Saroopa Samaradivakara Genetech Research Institute

Cinnamon

Cinnamon is a small evergreen tree belonging to the family Lauraceae

• It is native to Sri Lanka• Sri Lanka is the largest “true” cinnamon

producer in the world (Cinnamomum zeylanicum or C. verum)

• Commercially important types• Ceylon cinnamon (native to Sri Lanka)• Cassia

2Genetech Research Institute

What is Barcoding?•DNA barcoding involves sequencing a standard region of DNA as a tool for species identification

•Low substitution rates of mitochondrial DNA in plants

•Some of the leading candidate chloroplast plastid DNA regions used in land plants barcoding are atpF-atpH spacer, MatK gene, rbcL gene,rpoB gene, rpoC1gene, psbK-psbI spacer and TrnH- psbA spacer

3Genetech Research Institute

4Genetech Research Institute

Why TrnH and MatK barcoding loci?

• matK is one of the most rapidly evolving plastid coding regions and it gives a sequence of better quality

• trnH–psbA demonstrates good amplification across land plants

• TrnH and MatK expected band sizes ~450bp and ~930bp respectively

http://www.pnas.org/content/106/31/12794 (12.10.2009)

5Genetech Research Institute

• Beside from the C. verum there are 7 wild species• Cinnamomum tamala • Cinnamomum dubium (Sinhala: sewel Kurundu or wal

Kurundu) • Cinnamomum ovalifolium • Cinnamomum litseafolium (Sinhala: Kudu Kurundu) • Cinnamomum citriodorum (Sinhala: Pangiri Kurundu - rare) • Cinnamomum rivulorum • Cinnamomum sinharajense • Cinnamomum capparu-corende (Sinhala: Kapuru Kurundu)

http://en.wikipedia.org/wiki/Cinnamon

Why is it important to barcode Cinnamon?

6Genetech Research Institute

• Cassia types cultivated in Sri Lanka • Chinese cassia (Cinnamomum aromanticum)• Indonesian cassia (Cinnamomum brumannii Nees)• Vietnam cassia (Cinnamomum ioureirii Nees)

• However, these related species, Cassia are sometimes sold labelled as cinnamon.

• Therefore a DNA based method to rapidly identify the different strains of cinnamon and cassia would be an important tool for the conservation of the cinnamon strains of Sri Lanka and the control of the use of the name “True cinnamon” in the world market

7Genetech Research Institute

OBJECTIVES

• To barcode DNA extracted from Cinnamon leaves

• To amplify DNA extracted from processed cinnamon bark for the two barcode loci chosen

• To decide which loci out of MatK and TrnH enable producing DNA barcodes more easily

8Genetech Research Institute

MethodObjective 1

• We used four different species generally known to be the following types of cinnamon that can be found in Sri Lanka

• Cinnamomum camphora

• Cinnamomum aromanticum

• “Dawul Kurundu”

• “Wal Kurundu”9Genetech Research Institute

Genetech Research Institute 10

“Wal Kurundu”

Cinnamomum aromaticum

“Dawul kurundu”

Cinnamomum camphora

• DNA was extracted from leaves using the CTAB method

• PCR conducted for both TrnH and MatK• Enhancers BSA and DMSO were used for the MatK

system • DMSO was added in a dilution series of 0.5ul, 1.0ul,

1.5ul• Agarose gel electrophoresis was done to obtain

bands for the PCR products and the bands were purified

• Purified products were used for the sequencing process

11Genetech Research Institute

Results

12Genetech Research Institute

matK

trnH

A B C D E F G H

Cinnamomum camphora

A - λ 100 bp ladder

B - PCR amplified products of primers trnH-psbA

C - Negative control for trnH-psbA primer products

(all except template DNA)

D - PCR amplified products of primer matK with

0.5 µl of 14.07 M DMSO

E - PCR amplified products of primer matK with

1.0 µl of 14.07 M DMSO

F - PCR amplified products of primer matK with

1.5µl of 14.07 M DMSO

G - Negative control for matK (including 1.0 µl of

14.07 M

DMSO)

500bp

13Genetech Research Institute

GTAGTTATGAACCCTGTAGACATCCCCACGGGGTGGTGAAGGGAGGGCCCGATTGGTAGAAAAAAAC CCACAACCCCGGGGTTATCCTGCGCTTGGAAGAAAAAGTAGGAAAAGGAATAAATATAGTAATAGTTT TATTATTCGTCGCCGTAAATAGAAATATTCAAAATCAAATAAATATTGTTTTTTAAGGTGAAATAAAGATATTTACACCCCGTCCAAGTTTATAGGGATAGCAAATGCTGGGCGAACGACGGGAATTGAACCCGCGCATGTGGATTCACTCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCCTCTCTCAAAAGGATTCCATTTTCACCATTCATTATTTTTTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACGTAAAATAAAAAAAAAAAGAAAAATGCTTTGATTTTTTCCTAAAATCAAATTCTTTTGAAGAATAAGAGTATATAAATTGCAGGTTGGTACAGAAGAAACTACGATATCGATCACGAAATAACCAGCGGTTTTCATAAGTTGAATAAAAGAAATGAAAATGAAAAACGATTATGTGAAAACACTCTGAACCAAATAGATCAATCCAAACTTCTTAATAGAACAGAAGTTTGGTATTGATC

Trn H Cinnamomum camphora

14Genetech Research Institute

15Genetech Research Institute

MatK Cinnamomum camphora

ACTTTTTCGAGACAGTTATCACATTTAATTCATGTGTCAGATATACTAATTCCCCCCCCCATCCATCTGGAAATCTTGGTTCAAACCCTTCACTCTTGGATACAAGATACTCCTTCGTTGCATTTATTGCGATTCTCTCTCTACGAGTATTGGAATTCAAATAGTCTCATTACTCCAAAAAATTCCATTTCCCTTTTTTCAAAAGAGAATCAAAGATTCTTCTTGTTCCTCTCTAATTCTCATGTATATGAATGTGAATTCATATTCATTTTTCTCCGTAAACAACCCTTTCATTTACGATCAAAATCTTTTGGATCCTTTCTTGAGCGAACACATTTCTATGCAAAAATAGAATATCTTGTAGTAGTGCTTTGTAACGATTTTCAGAAAACCCTATGGTTGTTCAAAGACCCTTTTATGCATTATGTCAGATATCAAGGAAAATCGATTCTGGCTTCAAGGGGGGCTCGTCTTCTGATAAAGAAATGGAAATCTCACCTTGTCAACTTTTGGCAATCTCATTTTGACTTGTGGTCTCACCCGGCCAGGATCCATATAAAGCAATTATATAATCATCCCTCCATTTCCTGGGCTATCTTTCAAGTGTACCAACTAAACATCTTCGGAGAAAGGATCAAATGTTAA

16Genetech Research Institute

17Genetech Research Institute

“Dawul kurundu”

D1 - λ 100 bp ladder

D2 - PCR amplified products of primers matK for

“ Dawul kurudu”

D3 - Negative control for matK

D4 - PCR amplified products of primer trnH-psbA for

“Dawul kurudu”

D5 - PCR amplified products of primer trnH-psbA for

C. camphora

D6 - Negative control for matK primer products

D1 D2 D3 D4 D5 D6

trnH

18Genetech Research Institute

500bp

“Dawul kurundu” TrnH

AGAGGGCAACTGAGCCCCTGTGCCTTGATCCCTTGGCTACTTCCTGCCTACTCTCTCAAAAGATTCCCTTTCACCGTTCATTATTTTTTTATTTAGTCTTTATTACTTCCCCCCTCCTTCCTGCTGAAATACAGATATTGTACATAAAAAAAAAAAAAAATGCTTTGATTTTAGGAAAAAATTAAATTCTTTTGAAAAATAAGAGTATATAAATTGCGGGTTGGTACAGAAAAAACTACAATATTCGATCATGAAATAACCAGGGGTTTTTATAAGTTGAATAAAAGAGATGAAAATGAAAAACGATTATGTGAATAAAACACTACTGAACCAAATAGATCAATACCAAACTTCTTGTTCTATTAAGAAGTTTGGTATTGATCCTTCAACGACTCGTATACCCTAATACCAAAGTATTATCCGTTTGTAGATGGAACTTCGACAGCAGCTAGGTCTAGAGGGAAGTTGTGAGCCTTACGTTCTCGCCTATACACT

19Genetech Research Institute

20Genetech Research Institute

Cinnamomum aromaticum and “Wal kurundu”

TrnH

A- 100bp LadderB- Amplification with TrnH C- negative controlD- Amplification with MatK having 1ul of DMSOE- negative control F- Amplification with MatK having 1.5ul of DMSOG- negative control

21Genetech Research Institute

500bp

Partial Sequence of Cinnamomum aromaticum TrnH region

TCTTAGTCCTATGGATCCCTTGGGCTACATCCGCCTTCTCCCTCTCTCAAATATGGAATTCCATTTTCACCATTCATTAATTTTTTAATTTAGTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACATAAAAAAAAAAAAAAAAAAAATGCTTTGATTTTTTCCTAAAATCAAA

Partial Sequence of “Wal Kurundu” region

CAGGGCCTTGGATCCACTAGGGCTACATCCGCCCTCTTTCTCCTTTCAATGGAATTCCATTTTCACCATTCATTATTTTTTAATTTAGTCTTTATTACTTCACTCTCCTTCCCGCTGAAATACAGATATTGGGCATAATATTCATTGTTGTATGTATCA

22Genetech Research Institute

Extraction methods used

• CTAB method used in extracting DNA from leaves

• CTAB method having Polyvinyl Pyrrolidone (PVP ) this is used to remove polyphenols present in the bark

Objective 2Extraction of DNA from processed Cinnamon

bark for obtaining DNA Barcodes

23Genetech Research Institute

Discussion• Suitability of the two Barcode loci TrnH and MatK - TrnH gives

a better amplification than MatK.

• Though MatK is recommended there are instances where the MatK region has been difficult to amplify.

• Sequence data generated gave very good concordance with sequences of some species in NCBI eg: Cinnamomum camphora

• However some other specimens such as “Dawul Kurundu” did not show sufficient concordance with similar species in NCBI

24Genetech Research Institute

• This could be due to these species being endemic plants and that nobody till date has generated barcode sequences and submitted to NCBI

• Therefore there is a need to submit barcode sequences for such endemic species

• This project is now in prgress and we hope to generate TrnH sequences for all the varieties of cinnamon in Sri Lanka

25Genetech Research Institute

• It is important for the purpose of international trade.• Although we tried several methods of extraction up to now

we have not been able to generate a PCR product for bark DNA

Cinnamon bark DNA extraction and amplification

26Genetech Research Institute

This maybe due to the following reasons:

- The amount of chloroplast in the bark is much less than in the leaf

- The chloroplasts in bark may have undergone degradation during maturity and senescence

- The chloroplast degradation during processing of the cinnamon bark

- The bark may contain more cinnamic oils and acids which may have an inhibitory effect on the PCR

27Genetech Research Institute

• Therefore DNA barcoding which uses chloroplast DNA does not seem to be the best option for cinnamon bark samples

• In such a case an autosomal DNA marker maybe more suitable for this purpose

• However DNA barcoding is a good option for determining the phylogenetic relationships between the different cinnamon varieties in Sri Lanka and it will help to resolve some of the long standing taxonomic disputes of cinnamon

28Genetech Research Institute

ReferencesScientific papersAron J . Fazekas, Prasad R. Kesanakurti , Kevin S. Burgess,Diana M. Percy,Sean W. Graham,

Spencer C. H. Barrett, Steven G. NEWMASTER,Mehrdad Hajibabaei and Brian C. Husband. Are plant species inherently harder to discriminate than animal species using DNA barcoding markers? Molecular Ecology Resources (2009) 9 (Suppl. 1), 130–139

Web referenceswww.pnas.orgcgidoi10.1073pnas.0503123102http://www.pnas.org/content/106/31/12794http://www.plant-talk.org/resource/dna.htmlhttp://barcoding.si.edu/PDF/Informationonbarcodeloci.pdfhttp://www.kew.org/barcoding/protocols.html) http://en.wikipedia.org/wiki/Cinnamon

29Genetech Research Institute

Aknowledgement• Dr. Neil Fernandopulle• Bhagya Mendis• Thanuja Jayatunga• Romani Slegers• Ujith Karunaratne• Ms. Gayathri Baranage and Mr. Ishara Herath• Ms.Imalka Gunasekera and Trashila Wickramasinghe• Sample providers• Dr Dharshan De Silva and all the members of Genetech

Research Institute

Funded by Genetech Research Institute

30Genetech Research Institute

31Genetech Research Institute

MatK primer map. Note that the designation of F and R varies between primer names from different sources. MATK For matK, the proposed barcode region is indicated on the primer map above. It falls in the region between bp205-1046 (227-1019 excluding primer sequence) in the Arabidopsis thaliana sequence.

It is recognised that these primers will not work in all angiosperms and further primer development work is required in non-angiosperms for matK. We encourage community effort to enhance amplification strategies for matK, including the development of new primers and primer cocktails.

http://barcoding.si.edu/PDF/Informationonbarcodeloci.pdf

32Genetech Research Institute

33Genetech Research Institute

94◦C - 3 min - 1 cycle

94◦C - 1 min

55◦C - 1 min 35 cycles

72◦C - 1 min

72◦C - 3 min - 1 cycle

PCR protocol

34Genetech Research Institute

A- 100bp Ladder

B- Amplification of Cinnamomum aromaticum with

TrnH

C- Amplification of “Wal kurundu” with TrnH

35Genetech Research Institute

500bp