness in different in vivo models (84,

85).

39

Chemical Structure of BTP2

Figure 1.9. The boxed structural components are shared by all members of the BTP family of

chemical compounds. They include the core BTP ring. The derivatives of BTP, however, differ

in the excluded ring structure. In the case of BTP2, it is a thiadiazole ring.

40

Objective of Thesis:

To carve a niche into the area of allergy-related research, the focus of this study is to

understand the effects of BTP2 and the absence of its target drebrin on the biology of mast cells,

the central effector cells of allergic inflammation. This information will provide insight into the

role of drebrin in biological processes that regulate mast cell activation and, thus, facilitate the

design and development of novel pharmaceuticals for mast cell-mediated disease.

Hypothesis: BTP2 inhibits Ca2+

mobilization and mast cell activation through its effect on

drebrin.

41

CHAPTER 2

Materials and Methods

42

Mice

For BTP-related experiments, C57BL/6 mice were used. In the case of Drebrin knockout

(Drebrin-/-

) mouse-related experiments, 129S6/SvEvTac mice were obtained from Taconic USA

and utilized as wild-type (WT) control mice. Drebrin-/-

mice were generated from the 129/SvEv

gene trap embryonic stem (ES) cell clone OST 7352 for Mus musculus drebrin 1 (Dbn1),

provided by the Texas A&M Institute for Genomic Medicine (TIGM, College Station, TX).

With standard methods, the drebrin-/-

mouse line was generated by microinjection of Omnibank

ES cell clones into host blastocysts. Resultant chimeras were bred to C57BL/6 mice. Mice

heterozygous for the gene-trap mutation (genotype drebrin+/-

) were subsequently intercrossed to

produce drebrin-/-

mice. All experiments were carried out in accordance with the regulations of

the Institutional Animal Care and Use Committee (IACUC) at The Pennsylvania State University

and Cornell University.

Cell Culture and Reagents

Rat basophilic leukemia (RBL)-2H3 cells (American Type Culture Collection, Manassas,

VA, USA) were cultured at 37°C in Dulbecco’s Modified Eagle Medium (DMEM)

supplemented with 15% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, 100

μg/mL streptomycin, and 100 µM non-essential amino acid solution. Mouse BMMCs were

grown from femoral marrow cells of mice as previously described with a few changes (86). In

brief, bone marrow cells were obtained from 6–10-week-old mice and cultured at 37

oC in

DMEM supplemented with 10% heat-inactivated FBS, 100 U/mL penicillin, 100 μg/mL

streptomycin, 100 µM non-essential amino acids, 1 mM sodium pyruvate, 1 mM glutamine, 50

μM 2-β-mercaptoethanol (2-ME), IL-3 (10 ng/mL), and SCF (50 ng/mL) (Peprotech, Rocky Hill,

43

NJ). In the case of drebrin-/-

mouse studies, DMEM was supplemented with recombinant IL-3

(10 ng/mL, Cell Sciences, Canton, MA) alone. Cells were passaged every 2 d by replating the

cells in fresh medium. BMMCs were used for experiments after 4-8 weeks of culture (>95%

mast cells) and were routinely >95% positive for cell surface expression of FcεRI and c-kit as

determined via flow cytometry. To examine the population growth of BMMC cultures, 106

BMMCs were harvested and cultured for 4 weeks (>95% mast cells) at a concentration of

approximately 106 cells/mL as detailed above. Cells were counted weekly with a

hemacytometer. Weekly, the percentage of c-kit+ FcεRI

+ cells was determined as described

above. Then, the total number of mast cells for individual cultures was determined with the

following formula: (total number of cells in culture at timepoint, determined by counting with a

hemacytometer) (% of c-kit+ FcεRI

+ cells of culture at timepoint, determined by flow cytometry).

BTP2 (YM-58483; N-(4-(3,5-bis(Trifluoromethyl)-1H-pyrazol-1-yl)phenyl)-4-methyl-1,2,3-

thiadiazole-5-carboxamide) and other derivatives were synthesized as previously described (78,

87) or were purchased from Calbiochem. Both 2-Aminoethoxydiphenyl borate (2-APB) and

≥99.9% anhydrous dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich. For all

BTP2-based experiments, DMSO was utilized for vehicle control purposes at a maximum

concentration of 1 µL/mL (~14 µM or 1:1000 dilution).

Genotyping of Mice

Oligonucleotide primers (long terminal repeat (LTR) reverse, 5’–

ATAAACCCTCTTGCAGTTGCATC-3’; A, 5’–CTTCATCTTTGTCAGTCACCAGC-3’; B,

5’–CCAGTTCTAGGAGAGCCACTATC-3’) (all from Integrated DNA Technologies, USA)

were used in a multiplex reaction to amplify corresponding Dbn1 alleles on mouse chromosome

44

13. Approximately 100 ng of purified mouse tail or ear genomic DNA was used as a template

for polymerase chain reaction (PCR) in a 50 µL reaction volume. Cycling conditions were 94°C

for 60 sec, 60.2°C for 60 sec, and 72°C for 60 sec (38 cycles). Amplified products were

separated on 2% agarose gels and visualized with a Kodak Gel Logic 2200 Imaging System for

genotyping documentation.

Quantitative Real-Time PCR Analysis

For BTP-related studies, BMMCs (5 x 106 cells) were treated with 1 μM BTP2 or vehicle

and cultured for 2 days. Total RNA was prepared from respective BMMC populations, using a

RNeasy Mini Kit (Qiagen Sciences, MD). Complementary DNA (cDNA) was generated using

Ready-To-Go You-Prime First-Strand Beads (GE Healthcare, Buckinghamshire, UK) per

manufacturer’s protocol. Quantitative PCR was performed with the ABI 7300 Real-Time PCR

System using Taqman gene expression assay probes for IL-4, IL-6, TNF-α, and Dbn1 Exons 8-

10 (probe sequence, 5’– AGAAGTCGGAGTCAGAGGTGGAGG -3’; forward primer, 5’–

GGAGGTTAAAGGAGCAGTCTATC -3’; reverse primer, 5’– CGTGGGTTATCAGGCCG -

3’) with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a housekeeping gene (Applied

Biosystems, Branchburg, NJ). Data was analyzed using the Comparative ΔΔCT (threshold cycle)

method. Expression of IL-4, IL-6, TNF-α, and Dbn1 Exons 8-10 was normalized based on the

levels of mRNA for GAPDH and set relative to a calibrator sample. Fittingly, the normalized

relative gene expression levels of samples were then compared with the expression level of WT

populations or vehicle-treated populations, set as 1.

45

Western Blotting

Neocortical homogenates of 6-10-week-old mice were prepared with a plastic

homogenizer and cell strainer. Then, whole homogenate lysates were prepared with a x10

weight-to-volume ratio of lithium dodecyl sulfate (LDS) sample buffer, consisting of 2x NuPage

LDS Sample Buffer (Invitrogen, USA), 2 protease inhibitor tablets/10 mL total buffer (Roche,

USA), 1 mL mammalian cell culture protease inhibitor/10 mL total buffer, 50 µg 3,4-

dichloroisocoumarin/mL total buffer, 1 mM benzamidine, 1 mM sodium orthovanadate, 5.4 mM

sodium pyrophosphate, 50 mM sodium fluoride, 10% β-mercaptoethanol, and 10 mM

dithiothreitol. With the exception of NuPage LDS Sample Buffer and protease inhibitor tablets,

all sample buffer reagents were purchased from Sigma-Aldrich. Aliquots of whole homogenate

lysates were loaded to approximately 100 µg wet weight of cortical tissue per lane with

polyacrylamide gels and were subsequently subjected to Sodium Dodecyl Sulfate

Polyacrylamide Gel Electrophoresis (SDS-PAGE) and western blotting, as previously described

(86). Blots were probed with anti-pan-drebrin monoclonal antibodies (1:5000 dilution; clone

M2F6; Abcam, USA), followed by horseradish peroxidase (HRP)-linked goat anti-mouse Ig.

Thereafter, blots were stripped and reprobed with anti-β-actin control antibodies. Blots were

developed in chemiluminescent reagents and exposed to x-ray film.

In the case of western blotting with BMMC samples, cells were sensitized with 1 μg

mouse IgE anti-dinitrophenyl (DNP)/mL overnight, washed with phosphate-buffered saline

(PBS) solution once, and finally challenged with 100 ng DNP-human serum albumin (HSA)/mL

for indicated times (0-60 min). After challenge, the cells were washed with cold PBS and, then,

lysed in Radio Immuno Precipitation Assay (RIPA) lysis buffer supplemented with phosphatase

inhibitors on ice. To quantitate the protein concentration of whole cell lysates, the bicinchoninic

46

acid (BCA) protein assay (Pierce Biotechnology, Rockford, IL) was performed. Thereafter,

polyacrylamide gels were equally loaded with 20-25 µg protein per lane (depending upon the

experiment), and SDS-PAGE and western blotting were performed. Blots were probed with the

following antibodies: anti-phospho-Lyn (Tyr507

), anti-phospho-Erk1/2 (Thr202

, Tyr204

), anti-

phospho-SAPK/JNK (Thr183

, Tyr185

), anti-phospho-p38 (Thr180

, Tyr182

), and anti-phospho-

PLCγ1 (Tyr783

) (manufacturer’s recommended dilutions; all antibodies from Cell Signaling

Technology, Beverly, MA), followed by HRP-linked goat anti-mouse or goat anti-rabbit Ig

(Jackson Immunoresearch, USA). HRP-linked anti-phospho-tyrosine was also used. Blots were

stripped and reprobed with anti-β-actin or anti-α-tubulin control antibodies. Blots were

developed in chemiluminescent reagents and exposed to x-ray film. Densitometric analysis of

the western blots was performed with ImageJ software, and the data was standardized to the level

of β-actin or α-tubulin. Data for each lane is reported in the following manner: (fold change of

intensity of probed protein for WT sample at 0 min timepoint)/(fold change of intensity of

probed β-actin or α-tubulin for WT sample at 0 min timepoint).

Histological Staining

Skin tissue of approximately 5-8 mm in diameter was removed from the upper left

quandrant of the back of mice and immediately immersed in fixative solution for 2 h at room

temperature with minimal agitation. The fixative solution was composed of 2%

paraformaldehyde, 2.5% glutaraldehyde, 3 mM calcium chloride in 0.1 M sodium cacodylate

buffer (pH 7.4) (Sigma-Aldrich and Electron Microscopy Sciences, USA). After fixation, tissue

was processed into 1 x 2 mm blocks with the use of razor blades. Blocks were selected based

upon visualization of hardened tissue that was not mechanically damaged by separation between

47

the dermis and epidermis layers of the tissue. Subsequently, tissue blocks were transferred into

fresh fixative solution prior to fixation and embedding in epoxy resin. 0.5 µm thick tissue blocks

were sectioned and placed onto glass slides. Three slides were collected from each block with an

interval of 100 µm of tissue, separating each slide. The sections were stained with 0.1%

toluidine blue in borate buffer for 30 sec at 60°C, immersed in a 70% ethanol/2% acetic acid

solution for 5 sec, and rinsed with double distilled water (ddH2O). The sections were, then,

examined with an Olympus B51 microscope under a 100x magnification oil immersion objective

lens. Mast cells were identified based upon the intensity of metachromatic staining and counted

for quantification of the number of cells per standardized area. Representative images were also

recorded.

Transmission Electron Microscopy

Skin samples were prepared as detailed for histological staining with a few exceptions.

In brief, thin sections of approximately 80 nm in thickness were prepared with a Leica UC-6

ultramicrotome and collected onto 200-mesh hexagonal copper grids. Thereafter, the grids were

stained with 2% aqueous uranyl acetate and lead citrate. The grids were, then, examined with a

JEM-1200 transmission electron microscope at 80 kV. Representative images were documented.

Flow Cytometry

Approximately 5 x 105-1 x 10

6 cells per sample were stained for all assays. In brief,

BMMCs were harvested, washed with 2% FBS in PBS twice, and treated with Mouse BD Fc

Block for 15 min on ice (BD Pharmingen, USA). Then, cells were stained appropriately with

fluorescein isothiocyanate (FITC)-conjugated anti-mouse CD117/c-kit (BD Pharmingen, USA),

48

phycoerythrin (PE)-conjugated anti-mouse FcεRI alpha (FcεRIα), and/or allophycocyanin

(APC)-conjugated anti-IL-3R alpha chain (IL-3Rα) antibodies (eBioscience, USA) for 30 min on

ice. Cells were subsequently washed with 2% FBS in PBS twice, resuspended in PBS, and

monitored for surface expression of fluorescent markers with a FC500 Benchtop Cytometer or

BD LSR II. In the case of observation of IL-3Rα, cells were washed and incubated in the

absence of IL-3 overnight to remove exogenous IL-3 and prevent receptor recycling due to the

presence of stimulatory IL-3. Then, the cells were stained with anti-IL-3Rα antibodies.

Recorded measurements were analyzed with BD FACSDiva and FlowJo software.

Apoptosis Assay

To evaluate the viability of BMMCs by flow cytometry, the LIVE/DEAD Fixable Dead

Cell Red Stain Kit was used according to manufacturer’s instructions (Invitrogen, USA). The

cells were monitored with a BD LSR II, and recorded measurements were analyzed with BD

FACSDiva and FlowJo software.

Degranulation Assay

RBL-2H3 cells were seeded at 2 x 105 per well (in 1 mL) of a 12-well cell culture plate

and cultured overnight. In some cases, the cells were treated with BTP2, 2-APB (at 50 μM),

BTP2 derivatives (at the indicated concentrations or 1 μM), or vehicle for 30 min at 37°C and

subsequently challenged with 500 nM ionomycin for 30 min at 37°C. Alternatively, the cells

were sensitized with 1 μg mouse IgE anti-ovalbumin (OVA)/mL for 3 h at 37°C. The cells were

washed with PBS, treated with BTP2, BTP2 derivatives, or vehicle for 30 min at 37°C, and then

treated with 10 μg rat anti-mouse IgE in a final volume of 1 mL medium, supplemented with

49

BTP2, BTP2 derivatives, or vehicle for 30 min at 37°C. Mast cell degranulation was

quantitatively measured using a flow cytometric annexin-V binding assay (88). After stimulus,

RBL-2H3 cells were washed with pre-chilled PBS twice and subsequently stained with annexin-

V-PE at a dilution of 1:20 in binding buffer (commercially available as a part of the annexin-V-

PE kit; BD Pharmingen) for 15 min at room temperature. The cells were analyzed using a FC500

Benchtop Cytometer. Degranulation was calculated as a percentage of the mean fluorescence

intensity (MFI) of PE fluorescence of live RBL-2H3 cells, challenged in the presence of negative

control (vehicle) medium, after subtracting background release (% degranulation).

Degranulation was also determined by measuring levels of secreted β-hexosaminidase.

In the case of BTP-related experiments, RBL-2H3 cells or BMMCs were treated as described

above, except that after activation, β-hexosaminidase activity in the supernatants was determined

spectrophotometrically. In brief, 50 μL of supernatant samples and 80 μL of p-nitrophenyl-N-

acetyl-β-D-glucosamide (pNAG) solubilized in 0.05 M citrate buffer (pH 4.5) were added to the

wells of a flat-bottom 96-well plate. Color was allowed to develop for 30 min at 37°C. The

enzymatic reaction was terminated with the addition of 200 μL 0.05 M sodium carbonate buffer

(pH 10.0). Absorbances at 415 nm were measured in a microplate reader. Cells were lysed with

1% Triton-X, and the extracts were analyzed for endogenous β-hexosaminidase activity (total -

test). The β-hexosaminidase activity in unstimulated cells (spontaneous) was subtracted from the

enzyme activity of the stimulated cells (test). The percentage of β-hexosaminidase released into

each supernatant (% of total) was calculated using the following formula: β-hexosaminidase

secretion (% of total) = (test - spontaneous)/(total – spontaneous) x 100. Degranulation was

calculated as a percentage of the percentage released into each supernatant of total β-

hexosaminidase (% of total) for BMMCs, challenged in the presence of negative control

50

(vehicle) medium, after subtracting background release (% degranulation). For Drebrin-/-

mouse

experimentation, BMMCs were harvested, washed with Tyrode’s buffer, and sensitized with

anti-DNP IgE (2 µg/mL) in DMEM in the absence of IL-3 at 37°C overnight (4 x 106 cells/mL).

The cells were subsequently washed with Tyrode’s buffer to remove unbound IgE and

resuspended in Tyrode’s buffer at a concentration of 106 cells/60 µL. 10 µL of the cell

suspension was transferred to a 96-well round bottom plate, and cells were challenged with 10

µL of 2x stimulus (for final concentration of 0-1000 ng DNP-HSA/mL or 500 nM ionomycin)

for 1 h at 37°C. After activation, the β-hexosaminidase activity in the supernatants was

determined spectrophotometrically. In brief, 10 μL of supernatant samples and 50 μL of pNAG

solubilized in 0.05 M citrate buffer (pH 4.5) were added to the wells of a flat-bottom 96-well

plate. Color was allowed to develop for 60 min at 37°C. The enzymatic reaction was terminated

with the addition of 150 μL 0.2 M glycine (pH 10.7). Absorbances at 405 nm were measured in

a microplate reader. Cells were lysed with 0.5% Triton-X, and the extracts were analyzed for

endogenous β-hexosaminidase activity (total – test – blank). The β-hexosaminidase activity of

the blank substrate solution (blank) was subtracted from the enzyme activity of the unstimulated

or stimulated cells (test). The percentage of β-hexosaminidase released into each supernatant (%

of total) was calculated using the following formula: β-hexosaminidase secretion (% of total) =

(test - blank)/(total – blank) x 100.

In Vivo Histamine Release Assay

Analysis of in vivo histamine release was determined as previously described (86). In

short, mice (n=3-5 per group, 8 weeks old) were sensitized with 1 μg of mouse IgE anti-DNP via

intraperitoneal (i.p.) injection overnight. 12 h post-sensitization, mice were challenged with 50

51

μg DNP-HSA (solubilized in 100 µL PBS), which was delivered via intravenous (i.v.) injection.

For BTP-related experiments, mice were administered 10 mg BTP2/kg (~50 μL in PBS per

mouse) or vehicle (DMSO, 50 μL in PBS) as appropriate via i.p. injection. Then, 1 h post

treatment, mice were challenged with DNP-HSA as aforementioned. Control mice were either

not manipulated or were sensitized with mouse IgE anti-DNP and subsequently challenged with

PBS alone without exposure to DNP-HSA. In BTP-related experiments, Control mice were

sensitized with mouse IgE anti-DNP, treated with DMSO or BTP2, and were challenged with

PBS alone (i.e. no antigen). 3 min post-challenge, blood was collected by cardiac puncture and

stored on ice until centrifugation was performed for the preparation of serum samples.

Histamine was determined using a Beckman Coulter EIA Histamine Assay. All experiments

were carried out in accordance with the regulations of IACUC at The Pennsylvania State

University and Cornell University.

Serum IgE ELISA

For preparation of serum samples, blood was collected from mice via cardiac puncture

and transferred into a serum separator tube. Thereafter, tubes were centrifuged, and the serum

layer was removed. The IgE concentration of serum samples was assayed with the Mouse IgE

enzyme linked-immunosorbent assay (ELISA) MAX Deluxe Set according to manufacturer’s

instructions (BioLegend, USA).

Cytokine Secretion Assay

Analysis of cytokine secretion by BMMCs was performed as previously described (86).

In the case of BTP-related experiments, cells were incubated in the presence of 1 μM BTP2 or

52

vehicle for 30 min on ice in Tyrode’s buffer prior to stimulation. In brief, cells were washed and

sensitized with or without mouse IgE anti-DNP (1ug/mL) in the absence of IL-3 or SCF

overnight to remove exogenous IL-3. Subsequently, the cells were washed and resuspended in

Tyrode’s buffer. At this point, optionally, cells were incubated in the presence of 1 μM BTP2 or

vehicle for 30 min on ice in Tyrode’s buffer. Cells were then stimulated in medium starved of

IL-3 and SCF in V-bottom 96-well culture plates (2 x 105 cells/150 μL). Cells were stimulated

with 50 nM phorbol myristic acid (PMA) and 500 nM ionomycin. Alternatively, cells were

stimulated with 30 μg rat anti-mouse IgE/mL or 100 ng DNP-HSA/mL. In BTP2-related

experiments, for these steps, stimulation was performed in the presence or absence of 1 μM

BTP2. Cytokines in cell culture supernatants obtained 8 h and 24 h after stimulation were

measured using a Milliplex MAP immunoassay according to the suppliers’ instructions. Within

the assay’s sensitivities, mouse IL-2, IL-3, IL-4, IL-6, IL-13, TNF-α, and GM-CSF were

detected. IL-17 and IFN-γ were not detected. Cytokine concentrations are reported in pg/mL

units.

Measurements of Intracellular Ca2+

Concentration

Intracellular Ca2+

concentration in RBL-2H3 cells was measured using the Ca2+

-reactive

fluorescent probe Fura-2 acetoxymethylester (Fura-2AM) as previously described (86). First,

cells were pretreated with 1 μM BTP2 or vehicle for 1 h at 37⁰C and, thereafter, washed with

Ringer’s Solution (155 mM NaCl, 4.5 mM KCl, 2 mM MgCl2, 10 mM dextrose, 5 mM HEPES,

pH 7.4), supplemented with 1 mM CaCl2. Cells were loaded with 1 μM Fura-2AM at a

concentration of 107 cells/mL in Ca

2+-supplemented Ringer’s Solution for 1 h in the dark. Cells

were then washed, resuspended in Ca2+

-supplemented Ringer’s Solution, and the intracellular

53

Ca2+

concentration of 5 x 105 cells was monitored using a Photon Technology International

Quantamaster Spectrofluorometer. Fluorescence of Fura-2AM was monitored at room

temperature. Intracellular Ca2+

concentration was expressed as the ratio (Relative Fluorescence,

RF) of Fura-2AM fluorescence at 510 nM caused by the two excitation wavelengths (340

nm/380 nm).

Intracellular Ca2+

concentration in BMMCs was measured using the Ca2+

indicator Fluo-4

(Invitrogen, USA). BMMCs were sensitized with mouse IgE anti-DNP at a concentration of 1

μg IgE/2 x 106 cells/mL in medium starved of IL-3 and SCF overnight, washed, and resuspended

in factor-starved media. At this time, optionally, the cells were treated with BTP2 (1 μM),

3T5M-P, or vehicle for 1 hr at 37°C. Afterwards, the cells were loaded with Fluo-4 according to

manufacturer’s instructions. Subsequently, the cell suspension was supplemented with 2 mM

CaCl2. The intracellular Ca2+

concentration of 1.25 x 106 cells was monitored using a Coulter

XL-MCL flow cytometer. Relative fluorescence (RF) of Fluo-4 was measured at 494 nm when

excited by 488 nm of light at room temperature. Intracellular Ca2+

concentration was expressed

as the RF of Fluo-4. Mean calcium post-stimulation was calculated as the mean of intracellular

Ca2+

concentration ratiometric Fura-2AM or Fluo-4 RF measurements post-stimulation after

subtracting the mean of baseline measurements pre-treatment. Peak calcium post-stimulation

was calculated as the maximum intracellular Ca2+

concentration ratiometric Fura-2AM or Fluo-4

RF measurement post-stimulation after subtracting the mean of respective pre-treatment baseline

measurements. The slope of calcium decay was calculated as the slope of the linear regression

line fitted for Fluo-4 RF measurements post-stimulation.

54

Analysis of NFAT Localization

RBL-2H3 cells were cultured in glass bottom 6-well plates (2 x 105 cells/2 mL)

overnight. For DNP-HSA stimulation, cells were sensitized with 1 μg mouse IgE anti-DNP/mL

overnight, washed, and resuspended in factor-starved media. Then, the cells were treated with 1

μM BTP2 or vehicle for 30 min at 37°C, stimulated with 50 nM PMA and 500 nM ionomycin or

100 ng/mL DNP-HSA for 45 min at 37°C, and washed with PBS once. The cells were

immediately fixed and permeabilized in a 50:50 methanol:acetone mixture for, at least, 15 min at

-20°C. The cells were subsequently washed with PBS three times, blocked with normal rat serum

for 2 h at room temperature, and stained with Alexa Fluor 488-conjugated mouse IgG anti-

Nuclear Factor of Activated T cells, cytoplasmic 1 (NFATc1) (Santa Cruz Biotechnology, Inc.)

overnight at 4°C. Then, the cells were stained with TO-PRO-3 for identification of localization

of the nucleus. After staining, cells were observed using an Olympus Fluoview 1000 confocal

microscope for fluorescence at 519 nm with an excitation wavelength of 488 nm. At a 100x

magnification, images were captured at 0.2 μm slices as Z-plane stacks. Data was analyzed with

Autodeblur and Autovisualize X licensed software for deconvolution and 3-D image processing.

Statistical Analysis

Data represent the mean ± standard error mean (SEM) of, at least, three independent

experiments. The concentration causing 50% inhibition (IC50) was calculated using non-linear

regression analysis. The statistical significance was analyzed by Student’s t-test (unpaired t-test,

two-tailed) or by two-way ANOVA. Values of p<0.05 were considered significant. All data

analyses were performed using BD FACSDiva, FlowJo, or GraphPad Prism 5.

55

CHAPTER 3

Effect of BTP2 on Mast Cell Biology

56

Rationale

Much of our initial understanding of the electrophysiological properties of CRAC

channels came from a substantial body of work on T cells and mast cells. The precise molecular

mechanism of CRAC channel gating, however, is still largely unknown. Specific inhibitors of

CRAC channels could facilitate the molecular identification of the elusive key regulatory players

and would be excellent tools to study CRAC channel function. Unfortunately, all CRAC channel

blockers described thus far, including the most potent ones SK&F 96365, econazole, and 2-

aminoethyldiphenyl borate, have IC50 values in the micromolar range and are non-specific.

Djuric and colleagues described pyrazole derivatives that interfere specifically with the

expression of Ca2+

-dependent cytokine production following T cell receptor (TCR) stimulation,

but they could not detect inhibition of TCR-dependent Ca2+

signals in T cells (87). On the

contrary, Ishikawa et al. and we demonstrated that one of the pyrazole derivatives BTP2, also

known as YM-58483, is a potent inhibitor of store-operated influx in Jurkat T cells (78, 79).

Furthermore, we characterized an interaction between BTP2 and the actin-regulating protein

drebrin and identified a novel role for this protein as a regulator of calcium responses (78). We,

however, have not discriminated whether the mechanisms contributing to Ca2+

signals in mast

cells are affected by BTP2.

In this study, the pharmacological profile of BTP2 was investigated in the RBL-2H3 and

BMMC in vitro mast cell models and in vivo in the C57BL/6 murine system to evaluate the

therapeutic potential of this compound for mast cell-mediated diseases (6).

57

Effects of BTP2 on Ca2+

mobilization in RBL-2H3 cells and BMMCs

Increases in intracellular Ca2+

concentration, triggered through the FcεRI by IgE and

allergen, are necessary for the functional responses of mast cells. To analyze the possibility that

BTP2 has the potential to inhibit Ca2+

mobilization in mast cells, Ca2+

signals in the presence or

absence of BTP2 were compared. We first used RBL-2H3 cells which have been used

extensively as a mast cell model to study FcεRI signaling. These cells were pre-treated with

BTP2 (1 μM) or vehicle (DMSO) for 30 minutes and, then, analyzed for calcium responses, as

described in the Materials and Methods, following stimulation. These initial studies with RBL-

2H3 cells involved stimulation with the established Ca2+

ionophore ionomycin, which can

activate mast cell degranulation, as well as cytokine secretion, downstream of the FcεRI in the

presence of the phorbol ester PMA (89-91). We found that BTP2, at a 1 μM concentration,

significantly reduced intracellular Ca2+

following stimulation by ionomycin (Fig. 3.1A, left and

center panel). Moreover, analysis of peak Ca2+

responses showed a significant difference in this

parameter (Fig. 3.1A, right panel). Because ionomycin is not a physiological stimulus, we next

tested whether Ca2+

responses following more physiological stimuli via the FcεRI were also

inhibited by BTP2. In these experiments, we used anti-IgE. We also used antigen-specific IgE

anti-DNP in conjunction with DNP-HSA for the activation of primary sensitized BMMCs. These

BMMCs were pre-treated with BTP2 (1 μM) or vehicle for 30 minutes and then stimulated with

mouse anti-DNP IgE and rat anti-mouse IgE or the antigen DNP-HSA for the indicated time

period in the presence of CaCl2. Data summarized in Fig. 3.1B and 3.1C reveal that BTP2

inhibited the Ca2+

response in these BMMCs following FcεRI aggregation, with the Ca2+

peak

being significantly inhibited regardless of the stimulation method (Fig. 3.1, A-C, right panels).

58

Figure 3.1. BTP2 blocks intracellular Ca2+

mobilization in RBL-2H3 cells and BMMCs.

(A) RBL-2H3 cells were pre-treated with BTP2 (1 μM) or vehicle (DMSO) for 30 min, then

analyzed for calcium responses (as described in the Materials and Methods) following

stimulation with 500 nM ionomycin in the presence of CaCl2 for the indicated time period.

Intracellular Ca2+

concentration was expressed as ratiometric Fura-2AM, and representative data

of 3-5 independent experiments is shown (left panel). Quantification of mean calcium increase

(middle panel); peak calcium increase (right panel), with data expressed as the mean ± SEM of

3-5 independent experiments. *p<0.05 vs. Vehicle. (B) BMMCs were pre-treated with BTP2 (1

μM) or vehicle for 30 min, then stimulated with mouse anti-DNP IgE and rat anti-mouse IgE (10

μg/mL), and analyzed as in (A), except that intracellular Ca2+

concentration was expressed as

Fluo-4 relative fluorescence with representative data of 3-5 independent experiments shown (left

panel). Quantification of mean calcium increase (middle panel); peak calcium increase (right

panel) as in (A). Data are expressed as the mean ± SEM of 3-5 independent experiments.

*p<0.05 vs. Vehicle. (C) BMMCs were pre-treated with BTP2 (1 μM) or vehicle for 30 min,

then stimulated with 100 ng DNP-HSA and analyzed as in (A), except that intracellular Ca2+

concentration was expressed as Fluo-4 relative fluorescence with representative data of 3-5

independent experiments shown (left panel). Quantification of mean calcium increase (middle

panel); peak calcium increase (right panel) as in (A). Data are expressed as the mean ± SEM of

3-5 independent experiments. *p<0.05 vs. Vehicle.

59

Effects of BTP2 on FcεRI-mediated signaling in BMMCs

By contrast, BTP2 did not affect FcεRI-triggered tyrosine phosphorylation of cellular

proteins in BMMCs (Fig. 3.2A). Activation of Erk1/2, JNK, and p38 MAPK pathways were also

not affected by BTP2 treatment (Fig. 3.2, B-D, respectively). Finally, expression of c-Fos,

which is dependent upon the activation of Erk, was not altered by BTP2 treatment (Fig. 2E).

Thus, BTP2 does not grossly affect phosphorylation events immediately downstream of the

FcεRI.

60

Figure 3.2. BTP2 does not affect tyrosine kinase nor MAP kinase activation following

FcεRI triggering. BMMCs were treated with either BTP2 (1 μM) or vehicle (DMSO) for 30

min and then stimulated with mouse IgE anti-DNP and DNP-HSA for the indicated time periods,

lysed, and analyzed by western blot for (A) total phosphotyrosine; (B) phospho-ERK; (C)

phospho-JNK; (D) phospho-p38; or (E) c-Fos expression. Blots were stripped and reprobed with

control antibodies for β-actin. Numbers indicate fold increase corrected for expression levels.

61

BTP2 inhibits degranulation in RBL-2H3 cells

Mast cell degranulation is a highly regulated Ca2+

-dependent process (92). As BTP2

inhibits Ca2+

mobilization in RBL-2H3 cells and BMMCs (Fig. 3.1, A-C), we next determined if

mast cell degranulation could be inhibited by BTP2. For these experiments, we used an annexin-

V binding assay, as described in the Materials and Methods section. RBL-2H3 cells were pre-

treated with BTP2 or vehicle, at a 1 μM concentration, and then stimulated with ionomycin for

30 minutes, followed by analysis of degranulation. We found that BTP2 significantly reduced

ionomycin-induced degranulation (Fig. 3.3A). This inhibition occurred in a dose-dependent

fashion, with an IC50 value of 23 nM (Fig. 3.3B). Comparative analysis of population-based

measurements of the secretion of the granule-derived enzyme β-hexosaminidase between BTP-

treated cells and those that were treated with vehicle alone revealed inhibition of ionomycin-

induced degranulation upon pre-treatment with BTP2, thereby validating the results generated

through the annexin-V binding assay (Fig. 3.4). Furthermore, BTP2 could also significantly

reduce degranulation induced by FcεRI crosslinking with anti-IgE antibodies. In these

experiments, RBL-2H3 cells were sensitized with mouse IgE anti-OVA, pretreated with vehicle

or BTP2 (1 μM) for 30 minutes, and finally stimulated with rat anti-mouse IgE for 30 minutes.

Our results indicate that BTP2 significantly reduced degranulation induced by FcεRI as well

(Fig. 3.3C). BTP2 is therefore a potent inhibitor of mast cell degranulation induced through the

FcεRI.

62

Figure 3.3. BTP2 inhibits mast cell degranulation in vitro. (A) RBL-2H3 cells were pre-

treated with BTP2 or vehicle (DMSO) at 1 μM and then stimulated with ionomycin (500 nM) for

30 min. (B) RBL-2H3 cells were pre-treated with vehicle (DMSO) or BTP2 at the indicated

concentrations for 30 min then stimulated as in (A). (C) RBL-2H3 cells were pre-treated with

BTP2 (1 μM) or vehicle for 30 min, then stimulated with mouse IgE anti-OVA and rat anti-

mouse IgE for 30 min. All cells were analyzed for degranulation via an annexin-V binding

assay. Data are expressed as the mean ± SEM of 3 independent experiments. *p<0.05 vs.

Vehicle.

63

Figure 3.4. BTP2 inhibits mast cell degranulation and release of β-hexosaminidase in vitro.

RBL-2H3 cells were stimulated for 1 h with ionomycin (500 nM) following pre-treatment with

BTP2 (1 μM) or vehicle (DMSO) for 1 h. After stimulation, cells were lysed with 1% Triton-X,

and the extracts were analyzed for their β-hexosaminidase activities (total - test). Β-

hexosaminidase activity in unstimulated cells (spontaneous) was subtracted from the enzyme

activity from stimulated cells (test). (A) Data expressed as a percent of ionomycin-induced

release. (B) Data expressed as a percentage of total β-hexosaminidase released into the

supernatant. This was calculated using the following formula: release (% of total) = ((test -

spontaneous)/(total – spontaneous)) x 100. Data are expressed as the mean ± SEM of 3

independent experiments. *p<0.05 vs. Vehicle.

64

BTP2 inhibits histamine release in mice in response to antigenic challenge

To further characterize the effects of BTP2 on the mast cell-dependent physiological

response of degranulation, we analyzed the effect of BTP2 on histamine release in vivo. Mice

were sensitized with mouse IgE anti-DNP (1 μg) 12 hours prior to being pre-treated with 10 mg

BTP2/kg or vehicle that was delivered intraperitoneally. These mice were then challenged with

DNP-HSA an hour later to stimulate mast cell degranulation. 3 minutes post-challenge with

DNP-HSA, mice were sacrificed, and serum was collected and assayed for histamine. Control

mice were exposed to anti-DNP IgE, but they were left unexposed to antigen to ensure that the

measured responses were antigen-specific. The results show that BTP2 significantly reduces

histamine release upon antigenic stimulation in vivo (Fig. 3.5). In summary, this data provides

strong support for the idea that BTP2 is a potent inhibitor of mast cell degranulation in vivo.

65

Figure 3.5. BTP2 inhibits FcεRI-mediated histamine release in vivo. C57BL/6 mice were

sensitized with mouse IgE anti-DNP overnight, then treated with BTP2 (BTP2, 10 mg/kg) or

vehicle (DMSO) for 1 h. Mice, treated with BTP2 or vehicle, were then challenged with DNP-

HSA or PBS (as a control) for 3 min. Serum histamine concentration levels were then

determined and data are expressed as the mean ± SEM, n=8 except for control mice treated with

BTP and no antigen, n=3. *p<0.05 vs. Vehicle.

66

BTP2 inhibits cytokine secretion from mast cells

BTP2 was originally reported to inhibit IL-2 production in activated Jurkat T cells and

human CD4+ T cells, as well as IL-4 and IL-5 production in antigen-stimulated murine Th2 clone

D10.G4.1 cells (79, 80, 85, 87, 93). BTP2 also inhibits NFAT activation in Jurkat T cells and

primary human T cells (79, 80, 87, 93). Because secretion of these cytokines is regulated

differently in mast cells in certain cases (94-97), we tested whether the cytokine secretion of

BMMCs is affected by BTP2. BMMCs were stimulated with PMA and ionomycin in the

presence or absence of BTP2, and supernatants were analyzed for IL-2, IL-3, IL-4, IL-13, TNF-

α, and GM-CSF. As illustrated in Fig. 3.6, at both 8 and 24 hours after stimulation, BTP2

inhibited the secretion of IL-2, IL-3, IL-4, and TNF-α from BMMCs. While little IL-13 was

detected at the 8 hour timepoint, BTP2 inhibited IL-13 secretion by BMMCs at the 24 hour

timepoint (Fig. 3.6). BTP2 also significantly inhibited ionomycin-induced secretion of GM-CSF

at the 24 hour timepoint (Fig. 3.6). We also analyzed cytokine secretion in sensitized BMMCs

stimulated with anti-IgE. We found that there was little production of IL-2 and IL-13 up to 24

hours post-stimulation; however, BTP2 pre-treatment inhibited the secretion of IL-3, IL-4, IL-6,

TNF-α, and GM-CSF (Fig. 3.7). Similar results were obtained for IL-4, IL-6 and TNF-α when

sensitized BMMCs were stimulated with DNP-HSA (Fig. 3.8).

67

Figure 3.6. BTP2 inhibits cytokine secretion of PMA/ionomycin-activated BMMCs.

BMMCs were pre-treated with BTP2 (1 μM) or vehicle (DMSO) for 30 min and, then,

stimulated with PMA and ionomycin. 8 and 24 h after stimulation, the concentration of the

indicated cytokines was determined. Data are expressed as the mean ± SEM of technical non-

independent replicates, representative of 3 independent experiments. **,p = 0.001 – 0.01;

*p<0.05 vs. Vehicle.

68

Figure 3.7. BTP2 inhibits cytokine secretion of IgE/anti-IgE-activated mast cells. BMMCs

were sensitized with mouse anti-DNP IgE, pretreated with BTP2 (1 μM) or vehicle (DMSO) for

30 min, and then stimulated rat anti-mouse IgE. 8 and 24 h after stimulation, the concentration

of the indicated cytokines was determined. Data are expressed as the mean ± SEM of technical

non-independent replicates, representative of 3 independent experiments. *p<0.05 vs. Vehicle.

69

Figure 3.8. BTP2 inhibits cytokine secretion of IgE/antigen-activated mast cells. BMMCs

were sensitized with mouse anti-DNP IgE, pretreated with BTP2 (1 μM) or vehicle (DMSO) for

30 min and then stimulated with DNP-HSA (100 ng/mL). 8 and 24 h after stimulation, the

concentration of the indicated cytokines was determined. Data are expressed as the mean ± SEM

of technical non-independent replicates, representative of 3 independent experiments. *p<0.05

vs. Vehicle.

70

BTP2 inhibits NFAT nuclear localization in mast cells

Because the cytokines that were inhibited by BTP2 are regulated, in part, by NFAT (98,

99) and NFAT activation and nuclear translocation is dependent upon increases in cytosolic

Ca2+

, we examined the effect of BTP2 on NFAT localization in stimulated RBL-2H3 cells. Cells

were stimulated with ionomycin, and NFAT localization was examined. Alternatively, sensitized

RBL-2H3 cells were stimulated with DNP-HSA. These experiments show that BTP2 inhibited

ionomycin-induced, as well as antigen-IgE/FcεRI-induced, NFAT nuclear translocation (Fig.

3.9, A-B).

BTP2 inhibits de novo synthesis of cytokines in mast cells

We noted that BTP2 treatment completely suppressed the production of IL-2 and IL-3 but

partially inhibited the secretion of IL-4, IL-6, and TNF-α (Fig. 3.6-8). In mast cells, the

production of IL-2 is controlled almost entirely at the transcriptional level (100). On the

contrary, TNF-α, IL-4, and IL-13 occur both preformed and as newly synthesized molecules (2,

101). To determine whether the mechanism of inhibition responsible for our observation

involved a block in the transcription of preformed cytokines or de novo transcription, we

examined the effect of BTP2 on mRNA transcript levels for IL-4, IL-6, and TNF-α under steady-

state conditions in BMMCs. As illustrated in Fig. 3.10, BTP2 treatment did not significantly

inhibit the levels of preformed mRNA transcripts for these cytokines suggesting that BTP2

inhibits cytokine production primarily via its effects upon de novo transcription that is regulated

by NFAT or other Ca2+

-sensitive transcription factors.

71

Figure 3.9. BTP2 inhibits stimulus-induced NFAT nuclear translocation. (A) RBL-2H3

cells were pre-treated with BTP2 (1 μM) or vehicle (DMSO) for 30 min prior to stimulation for

45 min with ionomycin or (B) mouse anti-DNP IgE and DNP-HSA (100 ng/mL). Cells were

fixed and permeabilized, and NFATc1 localization was determined by confocal microscopy.

The nucleus was identified using TO-PRO-3 staining (red), and nuclear localization of NFAT

was identified with Alexa 488-conjugated anti-NFATc1 staining (green). Colocalization is

evident by yellow nuclear staining (red plus green). White bars indicate 40 μm. Representative

data of 3-5 independent experiments is shown.

72

Figure 3.10. BTP2 does not affect preformed cytokine mRNA expression. BMMCs were

pre-treated with BTP2 (1 μM) or vehicle (DMSO) for 2 days, and levels of IL-4, IL-6, and TNF-

α were quantified. Data are expressed as the mean ± SEM of duplicate experiments.

73

Discussion

BTP2 has been characterized as a selective blocker of store-operated Ca2+

entry. We

investigated the effect of BTP2 on mast cell function using the RBL-2H3 cell line and BMMCs

in vitro, as well as in in vivo murine models, to evaluate its therapeutic potential in mast cell-

mediated diseases. We show that BTP2 inhibits activation-induced increases in intracellular

Ca2+

responses. In addition, we show that BTP2 inhibits IgE and antigen-induced degranulation

in vitro and histamine release in vivo, as well as activation-induced cytokine secretion in vitro.

Sustained intracellular Ca2+

concentration increases are integral for allergen-induced mast

cell activation. The activation of mast cells leads to the release of performed mediators that are

stored in cytoplasmic granules. These mediators include histamine, serine proteases (tryptase

and chymase), carboxypeptidase A, and proteoglycans (2). The effects of BTP2 on mast cell

degranulation and cytokine secretion in vitro, as well as histamine release in vivo, suggest that

this compound could modulate the effect of histamine on smooth muscle contraction, endothelial

cell function, nerve endings, and mucous secretion. This agrees with other studies suggesting

that BTP2 may be efficacious in models of respiratory anaphylaxis in guinea pigs. In these

models, BTP2 was able to inhibit increased bronchoconstriction and airway hyperresponsiveness

(2, 84). Sustained elevations in intracellular Ca2+

concentration are also essential for the

production and secretion of cytokines by mast cells, which can modulate subsequent immune

responses (102). The ability of BTP2 to inhibit cytokine secretion in BMMCs is likely due to

reduced NFAT nuclear translocation since this transcription factor is essential for the expression

of many cytokine genes in mast cells (96, 103). Interestingly, BTP2 treatment completely

suppressed ionomycin-induced secretion of IL-2 and IL-3 but partially inhibited secretion of IL-4

and TNF-α. In mast cells, TNF-α and IL-4 can be expressed from both preformed mRNA, as

74

well as newly transcribed mRNA (2, 101). Our studies demonstrate that BTP2 treatment did not

affect the levels of preformed IL-4 and TNF-α mRNA. In addition, BTP2 also did not affect

preformed levels of IL-6 mRNA. This suggests that translation of preformed mRNA for TNF-α

and IL-4 in BMMCs is likely not affected by increases in intracellular Ca2+

concentration. On

the other hand, de novo transcription that is regulated by NFAT or other Ca2+

-sensitive

transcription factors is likely affected by BTP2. We found that, though BTP2 could significantly

inhibit FcεRI-mediated GM-CSF secretion, it was not as effective in inhibiting the secretion of

this cytokine when the cells were stimulated with PMA and ionomycin. This suggests that this

cytokine may be regulated differently and that its expression may not have as stringent a

requirement for increases in intracellular Ca2+

concentration. Indeed, analysis of the regulation

of GM-CSF in transgenic mice has revealed multiple cis-acting elements that regulate this

cytokine in T cells and mast cells (94). This analysis reveals that, in addition to NFAT, other

transcription factors, such as AP-1, Sp-1, GATA1, and GATA2 can be differentially used in

different cell types to regulate GM-CSF expression (94). Thus, while both FcεRI- and PMA and

ionomycin-mediated activation of mast cells result in GM-CSF secretion, they may execute this

by activating slightly different combinations of transcription factors, with FcεRI activation being

more Ca2+

-dependent and thus more potently inhibited by BTP2. Similar to BTP2-treated

BMMCs, BMMCs from mice lacking either Orai1 or STIM1 produce weak Ca2+

signals in

response to agonist (27, 39, 40). These BMMCs are characterized by severely impaired

histamine release, decreased leukotriene production, reduced TNF-α secretion, and a

dysfunctional subcutaneous anaphylactic response. Therefore, Ca2+

entry through CRAC

channels is essential for mast cell function (39, 40, 102). Here, our profiling of the effects of

BTP2 on mast cell activation and downstream responses suggests that BTP2 acts in a similar

75

pathway. Our recent characterization of an interaction between BTP2 and the actin-regulating

protein drebrin and the resultant discovery of a novel role for drebrin as a mediator of store-

operated Ca2+

entry further implies such a mechanism of action (78). Further analysis of the role

of drebrin in calcium signaling and mast cell function will reveal insights into the mechanism

behind this process.

76

CHAPTER 4

Structure-Activity Relationship Analysis of BTP2

77

Rationale

Specific inhibitors of the Ca2+

signaling pathway are potential therapeutics for various

immune and allergic diseases. As experimental tools, they could also facilitate molecular

identification of mechanisms of Ca2+

mobilization, particularly those governing CRAC channel

gating. Unfortunately, blockers, such as SK&F 96365, econazole, and 2-APB, have IC50 values

in the micromolar range and are non-specific (80, 104-111).

A number of groups have defined pyrazole derivatives exemplified by BTP2, that

specifically block TCR-induced Ca2+

entry and Ca2+

-dependent cytokine production (78-80, 87,

93). Considering that mast cell activation and degranulation are critically dependent on increases

in intracellular Ca2+

, compounds that inhibit this process may be useful as potential therapeutics

for allergies and asthma. Pyrazole compounds, including BTP2, represent potential leads for

treating these diseases; however, limited work has been performed on the effects of BTP2 on

mast cells (89-91). In addition, little is known in regards to the effects of modifications of the

core pyrazole ring to which the activity of this compound is attributed. The core pyrazole ring is

defined by the attachment of two trifluoromethyl groups and is shared by all members of the

BTP class of compounds. Here, we provide the first structure-activity relationship analysis of

the core pyrazole ring of BTP to define the active portion of the BTP2 parent compound.

78

The trifluoromethyl group at the C3 position is required for the inhibitory effect of BTP2

on the degranulation of BMMCs

To determine which moiety within the BTP2 molecule is important for its activity, we

performed limited structure-activity relationship studies of the BTP2 parent compound. We

synthesized a series of BTP2 derivatives that have retained the core structure shared by all

members of the BTP class of compounds but have been altered by replacing the trifluoromethyl

groups of the BTP ring with less bulky methyl groups (5T3M-P: 5-trifluoromethyl-3-methyl

pyrazole or 3T5M-P: 3-trifluoromethyl-5-methyl pyrazole), deleting a single trifluoromethyl at

either the C5 or C3 position (3T-P or 5T-P), deleting the trifluoromethyl groups entirely

(Pyrazole, Pyr), or replacing both trifluoromethyl groups with methyl groups (3M5M-P) (Fig.

4.1). In addition, the remaining ring of BTP2, which is unique and not shared by all members of

the BTP class of compounds, was replaced with the ring structure characteristic of BTP1 for

these BTP2 derivatives (Fig. 4.1) (112). Accordingly, BTP1 was also tested.

The BTP2 parent compound and its derivatives (1 μM) were tested for their ability to

inhibit degranulation in BMMCs upon ionomycin stimulation. BTP1 and BTP2 were

indistinguishable in their ability to inhibit degranulation (Fig. 4.2A). Pyr did not suppress

degranulation. On the contrary, 5T3M-P and 3T5M-P significantly reduced degranulation in

comparison to vehicle-treated cells (Fig. 4.2A). However, 5T3M-P only inhibited degranulation

by approximately 25%, whereas the level of inhibition linked to 3T5M-P was close in potency to

the level of the parent BTP2 compound (Fig. 4.2A). Our data also showed that the derivative

with a single trifluoromethyl group at the C3 position (3T-P) maintained the capacity to inhibit

degranulation. Nonetheless, the derivative with only a trifluoromethyl group at the C5 (5T-P)

position did not (Fig. 4.2A). Finally, the replacement of both trifluoromethyl groups with methyl

79

groups (in 3M5M-P) produced effects similar to those rendered by derivatives with complete

lack of trifluoromethyl groups (Pyr) (Fig. 4.2A). Control experiments verified that the known

Ca2+

influx inhibitor 2-APB was also able to inhibit this process. In summary, 2-APB confirmed

that BTP1, BTP2, and derivatives that retain the trifluoromethyl group at the C3 position inhibit

degranulation and validated the importance of elevations in intracellular Ca2+

concentration in

the generation of mast cell effector responses (Fig. 4.2A). Furthermore, consistent with this data,

3T5M-P inhibited ionomycin-induced degranulation with an IC50 of 25 nM, which is comparable

to that of the parent BTP2 compound (Fig. 4.2B)

Effects of 3T5M-P on Ca2+

mobilization in BMMCs

In line with the previous findings, 3T5M-P significantly inhibited IgE-DNP-HSA/FcεRI-

induced increases in intracellular Ca2+

concentration in BMMCs (Fig. 4.3, A-B). Overall, these

results suggest that the trifluoromethyl group at the C5 position of the pyrazole compound is

nonessential for the inhibitory activity of BTP2 on the Ca2+

-dependent process of degranulation.

80

Figure 4.1. Chemical structures of BTP analogs. BTP1; BTP2; Pyrazole: Pyr; 3-

trifluoromethyl-5-methyl-pyrazole: 3T5M-P; 3-trifluoromethyl-pyrazole: 3T-P; 5-

trifluoromethyl-3-methyl-pyrazole: 5T3M-P; 5-trifluoromethyl-pyrazole: 5T-P; 3-methyl-5-

methyl-pyrazole: 3M5M-P.

81

Figure 4.2. The 3-trifluoromethyl group is critical for the inhibitory activity of BTP2 on

BMMC degranulation. (A) BMMCs were pre-treated with vehicle, 2-APB (at 50 μM), or BTP

analogs (at 1 μM) and then stimulated with ionomycin. Degranulation was determined (as

indicated for β-hexosaminidase secretion in Materials and Methods). (B) RBL-2H3 cells were

pre-treated with 3T5M-P at the indicated concentrations. Cells were then stimulated with

ionomycin, and degranulation was measured (as indicated for the annexin-V binding assay in

Materials and Methods). Data are expressed as the mean ± SEM of 3 independent experiments.

*p< 0.05 vs. vehicle.

82

Figure 4.3. 3T5M-P blocks intracellular Ca2+

mobilization in BMMCs. (A) BMMCs were

pre-treated with 3T5M-P (1 μM) or vehicle for 30 min, then stimulated with mouse IgE anti-

DNP and DNP-HSA (100 ng/mL). Calcium responses were determined as in Fig. 3.1.

Representative data of 3-6 experiments is shown. (B) Mean calcium increase post-stimulation.

Data are expressed as the mean ± SEM of 3 independent experiments. **,p = 0.001 – 0.01 vs.

Vehicle.

83

Discussion

Our exploration of the structure-activity relationship between BTP2 and mast cell

degranulation has shown that the 3-trifluoromethyl group on the pyrazole ring is critical for the

inhibitory activity of the BTP family of immunosuppressants. Our study indicates that the

trifluoromethyl groups at positions C3 and C5 of the pyrazole compound play critical roles in the

mechanism of action of the BTP2 parent compound, with the trifluoromethyl group at C3 being

more critical for inhibitory activity of BTP2. While the 3T5M-P and 3T-P derivatives inhibited

activation-induced degranulation of BMMCs, the 5T3M-P, 5T-P, Pyr, and 3M5M-P derivatives

were less potent. Additionally, 3T5M-P inhibited FcεRI-triggered Ca2+

mobilization in BMMCs.

These observed activities are similar to those reported by Kiyonaka et al. for pyrazole

compounds that target the TRPC3 channel. This group recently showed that bulky functional

groups at the 3,5-positions of the pyrazole may be important for the inhibition of Ca2+

mobilization via the TRPC3 channel (112). In this work, Kiyonaka et al. characterized the

activity of a BTP derivative that substitutes the 3,5-bis-trifluoromethyl pyrazole group with an

ethyl-3-trifluoromethyl-pyrazole-4-carboxylate group in the BTP2 parent compound (4-(2,3,3-

trichloroacrylamide)phenyl)-5-(trifluoromethyl)-1H-pyrazole-4-carboxylate). This compound

selectively inhibited the TRPC3 channel and was a more potent inhibitor of NFAT in cardiac

myocytes than BTP2. This work also showed that the 3,5-bis-trifluoromethyl pyrazole group or

a trichloroacrylic amide group is critical for the selectivity for TRPC5 or TRPC3, respectively

(112). This suggests that the pyrazole group provides a molecular scaffold with which to

develop inhibitors of calcium signaling (112). These analyses suggest that the attachment of

bulky groups on the pyrazole ring of such molecules, particularly in the C3 position is important

for their ability to inhibit Ca2+

mobilization. All taken together, these studies indicate that BTP2

84

and its relatives provide a solid molecular framework for a new generation of small molecule

inhibitors for the treatment of bronchial asthma, allergies, and other mast-cell mediated diseases.

85

CHAPTER 5

Role of Drebrin in Mast Cell Biology

86

Rationale

Actin cytoskeletal reorganization has been implicated in models of CRAC channel

regulation. Nonetheless, little is known about actin-modulatory proteins that are involved in this

process or how actin regulates CRAC channel function and, thereby, downstream allergic

responses.

Pharmacological tools that could help to elucidate the role of actin-binding proteins in

store-operated channel regulation and allergic reactions are represented by a group of

immunosuppressant compounds that are derived from BTP. Recent evidence suggests that the

BTP derivative BTP2 may be beneficial in the treatment of allergic disorders, particularly

bronchial asthma. Amongst other effects, BTP2 inhibits antigen-induced histamine release from

and leukotriene production in IgE-primed RBL-2H3 cells, a model in vitro cell line for mast cells

(84). In agreement with other published work, we have demonstrated that BTP potently inhibits

immune cell activation via modulation of store-operated channel activity (78). Furthermore, our

past studies identified the actin-binding protein drebrin as a target of BTP. We demonstrated that

BTP inhibits actin reorganization mediated by the actin-binding protein and that loss of drebrin

protein expression prevents SOCE, similar to BTP treatment, in T cells. Our identification of

drebrin as a mediator of SOCE has provided insight into the interaction between actin

rearrangement and stimulus-induced Ca2+

mobilization (78).

All of these results implicate a regulatory role for drebrin in mast cell-mediated disease.

Here, utilizing a novel knockout mouse, we demonstrate that drebrin is required for in vivo

histamine release. Also, we show that drebrin regulates FcεRI-induced degranulation and

cytokine secretion in a Ca2+

-dependent manner in BMMCs. Collectively, these observations

87

provide the first genetic evidence that the actin-binding protein drebrin is required for Ca2+

mobilization in mast cells and has a role in allergic reactions.

Generation of Drebrin-/-

mice

To further understand the function of drebrin in immune cells, we generated drebrin-/-

mice from ES cell clones that we obtained from the TIGM. The TIGM has used high-throughput

gene-trapping with retroviral vectors in mouse ES cells to generate OmniBank, a library of

mutated ES cell clones. In our study, the ES cells were mutated by trapping the Dbn1 gene,

encoding Mus musculus drebrin 1. The gene-trapping cassette consists of a splice acceptor

sequence followed by the promoterless selectable marker β-geo, a functional fusion between the

β-galactosidase and neomycin resistance genes, with a polyadenylation signal. Insertion of the

retroviral vector into an expressed Dbn1 gene results in the splicing of upstream endogenous

exons into the cassette to generate a fusion transcript. Also encoded in the gene-trapping vector

is the mouse phosphoglycerate kinase gene promoter, a promoter active in ES cells, followed by

an exon, encoding puromycin resistance. The exon of this selectable marker in the 3’ trapping

component is upstream of a splice donor signal. Splicing from this signal to the exons

downstream of the insertion site produces a fusion transcript that was used by TIGM to generate

an Omnibank sequence tag (OST) of the trapped Dbn1 gene by Rapid Amplification of cDNA

ends (RACE), as previously described (113, 114). The TIGM has demonstrated that the OST

sequence is a reliable indicator of the genomic location of gene-trap inserts (114). Importantly,

the puromycin resistance exon contains termination codons which prevent the translation of

downstream fusion transcripts (Fig. 5.1).

88

Figure 5.1. Strategy for simultaneous inactivation and rapid identification of the disrupted

Dbn1 gene by gene-trapping in mouse ES cells. SA, splice acceptor sequence; β-Geo, fusion

of β-galactosidase and neomycin resistance genes; pA, polyadenylation signal; Pgk,

phosphoglycerate kinase gene promoter; Puro, puromycin resistance gene; SD, splice donor

sequence.

89

The procedures for infection of mouse ES cells with the described Omnibank gene-

trapping construct VICTR vector 21, selection and growth of ES cell clones, and determination

of the mutation sequence for the ES cell clone were performed by the TIGM, as reported in detail

by Zambrowicz et al. (114). The TIGM selected ES cell clones for microinjection based upon

the confirmation of intronic insertion of the gene-trapping construct. This was determined by

cloning the genomic insertion site with inverse PCR, as previously described (114). The ES cell

clone represented by OST 7352 was selected for the generation of drebrin-/-

mice. Inverse

genomic PCR of DNA isolated from OST 7352 cells confirmed that the retroviral gene-trap

vector had inserted in intron 8 of the mouse Dbn1 gene on chromosome 13 (114). To

specifically amplify the WT allele, PCR-based genotyping employed a primer that flanks the

genomic insertion site of the gene-trap vector (primer B). To amplify the mutated allele,

genotyping employed a LTR reverse primer, complementary to OmniBank vectors (Fig. 5.2).

Mice heterozygous for the mutation were generated by using standard methods of host embryo

microinjection, chimera production, and germ-line transmission (114). Heterozygous

intercrosses yielded homozygous animals, demonstrating that drebrin is not required for

embryonic development.

To demonstrate that trapping the Dbn1 gene led to a decrease in Dbn1 mRNA expression,

Dbn1 mRNA was measured by performing quantitative real-time RT-PCR with TaqMan probes

specific for the region spanning between exons 8-10 of the Dbn1 gene, where genomic insertion

of the gene-trapping cassette occurred. BMMCs of drebrin-/-

mice exhibited approximately a 4-

fold decrease in Dbn1 mRNA levels (Fig. 5.3). Moreover, our western blot analyses

demonstrated the absence of drebrin protein and correlated with the observed mRNA levels in

drebrin-/-

mice. In drebrin-/-

mice, drebrin protein expression was not detected in whole cell

90

lysates of the brain, where drebrin protein is known to be highly expressed. The truncated form

of drebrin protein that could be generated by the insertion-mediated fusion was also not detected

in the brain of drebrin-/-

mice with antibodies (M2F6 clone) (Fig. 5.4). Importantly, the epitope

recognized by the M2F6 clone has yet to be mapped. Collectively, these data suggest that Dbn1

mRNA derived from drebrin-/-

mice is unstable, resulting in a lack of drebrin protein expression

in these mice.

91

Figure 5.2. Mapping of genomic insertion site of the gene-trap vector in intron 8 of the

Dbn1 gene. Genotyping PCR primers A and B flank the genomic insertion site and amplify a

product for the WT allele. The LTR reverse primer was utilized in conjunction with primer B to

specifically amplify the mutated allele. Rev, reverse.

92

Figure 5.3. Verification of genetic disruption of the Dbn1 gene by gene-trap insertion with

RT-PCR. RT-PCR utilized primers that are complementary to exons flanking the insertion site

in the Dbn1 gene in mouse chromosome 13. Levels of drebrin mRNA from BMMCs were

quantified with murine GAPDH as a housekeeping gene. Data was analyzed using the

Comparative ΔΔCT method. Expression of drebrin was normalized based on the levels of

mRNA for GAPDH and set relative to a calibrator sample. The expression level of WT

populations is set as 1. Data are expressed as the mean ± SEM of 3 independent experiments.

*p<0.05 vs. WT.

93

Figure 5.4. Verification of ablation of protein expression of the disrupted Dbn1 gene by

western blot. Whole cell lysates for neocortical homogenates were analyzed by western blot for

pan-drebrin expression. Blots were stripped and reprobed with control antibodies for β-actin.

94

Cellular morphology but not distribution of drebrin-/-

mast cells in skin tissue is normal

Mast cells are characterized as tissue-based inflammatory cells of hematopoietic origin.

They are located primarily in association with blood vessels and at epithelial surfaces (2). To

characterize the mast cells of mice homozygous for the Dbn1 gene-trap mutation, phenotypic

analysis of skin tissue-resident mast cells was performed with toluidine blue staining and with

transmission electron microscopy. Similar to WT mice, the mast cells of drebrin-/-

mice were

identified by their metachromatic granule content, which was visualized as clusters of dark blue

circular elements with toluidine blue staining. The size and shape of drebrin-/-

mast cells

appeared normal. WT and drebrin-/-

mast cells retained similar granule density and shape and

shared similar patterns of tissue distribution (Fig. 5.5A). Quantitation of the density of mast cells

per square mm indicated a significant decrease in drebrin-/-

mice (Fig. 5.5B). Observation with

electron microscopy further corroborated our findings with histological staining (Fig. 5.5C).

Overall, these observations suggest that there is no difference between the cellular morphology

of WT and drebrin-/-

mast cells but that there is a difference in the distribution of skin mast cells

between these two groups in vivo.

95

Figure 5.5. Mast cells retain normal cellular morphology but not distribution in the skin of

drebrin-/-

mice. (A) Toluidine blue-stained skin sections from WT and drebrin-/-

mice (6-8

weeks old). Black arrows identify mast cells. (B) Quantification of the number of skin-resident

mast cells per standardized area. Data are expressed as the mean ± SEM of n = 3 per group, each

representative of the average of individual counts of 3 separate tissue block sections from (A) per

mouse. *p<0.05 vs. WT. (C) Transmission electron micrographs of skin sections from WT and

drebrin-/-

mice (6-8 weeks old). For (A and C), representative images is shown; n = 3 per group.

96

Drebrin is not required for development but is necessary for survival of drebrin-/-

BMMCs

in vitro

Mast cells arise from CD34+ pluripotent progenitor cells in the bone marrow. From the

bone marrow, mast cell precursors migrate into blood circulation and then home to tissues, where

they mature (2). Though both IL-3 and SCF represent critical mast cell growth factors, there are

published findings suggesting that IL-3 alone elicits mast cell growth from unfractionated mouse

bone marrow cells in vitro. This implicates the existence of bone marrow cell subpopulations

that are capable of mast cell growth in response to IL-3 alone (115-117). To determine if

absence of drebrin expression altered the development of mast cells from bone marrow

precursors, the differentiation of drebrin-/-

BMMC cultures in the presence of IL-3 alone was

monitored over a time course of 6 weeks. The percentage of cultured cells that expressed the

cell-surface receptors c-kit and FcεRI, which are canonical markers of fully differentiated mast

cells, was monitored on a weekly basis via flow cytometry. For WT mice, differentiation of

bone marrow precursors into mature mast cells occurred between 2 to 4 weeks and reached a

plateau of >95% c-kit+ FcεRI

+ cells between 5 to 6 weeks in IL-3 supplemented cultures. No

significant difference in the rate of differentiation of drebrin-/-

BMMCs was observed (Fig.

5.6A).

Like mast cells, basophils develop from CD34+ progenitors. After they differentiate and

mature in the bone marrow, they migrate to the periphery where they circulate in the blood.

Basophils are characterized by a c-kit- FcεRI

+ cell surface receptor expression profile. IL-3 is

the dominant cytokine driving basophil differentiation and is sufficient to differentiate stem cells

into basophils (2). Considering that we supplemented our BMMC cultures with IL-3 alone, the

development of basophils in our cultures was evaluated. Throughout 6 weeks of culture,

97

basophils comprised approximately less than 5 percent of our cell cultures. Interestingly, a slight

decrease in the percentage of c-kit- FcεRI

+ cells was observed for drebrin

-/- BMMC cultures

during 2 to 6 weeks of development; however, these differences were not statistically significant

(Fig. 5.6B). Together, these data suggest that the maturation and differentiation of drebrin-/-

BMMCs and basophils occurs normally in the presence of IL-3 in vitro.

98


BMMCs and basophils show normal development in vitro. (A) Rate

of differentiation of c-kit+ FcεRI

+ cells in BMMC cultures. Data are expressed as the mean ±

SEM of replicates, representative for BMMC cultures of 8 individual mice per group. (B)

Drebrin-/-

bone marrow-derived basophil development. Rate of differentiation of c-kit- FcεRI

+

cells in BMMC cultures. Data are expressed as the mean ± SEM of replicates, representative for

BMMC cultures of 8 individual mice per group.

99

Next, the population growth of our fully differentiated drebrin-/-

BMMC cultures was

monitored to evaluate the contribution of drebrin to this process in vitro. In short, after 4 weeks

of growth in the presence of IL-3, cultures that consisted of >95% c-kit+ FcεRI

+ BMMCs were

seeded at 106 cells, cultured, and monitored over the course of another 4 weeks, as described in

the Materials and Methods section. A decrease in the total number of c-kit+ FcεRI

+ BMMCs was

observed for drebrin-/-

cultures as early as 1 week after the initiation of the culture. After 4

weeks, an approximate 3-fold difference in the number of BMMCs between WT and drebrin-/-

cultures was observed. This suggests that drebrin-/-

BMMC cultures grow at a slower rate in

vitro (Fig. 5.7A). Because the growth of our cultures was mediated by IL-3, a potential

explanation for the observed differences is that drebrin-/-

BMMCs express lower levels of IL-3

receptor. Flow cytometry showed that IL-3Rα was expressed at similar levels on the surface of

WT and drebrin-/-

BMMCs (Fig. 5.7B). Alternatively, decreased viability of drebrin-/-

BMMCs

could account for the slower rate of growth of respective cultures. The viability of drebrin-/-

BMMCs was evaluated by flow cytometry with LIVE/DEAD dye staining, which can permeate

the compromised membranes of necrotic cells and react with free amines in the interior, as well

as on the cell surface. Unlike WT BMMCs that were relatively dimly stained due to the presence

of only cell surface amines, drebrin-/-

BMMCs were intensely stained. Gating of non-viable cells

demonstrated that approximately 60 percent of drebrin-/-

BMMCs were non-viable in comparison

to approximately 2 percent of WT BMMCs (Fig. 5.7C). Therefore, the decreased viability of

drebrin-/-

cultures suggests that drebrin is required for the survival and growth of BMMCs in

vitro.

100


BMMCs show less viability in vitro. (A) Rate of growth of c-kit+

FcεRI+ population in BMMC cultures with >95% c-kit

+ FcεRI

+ cells. (B) BMMCs were

analyzed for cell surface expression of IL-3Rα via flow cytometry. (C) BMMCs were analyzed

for LIVE/DEAD Fixable Dead Cell Red Stain via flow cytometry. The percentage of non-viable

cells was calculated based upon the non-viable cell gate, set for the LIVE/DEAD Fixable Dead

Cell Red Stain histogram. For (A-C), data are expressed as the mean ± SEM of 3 independent

experiments. *p<0.05 vs. WT.

101

Drebrin is required for degranulation of BMMCs

Mast cells respond to signals of innate and adaptive immunity with immediate and

delayed release of inflammatory mediators. The critical mediators of the immediate response are

comprised of preformed mediators that are stored in cytoplasmic granules. They include

histamine, serine proteases (tryptase and chymase), carboxypeptidase A, and proteoglycans.

Upon activation of mast cells, granules fuse with the plasma membrane, and the contents are

released into the extracellular environment within minutes to drive immune responses (2). To

assess if the absence of drebrin affected the mast cell effector response of degranulation, a β-

hexosaminidase secretion assay was first performed to measure the magnitude of degranulation

for drebrin-/-

BMMCs. β-hexosaminidase is a lysosomal enzyme which is secreted

proportionally to the extent of degranulation (118, 119). Initial studies involved stimulation with

the Ca2+

ionophore ionomycin, which can elevate intracellular Ca2+

concentration and, thus,

activate mast cell degranulation downstream of the FcεRI (89-91). In comparison to WT

BMMCs, drebrin-/-

BMMCs exhibited reduced levels of degranulation upon stimulation with

ionomycin. The decrease equalled to an approximate reduction of 20 percent of WT levels (Fig.

5.8A). Because ionomycin is not a physiological stimulus, the degranulation responses of

drebrin-/-

BMMCs following more physiologically relevant stimuli via the FcεRI were also

measured. Drebrin-/-

BMMCs showed significantly reduced levels of degranulation induced by

FcεRI crosslinking with IgE and graded doses of the antigen DNP-HSA. Degranulation

responses steadily increased with increasing amounts of DNP-HSA presumably as the saturation

of FcεRIs with crosslinking antibody-antigen complexes was reached. The optimal dose was

100 ng. Similar to stimulation with ionomycin, challenge with 10 to 1000 ng DNP-HSA

demonstrated diminished degranulation for drebrin-/-

BMMCs to approximately 80 percent of

102

WT levels (Fig. 5.8B). These results show that lack of drebrin expression significantly reduces

degranulation mediated by FcεRI crosslinking with antigen. Drebrin is, therefore, an important

regulator of mast cell degranulation induced through the FcεRI.

Drebrin is required for histamine release in mice in response to antigenic challenge

To further characterize the effects of knockout of drebrin expression on the mast cell-

dependent physiological response of degranulation, the release of histamine in vivo was analyzed

in drebrin-/-

mice. As described in the Materials and Methods section, control mice were either

left untreated or sensitized with IgE but left unexposed to antigen to ensure that the measured

responses were antigen-specific. As expected, histamine release was undetectable under basal

conditions or with sensitization alone in WT and drebrin-/-

mice. Upon antigenic challenge with

DNP-HSA, evoked histamine release was detected in both WT and drebrin-/-

mice. Drebrin-/-

mice exhibited significantly reduced levels of in vivo histamine release (Fig. 5.9A). Varying

levels of serum IgE in drebrin-/-

mice could be responsible for the observed difference. However,

ELISAs showed that levels of serum IgE in drebrin-/-

mice were similar to WT levels (Fig. 5.9B).

In summary, our data provides strong support for the idea that drebrin plays an important role in

potentiating mast cell degranulation in vitro and in vivo independent of serum IgE levels.

103


mice exhibit impairment in mast cell degranulation in vitro. (A-B) β-

hexosaminidase secretion of BMMCs. β-hexosaminidase secretion in supernatants was

measured for BMMCs either (A) stimulated with ionomycin (500 nM) for 1h or (B) sensitized

with mouse IgE anti-DNP (2 µg/mL) overnight and subsequently challenged with DNP-HSA

(for final concentration of 0-1000 ng/mL) for 1 h. The β-hexosaminidase activities of the blank

substrate solutions (blank) were subtracted from the enzyme activities of the unstimulated or

stimulated cells (test). After stimulation, cells were lysed with 1% Triton-X, and the extracts

were analyzed for their β-hexosaminidase activities (total – test – blank). The percentage of β-

hexosaminidase released into each supernatant was calculated using the following formula: β-

hexosaminidase secretion (% of total) = (test – blank)/(total – blank) x 100. Data are expressed

as the mean ± SEM of 3 independent experiments. For (A-B), *p<0.05 vs. WT.

104


mice exhibit impairment in FcεRI-mediated histamine release in vivo.

(A) In vivo histamine release of WT and drebrin-/-

mice (8 weeks old). Experimental mice were

sensitized with mouse IgE anti-DNP overnight (1 µg) then challenged with DNP-HSA (50 μg)

for 3 min. Control mice were either left untreated (Basal) or sensitized and injected with PBS

alone to avoid exposure to DNP-HSA and ensure antigen dependence for experimental mice.

Thereafter, serum histamine concentration levels were determined. Data are expressed as the

mean ± SEM of n = 3-5 per group. (B) Serum IgE levels of WT and drebrin-/-

mice (8 weeks

old). Data are expressed as the mean ± SEM of n = 3 per group. For (A-B), *p<0.05 vs. WT.

105

Drebrin is required for cytokine secretion of BMMCs

Unlike granule-associated mediators that are immediately released following mast cell

activation, cytokines drive the delayed responses of hypersensitivity immune reactions (2).

Importantly, the release of both groups of inflammatory mediators is regulated by overlapping

intracellular signaling pathways (10). In consideration of this and our observation that the

absence of drebrin diminished mast cell degranulation, the release of cytokines from drebrin-/-

BMMCs was evaluated. Previous investigation has demonstrated that stimulation with

ionomycin can activate mast cell cytokine secretion downstream of the FcεRI in the presence of

the phorbol ester PMA (89-91). At both 8 and 24 hours after stimulation with PMA and

ionomycin, drebrin-/-

BMMCs secreted less IL-2, TNF-α, and GM-CSF. Diminished levels of

IL-3, IL-4, and IL-13 secreted by drebrin-/-

BMMCs at 8 and 24 hour time points were also

observed; however, these differences were not statistically significant with the exception of that

observed for IL-13 at 24 hours post-stimulation (Fig. 5.10). Under conditions of physiological

stimulation with crosslinking anti-IgE antibodies, FcεRI triggering resulted in decreased IL-2

and GM-CSF secretion by drebrin-/-

BMMCs. The difference observed for IL-2 at 24 hours post-

stimulation was not statistically significant. In addition, though TNF-α was not detected for WT

nor drebrin-/-

BMMCs at 8 hours after challenge with anti-IgE antibodies, a significant reduction

in TNF-α secretion at the 24 hour time point was monitored for drebrin-/-

BMMCs (Fig. 5.11).

No to little secretion of IL-3, IL-4, and IL-13 was observed for both WT and drebrin-/-

BMMCs

with FcεRI crosslinking. Thus, mast cell cytokine secretion that is initiated through the FcεRI

necessitates the presence of drebrin.

106


BMMCs exhibit impairment in PMA/ionomycin-induced cytokine

secretion. BMMCs were stimulated with PMA (50 nM) and ionomycin (500 nM). 8 and 24 hr

after stimulation, the concentration of the indicated cytokines was determined through

measurement via Milliplex MAP immunoassay. Data are expressed as the mean ± SEM of

technical non-independent replicates, representative of 3 independent experiments. *p<0.05 vs.

WT.

107


BMMCs exhibit impairment in FcεRI-mediated cytokine secretion.

BMMCs were sensitized with mouse IgE anti-DNP and then stimulated with rat anti-mouse IgE

(30 µg/mL). 8 and 24 hr after stimulation, the concentration of the indicated cytokines was

determined through measurement via Milliplex MAP immunoassay. Data are expressed as the

mean ± SEM of technical non-independent replicates, representative of 3 independent


108

Drebrin-/-

BMMCs exhibit normal levels of FcεRI surface expression

To elucidate potential mechanisms responsible for the differences observed for drebrin-/-

mast cell effector responses, biochemical analysis of cellular signaling pathways leading to mast

cell activation was performed. As shown in Fig. 5.9B, serum titers of IgE were comparable

between WT and drebrin-/-

mice, thereby eliminating the possibility that varying levels of IgE

were altering the ability of exogenous antigen-specific IgE to activate drebrin-/-

mast cells in

vitro and in vivo. On the other hand, an alternative explanation for our observed phenotypical

differences is that drebrin-/-

BMMCs could express lower levels of FcεRI on their surface and

resultantly modulate activation signal strength. As determined by flow cytometry, surface

expression of the FcεRIα chain, which is responsible for binding IgE, was slightly decreased for

drebrin-/-

BMMCs; however, this difference was not statistically significant (Fig. 5.12). Drebrin

is, ergo, not required to maintain normal levels of FcεRI surface expression.

109

Figure 5.12. Cell surface expression of FcεRI on drebrin-/-

BMMCs is normal. (A) BMMCs

were analyzed for FcεRI via flow cytometry. Data are expressed as the mean ± SEM of triplicate


110

Phosphorylation events downstream of FcεRI are normal in drebrin-/-

BMMCs

Phosphorylation events triggered by FcεRI engagement with antibody-antigen complexes

relay signals required for the activation of degranulation and cytokine secretion. In brief, upon

crosslinking of FcεRIs, Lyn kinase is brought into closer proximity of the FcεRI where it can

phosphorylate the tyrosine residues of ITAMs in the FcεRI β- and γ-chains. These ITAMs

provide docking sites for the tethering of Lyn and Syk and subsequent activation of Syk. Syk,

then, phosphorylates the transmembrane adaptor molecule LAT, coordinating the association of

a multimolecular complex that consists of cytosolic adaptor molecules, GEFs, and signaling

enzymes (Fig. 1.1). Integral to the assembly of this macromolecular complex is tyrosine

phosphorylation (10). To evaluate tyrosine kinase activity in drebrin-/-

BMMCs, global patterns

of tyrosine phosphorylation for WT and drebrin-/-

BMMCs that were challenged with antigen

were monitored over a time course of 1 hour post-stimulation. For both WT and drebrin-/-

BMMCs, overall tyrosine phosphorylation peaked at 2 minutes post-challenge and declined

thereafter. Densitometric analysis showed no major differences between WT and drebrin-/-

BMMCs for this parameter (Fig. 5.13A). Moreover, the phosphorylation of Lyn in drebrin-/-

BMMCs was further assessed because this kinase has been shown to be a negative regulator of

degranulation for BMMCs derived from mice of the 129/Sv genetic background (120-126). No

substantial difference in Lyn phosphorylation, which reached its highest levels at 2 minutes post-

challenge and gradually decreased over the remaining time course, was observed in drebrin-/-

BMMCs. As expected, densitometric analysis of the intensity of corresponding bands revealed

no differences (Fig. 5.13B).

111

A)

B)

Figure 5.13. Tyrosine kinase activation following FcεRI triggering is not affected in

drebrin-/-

BMMCs. BMMCs were stimulated with mouse IgE anti-DNP and DNP-HSA for the

indicated time periods, lysed, and analyzed by western blot for (A) total phosphotyrosine; or (B)

phospho-Lyn. Blots were stripped and reprobed with control antibodies for either β-actin or α-

tubulin. Densitometric values indicate fold increase that has been corrected to account for

expression levels.

112

Occurring in parallel to the canonical mast cell activation pathway described above, the

MAPK pathway can be activated through GEF-mediated exchange of GDP for GTP with the

small GTPase Ras. Activated Ras can subsequently activate the serine/threonine kinase family

of MAPK proteins by transmitting signals to Raf and other downstream elements, leading to

eicosanoid generation and the production of cytokines (10). To address whether the absence of

drebrin affects MAPK activation, phosphorylation of Erk1/2, JNK, and p38 was monitored.

Peak phosphorylation for Erk1/2 and p38 was detected at 2 minutes post-stimulation (Fig. 5.14A

and 14C, respectively). In the case of JNK, phosphorylation reached its highest level at the 10

minute time point post-challenge (Fig. 5.14B). Phosphorylation of the MAPKs declined after

time points of peak phosphorylation as determined by densitometric analysis. No major

differences were observed between WT and drebrin-/-

BMMCs (Fig. 5.14, A-C). Collectively,

these results suggest that drebrin does not regulate mast cell effector responses via modulation of

tyrosine and serine/threonine kinase activity downstream of FcεRI triggering.

113

A)

B)

C)

Figure 5.14. MAP kinase activation following FcεRI triggering is not affected in drebrin-/-

BMMCs. BMMCs were stimulated with mouse IgE anti-DNP and DNP-HSA for the indicated

time periods, lysed, and analyzed by western blot for (A) phospho-ERK1/2; (B) phospho-JNK;

or (C) phospho-p38 expression. Blots were stripped and reprobed with control antibodies for

either β-actin. Densitometric values indicate fold increase that has been corrected to account for

expression levels.

114

Drebrin is required for Ca2+

mobilization in mast cells

As detailed previously, increases in intracellular Ca2+

concentration that are triggered

through the FcεRI by IgE-antigen complexes are necessary for the functional responses of mast

cells. To evaluate the potential that drebrin may have a role in the mobilization of Ca2+

in mast

cells, Ca2+

signals generated in WT and drebrin-/-

BMMCs upon activation of FcεRI-mediated

signaling were compared. Utilizing the calcium-sensitive dye Fluo-4, changes in intracellular

Ca2+

concentration were monitored. Upon physiological stimulation of sensitized BMMCs with

the antigen DNP-HSA, drebrin-/-

BMMCs exhibited impaired Ca2+

mobilization (Fig. 5.15A).

Importantly, diminished Ca2+

flux was more pronounced in the latter phase of Ca2+

mobilization

than in the initial response. The initial phase of Ca2+

mobilization corresponds to the depletion

of intracellular stores. This step is primarily driven by the generation of IP3 by activated PLCγ

and the subsequent binding of IP3 to IP3Rs on the surface of the ER. To investigate whether this

step was affected in the absence of drebrin, the phosphorylation of PLCγ1 in drebrin-/-

BMMCs

was monitored over a time course of 1 hour after stimulation with DNP-HSA. Based upon the

profile of phosphorylation for PLCγ1 in WT and drebrin-/-

BMMCs, activation of the signaling

enzyme peaked at 2 minutes post-antigenic challenge and remained in the active state until

approximately the 10 minute time point. In comparison to WT BMMCs, no major difference in

the level of phosphorylation of PLCγ1 for drebrin-/-

BMMCs was shown according to

densitometric analysis (Fig. 5.16). This data, therefore, implicates a role for drebrin in the latter

phase of Ca2+

mobilization. The latter phase of Ca2+

mobilization is due almost entirely to the

uptake of extracellular Ca2+

through CRAC channels. To quantitate the differences observed in

the latter phase, we determined mean intracellular Ca2+

concentration levels post-stimulation, as

well as the slope of calcium decay. Both parameters showed a significant difference in the

115

magnitude of Ca2+

mobilization in drebrin-/-

BMMCs (Fig. 5.15, B-C). In summary, these results

provide the first genetic evidence for a novel role for drebrin in the regulation of SOCE and

downstream Ca2+

-dependent mast cell effector responses.

116

Figure 5.15. Ca2+

mobilization is impaired in drebrin-/-

BMMCs. (A) BMMCs were

stimulated with mouse IgE anti-DNP IgE (1 µg/mL) and DNP-HSA (100 ng/mL) in the presence

of CaCl2 for the indicated time period, as described in the Materials and Methods section.

Intracellular Ca2+

concentration was expressed as Fluo-4 relative fluorescence, and representative

data of 3 independent experiments is shown. (B-C) Quantification of (B) mean intracellular

calcium level and (C) the slope of calcium decay post-stimulation. Data are expressed as the

mean ± SEM of triplicate experiments, performed in (A). *p<0.05 vs. WT.

117

Figure 5.16. Activation of PLCγ1 is not affected in drebrin-/-

BMMCs. BMMCs were

stimulated with mouse IgE anti-DNP and DNP-HSA for the indicated time periods, lysed, and

analyzed by western blot for phospho-PLCγ1. Blots were stripped and reprobed with control

antibodies for β-actin. Densitometric values indicate fold increase that has been corrected to

account for expression levels.

118

Discussion

Drebrin regulates the mast cell-mediated allergic response.

We demonstrate that an actin-binding protein drebrin plays a crucial role in mast cell

activation and mast cell-mediated allergic responses. Acknowledged as the central effector cell

of allergic inflammation, the mast cell is integral to the pathogenesis of IgE-associated disorders,

such as anaphylaxis and allergic asthma (2, 127). In support of this, characterization of

genetically engineered mast cell-deficient KitW

/KitW-V

or KitW-sh

/KitW-sh

mice has demonstrated

the requirement for mast cells in the IgE-mediated immediate-type allergic response. This

immediate response is prompted by degranulation of preformed mediators and synthesis of

arachidonic acid metabolites (prostaglandins, leukotrienes) and platelet-activating factor (PAF)

(128-130). The contribution of mast cells in the immediate allergic reaction has, therefore, been

well-documented. Beyond this conventional role, ample investigations have shown that mast

cells participate in delayed-type allergic responses and chronic inflammatory diseases, including

arthritis, EAE, colitis, and Chediak-Higashi syndrome (131-134). A myriad of mast cell-derived

cytokines and chemokines presumably play an important role in delayed-type allergic reactions

and chronic inflammatory diseases. Promoting this idea, experiments have shown that EAE can

be rescued in mast cell-defective KitW

/KitW-V

mice, which do not develop EAE, by the transfer

of WT BMMCs into these mice; however, transfer of IL-4-deficient BMMCs does not rescue the

defect (135). This evidence indicates that mast cell-derived cytokines are crucial determinants of

inflammatory disease.

Here, we demonstrated that drebrin-/-

mast cells had an impaired degranulation process,

as well as dysfunctional cytokine secretion. Under different activation stimuli, drebrin-/-

119

BMMCs exhibited diminished levels of degranulation. Secretion of IL-2, IL-3, IL-4, IL-13,

TNF-α, and GM-CSF by drebrin-/-

BMMCs was reduced in response to stimulation with PMA

and ionomycin. A similar trend was monitored upon FcεRI triggering with crosslinking antibody

complexes; however, no to little IL-3, IL-4, and IL-13 was detected in this scenario. In mast

cells, the production of IL-2 is controlled almost entirely at the transcriptional level (100). On

the contrary, TNF-α, IL-4, and IL-13 occur both preformed and as newly synthesized molecules

(2, 101). To decipher the molecular mechanism responsible for reduced cytokine secretion by

drebrin-/-

BMMCs, future research efforts should be invested in determining whether preformed

levels of TNF-α, IL-4, and IL-13 are reduced in drebrin-/-

BMMCs or whether de novo

transcription is modulated differently in drebrin-/-

BMMCs. This will elucidate whether the

diminished secretion of select cytokines by drebrin-/-

BMMCs is attributed to dysfunctional

transcription and ensuing translation of preformed mRNA in these cells. Based upon our

observations for IL-2 secretion by drebrin-/-

BMMCs, it is reasonable to predict that, at least,

drebrin is important for de novo transcription of cytokines whose production is stimulated by

FcεRI triggering and subsequent mast cell activation. In addition, drebrin-/-

mice were

characterized by defective histamine release upon antigenic challenge. Importantly, histamine is

derived from mast cells and basophils. Like mast cells, basophils express FcεRI on their cell

surface. Ensuing the aggregation of IgE-bound FcεRIs by multivalent antigen, basophils are

activated. Granule exocytosis and release of mediators follows (2). Because of parallel

mechanisms of activation for mast cells and basophils, basophils from drebrin-/-

mice may

potentially have diminished degranulation. In combination with decreased mast cell

degranulation, this may have exaggerated the reduction in histamine release responses observed

for drebrin-/-

mice in our study. Further investigation will need to be performed to explore this

120

possibility. It will also be important to evaluate whether the reduction in histamine release is

associated with lower numbers of drebrin-/-

skin mast cells in vivo, as shown by histology.

Nonetheless, our histological staining and TEM analysis implicates that the granule content of

drebrin-/-

mast cells is not different than that of WT mast cells. These results suggest that

histamine is stored in the cytoplasmic granules of drebrin-/-

mast cells at normal levels.

However, as determined by our in vivo assay, drebrin-/-

mast cells release histamine in lower

quantities. Our in vitro characterization of degranulation for drebrin-/-

BMMCs provides further

evidence for the concept that mast cell degranulation is compromised in the absence of drebrin.

In summary, our results implicate that the drebrin-/-

mouse will be a valuable tool for analyzing

the pathological status of a variety of immune-related diseases (134).

Yet, the incomplete impairment of effector responses of drebrin-/-

BMMCs suggests the

possibility that other molecular players may have a compensatory role for drebrin and vice-versa.

Importantly, our recent studies have indicated that BTP has off-target effects. When drebrin-/-

BMMCs were treated with the BTP derivative BTP2, already diminished levels of ionomycin-

induced degranulation were further decreased (Fig. 5.17). It is, therefore, likely that other

molecules play a part in calcium responses and are also targeted by BTP. Further exploration

should determine the existence of proteins with redundant immunomodulatory roles.

121

Figure 5.17. BTP2 inhibits ionomycin-induced degranulation of Drebrin-/-

BMMCs. β-

hexosaminidase secretion in supernatants was measured for Drebrin-/-

BMMCs that were pre-

treated with BTP2 (1 µM) or vehicle (DMSO) and then either left unstimulated or stimulated

with ionomycin (500 nM) for 1h. The β-hexosaminidase activities of the blank substrate

solutions (blank) were subtracted from the enzyme activities of the unstimulated or stimulated

cells (test). After stimulation, cells were lysed with 1% Triton-X, and the extracts were analyzed

for their β-hexosaminidase activities (total – test – blank). The percentage of β-hexosaminidase

released into each supernatant was calculated using the following formula: β-hexosaminidase

secretion (% of total) = (test – blank)/(total – blank) x 100. Data are expressed as the mean ±

SEM of 6 independent experiments.

122

Drebrin is required for FcεRI-mediated Ca2+

mobilization.

Our results revealed that drebrin is important for FcεRI-mediated degranulation and

cytokine secretion. As drebrin-/-

mice exhibited diminished levels of histamine release upon

antigenic challenge, we first examined whether drebrin-/-

mice were defective in IgE production.

Serum IgE titers were normal, indicating that IgE production was unaffected by drebrin

deficiency in these mice. We also observed normal surface expression of FcεRI on drebrin-/-

BMMCs. This observation is consistent with our results which demonstrate normal FcεRI-

induced activation of tyrosine kinases and the serine/threonine kinase family of MAPKs.

Collectively, these results led to the conclusion that phosphorylation events downstream of the

FcεRI occur normally in drebrin-/-

mast cells. Our results, however, indicate that drebrin is

involved in the regulation of Ca2+

mobilization.

FcεRI-mediated Ca2+

mobilization was impaired in drebrin-/-

BMMCs. Our previous

work has demonstrated that loss of drebrin protein expression via drebrin-specific siRNA

treatment blunts the latter phase of stimulus-induced Ca2+

mobilization, which corresponds to

extracellular Ca2+

influx, in Jurkat T cells (78). Likewise, in drebrin-/-

BMMCs, the reduction in

Ca2+

flux was more pronounced in the latter phase of Ca2+

mobilization than in the initial

response to physiological stimulus. The diminished Ca2+

response was quantitated to be

significant based upon measurements of population-based mean Ca2+

values over a time course

proceeding stimulation. The slope of calcium decay further corroborated our assessment of

impaired Ca2+

mobilization in drebrin-/-

BMMCs. We, therefore, conclude that drebrin is

selectively required for SOCE in mast cells. In line with this, western blot analysis showed that

the phosphorylation of PLCγ1 in drebrin-/-

BMMCs was unaffected. Because activation of

PLCγ1 is essential for the generation of IP3 and successive liberation of intracellular Ca2+

stores,

123

this result indicates that intracellular Ca2+

store depletion is unaffected in drebrin-/-

BMMCs.

Collectively, our analysis suggests that SOCE and downstream activation of NFAT and other

Ca2+

-dependent transcription factors are impaired in the absence of drebrin.

FcεRI-mediated Ca2+

mobilization is indispensible for degranulation (92). Because the

expression of cytokines depends upon the activation of transcription factors, such as NFAT,

which are Ca2+

-dependent, it also plays a key role in cytokine secretion. Unlike FcεRI-induced

degranulation which occurs within 5 to 30 minutes of antigen binding, the generation of

cytokines and chemokines resulting from increased gene expression takes place within the

delayed-phase of mast cell activation. This occurs 2 to 6 hours post-stimulation (129). Thus,

while both degranulation and cytokine secretion processes necessitate an increase in intracellular

Ca2+

concentration, their requirements for calcium signals may slightly differ because of their

temporal dynamics. The immediate response of degranulation may not have as stringent a

requirement for sustained elevations in intracellular Ca2+

concentration in comparison to the

delayed responses linked to cytokine production. This may resolve the discrepancies in the

degree of impairment of effector responses of drebrin-/-

BMMCs, which exhibit partial decreases

in degranulation and more marked reductions in cytokine secretion. This would fit the

hypothesis that the role of drebrin in Ca2+

mobilization is limited to SOCE.

124

CHAPTER 6

Conclusion and Future Direction

125

These studies provide strong evidence for the capacity of BTP2 and its relatives to act as

potent inhibitors of FcεRI-triggered Ca2+

mobilization. Through this mechanism of action, BTP2

can modulate the potentiation of mast cell activation and downstream effector responses. It,

therefore, holds promise as a potential therapeutic for allergies and other mast-cell mediated

diseases. Interestingly, knockout of expression of the BTP-targeted protein drebrin in our novel

genetically engineered murine model leads to unique mast cell-specific phenotypes that mimic

treatment with BTP2. Consequently, we conclude that our chemico-genetic studies identify a

functional link between the actin-binding protein drebrin and store-operated Ca2+

channels in

mast cells. We hypothesize that BTP interferes with this key interaction, which plays an integral

role in regulatory mechanisms of store-operated Ca2+

entry. Nonetheless, we understand that

careful review of our investigation can introduce caveats to our story.

As previously discussed, the incomplete impairment of effector responses of drebrin-/-

BMMCs suggests the possibility that other molecular players may have a compensatory role for

drebrin and vice-versa. The actin-binding adaptor protein Hematopoietic Progenitor Kinase 1

(HPK1)-interacting Protein of 55 kDa (HIP-55; also called drebrin-like protein, mammalian

Actin-binding protein 1 (mAbp1), and SH3P7) is a good candidate (136). HIP-55 shares

sequence homology with drebrin. In particular, like drebrin, it contains an actin-binding domain

that allows it to control the dendritic spine morphology of neurons (137). BTP interacts with this

domain in drebrin to inhibit its functional role in actin dynamics and, presumably, in Ca2+

mobilization. Importantly, our recent studies have indicated that BTP has off-target effects. As

demonstrated earlier, when drebrin-/-

BMMCs were treated with the BTP derivative BTP2,

already diminished levels of ionomycin-induced degranulation were further decreased (Fig.

5.17). It is, ergo, plausible that HIP-55 plays a part in calcium responses and is also targeted by

126

BTP. Interestingly, analogous to the phenotypes of drebrin-/-

BMMCs, T cells from HIP-55

knockout mice develop normally but display defective proliferation and decreased cytokine

production (138). To a degree, these immunomodulatory roles for HIP-55 have been attributed

to its involvement in TCR expression (138, 139). There has been confusion, however, regarding

its requirement in this process. Experiments have shown that overexpression of HIP-55 down-

regulates TCR expression (139). Nevertheless, a slight increase in TCR internalization in T cells

derived from HIP-55 knockout mice has also been reported (138). In terms of signaling, HIP-55

deficiency in T cells is linked to defective LAT and PLCγ1 phosphorylation, as well as decreased

HPK1 and JNK activation (136, 138). Unfortunately, the role of HIP-55 in SOCE has not been

evaluated. Further exploration with HIP-55 knockout mice and the generation of HIP-55/drebrin

double-knockout mice should determine if the proteins have redundant immunomodulatory roles.

Together, our previous and present findings confirm a novel role for the actin-binding

protein drebrin in the regulation of SOCE in T cells and mast cells (78). Using actin- and

microtubule-depolymerizing agents, others have firmly established a connection between

cytoskeletal rearrangement and the regulation of extracellular Ca2+

influx (50, 140, 141).

Nonetheless, the molecular details of how actin-regulating proteins, such as drebrin, participate

in the regulation of SOCE remain poorly defined. The formation of ER-PM junctions would

necessitate the coordinated effort of a myriad of proteins, ranging from cytoskeletal elements to

anchoring and targeting proteins, in order to adequately dock all of the elements involved in

SOCE. The identification of STIM1 as a microtubule-tracking molecule further advocates this

hypothesis. Recent evidence indicates that dissociation of STIM1 from the microtubule end-

binding protein 1 (EB1) is a prerequisite for the initiation of STIM1 puncta formation and the

activation of SOCE (59, 142). Nonetheless, the purpose of the association between STIM1 and

127

EB1 is not well understood. The identification of binding partners of EB1 and related protein

family members could provide leads to understanding the role of the STIM1-EB1-microtubule

complex in SOCE (59). Of interest, drebrin interacts with a related protein family member EB3.

The direct interaction between drebrin and EB3 is required for neuritogenesis (75). More

investigation is necessary to evaluate the relevance of this interaction in Ca2+

influx and the

assembly of SOCE-associated complexes and to identify possible yet undiscovered ones. On a

related note, in T cells, the actin-modulating protein WASP family member 2 (WAVE-2)

regulates store-operated channel activity. This promotes the idea that modulating the actin

cytoskeleton modulates store-operated channels and related Ca2+

influx (143). Similar to our

work with drebrin, reduction in the expression of WAVE-2 results in a selective block in Ca2+

mobilization at a point distal to PLCγ1 activation and associated IP3-mediated intracellular store

release (143). Therefore, our data, which implicates the involvement of drebrin in store-operated

channel regulation, should provide novel insight into the relationship between the actin

cytoskeleton and the activation of store-operated channels.

Drebrin may regulate extracellular Ca2+

influx by facilitating actin rearrangement that

accompanies the activation of store-operated channels following the depletion of intracellular

Ca2+

reserves. This may be mediated by formation of a macromolecular complex at the IP3R

where drebrin could interact with Homer adaptor proteins, which have been shown to bind both

IP3R and drebrin, as well as the TRPC family of ion-channels (144, 145). Drebrin has recently

been shown to exist in a complex and co-immunoprecipitate with TRPC5 and TRPC6 (146).

Both TRPC5 and TRPC6 are Ca2+

-permeable non-selective cation channels (147, 148).

Interestingly, it has been reported that BTP2 facilitates the activity of TRPM4. As a result, Ca2+

influx and cytokine production are inhibited in BTP2-treated lymphocytes (82). In BMMCs

128

from TRPM4-/-

mice, antigen stimulation leads to more Ca2+

entry as a result of a lack of control

on the driving force for Ca2+

influx. Consequently, the degranulation of TRPM4-/-

BMMCs is

augmented. They release more histamine, leukotrienes, and TNF (149). However, BMMCs

from TRPM4-/-

mice show defects in the highly Ca2+

-dependent process of migration. Shimizu

et al. conclude that TRPM4 controls this process by setting the threshold for Ca2+

-dependent

actin cytoskeleton rearrangements upon FcεRI aggregation (150). It will be intriguing to check

whether TRPM4 activity is affected in drebrin-/-

BMMCs. By recruiting drebrin to such

complexes, the associated actin structure could be induced to rearrange, thereby regulating store-

operated channel function.

We propose a role for drebrin in a revised version of the conformational coupling model.

In our model, when intracellular Ca2+

stores are full, drebrin participates in a macromolecular

complex at the IP3R where it associates with Homer adaptor proteins. Drebrin is tethered to the

IP3R via interaction with Homer. In this state, drebrin is sequestered within the cytoplasmic

space. Simultaneously, STIM1 is associated with EB1 and travels through the ER constantly

(Fig. 6.1). Following store depletion, a conformational change in STIM1 induces its dissociation

from EB1 and the initiation of puncta formation. EB1 and related family members, then, bind to

drebrin. EB proteins direct ER microtubule protrusions toward cortical sites, where drebrin

reorganizes cortical actin promoting the juxtaposition of the ER with the PM. The

rearrangement of actin allows for STIM1 to interact with Orai1 and consequently stimulates Ca2+

influx. Coincidently, in conjunction with STIM1, drebrin drives the fusion of tubular cargos,

containing the TRPC family of ion channels, into lipid raft domains at the PM, where they insert

and activate Ca2+

influx. The IP3R-associated complex participates in the controlled insertion of

TRPC channels into lipid rafts. Drebrin specifically promotes the formation of new cytoskeletal

129

structures that act as physical forces involved in the relocation of TRPC channels into the lipid

raft domains of the PM (Fig. 6.1). In support of this, pharmacological studies have shown that

nocodazole, a microtubule-depolymerizing agent, prevents the triggering of SOCE (151).

Moreover, recent evidence has shown that STIM1 co-immunoprecipitates with Orai1 and TRPC1

(59). In activated mast cells, STIM1 forms puncta associated with microtubules in protrusions

(152). Recent studies also demonstrate that STIM1 governs the insertion of TRPC1 into lipid

raft domains at the PM (153). BTP may inhibit the function of drebrin in this process by either

blocking the interaction between drebrin and this complex or blocking the ability of drebrin to

induce cytoskeletal changes. In summary, this model proposes a critical role for drebrin in

protein anchoring and transport during the assembly of a store-operated Ca2+

influx-associated

complex at the ER-PM junction.

130

Figure 6.1. Model for the involvement of drebrin in store-operated Ca2+

entry. When

intracellular Ca2+

stores are filled, drebrin is tethered to the IP3R via interaction with Homer.

Upon store depletion, EB1 proteins and related family members interact with drebrin and direct

it to the PM, where it reorganizes cortical actin to facilitate the juxtaposition of the ER with the

PM. This promotes the interaction between STIM1 and Orai1 and the insertion of TRPC

channels into the lipid raft domains of the PM, thereby activating Ca2+

influx.

131

Further research dissecting macromolecular complexes in which drebrin participates will

lead to a better understanding of the mechanisms regulating store-operated channel function in

mast cells. Most importantly, it will illuminate the “big picture” of the sophisticated and highly

regulated Ca2+

-dependent mechanisms governing mast cell activation and allergic responses.

In consideration of the role of drebrin in the highly conserved mechanism of SOCE

activation, characterization of the development, activation, and function of other immune cell

populations in the drebrin-/-

mouse will provide general insights into signal transduction, immune

cell function, and mechanisms that contribute to inflammatory disorders and autoimmunity. For

the long term, it will provide a stronger basis for the targeting of drebrin in the design of

pharmaceuticals for immune-related disease.

132

BIBLIOGRAPHY

1. Beaven, M. A. 2009. Our perception of the mast cell from Paul Ehrlich to now. Eur. J.

Immunol. 39: 11-25.

2. Stone, K. D., C. Prussin, and D. D. Metcalfe. 2010. IgE, mast cells, basophils, and eosinophils.

J. Allergy Clin. Immunol. 125: S73-80.

3. Weller, C. L., S. J. Collington, T. Williams, and J. R. Lamb. 2011. Mast cells in health and

disease. Clin. Sci. (Lond) 120: 473-484.

4. Reuter, S., M. Stassen, and C. Taube. 2010. Mast cells in allergic asthma and beyond. Yonsei

Med. J. 51: 797-807.

5. Hu, Z. Q., W. H. Zhao, and T. Shimamura. 2007. Regulation of mast cell development by

inflammatory factors. Curr. Med. Chem. 14: 3044-3050.

6. Wright, H. V., D. Bailey, M. Kashyap, C. L. Kepley, M. S. Drutskaya, S. A. Nedospasov, and

J. J. Ryan. 2006. IL-3-mediated TNF production is necessary for mast cell development. J.

Immunol. 176: 2114-2121.

7. Patella, V., A. Giuliano, J. P. Bouvet, and G. Marone. 1998. Endogenous superallergen protein

Fv induces IL-4 secretion from human Fc epsilon RI+ cells through interaction with the VH3

region of IgE. J. Immunol. 161: 5647-5655.

8. Pandey, V., S. Mihara, A. Fensome-Green, S. Bolsover, and S. Cockcroft. 2004. Monomeric

IgE stimulates NFAT translocation into the nucleus, a rise in cytosol Ca2+, degranulation, and

membrane ruffling in the cultured rat basophilic leukemia-2H3 mast cell line. J. Immunol. 172:

4048-4058.

9. Kalesnikoff, J., M. Huber, V. Lam, J. E. Damen, J. Zhang, R. P. Siraganian, and G. Krystal.

2001. Monomeric IgE stimulates signaling pathways in mast cells that lead to cytokine

production and cell survival. Immunity 14: 801-811.

10. Gilfillan, A. M. and C. Tkaczyk. 2006. Integrated signalling pathways for mast-cell

activation. Nat. Rev. Immunol. 6: 218-230.

11. Gilfillan, A. M. and J. Rivera. 2009. The tyrosine kinase network regulating mast cell

activation. Immunol. Rev. 228: 149-169.

12. Metcalfe, D. D., R. D. Peavy, and A. M. Gilfillan. 2009. Mechanisms of mast cell signaling

in anaphylaxis. J. Allergy Clin. Immunol. 124: 639-46; quiz 647-8.

133

13. Wilson, B. S., J. R. Pfeiffer, and J. M. Oliver. 2002. FcepsilonRI signaling observed from the

inside of the mast cell membrane. Mol. Immunol. 38: 1259-1268.

14. Marcum, J. A., J. B. McKenney, S. J. Galli, R. W. Jackman, and R. D. Rosenberg. 1986.

Anticoagulantly active heparin-like molecules from mast cell-deficient mice. Am. J. Physiol.

250: H879-88.

15. Nader, H. B., S. F. Chavante, E. A. dos-Santos, T. W. Oliveira, J. F. de-Paiva, S. M.

Jeronimo, G. F. Medeiros, L. R. de-Abreu, E. L. Leite, J. F. de-Sousa-Filho, R. A. Castro, L.

Toma, I. L. Tersariol, M. A. Porcionatto, and C. P. Dietrich. 1999. Heparan sulfates and

heparins: similar compounds performing the same functions in vertebrates and invertebrates?

Braz. J. Med. Biol. Res. 32: 529-538.

16. Minai-Fleminger, Y. and F. Levi-Schaffer. 2009. Mast cells and eosinophils: the two key

effector cells in allergic inflammation. Inflamm. Res. 58: 631-638.

17. Hamid, Q. and M. Tulic. 2009. Immunobiology of asthma. Annu. Rev. Physiol. 71: 489-507.

18. Galli, S. J., M. Tsai, and A. M. Piliponsky. 2008. The development of allergic inflammation.

Nature 454: 445-454.

19. Hofmann, A. M. and S. N. Abraham. 2009. New roles for mast cells in modulating allergic

reactions and immunity against pathogens. Curr. Opin. Immunol. 21: 679-686.

20. Kumar, V. and A. Sharma. 2010. Mast cells: emerging sentinel innate immune cells with

diverse role in immunity. Mol. Immunol. 48: 14-25.

21. von Kockritz-Blickwede, M. and V. Nizet. 2009. Innate immunity turned inside-out:

antimicrobial defense by phagocyte extracellular traps. J. Mol. Med. 87: 775-783.

22. von Kockritz-Blickwede, M., O. Goldmann, P. Thulin, K. Heinemann, A. Norrby-Teglund,

M. Rohde, and E. Medina. 2008. Phagocytosis-independent antimicrobial activity of mast cells

by means of extracellular trap formation. Blood 111: 3070-3080.

23. Benoist, C. and D. Mathis. 2002. Mast cells in autoimmune disease. Nature 420: 875-878.

24. Christy, A. L. and M. A. Brown. 2007. The multitasking mast cell: positive and negative

roles in the progression of autoimmunity. J. Immunol. 179: 2673-2679.

25. Hogan, P. G. and A. Rao. 2007. Dissecting ICRAC, a store-operated calcium current. Trends

in Biochemical Sciences 32: 235-45.

26. Parekh, A. B. 2010. Store-operated CRAC channels: function in health and disease. Nat. Rev.

Drug Discov. 9: 399-410.

134

27. Baba, Y. and T. Kurosaki. 2009. Physiological function and molecular basis of STIM1-

mediated calcium entry in immune cells. Immunol. Rev. 231: 174-188.

28. Feske, S. 2007. Calcium signalling in lymphocyte activation and disease. Nature Reviews 7:

690-702.

29. Gwack, Y., S. Feske, S. Srikanth, P. G. Hogan, and A. Rao. 2007. Signalling to transcription:

store-operated Ca2+ entry and NFAT activation in lymphocytes. Cell Calcium 42: 145-56.

30. Di Capite, J. and A. B. Parekh. 2009. CRAC channels and Ca2+ signaling in mast cells.

Immunol. Rev. 231: 45-58.

31. Scharenberg, A. M. and J. P. Kinet. 1998. PtdIns-3,4,5-P3: a regulatory nexus between

tyrosine kinases and sustained calcium signals. Cell 94: 5-8.

32. Turner, H. and J. P. Kinet. 1999. Signalling through the high-affinity IgE receptor Fc

epsilonRI. Nature 402: B24-30.

33. Hogan, P. G., R. S. Lewis, and A. Rao. 2010. Molecular basis of calcium signaling in

lymphocytes: STIM and ORAI. Annu. Rev. Immunol. 28: 491-533.

34. Hewavitharana, T., X. Deng, J. Soboloff, and D. L. Gill. 2007. Role of STIM and Orai

proteins in the store-operated calcium signaling pathway. Cell Calcium 42: 173-82.

35. Varnai, P., B. Toth, D. J. Toth, L. Hunyady, and T. Balla. 2007. Visualization and

manipulation of plasma membrane-endoplasmic reticulum contact sites indicates the presence of

additional molecular components within the STIM1-Orai1 Complex. J. Biol. Chem. 282: 29678-

29690.

36. Yuan, J. P., W. Zeng, G. N. Huang, P. F. Worley, and S. Muallem. 2007. STIM1

heteromultimerizes TRPC channels to determine their function as store-operated channels. Nat.

Cell Biol. 9: 636-645.

37. Worley, P. F., W. Zeng, G. N. Huang, J. P. Yuan, J. Y. Kim, M. G. Lee, and S. Muallem.

2007. TRPC channels as STIM1-regulated store-operated channels. Cell Calcium 42: 205-211.

38. Huang, G. N., W. Zeng, J. Y. Kim, J. P. Yuan, L. Han, S. Muallem, and P. F. Worley. 2006.

STIM1 carboxyl-terminus activates native SOC, I(crac) and TRPC1 channels. Nat. Cell Biol. 8:

1003-1010.

39. Baba, Y., K. Nishida, Y. Fujii, T. Hirano, M. Hikida, and T. Kurosaki. 2008. Essential

function for the calcium sensor STIM1 in mast cell activation and anaphylactic responses. Nat.

Immunol. 9: 81-88.

135

40. Vig, M., W. I. DeHaven, G. S. Bird, J. M. Billingsley, H. Wang, P. E. Rao, A. B. Hutchings,

M. H. Jouvin, J. W. Putney, and J. P. Kinet. 2008. Defective mast cell effector functions in mice

lacking the CRACM1 pore subunit of store-operated calcium release-activated calcium channels.

Nature Immunology 9: 89-96.

41. Parekh, A. B. 2006. On the activation mechanism of store-operated calcium channels.

Pflugers Arch 453: 303-11.

42. Rosado, J. A., P. C. Redondo, S. O. Sage, J. A. Pariente, and G. M. Salido. 2005. Store-

operated Ca2+ entry: vesicle fusion or reversible trafficking and de novo conformational

coupling? Journal of Cellular Physiology 205: 262-9.

43. Parekh, A. B. and R. Penner. 1997. Store depletion and calcium influx. Physiological

Reviews 77: 901-30.

44. Randriamampita, C. and R. Y. Tsien. 1993. Emptying of intracellular Ca2+ stores releases a

novel small messenger that stimulates Ca2+ influx. Nature 364: 809-14.

45. Vig, M. and J. P. Kinet. 2007. The long and arduous road to CRAC. Cell Calcium 42: 157-

62.

46. Yao, Y., A. V. Ferrer-Montiel, M. Montal, and R. Y. Tsien. 1999. Activation of store-

operated Ca2+ current in Xenopus oocytes requires SNAP-25 but not a diffusible messenger.

Cell 98: 475-85.

47. Fasolato, C., M. Hoth, and R. Penner. 1993. A GTP-dependent step in the activation

mechanism of capacitative calcium influx. The Journal of Biological Chemistry 268: 20737-40.

48. Berridge, M. J. 1995. Capacitative calcium entry. The Biochemical Journal 312 ( Pt 1): 1-11.

49. Irvine, R. F. 1990. 'Quantal' Ca2+ release and the control of Ca2+ entry by inositol

phosphates--a possible mechanism. FEBS Letters 263: 5-9.

50. Patterson, R. L., D. B. van Rossum, and D. L. Gill. 1999. Store-operated Ca2+ entry:

evidence for a secretion-like coupling model. Cell 98: 487-499.

51. Rosado, J. A., S. Jenner, and S. O. Sage. 2000. A role for the actin cytoskeleton in the

initiation and maintenance of store-mediated calcium entry in human platelets. Evidence for

conformational coupling. The Journal of Biological Chemistry 275: 7527-33.

52. Rosado, J. A. and S. O. Sage. 2000. Coupling between inositol 1,4,5-trisphosphate receptors

and human transient receptor potential channel 1 when intracellular Ca2+ stores are depleted.

The Biochemical Journal 350 Pt 3: 631-5.

136

53. Janmey, P. A., K. Iida, H. L. Yin, and T. P. Stossel. 1987. Polyphosphoinositide micelles and

polyphosphoinositide-containing vesicles dissociate endogenous gelsolin-actin complexes and

promote actin assembly from the fast-growing end of actin filaments blocked by gelsolin. J. Biol.

Chem. 262: 12228-12236.

54. Janmey, P. A. and T. P. Stossel. 1987. Modulation of gelsolin function by

phosphatidylinositol 4,5-bisphosphate. Nature 325: 362-364.

55. Lassing, I. and U. Lindberg. 1988. Specificity of the interaction between phosphatidylinositol

4,5-bisphosphate and the profilin:actin complex. J. Cell. Biochem. 37: 255-267.

56. Rosenberg, S., A. Stracher, and K. Burridge. 1981. Isolation and characterization of a

calcium-sensitive alpha-actinin-like protein from human platelet cytoskeletons. J. Biol. Chem.

256: 12986-12991.

57. Burridge, K. and J. R. Feramisco. 1981. Non-muscle alpha actinins are calcium-sensitive

actin-binding proteins. Nature 294: 565-567.

58. Gilbert, S. H., K. Perry, and F. S. Fay. 1994. Mediation of chemoattractant-induced changes

in [Ca2+]i and cell shape, polarity, and locomotion by InsP3, DAG, and protein kinase C in newt

eosinophils. J. Cell Biol. 127: 489-503.

59. Vaca, L. 2010. SOCIC: the store-operated calcium influx complex. Cell Calcium 47: 199-

209.

60. Pivniouk, V. I., S. B. Snapper, A. Kettner, H. Alenius, D. Laouini, H. Falet, J. Hartwig, F. W.

Alt, and R. S. Geha. 2003. Impaired signaling via the high-affinity IgE receptor in Wiskott-

Aldrich syndrome protein-deficient mast cells. Int. Immunol. 15: 1431-1440.

61. Majoul, I., T. Shirao, Y. Sekino, and R. Duden. 2007. Many faces of drebrin: from building

dendritic spines and stabilizing gap junctions to shaping neurite-like cell processes.

Histochemistry and Cell Biology 127: 355-61.

62. Xu, W. and M. Stamnes. 2006. The actin-depolymerizing factor homology and

charged/helical domains of drebrin and mAbp1 direct membrane binding and localization via

distinct interactions with actin. J. Biol. Chem. 281: 11826-11833.

63. Hayashi, K., R. Ishikawa, R. Kawai-Hirai, T. Takagi, A. Taketomi, and T. Shirao. 1999.

Domain analysis of the actin-binding and actin-remodeling activities of drebrin. Experimental

Cell Research 253: 673-80.

64. Hayashi, K. and T. Shirao. 1999. Change in the shape of dendritic spines caused by

overexpression of drebrin in cultured cortical neurons. J Neurosci 19: 3918-25.

137

65. Ishikawa, R., K. Hayashi, T. Shirao, Y. Xue, T. Takagi, Y. Sasaki, and K. Kohama. 1994.

Drebrin, a development-associated brain protein from rat embryo, causes the dissociation of

tropomyosin from actin filaments. The Journal of Biological Chemistry 269: 29928-33.

66. Sasaki, Y., K. Hayashi, T. Shirao, R. Ishikawa, and K. Kohama. 1996. Inhibition by drebrin

of the actin-bundling activity of brain fascin, a protein localized in filopodia of growth cones.

Journal of Neurochemistry 66: 980-8.

67. Shirao, T., K. Hayashi, R. Ishikawa, K. Isa, H. Asada, K. Ikeda, and K. Uyemura. 1994.

Formation of thick, curving bundles of actin by drebrin A expressed in fibroblasts. Experimental

Cell Research 215: 145-53.

68. Takahashi, H., Y. Sekino, S. Tanaka, T. Mizui, S. Kishi, and T. Shirao. 2003. Drebrin-

dependent actin clustering in dendritic filopodia governs synaptic targeting of postsynaptic

density-95 and dendritic spine morphogenesis. J Neurosci 23: 6586-95.

69. Toda, M., T. Shirao, and K. Uyemura. 1999. Suppression of an actin-binding protein,

drebrin, by antisense transfection attenuates neurite outgrowth in neuroblastoma B104 cells.

Brain Research 114: 193-200.

70. Sekino, Y., N. Kojima, and T. Shirao. 2007. Role of actin cytoskeleton in dendritic spine

morphogenesis. Neurochemistry International 51: 92-104.

71. Mizui, T., H. Takahashi, Y. Sekino, and T. Shirao. 2005. Overexpression of drebrin A in

immature neurons induces the accumulation of F-actin and PSD-95 into dendritic filopodia, and

the formation of large abnormal protrusions. Molecular and Cellular Neurosciences 30: 630-8.

72. Biou, V., H. Brinkhaus, R. C. Malenka, and A. Matus. 2008. Interactions between drebrin

and Ras regulate dendritic spine plasticity. Eur. J. Neurosci. 27: 2847-2859.

73. Kojima, N. and T. Shirao. 2007. Synaptic dysfunction and disruption of postsynaptic drebrin-

actin complex: a study of neurological disorders accompanied by cognitive deficits.

Neuroscience Research 58: 1-5.

74. Kojima, N., K. Hanamura, H. Yamazaki, T. Ikeda, S. Itohara, and T. Shirao. 2010. Genetic

disruption of the alternative splicing of drebrin gene impairs context-dependent fear learning in

adulthood. Neuroscience 165: 138-150.

75. Geraldo, S., U. K. Khanzada, M. Parsons, J. K. Chilton, and P. R. Gordon-Weeks. 2008.

Targeting of the F-actin-binding protein drebrin by the microtubule plus-tip protein EB3 is

required for neuritogenesis. Nat. Cell Biol. 10: 1181-1189.

76. Butkevich, E., S. Hulsmann, D. Wenzel, T. Shirao, R. Duden, and I. Majoul. 2004. Drebrin is

a novel connexin-43 binding partner that links gap junctions to the submembrane cytoskeleton.

Curr Biol 14: 650-8.

138

77. Giepmans, B. N. 2006. Role of connexin43-interacting proteins at gap junctions. Advances in

Cardiology 42: 41-56.

78. Mercer, J. C., Q. Qi, L. F. Mottram, M. Law, D. Bruce, A. Iyer, J. L. Morales, H. Yamazaki,

T. Shirao, B. R. Peterson, and A. August. 2010. Chemico-genetic identification of drebrin as a

regulator of calcium responses. Int. J. Biochem. Cell Biol. 42: 337-345.

79. Ishikawa, J., K. Ohga, T. Yoshino, R. Takezawa, A. Ichikawa, H. Kubota, and T. Yamada.

2003. A pyrazole derivative, YM-58483, potently inhibits store-operated sustained Ca2+ influx

and IL-2 production in T lymphocytes. J. Immunol. 170: 4441-4449.

80. Zitt, C., B. Strauss, E. C. Schwarz, N. Spaeth, G. Rast, A. Hatzelmann, and M. Hoth. 2004.

Potent inhibition of Ca2+ release-activated Ca2+ channels and T-lymphocyte activation by the

pyrazole derivative BTP2. The Journal of Biological Chemistry 279: 12427-37.

81. Steinckwich, N., J. P. Frippiat, M. J. Stasia, M. Erard, R. Boxio, C. Tankosic, I. Doignon,

and O. Nusse. 2007. Potent inhibition of store-operated Ca2+ influx and superoxide production

in HL60 cells and polymorphonuclear neutrophils by the pyrazole derivative BTP2. Journal of

Leukocyte Biology 81: 1054-64.

82. Takezawa, R., H. Cheng, A. Beck, J. Ishikawa, P. Launay, H. Kubota, J. P. Kinet, A. Fleig,

T. Yamada, and R. Penner. 2006. A pyrazole derivative potently inhibits lymphocyte Ca2+

influx and cytokine production by facilitating transient receptor potential melastatin 4 channel

activity. Mol. Pharmacol. 69: 1413-1420.

83. He, L. P., T. Hewavitharana, J. Soboloff, M. A. Spassova, and D. L. Gill. 2005. A functional

link between store-operated and TRPC channels revealed by the 3,5-bis(trifluoromethyl)pyrazole

derivative, BTP2. The Journal of Biological Chemistry 280: 10997-1006.

84. Ohga, K., R. Takezawa, T. Yoshino, T. Yamada, Y. Shimizu, and J. Ishikawa. 2008. The

suppressive effects of YM-58483/BTP-2, a store-operated Ca2+ entry blocker, on inflammatory

mediator release in vitro and airway responses in vivo. Pulm. Pharmacol. Ther. 21: 360-369.

85. Yoshino, T., J. Ishikawa, K. Ohga, T. Morokata, R. Takezawa, H. Morio, Y. Okada, K.

Honda, and T. Yamada. 2007. YM-58483, a selective CRAC channel inhibitor, prevents antigen-

induced airway eosinophilia and late phase asthmatic responses via Th2 cytokine inhibition in

animal models. European Journal of Pharmacology 560: 225-33.

86. Iyer, A. S. and A. August. 2008. The Tec family kinase, IL-2-inducible T cell kinase,

differentially controls mast cell responses. J. Immunol. 180: 7869-7877.

87. Djuric, S. W., N. Y. BaMaung, A. Basha, H. Liu, J. R. Luly, D. J. Madar, R. J. Sciotti, N. P.

Tu, F. L. Wagenaar, P. E. Wiedeman, X. Zhou, S. Ballaron, J. Bauch, Y. W. Chen, X. G. Chiou,

T. Fey, D. Gauvin, E. Gubbins, G. C. Hsieh, K. C. Marsh, K. W. Mollison, M. Pong, T. K.

Shaughnessy, M. P. Sheets, M. Smith, J. M. Trevillyan, U. Warrior, C. D. Wegner, and G. W.

139

Carter. 2000. 3,5-Bis(trifluoromethyl)pyrazoles: a novel class of NFAT transcription factor

regulator. J. Med. Chem. 43: 2975-2981.

88. Demo, S. D., E. Masuda, A. B. Rossi, B. T. Throndset, A. L. Gerard, E. H. Chan, R. J.

Armstrong, B. P. Fox, J. B. Lorens, D. G. Payan, R. H. Scheller, and J. M. Fisher. 1999.

Quantitative measurement of mast cell degranulation using a novel flow cytometric annexin-V

binding assay. Cytometry 36: 340-348.

89. Gertler, R. and I. Pecht. 1988. Ionic signalling in mast cells; antigen and ionophore induced

changes in cytosolic pH. Mol. Immunol. 25: 1087-1092.

90. Gomperts, B. D., S. Cockcroft, J. P. Bennett, and C. M. Fewtrell. 1980. Early events in the

activation of Ca2+ dependent secretion: studies with rat peritoneal mast cells. J. Physiol. (Paris)

76: 383-393.

91. Plaut, M., J. H. Pierce, C. J. Watson, J. Hanley-Hyde, R. P. Nordan, and W. E. Paul. 1989.

Mast cell lines produce lymphokines in response to cross-linkage of Fc epsilon RI or to calcium

ionophores. Nature 339: 64-67.

92. Melicoff, E., L. Sansores-Garcia, A. Gomez, D. C. Moreira, P. Datta, P. Thakur, Y. Petrova,

T. Siddiqi, J. N. Murthy, B. F. Dickey, R. Heidelberger, and R. Adachi. 2009. Synaptotagmin-2

controls regulated exocytosis but not other secretory responses of mast cells. J. Biol. Chem. 284:

19445-19451.

93. Trevillyan, J. M., X. G. Chiou, Y. W. Chen, S. J. Ballaron, M. P. Sheets, M. L. Smith, P. E.

Wiedeman, U. Warrior, J. Wilkins, E. J. Gubbins, G. D. Gagne, J. Fagerland, G. W. Carter, J. R.

Luly, K. W. Mollison, and S. W. Djuric. 2001. Potent inhibition of NFAT activation and T cell

cytokine production by novel low molecular weight pyrazole compounds. The Journal of

Biological Chemistry 276: 48118-26.

94. Bert, A. G., B. V. Johnson, E. W. Baxter, and P. N. Cockerill. 2007. A modular enhancer is

differentially regulated by GATA and NFAT elements that direct different tissue-specific

patterns of nucleosome positioning and inducible chromatin remodeling. Mol. Cell. Biol. 27:

2870-2885.

95. Monticelli, S., D. U. Lee, J. Nardone, D. L. Bolton, and A. Rao. 2005. Chromatin-based

regulation of cytokine transcription in Th2 cells and mast cells. Int. Immunol. 17: 1513-1524.

96. Monticelli, S., D. C. Solymar, and A. Rao. 2004. Role of NFAT proteins in IL13 gene

transcription in mast cells. J. Biol. Chem. 279: 36210-36218.

97. Solymar, D. C., S. Agarwal, C. H. Bassing, F. W. Alt, and A. Rao. 2002. A 3' enhancer in the

IL-4 gene regulates cytokine production by Th2 cells and mast cells. Immunity 17: 41-50.

140

98. De Boer, M. L., V. A. Mordvinov, M. A. Thomas, and C. J. Sanderson. 1999. Role of nuclear

factor of activated T cells (NFAT) in the expression of interleukin-5 and other cytokines

involved in the regulation of hemopoetic cells. Int. J. Biochem. Cell Biol. 31: 1221-1236.

99. Savignac, M., B. Mellstrom, and J. R. Naranjo. 2007. Calcium-dependent transcription of

cytokine genes in T lymphocytes. Pflugers Arch. 454: 523-533.

100. Jain, J., C. Loh, and A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin.

Immunol. 7: 333-342.

101. Gessner, A., K. Mohrs, and M. Mohrs. 2005. Mast cells, basophils, and eosinophils acquire

constitutive IL-4 and IL-13 transcripts during lineage differentiation that are sufficient for rapid

cytokine production. J. Immunol. 174: 1063-1072.

102. Di Capite, J. and A. B. Parekh. 2009. CRAC channels and Ca2+ signaling in mast cells.

Immunol. Rev. 231: 45-58.

103. Klein, M., S. Klein-Hessling, A. Palmetshofer, E. Serfling, C. Tertilt, T. Bopp, V. Heib, M.

Becker, C. Taube, H. Schild, E. Schmitt, and M. Stassen. 2006. Specific and redundant roles for

NFAT transcription factors in the expression of mast cell-derived cytokines. J. Immunol. 177:

6667-6674.

104. Braun, F. J., O. Aziz, and J. W. Putney Jr. 2003. 2-Aminoethoxydiphenyl Borane Activates

a Novel Calcium-Permeable Cation Channel. Mol. Pharmacol. 63: 1304-1311.

105. Chung, S. C., T. V. McDonald, and P. Gardner. 1994. Inhibition by SK&F 96365 of Ca2+

current, IL-2 production and activation in T lymphocytes. Br. J. Pharmacol. 113: 861-868.

106. Franzius, D., M. Hoth, and R. Penner. 1994. Non-specific effects of calcium entry

antagonists in mast cells. Pflugers Arch. 428: 433-438.

107. Ma, H. T., K. Venkatachalam, J. B. Parys, and D. L. Gill. 2002. Modification of store-

operated channel coupling and inositol trisphosphate receptor function by 2-

aminoethoxydiphenyl borate in DT40 lymphocytes. J. Biol. Chem. 277: 6915-6922.

108. Peppiatt, C. M., T. J. Collins, L. Mackenzie, S. J. Conway, A. B. Holmes, M. D. Bootman,

M. J. Berridge, J. T. Seo, and H. L. Roderick. 2003. 2-Aminoethoxydiphenyl borate (2-APB)

antagonises inositol 1,4,5-trisphosphate-induced calcium release, inhibits calcium pumps and has

a use-dependent and slowly reversible action on store-operated calcium entry channels. Cell

Calcium 34: 97-108.

109. Prakriya, M. and R. S. Lewis. 2001. Potentiation and inhibition of Ca(2+) release-activated

Ca(2+) channels by 2-aminoethyldiphenyl borate (2-APB) occurs independently of IP(3)

receptors. J. Physiol. 536: 3-19.

141

110. Schindl, R., H. Kahr, I. Graz, K. Groschner, and C. Romanin. 2002. Store depletion-

activated CaT1 currents in rat basophilic leukemia mast cells are inhibited by 2-

aminoethoxydiphenyl borate. Evidence for a regulatory component that controls activation of

both CaT1 and CRAC (Ca(2+) release-activated Ca(2+) channel) channels. J. Biol. Chem. 277:

26950-26958.

111. Wu, J., N. Kamimura, T. Takeo, S. Suga, M. Wakui, T. Maruyama, and K. Mikoshiba.

2000. 2-Aminoethoxydiphenyl borate modulates kinetics of intracellular Ca(2+) signals mediated

by inositol 1,4,5-trisphosphate-sensitive Ca(2+) stores in single pancreatic acinar cells of mouse.

Mol. Pharmacol. 58: 1368-1374.

112. Kiyonaka, S., K. Kato, M. Nishida, K. Mio, T. Numaga, Y. Sawaguchi, T. Yoshida, M.

Wakamori, E. Mori, T. Numata, M. Ishii, H. Takemoto, A. Ojida, K. Watanabe, A. Uemura, H.

Kurose, T. Morii, T. Kobayashi, Y. Sato, C. Sato, I. Hamachi, and Y. Mori. 2009. Selective and

direct inhibition of TRPC3 channels underlies biological activities of a pyrazole compound.

Proc. Natl. Acad. Sci. U. S. A. 106: 5400-5405.

113. Stanford, W. L., J. B. Cohn, and S. P. Cordes. 2001. Gene-trap mutagenesis: past, present

and beyond. Nat. Rev. Genet. 2: 756-768.

114. Zambrowicz, B. P., A. Abuin, R. Ramirez-Solis, L. J. Richter, J. Piggott, H. BeltrandelRio,

E. C. Buxton, J. Edwards, R. A. Finch, C. J. Friddle, A. Gupta, G. Hansen, Y. Hu, W. Huang, C.

Jaing, B. W. Key Jr, P. Kipp, B. Kohlhauff, Z. Q. Ma, D. Markesich, R. Payne, D. G. Potter, N.

Qian, J. Shaw, J. Schrick, Z. Z. Shi, M. J. Sparks, I. Van Sligtenhorst, P. Vogel, W. Walke, N.

Xu, Q. Zhu, C. Person, and A. T. Sands. 2003. Wnk1 kinase deficiency lowers blood pressure in

mice: a gene-trap screen to identify potential targets for therapeutic intervention. Proc. Natl.

Acad. Sci. U. S. A. 100: 14109-14114.

115. Gurish, M. F., N. Ghildyal, H. P. McNeil, K. F. Austen, S. Gillis, and R. L. Stevens. 1992.

Differential expression of secretory granule proteases in mouse mast cells exposed to interleukin

3 and c-kit ligand. J. Exp. Med. 175: 1003-1012.

116. Ihle, J. N., J. Keller, S. Oroszlan, L. E. Henderson, T. D. Copeland, F. Fitch, M. B.

Prystowsky, E. Goldwasser, J. W. Schrader, E. Palaszynski, M. Dy, and B. Lebel. 1983. Biologic

properties of homogeneous interleukin 3. I. Demonstration of WEHI-3 growth factor activity,

mast cell growth factor activity, p cell-stimulating factor activity, colony-stimulating factor

activity, and histamine-producing cell-stimulating factor activity. J. Immunol. 131: 282-287.

117. Yuan, Q., M. F. Gurish, D. S. Friend, K. F. Austen, and J. A. Boyce. 1998. Generation of a

novel stem cell factor-dependent mast cell progenitor. J. Immunol. 161: 5143-5146.

118. Gondokaryono, S. P., H. Ushio, F. Niyonsaba, M. Hara, H. Takenaka, S. T. Jayawardana, S.

Ikeda, K. Okumura, and H. Ogawa. 2007. The extra domain A of fibronectin stimulates murine

mast cells via toll-like receptor 4. J. Leukoc. Biol. 82: 657-665.

142

119. Naal, R. M., J. Tabb, D. Holowka, and B. Baird. 2004. In situ measurement of

degranulation as a biosensor based on RBL-2H3 mast cells. Biosens. Bioelectron. 20: 791-796.

120. Yamashita, Y., N. Charles, Y. Furumoto, S. Odom, T. Yamashita, A. M. Gilfillan, S.

Constant, M. A. Bower, J. J. Ryan, and J. Rivera. 2007. Cutting edge: genetic variation

influences Fc epsilonRI-induced mast cell activation and allergic responses. J. Immunol. 179:

740-743.

121. Odom, S., G. Gomez, M. Kovarova, Y. Furumoto, J. J. Ryan, H. V. Wright, C. Gonzalez-

Espinosa, M. L. Hibbs, K. W. Harder, and J. Rivera. 2004. Negative regulation of

immunoglobulin E-dependent allergic responses by Lyn kinase. J. Exp. Med. 199: 1491-1502.

122. Nishizumi, H. and T. Yamamoto. 1997. Impaired tyrosine phosphorylation and Ca2+

mobilization, but not degranulation, in lyn-deficient bone marrow-derived mast cells. J.

Immunol. 158: 2350-2355.

123. Kawakami, Y., J. Kitaura, A. B. Satterthwaite, R. M. Kato, K. Asai, S. E. Hartman, M.

Maeda-Yamamoto, C. A. Lowell, D. J. Rawlings, O. N. Witte, and T. Kawakami. 2000.

Redundant and opposing functions of two tyrosine kinases, Btk and Lyn, in mast cell activation.

J. Immunol. 165: 1210-1219.

124. Parravicini, V., M. Gadina, M. Kovarova, S. Odom, C. Gonzalez-Espinosa, Y. Furumoto, S.

Saitoh, L. E. Samelson, J. J. O'Shea, and J. Rivera. 2002. Fyn kinase initiates complementary

signals required for IgE-dependent mast cell degranulation. Nat. Immunol. 3: 741-748.

125. Hernandez-Hansen, V., G. A. Mackay, C. A. Lowell, B. S. Wilson, and J. M. Oliver. 2004.

The Src kinase Lyn is a negative regulator of mast cell proliferation. J. Leukoc. Biol. 75: 143-

151.

126. Hernandez-Hansen, V., A. J. Smith, Z. Surviladze, A. Chigaev, T. Mazel, J. Kalesnikoff, C.

A. Lowell, G. Krystal, L. A. Sklar, B. S. Wilson, and J. M. Oliver. 2004. Dysregulated

FcepsilonRI signaling and altered Fyn and SHIP activities in Lyn-deficient mast cells. J.

Immunol. 173: 100-112.

127. Galli, S. J., M. Tsai, and A. M. Piliponsky. 2008. The development of allergic

inflammation. Nature 454: 445-454.

128. Miyajima, I., D. Dombrowicz, T. R. Martin, J. V. Ravetch, J. P. Kinet, and S. J. Galli. 1997.

Systemic anaphylaxis in the mouse can be mediated largely through IgG1 and Fc gammaRIII.

Assessment of the cardiopulmonary changes, mast cell degranulation, and death associated with

active or IgE- or IgG1-dependent passive anaphylaxis. J. Clin. Invest. 99: 901-914.

129. Metcalfe, D. D., R. D. Peavy, and A. M. Gilfillan. 2009. Mechanisms of mast cell signaling

in anaphylaxis. J. Allergy Clin. Immunol. 124: 639-46; quiz 647-8.

143

130. Wershil, B. K., Y. A. Mekori, T. Murakami, and S. J. Galli. 1987. 125I-fibrin deposition in

IgE-dependent immediate hypersensitivity reactions in mouse skin. Demonstration of the role of

mast cells using genetically mast cell-deficient mice locally reconstituted with cultured mast

cells. J. Immunol. 139: 2605-2614.

131. Galli, S. J., A. M. Dvorak, and I. Hammel. 1993. Mast cell abnormalities in the Chediak-

Higashi syndrome. Int. Arch. Allergy Immunol. 100: 89-92.

132. Lee, D. M., D. S. Friend, M. F. Gurish, C. Benoist, D. Mathis, and M. B. Brenner. 2002.

Mast cells: a cellular link between autoantibodies and inflammatory arthritis. Science 297: 1689-

1692.

133. Araki, Y., A. Andoh, Y. Fujiyama, and T. Bamba. 2000. Development of dextran sulphate

sodium-induced experimental colitis is suppressed in genetically mast cell-deficient Ws/Ws rats.

Clin. Exp. Immunol. 119: 264-269.

134. Nishida, K., A. Hasegawa, S. Nakae, K. Oboki, H. Saito, S. Yamasaki, and T. Hirano. 2009.

Zinc transporter Znt5/Slc30a5 is required for the mast cell-mediated delayed-type allergic

reaction but not the immediate-type reaction. J. Exp. Med. 206: 1351-1364.

135. Gregory, G. D., S. S. Raju, S. Winandy, and M. A. Brown. 2006. Mast cell IL-4 expression

is regulated by Ikaros and influences encephalitogenic Th1 responses in EAE. J. Clin. Invest.

116: 1327-1336.

136. Han, J., R. Kori, J. W. Shui, Y. R. Chen, Z. Yao, and T. H. Tan. 2003. The SH3 domain-

containing adaptor HIP-55 mediates c-Jun N-terminal kinase activation in T cell receptor

signaling. J. Biol. Chem. 278: 52195-52202.

137. Haeckel, A., R. Ahuja, E. D. Gundelfinger, B. Qualmann, and M. M. Kessels. 2008. The

actin-binding protein Abp1 controls dendritic spine morphology and is important for spine head

and synapse formation. J. Neurosci. 28: 10031-10044.

138. Han, J., J. W. Shui, X. Zhang, B. Zheng, S. Han, and T. H. Tan. 2005. HIP-55 is important

for T-cell proliferation, cytokine production, and immune responses. Mol. Cell. Biol. 25: 6869-

6878.

139. Le Bras, S., I. Foucault, A. Foussat, C. Brignone, O. Acuto, and M. Deckert. 2004.

Recruitment of the actin-binding protein HIP-55 to the immunological synapse regulates T cell

receptor signaling and endocytosis. J. Biol. Chem. 279: 15550-15560.

140. Hao, S. and A. August. 2005. Actin depolymerization transduces the strength of B-cell

receptor stimulation. Mol. Biol. Cell 16: 2275-2284.

144

141. Smyth, J. T., W. I. DeHaven, G. S. Bird, and J. W. Putney Jr. 2007. Role of the microtubule

cytoskeleton in the function of the store-operated Ca2+ channel activator STIM1. J. Cell. Sci.

120: 3762-3771.

142. Sampieri, A., A. Zepeda, A. Asanov, and L. Vaca. 2009. Visualizing the store-operated

channel complex assembly in real time: identification of SERCA2 as a new member. Cell

Calcium 45: 439-446.

143. Nolz, J. C., T. S. Gomez, P. Zhu, S. Li, R. B. Medeiros, Y. Shimizu, J. K. Burkhardt, B. D.

Freedman, and D. D. Billadeau. 2006. The WAVE2 complex regulates actin cytoskeletal

reorganization and CRAC-mediated calcium entry during T cell activation. Curr. Biol. 16: 24-34.

144. Shiraishi, Y., A. Mizutani, H. Bito, K. Fujisawa, S. Narumiya, K. Mikoshiba, and T.

Furuichi. 1999. Cupidin, an isoform of Homer/Vesl, interacts with the actin cytoskeleton and

activated rho family small GTPases and is expressed in developing mouse cerebellar granule

cells. J. Neurosci. 19: 8389-8400.

145. Yuan, J. P., K. Kiselyov, D. M. Shin, J. Chen, N. Shcheynikov, S. H. Kang, M. H. Dehoff,

M. K. Schwarz, P. H. Seeburg, S. Muallem, and P. F. Worley. 2003. Homer binds TRPC family

channels and is required for gating of TRPC1 by IP3 receptors. Cell 114: 777-789.

146. Goel, M., W. Sinkins, A. Keightley, M. Kinter, and W. P. Schilling. 2005. Proteomic

analysis of TRPC5- and TRPC6-binding partners reveals interaction with the plasmalemmal

Na(+)/K(+)-ATPase. Pflugers Arch. 451: 87-98.

147. Blair, N. T., J. S. Kaczmarek, and D. E. Clapham. 2009. Intracellular calcium strongly

potentiates agonist-activated TRPC5 channels. J. Gen. Physiol. 133: 525-546.

148. Dietrich, A. and T. Gudermann. 2007. Trpc6. Handb. Exp. Pharmacol. (179): 125-141.

149. Vennekens, R., J. Olausson, M. Meissner, W. Bloch, I. Mathar, S. E. Philipp, F. Schmitz, P.

Weissgerber, B. Nilius, V. Flockerzi, and M. Freichel. 2007. Increased IgE-dependent mast cell

activation and anaphylactic responses in mice lacking the calcium-activated nonselective cation

channel TRPM4. Nat. Immunol. 8: 312-320.

150. Shimizu, T., G. Owsianik, M. Freichel, V. Flockerzi, B. Nilius, and R. Vennekens. 2009.

TRPM4 regulates migration of mast cells in mice. Cell Calcium 45: 226-232.

151. Thompson, M. A., C. M. Pabelick, and Y. S. Prakash. 2009. Role of STIM1 in regulation of

store-operated Ca2+ influx in pheochromocytoma cells. Cell. Mol. Neurobiol. 29: 193-202.

152. Hajkova, Z., V. Bugajev, E. Draberova, S. Vinopal, L. Draberova, J. Janacek, P. Draber,

and P. Draber. 2011. STIM1-directed reorganization of microtubules in activated mast cells. J.

Immunol. 186: 913-923.

145

153. Alicia, S., Z. Angelica, S. Carlos, S. Alfonso, and L. Vaca. 2008. STIM1 converts TRPC1

from a receptor-operated to a store-operated channel: moving TRPC1 in and out of lipid rafts.

Cell Calcium 44: 479-491.

VITA

Name Mankit Law

Education

2005-2011 Doctor of Philosophy in Immunology and Infectious Diseases


University Park, PA.

1999-2004 Bachelor of Science in Biotechnology


University Park, PA.

Research Experience

2005-2011 The Huck Institutes of the Life Sciences


Advisor: Avery August

Dissertation Title: A Functional Link Between Store-Operated

Calcium Channels and the Actin-Binding Protein Drebrin in Mast

Cells Revealed by 3,5-Bis-Trifluoromethyl Pyrazole (BTP)

Compounds

Teaching Experience

Fall 2006 Teaching Assistant- Principles of Immunology (MICRB 410)

Publications 1. M. Law and A. August. “p130Cas, a multi-function scaffold for diverse signals.”

Adaptor Proteins and Cancer, 2008. Ed. Maria-Magdalena Georgescu.

2. J.C. Mercer*, Q. Qi*, L.F. Mottram*, M. Law, D. Bruce, A. Iyer, J.L. Morales, H.

Yamazaki, T. Shirao, B.R. Peterson, and A. August. “Chemico-genetic identification of

drebrin as a regulator of calcium responses.” (2010) Int. J. Biochem. & Cell Biol. 42:

337-345. (*equal contributors)

3. M. Law, J.L. Morales, L.F. Mottram, A. Iyer, B.R. Peterson, and A. August. “Structural

requirements for the inhibition of calcium mobilization and mast cell activation by the

pyrazole derivative BTP2.” (2011) Int. J. Biochem. & Cell Biol. 43: 1228-1239.

a functional link between store-operated calcium …

Documents