9 112 samaradivakara s dna barcoding of cinnamon
Upload: university-of-sri-jayewardenepura-dept-forestry-and-environment
Post on 20-Dec-2014
2.060 views
DESCRIPTION
TRANSCRIPT
Saroopa Samaradivakara Genetech Research Institute
Cinnamon
Cinnamon is a small evergreen tree belonging to the family Lauraceae
• It is native to Sri Lanka• Sri Lanka is the largest “true” cinnamon
producer in the world (Cinnamomum zeylanicum or C. verum)
• Commercially important types• Ceylon cinnamon (native to Sri Lanka)• Cassia
2Genetech Research Institute
What is Barcoding?•DNA barcoding involves sequencing a standard region of DNA as a tool for species identification
•Low substitution rates of mitochondrial DNA in plants
•Some of the leading candidate chloroplast plastid DNA regions used in land plants barcoding are atpF-atpH spacer, MatK gene, rbcL gene,rpoB gene, rpoC1gene, psbK-psbI spacer and TrnH- psbA spacer
3Genetech Research Institute
4Genetech Research Institute
Why TrnH and MatK barcoding loci?
• matK is one of the most rapidly evolving plastid coding regions and it gives a sequence of better quality
• trnH–psbA demonstrates good amplification across land plants
• TrnH and MatK expected band sizes ~450bp and ~930bp respectively
http://www.pnas.org/content/106/31/12794 (12.10.2009)
5Genetech Research Institute
• Beside from the C. verum there are 7 wild species• Cinnamomum tamala • Cinnamomum dubium (Sinhala: sewel Kurundu or wal
Kurundu) • Cinnamomum ovalifolium • Cinnamomum litseafolium (Sinhala: Kudu Kurundu) • Cinnamomum citriodorum (Sinhala: Pangiri Kurundu - rare) • Cinnamomum rivulorum • Cinnamomum sinharajense • Cinnamomum capparu-corende (Sinhala: Kapuru Kurundu)
http://en.wikipedia.org/wiki/Cinnamon
Why is it important to barcode Cinnamon?
6Genetech Research Institute
• Cassia types cultivated in Sri Lanka • Chinese cassia (Cinnamomum aromanticum)• Indonesian cassia (Cinnamomum brumannii Nees)• Vietnam cassia (Cinnamomum ioureirii Nees)
• However, these related species, Cassia are sometimes sold labelled as cinnamon.
• Therefore a DNA based method to rapidly identify the different strains of cinnamon and cassia would be an important tool for the conservation of the cinnamon strains of Sri Lanka and the control of the use of the name “True cinnamon” in the world market
7Genetech Research Institute
OBJECTIVES
• To barcode DNA extracted from Cinnamon leaves
• To amplify DNA extracted from processed cinnamon bark for the two barcode loci chosen
• To decide which loci out of MatK and TrnH enable producing DNA barcodes more easily
8Genetech Research Institute
MethodObjective 1
• We used four different species generally known to be the following types of cinnamon that can be found in Sri Lanka
• Cinnamomum camphora
• Cinnamomum aromanticum
• “Dawul Kurundu”
• “Wal Kurundu”9Genetech Research Institute
Genetech Research Institute 10
“Wal Kurundu”
Cinnamomum aromaticum
“Dawul kurundu”
Cinnamomum camphora
• DNA was extracted from leaves using the CTAB method
• PCR conducted for both TrnH and MatK• Enhancers BSA and DMSO were used for the MatK
system • DMSO was added in a dilution series of 0.5ul, 1.0ul,
1.5ul• Agarose gel electrophoresis was done to obtain
bands for the PCR products and the bands were purified
• Purified products were used for the sequencing process
11Genetech Research Institute
Results
12Genetech Research Institute
matK
trnH
A B C D E F G H
Cinnamomum camphora
A - λ 100 bp ladder
B - PCR amplified products of primers trnH-psbA
C - Negative control for trnH-psbA primer products
(all except template DNA)
D - PCR amplified products of primer matK with
0.5 µl of 14.07 M DMSO
E - PCR amplified products of primer matK with
1.0 µl of 14.07 M DMSO
F - PCR amplified products of primer matK with
1.5µl of 14.07 M DMSO
G - Negative control for matK (including 1.0 µl of
14.07 M
DMSO)
500bp
13Genetech Research Institute
GTAGTTATGAACCCTGTAGACATCCCCACGGGGTGGTGAAGGGAGGGCCCGATTGGTAGAAAAAAAC CCACAACCCCGGGGTTATCCTGCGCTTGGAAGAAAAAGTAGGAAAAGGAATAAATATAGTAATAGTTT TATTATTCGTCGCCGTAAATAGAAATATTCAAAATCAAATAAATATTGTTTTTTAAGGTGAAATAAAGATATTTACACCCCGTCCAAGTTTATAGGGATAGCAAATGCTGGGCGAACGACGGGAATTGAACCCGCGCATGTGGATTCACTCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCCTCTCTCAAAAGGATTCCATTTTCACCATTCATTATTTTTTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACGTAAAATAAAAAAAAAAAGAAAAATGCTTTGATTTTTTCCTAAAATCAAATTCTTTTGAAGAATAAGAGTATATAAATTGCAGGTTGGTACAGAAGAAACTACGATATCGATCACGAAATAACCAGCGGTTTTCATAAGTTGAATAAAAGAAATGAAAATGAAAAACGATTATGTGAAAACACTCTGAACCAAATAGATCAATCCAAACTTCTTAATAGAACAGAAGTTTGGTATTGATC
Trn H Cinnamomum camphora
14Genetech Research Institute
15Genetech Research Institute
MatK Cinnamomum camphora
ACTTTTTCGAGACAGTTATCACATTTAATTCATGTGTCAGATATACTAATTCCCCCCCCCATCCATCTGGAAATCTTGGTTCAAACCCTTCACTCTTGGATACAAGATACTCCTTCGTTGCATTTATTGCGATTCTCTCTCTACGAGTATTGGAATTCAAATAGTCTCATTACTCCAAAAAATTCCATTTCCCTTTTTTCAAAAGAGAATCAAAGATTCTTCTTGTTCCTCTCTAATTCTCATGTATATGAATGTGAATTCATATTCATTTTTCTCCGTAAACAACCCTTTCATTTACGATCAAAATCTTTTGGATCCTTTCTTGAGCGAACACATTTCTATGCAAAAATAGAATATCTTGTAGTAGTGCTTTGTAACGATTTTCAGAAAACCCTATGGTTGTTCAAAGACCCTTTTATGCATTATGTCAGATATCAAGGAAAATCGATTCTGGCTTCAAGGGGGGCTCGTCTTCTGATAAAGAAATGGAAATCTCACCTTGTCAACTTTTGGCAATCTCATTTTGACTTGTGGTCTCACCCGGCCAGGATCCATATAAAGCAATTATATAATCATCCCTCCATTTCCTGGGCTATCTTTCAAGTGTACCAACTAAACATCTTCGGAGAAAGGATCAAATGTTAA
16Genetech Research Institute
17Genetech Research Institute
“Dawul kurundu”
D1 - λ 100 bp ladder
D2 - PCR amplified products of primers matK for
“ Dawul kurudu”
D3 - Negative control for matK
D4 - PCR amplified products of primer trnH-psbA for
“Dawul kurudu”
D5 - PCR amplified products of primer trnH-psbA for
C. camphora
D6 - Negative control for matK primer products
D1 D2 D3 D4 D5 D6
trnH
18Genetech Research Institute
500bp
“Dawul kurundu” TrnH
AGAGGGCAACTGAGCCCCTGTGCCTTGATCCCTTGGCTACTTCCTGCCTACTCTCTCAAAAGATTCCCTTTCACCGTTCATTATTTTTTTATTTAGTCTTTATTACTTCCCCCCTCCTTCCTGCTGAAATACAGATATTGTACATAAAAAAAAAAAAAAATGCTTTGATTTTAGGAAAAAATTAAATTCTTTTGAAAAATAAGAGTATATAAATTGCGGGTTGGTACAGAAAAAACTACAATATTCGATCATGAAATAACCAGGGGTTTTTATAAGTTGAATAAAAGAGATGAAAATGAAAAACGATTATGTGAATAAAACACTACTGAACCAAATAGATCAATACCAAACTTCTTGTTCTATTAAGAAGTTTGGTATTGATCCTTCAACGACTCGTATACCCTAATACCAAAGTATTATCCGTTTGTAGATGGAACTTCGACAGCAGCTAGGTCTAGAGGGAAGTTGTGAGCCTTACGTTCTCGCCTATACACT
19Genetech Research Institute
20Genetech Research Institute
Cinnamomum aromaticum and “Wal kurundu”
TrnH
A- 100bp LadderB- Amplification with TrnH C- negative controlD- Amplification with MatK having 1ul of DMSOE- negative control F- Amplification with MatK having 1.5ul of DMSOG- negative control
21Genetech Research Institute
500bp
Partial Sequence of Cinnamomum aromaticum TrnH region
TCTTAGTCCTATGGATCCCTTGGGCTACATCCGCCTTCTCCCTCTCTCAAATATGGAATTCCATTTTCACCATTCATTAATTTTTTAATTTAGTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACATAAAAAAAAAAAAAAAAAAAATGCTTTGATTTTTTCCTAAAATCAAA
Partial Sequence of “Wal Kurundu” region
CAGGGCCTTGGATCCACTAGGGCTACATCCGCCCTCTTTCTCCTTTCAATGGAATTCCATTTTCACCATTCATTATTTTTTAATTTAGTCTTTATTACTTCACTCTCCTTCCCGCTGAAATACAGATATTGGGCATAATATTCATTGTTGTATGTATCA
22Genetech Research Institute
Extraction methods used
• CTAB method used in extracting DNA from leaves
• CTAB method having Polyvinyl Pyrrolidone (PVP ) this is used to remove polyphenols present in the bark
Objective 2Extraction of DNA from processed Cinnamon
bark for obtaining DNA Barcodes
23Genetech Research Institute
Discussion• Suitability of the two Barcode loci TrnH and MatK - TrnH gives
a better amplification than MatK.
• Though MatK is recommended there are instances where the MatK region has been difficult to amplify.
• Sequence data generated gave very good concordance with sequences of some species in NCBI eg: Cinnamomum camphora
• However some other specimens such as “Dawul Kurundu” did not show sufficient concordance with similar species in NCBI
24Genetech Research Institute
• This could be due to these species being endemic plants and that nobody till date has generated barcode sequences and submitted to NCBI
• Therefore there is a need to submit barcode sequences for such endemic species
• This project is now in prgress and we hope to generate TrnH sequences for all the varieties of cinnamon in Sri Lanka
25Genetech Research Institute
• It is important for the purpose of international trade.• Although we tried several methods of extraction up to now
we have not been able to generate a PCR product for bark DNA
Cinnamon bark DNA extraction and amplification
26Genetech Research Institute
This maybe due to the following reasons:
- The amount of chloroplast in the bark is much less than in the leaf
- The chloroplasts in bark may have undergone degradation during maturity and senescence
- The chloroplast degradation during processing of the cinnamon bark
- The bark may contain more cinnamic oils and acids which may have an inhibitory effect on the PCR
27Genetech Research Institute
• Therefore DNA barcoding which uses chloroplast DNA does not seem to be the best option for cinnamon bark samples
• In such a case an autosomal DNA marker maybe more suitable for this purpose
• However DNA barcoding is a good option for determining the phylogenetic relationships between the different cinnamon varieties in Sri Lanka and it will help to resolve some of the long standing taxonomic disputes of cinnamon
28Genetech Research Institute
ReferencesScientific papersAron J . Fazekas, Prasad R. Kesanakurti , Kevin S. Burgess,Diana M. Percy,Sean W. Graham,
Spencer C. H. Barrett, Steven G. NEWMASTER,Mehrdad Hajibabaei and Brian C. Husband. Are plant species inherently harder to discriminate than animal species using DNA barcoding markers? Molecular Ecology Resources (2009) 9 (Suppl. 1), 130–139
Web referenceswww.pnas.orgcgidoi10.1073pnas.0503123102http://www.pnas.org/content/106/31/12794http://www.plant-talk.org/resource/dna.htmlhttp://barcoding.si.edu/PDF/Informationonbarcodeloci.pdfhttp://www.kew.org/barcoding/protocols.html) http://en.wikipedia.org/wiki/Cinnamon
29Genetech Research Institute
Aknowledgement• Dr. Neil Fernandopulle• Bhagya Mendis• Thanuja Jayatunga• Romani Slegers• Ujith Karunaratne• Ms. Gayathri Baranage and Mr. Ishara Herath• Ms.Imalka Gunasekera and Trashila Wickramasinghe• Sample providers• Dr Dharshan De Silva and all the members of Genetech
Research Institute
Funded by Genetech Research Institute
30Genetech Research Institute
31Genetech Research Institute
MatK primer map. Note that the designation of F and R varies between primer names from different sources. MATK For matK, the proposed barcode region is indicated on the primer map above. It falls in the region between bp205-1046 (227-1019 excluding primer sequence) in the Arabidopsis thaliana sequence.
It is recognised that these primers will not work in all angiosperms and further primer development work is required in non-angiosperms for matK. We encourage community effort to enhance amplification strategies for matK, including the development of new primers and primer cocktails.
http://barcoding.si.edu/PDF/Informationonbarcodeloci.pdf
32Genetech Research Institute
33Genetech Research Institute
94◦C - 3 min - 1 cycle
94◦C - 1 min
55◦C - 1 min 35 cycles
72◦C - 1 min
72◦C - 3 min - 1 cycle
PCR protocol
34Genetech Research Institute
A- 100bp Ladder
B- Amplification of Cinnamomum aromaticum with
TrnH
C- Amplification of “Wal kurundu” with TrnH
35Genetech Research Institute
500bp