2017 the severe acute respiratory syndrome coronavirus nucleocapsid inhibits type i interferon...

SARS Coronavirus Nucleocapsid Inhibits Type I Interferon Production by 1

Interfering with TRIM25-Mediated RIG-I Ubiquitination 2

Yong Hu, Wei Li, Ting Gao, Yan Cui, Yanwen Jin, Ping Li, Qingjun Ma, Xuan Liu* and 3

Cheng Cao* 4

5

1 State Key Laboratory of Pathogen Biosecurity, Beijing Institute of Biotechnology, Beijing 6

100850, China. 7

8

9

10

*Correspondence: 11

Xuan Liu: [email protected] 12

Phone and Fax (+86-10-6815-5151) 13

Cheng Cao: [email protected] (C.C.) 14

Phone and Fax: (+86-10) 8817-1105. 15

Running title: SARS-CoV N Protein Inhibits Type I Interferon Pathway 16

Keywords: SARS coronavirus; Nucleocapsid; Interferon; TRIM25; RIG-I 17

18

19

20

JVI Accepted Manuscript Posted Online 1 February 2017J. Virol. doi:10.1128/JVI.02143-16Copyright © 2017 American Society for Microbiology. All Rights Reserved.

on February 4, 2017 by U

NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Abstract 21

Severe acute respiratory syndrome (SARS) is a respiratory disease caused by a 22

coronavirus (SARS-CoV) that is characterized by atypical pneumonia. The nucleocapsid 23

protein (N protein) of SARS-CoV plays an important role in inhibition of type I interferon 24

(IFN) production via an unknown mechanism. In this study, the SARS-CoV N protein was 25

found to bind to the SPRY domain of the tripartite motif protein 25 (TRIM25) E3 ubiquitin 26

ligase, thereby interfering with the association between TRIM25 and retinoic 27

acid-inducible gene I (RIG-I) and inhibiting TRIM25-mediated RIG-I ubiquitination and 28

activation. Type I IFN production induced by poly I:C or Sendai virus (SeV) was 29

suppressed by the SARS-CoV N protein. SARS-CoV replication was increased by 30

over-expression of the full-length N protein but not N (1-361), which could not interact with 31

TRIM25. These findings provide an insightful interpretation of the SARS-CoV-mediated 32

host innate immune suppression caused by the N protein. 33

34

Importance 35

The SARS-CoV N protein is essential for the viral life cycle and plays a key role in the 36

virus-host interaction. We demonstrated that the interaction between the C-terminus of the 37

N protein and the SPRY domain of TRIM25 inhibited TRIM25-mediated RIG-I 38

ubiquitination, which resulted in the inhibition of IFN production. We also found that the 39

MERS-CoV N protein interacted with TRIM25 and inhibited RIG-I signaling. The outcomes 40

of these findings indicate the function of the coronavirus N protein in modulating the host’s 41

initial innate immune response. 42

43


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Introduction 44

As the first line of defense against viruses, type I interferon (IFN) plays a critical role 45

in initiating host antiviral responses. Following virus infection, the host innate immune 46

system is triggered by the recognition of viral-specific components (pattern recognition 47

receptors, PRRs), such as DNA, ssRNA, dsRNA or glycoproteins (1). The Toll-like 48

receptors (TLRs) and RIG-I-like receptors (RLRs) are the most common host PRRs that 49

respond to RNA viruses (2). The cytoplasmic virus receptor RIG-I directly recognizes and 50

binds to viral 5’-PPP RNA and short dsRNA, which are found in cells infected with a 51

variety of RNA viruses, through its helicase and repressor domain (RD) (1, 3). After 52

recognition, the N terminal caspase recruitment domains (CARDs) of RIG-I are modified 53

by ubiquitin, mediated by the E3 ligase tripartite motif protein 25 (TRIM25) (4). The 54

domains then initiate an antiviral signaling cascade by interacting with the downstream 55

partner MAVS/VISA/IPS-1/Cardif (4, 5), leading to the phosphorylation and activation of 56

the transcription factors IRF3 and NF-κB, eventually leading to the production of type I IFN 57

and many other cytokines. IFN-β secretion induces IFN-stimulated genes (ISGs), which 58

exert antiviral effector functions (6). 59

Viruses have evolved the capacity to evade host immune recognition and to suppress 60

the host IFN system (7). Viruses encode viral proteins that interfere with PRR signaling 61

pathways to gain an early advantage against host defense. For example, the influenza A 62

virus NS1 protein, Ebola virus VP35 protein, and Vaccine virus E3L protein bind viral 63

dsRNA to evade host immune recognition (8). Virus-encoded proteins also target IFN 64

genes and IFN-induced genes to prevent host antiviral effector responses (2, 9). 65

Severe acute respiratory syndrome coronavirus (SARS-CoV), which emerged in 66


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2003, has high mortality in humans. Similar to other known coronaviruses, SARS-CoV 67

has a 29.7-kb genome that encodes four structural proteins: spike (S), envelope (E), 68

membrane (M), and nucleocapsid (N) proteins (10, 11). The N protein enters host cells 69

together with viral RNA. Both the N- and C-termini of the N protein bind viral RNA to form 70

the helical ribonucleocapsid (RNP), which plays a fundamental role in viral assembly (12, 71

13). The multimerization of N proteins occurs primarily through the C-terminus (14). The 72

N-terminal portion of the N protein (168-208 a.a.) is important for the interaction with the 73

viral M protein, indicating that this region may be crucial for viral packaging (15, 16). The 74

N protein of SARS-CoV has been demonstrated to up-regulate the expression of the 75

pro-inflammatory factor COX2 and to interact with the proteasome subunit p42, which 76

affects a variety of basic cellular processes and inflammatory responses (17, 18). Notably, 77

N also inhibits the synthesis of IFN-β, which plays a vital role in innate immunity against 78

RNA virus infections by a mechanism that is not fully understood(19-21). 79

In this study, we found that the SARS-CoV N protein interacted with TRIM25 and 80

interfered with the association between TRIM25 and RIG-I. Thus, TRIM25-mediated RIG-I 81

ubiquitination was inhibited by the SARS-CoV N protein and contributed to the 82

suppression of type I IFN production. 83

84

Materials and Methods 85

Cell lines and viruses 86

Cell lines (293T, HeLa, A549, Vero and Calu-3) were grown in Dulbecco’s modified 87

Eagle’s medium (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA) supplemented 88


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

with 10% (or 20% for Calu-3) heat-inactivated fetal bovine serum (FBS) (Gibco, Life 89

Technologies, USA), 100 IU/mL of ampicillin and 100 µg/mL of streptomycin. The cells 90

were cultured in 5% CO2 and a humidified atmosphere at 37°C. The 293T and A549 cells 91

were transfected using Vigofect reagent (Vigorous, Beijing, China) and jetPRIME reagent 92

(Polyplus, New York City, NY, USA) according to the manufacturer’s instructions. 93

SeV (Sendai virus) and NDV-GFP (green fluorescent protein gene incorporated into 94

the Newcastle disease virus genome) were amplified in 9- to 11-day embryonated specific 95

pathogen-free (SPF) eggs. The 50% tissue culture infectious dose (TCID50) in Vero cells 96

was determined as previously described (22, 23). 97

DNA constructs 98

Flag- or hemagglutinin (HA)-tagged protein genes were cloned into the 99

pcDNA3-based expression vector (Invitrogen, Carlsbad, CA, USA). Enhanced GFP 100

(EGFP)- or Myc-tagged protein genes were cloned into the pCMV-Myc expression vector 101

(Clontech, Mountain View, CA, USA). 102

siRNAs targeting TRIM25 (siTRIM25, sense, 5’-GCAAAUGUUCCCAGCACAATT-3’ 103

and antisense, 5’-UUGUGCUGGGAACAUUUGCTT-3’) and a non-target siRNA (si-control) 104

were purchased from Genepharm Technologies (Shanghai, China). All siRNA 105

transfections were performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, 106

USA). 107

Quantitative RT-PCR 108

RNA was extracted using an RNeasy Mini Kit (QIAGEN, Valencia, CA, USA), and 1 109

µg of RNA was used to synthesize cDNA using ReverTra Ace qPCR RT Master Mix with 110


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

gDNA Remover (TOYOBO, Osaka, Japan). Quantitative RT-PCR was performed using 111

SYBR Green Supermix (Bio-Rad, iQTM Supermix, Hercules, CA, USA) with an iQ5 112

Multicolor Real-Time PCR Detection System (Bio-Rad). The primer sequences are shown 113

in Table 1, and relative gene expression levels were calculated using the 2-ΔΔCT method 114

(24). 115

Immunoprecipitation and immunoblotting analysis 116

Cell lysates were prepared in lysis buffer containing 1% Nonidet P-40 (25). Soluble 117

proteins were subjected to immunoprecipitation with an anti-Flag antibody (M2, Sigma 118

F2426, MO, USA) or mouse IgG (Sigma A0910, MO, USA). An aliquot of the total lysate 119

(5%, v/v) was included as a control. The immunoblotting analysis was performed with 120

anti-GFP (Proteintech HRP-66002, Chicago, IL, USA), anti-TRIM25 (Abcam ab167154, 121

Cambridge, MA, USA), anti-Myc (Santa Cruz SC-40, CA, USA), anti-Flag horseradish 122

peroxidase (HRP) (Sigma A8592, MO, USA), anti-β-actin (Santa Cruz SC-1616, CA, USA), 123

anti-ubiquitin (Santa Cruz SC-8017, CA, USA), anti-HA (Sigma H9658, MO, USA), 124

anti-IRF3 (Abcam ab68481, Cambridge, MA, USA) or Anti-pIRF3 (S396) (Abcam 125

ab138449, Cambridge, MA, USA) antibodies. The antigen-antibody complexes were 126

visualized using ECL chemiluminescence (Amersham Biosciences/GE 127

Healthcare,Buckinghamshire,UK). On average, three independent experiments were 128

performed, with standard deviations (error bars) and P values determined by the t test. 129

LC-MS/MS analysis 130

Plasmids expressing the Flag-tagged SARS-CoV N protein (Flag-N) were transiently 131

transfected into 293T cells. Twenty-four hours after transfection, cell lysates were 132


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

prepared and subjected to anti-Flag immunoprecipitation, SDS-PAGE and Coomassie 133

Brilliant Blue staining. Protein bands co-precipitated with Flag-N but not control IgG were 134

excised, digested with trypsin, and subjected to liquid chromatography-tandem mass 135

spectrometry (LC-MS/MS, Micromass, Inc.) analysis to identify interacting proteins. The 136

data were compared against SWISSPROT using the Mascot search engine 137

(www.matrixscience.com) for protein identification. 138

NDV-GFP infection assay 139

The GFP-expressing Newcastle disease virus (NDV-GFP) was used to infect cells for 140

the previously described infection efficiency analysis (23). First, A549 cells transfected 141

with or without SARS-CoV N protein were infected with SeV to induce IFN production. 142

Vero cells were incubated with supernatants from the A549 cell culture and were then 143

infected with NDV-GFP at the given viral titers. At 16 h post-infection, the number of 144

GFP-positive cells and the GFP expression levels were analyzed by flow cytometry (BD 145

FACSCalibur). 146

Duolink assay and confocal microscopy 147

Duolink in situ proximity ligation assay (PLA, Duolink Detection kit, Olink Bioscience, 148

Uppsala, Sweden) was used to detect interactions between endogenous TRIM25 and the 149

N protein or endogenous TRIM25 and RIG-I in the cells. Briefly, HeLa cells plated on glass 150

coverslips were transfected with the GFP-N-expressing plasmid. After fixation with 4% 151

formaldehyde, the cells were incubated with rabbit anti-RIG-I (Millipore 4200, MA, USA) or 152

rabbit anti-GFP (Abcam ab183734, Cambridge, MA, USA) and mouse anti-TRIM25 153

(Abcam ab88669, Cambridge, MA, USA) primary antibodies or with anti-TRIM25 antibody 154


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

alone as a control. The Duolink system provides oligonucleotide-labeled secondary 155

antibodies (PLA probes) for each of the primary antibodies. In combination with a DNA 156

amplification-based reporter system, these antibodies generate a signal only when the 157

two primary antibodies are in close proximity (~10 nm). According to the manufacturer's 158

instructions, the signal from each detected pair of primary antibodies was visualized as a 159

fluorescent spot. Slides were evaluated using an LSM 510 META confocal microscope 160

(Carl Zeiss). The cell images were exported in TIF format using the Zeiss LSM Image 161

Browser (Carl Zeiss) for analysis. Interactions per cell were determined with the Duolink 162

image tool developed by Olink Biosciences and were counted in at least three fields. 163

Quantifications were given as the means±S.D. Representative results are shown from 164

experiments repeated three times. 165

Duo-luciferase assays 166

To evaluate expression, 293T cells were seeded into 24-well plates and 167

co-transfected with control plasmids or expression plasmids together with the luciferase 168

reporter plasmid. A 10-ng sample of the pRL Renilla Luciferase Control Reporter Vector 169

(pRL) was included as the control. Twenty-four hours after transfection, the cells were 170

infected with Sendai virus (SeV) at a multiplicity of infection (MOI) of 2 for 16 h. The cell 171

lysates were subjected to luciferase activity analysis using the Dual Luciferase Reporter 172

Assay System (Promega). Total light production was measured using a Monolight 2010 173

luminometer (Analytical Luminescence Laboratory, San Diego, CA, USA). The results are 174

expressed as the means±S.D. of three independent experiments. 175

Virus replication assays 176


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

A549 cells were seeded at a density of 2x106 cells in 25-cm2 flasks (Corning, 177

Corning, NY), and Vero and Calu-3 cells were seeded in 24-well plates (Corning, Corning, 178

NY). After 24 h, the cells were washed with 1x PBS and incubated with medium containing 179

SARS-CoV at an MOI of 0.05 plaque-forming units (PFU) per cell (in each cell type) in a 180

1-ml volume for 45 min at 37°C. The medium was removed, the cells were washed twice 181

with 1x PBS, and medium containing 2% FBS was added. Anti-IFN-β antibody (Abcam, 182

ab6979, Cambridge, MA, USA) was used to neutralize IFN-β in Calu-3 cells at a 183

concentration of 2.7 µg/ml. At the indicated time points post-infection, supernatant from 184

each flask was subjected to RNA extraction using TRIzol reagent (Invitrogen, Carlsbad, 185

CA, USA) and reverse transcription using the ReverTra Ace qPCR RT Master Mix 186

(FSQ-201, TOYOBO) with the reverse primer given below. The TIANGEN SuperReal 187

Premix (Probe) was used for quantitative nucleic acid amplification with specific primers in 188

a Bio-Rad IQ5 Optical System. CT values were compared to a series of dilutions of 189

standard samples. The primers used for quantifying SARS-CoV subgenomic mRNA 5 (M 190

gene) are as follows: forward primer (5’-CTCTTCTGAAGGAGTTCCTGAT-3’), reverse 191

primer (5’-GACAGCAGCAAGCACAAAACAA-3’), and FAM probe 192

(5’-GGCTCTTGTGGCCAGTAACACTT-3’). Viral titers in the supernatants were calculated 193

as previously described using RT-PCR (26, 27). 194

All experiments with SARS-CoV were performed in a Biosafety Level 3 laboratory. 195

196

Results 197

The SARS-CoV N protein interacts with TRIM25 198


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

To investigate the cellular interaction partners of the SARS-CoV N protein in humans, 199

lysates from 293T cells that exogenously expressed the Flag-N protein or Flag-vector 200

control were immunoprecipitated with an anti-Flag antibody. The immunoprecipitates were 201

subjected to SDS-PAGE and Coomassie Brilliant Blue staining (Fig. 1A). Stained bands 202

that appeared in the Flag-N, but not the control immunoprecipitates, were subjected to 203

trypsin digestion and LC/MS/MS analysis. Two TRIM25 peptides in the indicated band 204

were identified by a Mascot search (http://www.matrixscience.com). These results 205

suggested that TRIM25, the E3 ligase for RIG-I ubiquitination that plays a vital role in the 206

innate immune response to RNA virus infection, was detected in the Flag-N 207

immunoprecipitates and that is might associate with the SARS-CoV N protein (Fig. 1B). 208

The interaction between the SARS-CoV N protein and TRIM25 was verified by 209

immunoblotting. Endogenous TRIM25 was co-immunoprecipitated with Flag-N but not 210

with the Flag-vector control, with or without SeV infection (Fig. 1C). Moreover, an 211

interaction between exogenous Flag-TRIM25 and the Myc-N protein was observed by 212

immunoblotting anti-Flag immunoprecipitates with the anti-Myc antibody (Fig. 1D). Further, 213

to demonstrate the association between the SARS-CoV N protein and endogenous 214

TRIM25 in situ, HeLa cells expressing GFP-N or GFP alone were subjected to a 215

Duolink-based in situ PLA followed by confocal microscopy. PLA-positive signals (red 216

points) indicated that co-localization of the SARS-CoV N protein (but not GFP) and 217

endogenous TRIM25 were exclusively observed in the cytoplasm. This distribution was 218

similar to that observed for the SARS-CoV N protein (Fig. 1E). These data collectively 219

showed that TRIM25 was an association partner of the SARS-CoV N protein in human 220


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

cells. 221

The C-terminus of the SARS-CoV N protein interacts with the TRIM25 SPRY domain 222

To investigate the interaction between TRIM25 and the SARS-CoV N protein, 223

GFP-tagged truncated fragments of the SARS-CoV N protein (1-175, 176-251, 252-361, 224

and 362-422 a.a.) were co-transfected with Flag-TRIM25 into 293T cells. The C-terminus 225

of SARS-CoV N (362-422 a.a.), but not the other truncated regions, was responsible for 226

the TRIM25 association (Fig. 2A). Reciprocally, we also produced Flag-tagged TRIM25 227

truncated proteins containing SPRY, B Box/CCD, or RING domains and found that only 228

the SPRY domain was involved in the SARS-CoV N association (Fig. 2B and Fig. 2C). 229

Furthermore, a Flag-tagged SPRY domain with deleted TRIM25 (Flag-del-SPRY) failed to 230

interact with the N protein (Fig. 2C). These findings clearly defined the interaction domains 231

that contributed to the association of the two proteins. 232

The SARS-CoV N protein interferes with the TRIM25–RIG-I interaction 233

The TRIM25 SPRY and RING domains have been reported to be involved in the 234

interaction with the RIG-I N-terminal CARD domains and E2 ubiquitin-conjugating 235

enzymes, respectively(28). Due to the association of the TRIM25 SPRY domain with the 236

SARS-CoV N protein, we hypothesized that SPRY domain-mediated RIG-1 binding might 237

be competitively regulated by the SARS-CoV N protein. To investigate this hypothesis, 238

Flag-RIG-I and Myc-TRIM25 were co-expressed with or without Myc-N in 293T cells. The 239

interaction between RIG-I and TRIM25 was substantially attenuated by co-expression of 240

the SARS-CoV N protein in a dose-dependent manner (Fig. 3A-3B). Additionally, the in 241

situ PLA analysis demonstrated that the interaction between endogenous RIG-I and 242


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

TRIM25 was decreased by exogenous SARS-CoV N expression but not by GFP 243

expression (Fig. 3C-3D). These results collectively indicated that the SARS-CoV N protein 244

competitively bound to the TRIM25 SPRY domain and interfered with the association 245

between TRIM25 and its ubiquitination substrate RIG-I. 246

The SARS-CoV N protein suppresses RIG-I ubiquitination 247

Next, we investigated whether TRIM25-mediated RIG-I ubiquitination at the 248

N-terminal CARD domain was regulated by the SARS-CoV N protein. Lysates prepared 249

from 293T cells co-transfected with Flag-RIG-I, HA-Ub and the indicated amount of the 250

Myc-N expression plasmids were immunoprecipitated with an anti-Flag antibody and 251

analyzed by immunoblotting with anti-HA or anti-Flag. As previously reported, 252

TRIM25-mediated RIG-I ubiquitination was potentiated by SeV infection but was 253

substantially suppressed by increasing SARS-CoV N protein expression (Fig. 4A) in a 254

dose-dependent manner. In agreement with this result, the ubiquitination of the two-CARD 255

domains of RIG-I was similarly inhibited by exogenous N protein expression (Fig. 4B). 256

Phosphorylation of IRF3 Ser(396) plays an essential role in IRF-3 activation responses to 257

virus infection (29). In concert, IRF3(S396) phosphorylation induced by the 258

overexpression of the two-CARD domains of RIG-I was suppressed by the SARS-CoV N 259

protein (Fig. 4C). Notably, the suppression of RIG-I ubiquitination by the SARS-CoV N 260

protein could be partially rescued by TRIM25 overexpression (Fig. 4D). These results 261

indicated that competitive binding of TRIM25 by the SARS-CoV N protein interfered with 262

TRIM25’s association with its ubiquitination substrate, thereby inhibiting RIG-I 263

ubiquitination and activation in a SARS-CoV N dose-dependent manner. 264


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

The SARS-CoV N protein suppresses type I IFN production 265

RIG-I is activated by TRIM25-mediated ubiquitination, which plays a vital role in 266

virus-induced type I IFN production. To examine the regulation of RIG-I activity by the 267

SARS-CoV N protein, we constructed a luciferase reporter under control of the IFN-β 268

promoter (IFN-β-Luc) to quantify IFN-β promoter activation. In concert with the inhibition of 269

RIG-I ubiquitination by the N protein, IFN-β promoter activation induced by RIG-I CARD 270

domain overexpression was significantly inhibited by SARS-CoV N expression in a 271

dose-dependent manner (Fig. 5A). However, co-expression of TRIM25 with SARS-CoV N 272

counteracted the inhibition caused by the N protein (Fig. 5B). Similarly, IFN-β promoter 273

activation induced by SeV infection was suppressed by the SARS-CoV N protein in a 274

dose-dependent manner (Fig. 5C). Both the IFN-β transcription and expression levels 275

could be suppressed by the N protein and rescued by TRIM25 overexpression (Fig. 276

5D-5E). Next, we investigated whether the inhibition of IFN production by the N protein 277

was dependent on the TRIM25 association. Only full-length N and the 362-422 a.a. 278

fragment that could interact with TRIM25, but not the other truncated fragments, were 279

responsible for the suppression of IFN-β production (Fig. 5F). Accordingly, the 280

transcriptional activity of the IFN-responsive sequence element (IRSE) and the 281

transcription of IFN-stimulated gene 15 (ISG15), ISG56 and IP10, which greatly depend 282

on the cellular IFN level, were similarly inhibited by the SARS-CoV N protein and partially 283

recovered by TRIM25 overexpression (Fig. 5G to J). 284

Because the SARS-CoV N protein suppressed the production of IFN induced by SeV, 285

we next investigated whether viral infection and proliferation were regulated by the N 286


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

protein. First, A549 cells exogenously expressing Myc-N or Myc-vector were infected (or 287

not, in the control) with SeV for 16 h to induce IFN production. In concert with the previous 288

finding, SeV-induced IFN-β transcription in A549 cells was suppressed by the SARS-CoV 289

N protein. IFN-β sensitive Vero E6 cells were pre-incubated with the above-mentioned 290

A549 cell culture supernatants for 4 h and then infected with GFP expressing NDV 291

(NDV-GFP). The proliferation of NDV-GFP in Vero E6 cells was determined by the 292

GFP-positive cell number and the fluorescence intensity detected by flow cytometry. As 293

shown in Fig. 5K, Vero E6 cells pre-incubated with SeV-infected A549 cell culture 294

supernatants showed a significantly decreased NDV-GFP infection rate compared with 295

Vero E6 cells pre-incubated with the normal A549 cell culture supernatant without SeV 296

infection (~73.1% vs ~27.8%). This difference was due to the antiviral activity of the 297

IFN-β released by the SeV-infected A549 cells (Fig. 5K, left and middle). In accordance 298

with the finding that the N protein inhibits IFN production (Fig. 5A~5E), a much higher 299

NDV-GFP infection rate was observed in Vero E6 cells pre-incubated with the supernatant 300

collected from SeV-infected A549 cells expressing the SARS-CoV N protein (~49.2% vs 301

27.8%) (Fig. 5K). Additionally, the NDV infection rate was increased in an N-protein 302

dose-dependent manner (Fig. 5L) and was compromised when TRIM25 was 303

co-expressed with the N protein (Fig. 5M). These results demonstrated that the 304

SARS-CoV N-protein-mediated inhibition of IFN production relied on its host cell 305

association partner TRIM25. 306

307

N protein promotes virus replication by inhibiting TRIM25-mediated IFN-β 308


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

production. 309

Next, we investigated the function of TRIM25 in SARS-CoV infection and proliferation 310

in human cells using the de novo synthesized recombinant SARS-CoV strain v2163 (30). 311

A549 cells were transfected with a TRIM25-targeting siRNA or scrambled siRNA for 48 h, 312

resulting in ~70% TRIM25 knockdown (Fig. 6A). The siRNA-transfected cells were 313

infected with recombinant SARS-CoV at a dose of 0.05 PFU per cell for 24 h. The virus 314

particles released into the cell culture supernatant were collected, and the genomic RNA 315

copy numbers were determined by qPCR. Compared with the scrambled siRNA, the 316

TRIM25-targeting siRNA resulted in a significantly higher SARS-CoV titer in A549 cells 317

(Fig. 6A). TRIM25 overexpression reduced SARS-CoV release in A549 cells (Fig. 6B). 318

These results suggested that higher TRIM25 levels may compensate the activity inhibition 319

of RIG-I ubiquitination mediated by the viral N protein because the N protein suppressed 320

RIG-I ubiquitination in a dose-dependent manner. Thus, a higher N protein:TRIM25 ratio 321

should contribute more suppression. Further, A549 cells were transfected with full-length 322

N protein or N-terminal (1-361); 24 h later, cells were infected with SARS-CoV. 323

Twenty-four hours post-infection, the viral genomic RNA copy numbers were determined 324

by qPCR. Overexpression of full-length N protein led to a higher viral genomic copy 325

number compared with the N protein N-terminal version in A549 cells (Fig. 6C). 326

SARS-CoV can productively infect the human bronchial epithelium Calu-3 cell line and 327

shows more sensitivity to IFN treatment (31, 32). To further study the effect of the N 328

protein on SARS-CoV replication, Calu-3 cells were transfected with full-length N protein 329

or its N-terminal (1-361) truncation, which do not interact with TRIM25. At 24 h 330


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

post-transfection, cells were infected with SARS-CoV for the indicated time in the 331

presence/absence of IFN-β-specific neutralization antibody at a concentration of 2.7 µg/ml. 332

Compared with the N-terminus of the N protein, the full-length N protein showed little, if 333

any, effect on viral replication in the presence of the IFN-β-specific neutralization antibody, 334

while a much higher viral titer was observed in the cells overexpressing full-length N 335

protein in the absence of IFN-β antibody, suggesting that the overexpressed N protein 336

promoted viral replication by suppressing IFN production (Fig. 6D). Unexpectedly, a lower 337

viral titer was observed (data not shown) in the cells expressing the C-terminal N protein, 338

possibly due to the incorporation of this protein into a nucleocapsid that may block the 339

formation of functionally infectious virus, since the C-terminal N protein plays vital roles in 340

N protein polymerization (14, 33). 341

MERS-CoV N protein interaction with TRIM25 342

MERS-CoV is a new human coronavirus, discovered in the Middle East in 2012, with 343

high lethality, that is comparable to SARS-CoV in many aspects (34). The SARS-CoV N 344

shares only 20-30% homology with the N proteins of other known coronaviruses (35), 345

except SARS-like bat viruses, including HKU4, HKU5, and MERS-CoV (40-50%) (36, 37). 346

To test whether MERS-CoV could interact with TRIM25 and suppress IFN-β expression, 347

lysates from cells expressing Flag-TRIM25 and GFP-MERS-N or GFP as a control were 348

subjected to immunoprecipitation with anti-Flag, and the immunoprecipitates were 349

immunoblotted with anti-Flag and anti-GFP. GFP-MERS-N, but not GFP, co-precipitated 350

with Flag-TRIM25 (Fig. 7A). Similar to the SARS-CoV N protein, the C-terminal part of the 351

MERS-CoV N protein interacted with TRIM25 (Fig. 7B). The Flag-2CARD of 352


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

RIG-I-induced IFN production was suppressed by the MERS-N protein in a 353

dose-dependent manner (Fig. 7C). Unlike the SARS-CoV N protein, both the N- and 354

C-terminal portions of the MERS-CoV N protein suppressed RIG-I-induced IFN production 355

(Fig. 7D), suggesting that the MERS-CoV N protein interferes with IFN production by 356

interacting with TRIM25, similar to SARS-CoV and other unidentified pathways. 357

358

Discussion 359

Most human coronaviruses cause mild infections, but the outbreaks of SARS in 2003 360

and MERS in 2012 represented highly lethal coronavirus epidemics. SARS-CoV and 361

MERS-CoV have similar genome structures, viral growth kinetics and clinical 362

presentations (32). Therefore, understanding the virulence mechanisms and microbe-host 363

interactions of these pathogens will be beneficial for the development of effective 364

therapies to control outbreaks of similar coronaviruses in the future (36, 38, 39). 365

Inhibition of IFN production and function plays key roles for virus to escape from the 366

innate immunity. Previous studies have shown that both SARS-CoV and MERS-CoV 367

failed to elicit strong IFN expression during the innate immune response. Viral infection 368

failed to induce transcription of type I interferon in peripheral blood mononuclear cells 369

(PBMCs) derived from SARS patients and in MERS-CoV infected ex vivo respiratory 370

tissues (40, 41). Elderly patients got bad overcome in SARS and MERS infection, 371

especially for those who were immunocompromised (42). Several SARS-CoV encoded 372

proteins such as nsp1, nsp7, nsp15, PLpro, M, ORF3b, ORF6, and ORF9b were found to 373

antagonize IFN production by different pathways (43). MERS-COV 4a protein suppresses 374


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

PACT-induced activation of RIG-I and MDA5 in the innate antiviral responses (44, 45), 375

and its M protein, ORF 4a, ORF 4b, and ORF 5 inhibit the nuclear trafficking and 376

activation of IRF3, and the activity of NF-κB and ISRE promoter (46). Another well studied 377

coronavirus, murine coronavirus mouse hepatitis virus (MHV), could induces type I 378

interferon expression dependent on RIG-I recognition. Notably, the nucleocapsid protein 379

of MHV, which shares ~34% homology with that of SARS-CoV, is also regarded as a type I 380

IFN antagonist by interfering with RNase L activity associated with the induction of 2’-5’ 381

OAS (47). 382

Our work demonstrated that the N proteins of SARS-CoV could inhibit IFN-β 383

production by interaction with TRIM25, therefore suppress TRIM25-mediated RIG-I 384

activation by ubiquitination, which provides in-depth insight into the mechanism of 385

SARS-CoV-induced innate immune suppression. MERS-CoV N protein was also 386

demonstrated to interact with TRIM25 and to inhibit IFN-β promoter activity, which 387

suggests that the N protein of MERS may be involved in IFN production in a way similar 388

with SARS-CoV. 389

TRIM family proteins contain at least three domains [an N-terminal RING domain, 390

one or two B-boxes and a central coiled-coil domain (CCD)]. Most human TRIM proteins 391

also contain a SPRY domain that is involved in broad biological processes, including 392

diverse cellular functions and antiviral and antimicrobial activity (48-50). As an ubiquitin E3 393

ligase, TRIM25 plays a crucial role in the RIG-I-mediated activation of the type I IFN 394

pathway(28). TRIM25 acts as an E3 ubiquitin ligase in both MAVS ubiquitination and 395

degradation (51). TRIM25 is also required for full NF-κB activation by ubiquitinating 396


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

TRAF6 (52). Targeting TRIM25 is an efficient approach to inhibit the IFN-signaling 397

pathway. The NS1 protein of influenza A virus was reported to inhibit RIG-I activation by 398

targeting the TRIM25 B Box/CCD domains (4). In addition to the interactions of viral 399

proteins, the subgenomic flavivirus RNA (sfRNA) of PR-2B serotype 2 (DENV-2) binds to 400

TRIM25, prevents its deubiquitylation, and results in the inhibition of RIG-I activation and, 401

thus, IFN expression (53). Previous studies have suggested that the SARS-CoV N protein 402

is capable of inhibiting IFN-β production by blocking the RIG-I signaling pathway, and the 403

N protein of SARS-CoV was found to inhibit IRF3 activation induced by SeV (21, 54). 404

Antagonism of IFN induction by the N protein was further mapped to the C-terminus of the 405

protein, while the N protein was shown not to interact with RIG-I and MDA5 (55). In this 406

study, we show that the N protein of SARS-CoV suppressed IFN-β production by targeting 407

the SPRY domain of TRIM25 and disturbing interaction between this SPRY domain and 408

the N-terminal CARDs of RIG-I, resulting in the inhibition of RIG-I ubiquitination and 409

downstream signaling, and ultimately the production of type I interferon (Fig. 8). 410

Considering that the inhibition of interferon production is mediated by the association of 411

Trim25 with N protein, an abolished inhibition should be observed by infection with a 412

recombinant virus bearing point mutation of N protein that doesn't bind Trim25, but it was 413

failed since no virus could be successfully rescued with such N protein mutant because of 414

the impaired functions. 415

Proteins of SARS-CoV including the N protein suppress innate immunity by inhibiting 416

IFN production other than blocking IFN responses, suggesting that type I interferon may 417

be employed for the treatment of early stage SARS infection. Administration of type I 418


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

interferon in BALB/c mice before or at the initial stage of SARS-CoV infection resulted in 419

reduced virus titer, limited inflammatory response and mild clinical disease (56). Type I 420

interferon treatment also improves outcome of SARS-CoV and MERS-CoV infection in 421

non-human primate models (57, 58), and has also been used in several clinical practices, 422

together with other drugs(59-61). 423

In conclusion, our results provide evidence for the mechanism by which the 424

SARS-CoV (and also MERS-CoV) N proteins inhibit RIG-I ubiquitination and thus 425

suppress the release of type I IFN. The results help us to understand the pathogenicity of 426

highly dangerous coronaviruses. 427

428

Author Contributions 429

Yong Hu, Wei Li, Ting Gao and Yan Cui performed the experiments. Qingjun Ma, 430

Xuan Liu and Cheng Cao designed and supervised the research. Yanwen Jin and Ping Li 431

developed the protocols and provided reagents. 432

433

Acknowledgements 434

This investigation was supported by grant 2016YFC1202400 and 2012CB518900 435

awarded by the Ministry of Science and Technology of China, grant 30871240 and 436

81550001 awarded by the Natural Science Foundation of China. The authors declare no 437

conflicts of interest. 438

439

440


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

References 441

1. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung 442 A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh C-S, Reis e Sousa C, 443 Matsuura Y, Fujita T, Akira S. 2006. Differential roles of MDA5 and RIG-I helicases in 444 the recognition of RNA viruses. Nature 441:101-105. 445

2. Chan YK, Gack MU. 2016. Viral evasion of intracellular DNA and RNA sensing. Nat 446 Rev Microbiol 14:360-373. 447

3. Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, Reis e Sousa C. 448 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 449 5'-phosphates. Science 314:997-1001. 450

4. Gack MU, Albrecht RA, Urano T, Inn K-S, Huang IC, Carnero E, Farzan M, Inoue S, 451 Jung JU, García-Sastre A. 2009. Influenza A virus NS1 targets the ubiquitin ligase 452 TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 453 5:439-449. 454

5. Jiang F, Ramanathan A, Miller MT, Tang G-Q, Gale M, Patel SS, Marcotrigiano J. 2011. 455 Structural basis of RNA recognition and activation by innate immune receptor RIG-I. 456 Nature 479:423-427. 457

6. Schneider WM, Chevillotte MD, Rice CM. 2014. Interferon-stimulated genes: a 458 complex web of host defenses. Annu Rev Immunol 32:513-545. 459

7. Akira S, Uematsu S, Takeuchi O. 2006. Pathogen recognition and innate immunity. 460 Cell 124:783-801. 461

8. Bowie AG, Unterholzner L. 2008. Viral evasion and subversion of pattern-recognition 462 receptor signalling. Nat Rev Immunol 8:911-922. 463

9. Katze MG, He Y, Gale M, Jr. 2002. Viruses and interferon: a fight for supremacy. Nat 464 Rev Immunol 2:675-687. 465

10. Lai MM. 2003. SARS virus: the beginning of the unraveling of a new coronavirus. J 466 Biomed Sci 10:664-675. 467

11. Becker MM, Graham RL, Donaldson EF, Rockx B, Sims AC, Sheahan T, Pickles RJ, 468 Corti D, Johnston RE, Baric RS, Denison MR. 2008. Synthetic recombinant bat 469 SARS-like coronavirus is infectious in cultured cells and in mice. Proc Natl Acad Sci U 470 S A 105:19944-19949. 471

12. Chen CY, Chang CK, Chang YW, Sue SC, Bai HI, Riang L, Hsiao CD, Huang TH. 472 2007. Structure of the SARS coronavirus nucleocapsid protein RNA-binding 473 dimerization domain suggests a mechanism for helical packaging of viral RNA. J Mol 474 Biol 368:1075-1086. 475

13. Huang Q, Yu L, Petros AM, Gunasekera A, Liu Z, Xu N, Hajduk P, Mack J, Fesik SW, 476 Olejniczak ET. 2004. Structure of the N-terminal RNA-binding domain of the SARS 477 CoV nucleocapsid protein. Biochemistry 43:6059-6063. 478

14. Surjit M, Liu B, Kumar P, Chow VT, Lal SK. 2004. The nucleocapsid protein of the 479 SARS coronavirus is capable of self-association through a C-terminal 209 amino acid 480 interaction domain. Biochem Biophys Res Commun 317:1030-1036. 481

15. He R, Leeson A, Ballantine M, Andonov A, Baker L, Dobie F, Li Y, Bastien N, 482 Feldmann H, Strocher U, Theriault S, Cutts T, Cao J, Booth TF, Plummer FA, Tyler S, 483


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Li X. 2004. Characterization of protein-protein interactions between the nucleocapsid 484 protein and membrane protein of the SARS coronavirus. Virus Res 105:121-125. 485

16. Hatakeyama S, Matsuoka Y, Ueshiba H, Komatsu N, Itoh K, Shichijo S, Kanai T, 486 Fukushi M, Ishida I, Kirikae T, Sasazuki T, Miyoshi-Akiyama T. 2008. Dissection and 487 identification of regions required to form pseudoparticles by the interaction between 488 the nucleocapsid (N) and membrane (M) proteins of SARS coronavirus. Virology 489 380:99-108. 490

17. Yan X, Hao Q, Mu Y, Timani KA, Ye L, Zhu Y, Wu J. 2006. Nucleocapsid protein of 491 SARS-CoV activates the expression of cyclooxygenase-2 by binding directly to 492 regulatory elements for nuclear factor-kappa B and CCAAT/enhancer binding protein. 493 Int J Biochem Cell Biol 38:1417-1428. 494

18. Wang Q, Li C, Zhang Q, Wang T, Li J, Guan W, Yu J, Liang M, Li D. 2010. Interactions 495 of SARS coronavirus nucleocapsid protein with the host cell proteasome subunit p42. 496 Virol J 7:99. 497

19. Frieman M, Heise M, Baric R. 2008. SARS coronavirus and innate immunity. Virus 498 Res 133:101-112. 499

20. Chang CK, Hsu YL, Chang YH, Chao FA, Wu MC, Huang YS, Hu CK, Huang TH. 500 2009. Multiple nucleic acid binding sites and intrinsic disorder of severe acute 501 respiratory syndrome coronavirus nucleocapsid protein: implications for 502 ribonucleocapsid protein packaging. J Virol 83:2255-2264. 503

21. Kopecky-Bromberg SA, Martinez-Sobrido L, Frieman M, Baric RA, Palese P. 2007. 504 Severe acute respiratory syndrome coronavirus open reading frame (ORF) 3b, ORF 6, 505 and nucleocapsid proteins function as interferon antagonists. J Virol 81:548-557. 506

22. Bitzer M, Lauer U, Baumann C, Spiegel M, Gregor M, Neubert WJ. 1997. Sendai virus 507 efficiently infects cells via the asialoglycoprotein receptor and requires the presence of 508 cleaved F0 precursor proteins for this alternative route of cell entry. J Virol 509 71:5481-5486. 510

23. Park MS, Shaw ML, Munoz-Jordan J, Cros JF, Nakaya T, Bouvier N, Palese P, 511 Garcia-Sastre A, Basler CF. 2003. Newcastle disease virus (NDV)-based assay 512 demonstrates interferon-antagonist activity for the NDV V protein and the Nipah virus 513 V, W, and C proteins. J Virol 77:1501-1511. 514

24. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using 515 real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25:402-408. 516

25. Cao C, Leng Y, Kufe D. 2003. Catalase activity is regulated by c-Abl and Arg in the 517 oxidative stress response. J Biol Chem 278:29667-29675. 518

26. Mossel EC, Wang J, Jeffers S, Edeen KE, Wang S, Cosgrove GP, Funk CJ, Manzer R, 519 Miura TA, Pearson LD, Holmes KV, Mason RJ. 2008. SARS-CoV replicates in primary 520 human alveolar type II cell cultures but not in type I-like cells. Virology 372:127-135. 521

27. Gillim-Ross L, Taylor J, Scholl DR, Ridenour J, Masters PS, Wentworth DE. 2004. 522 Discovery of novel human and animal cells infected by the severe acute respiratory 523 syndrome coronavirus by replication-specific multiplex reverse transcription-PCR. J 524 Clin Microbiol 42:3196-3206. 525

28. Gack MU, Shin YC, Joo CH, Urano T, Liang C, Sun L, Takeuchi O, Akira S, Chen Z, 526 Inoue S, Jung JU. 2007. TRIM25 RING-finger E3 ubiquitin ligase is essential for 527


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

RIG-I-mediated antiviral activity. Nature 446:916-920. 528 29. Servant MJ, Grandvaux N, tenOever BR, Duguay D, Lin R, Hiscott J. 2003. 529

Identification of the minimal phosphoacceptor site required for in vivo activation of 530 interferon regulatory factor 3 in response to virus and double-stranded RNA. J Biol 531 Chem 278:9441-9447. 532

30. Day CW, Baric R, Cai SX, Frieman M, Kumaki Y, Morrey JD, Smee DF, Barnard DL. 533 2009. A new mouse-adapted strain of SARS-CoV as a lethal model for evaluating 534 antiviral agents in vitro and in vivo. Virology 395:210-222. 535

31. Kumaki Y, Day CW, Wandersee MK, Schow BP, Madsen JS, Grant D, Roth JP, Smee 536 DF, Blatt LM, Barnard DL. 2008. Interferon alfacon 1 inhibits SARS-CoV infection in 537 human bronchial epithelial Calu-3 cells. Biochem Biophys Res Commun 371:110-113. 538

32. Zielecki F, Weber M, Eickmann M, Spiegelberg L, Zaki AM, Matrosovich M, Becker S, 539 Weber F. 2013. Human cell tropism and innate immune system interactions of human 540 respiratory coronavirus EMC compared to those of severe acute respiratory syndrome 541 coronavirus. J Virol 87:5300-5304. 542

33. Luo H, Chen J, Chen K, Shen X, Jiang H. 2006. Carboxyl terminus of severe acute 543 respiratory syndrome coronavirus nucleocapsid protein: self-association analysis and 544 nucleic acid binding characterization. Biochemistry 45:11827-11835. 545

34. Durai P, Batool M, Shah M, Choi S. 2015. Middle East respiratory syndrome 546 coronavirus: transmission, virology and therapeutic targeting to aid in outbreak control. 547 Exp Mol Med 47:e181. 548

35. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, Penaranda S, 549 Bankamp B, Maher K, Chen MH, Tong S, Tamin A, Lowe L, Frace M, DeRisi JL, Chen 550 Q, Wang D, Erdman DD, Peret TC, Burns C, Ksiazek TG, Rollin PE, Sanchez A, Liffick 551 S, Holloway B, Limor J, McCaustland K, Olsen-Rasmussen M, Fouchier R, Gunther S, 552 Osterhaus AD, Drosten C, Pallansch MA, Anderson LJ, Bellini WJ. 2003. 553 Characterization of a novel coronavirus associated with severe acute respiratory 554 syndrome. Science 300:1394-1399. 555

36. Lu G, Liu D. 2012. SARS-like virus in the Middle East: a truly bat-related coronavirus 556 causing human diseases. Protein Cell 3:803-805. 557

37. Hu B, Ge X, Wang LF, Shi Z. 2015. Bat origin of human coronaviruses. Virol J 12:221. 558 38. Subissi L, Posthuma CC, Collet A, Zevenhoven-Dobbe JC, Gorbalenya AE, Decroly E, 559

Snijder EJ, Canard B, Imbert I. 2014. One severe acute respiratory syndrome 560 coronavirus protein complex integrates processive RNA polymerase and exonuclease 561 activities. Proc Natl Acad Sci U S A 111:E3900-3909. 562

39. Honda-Okubo Y, Barnard D, Ong CH, Peng BH, Tseng CT, Petrovsky N. 2015. Severe 563 acute respiratory syndrome-associated coronavirus vaccines formulated with delta 564 inulin adjuvants provide enhanced protection while ameliorating lung eosinophilic 565 immunopathology. J Virol 89:2995-3007. 566

40. Reghunathan R, Jayapal M, Hsu LY, Chng HH, Tai D, Leung BP, Melendez AJ. 2005. 567 Expression profile of immune response genes in patients with Severe Acute 568 Respiratory Syndrome. BMC Immunol 6:2. 569

41. Chan RW, Chan MC, Agnihothram S, Chan LL, Kuok DI, Fong JH, Guan Y, Poon LL, 570 Baric RS, Nicholls JM, Peiris JS. 2013. Tropism of and innate immune responses to 571


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

the novel human betacoronavirus lineage C virus in human ex vivo respiratory organ 572 cultures. J Virol 87:6604-6614. 573

42. Graham RL, Donaldson EF, Baric RS. 2013. A decade after SARS: strategies for 574 controlling emerging coronaviruses. Nat Rev Microbiol 11:836-848. 575

43. Jauregui AR, Savalia D, Lowry VK, Farrell CM, Wathelet MG. 2013. Identification of 576 residues of SARS-CoV nsp1 that differentially affect inhibition of gene expression and 577 antiviral signaling. PLoS One 8:e62416. 578

44. Siu KL, Yeung ML, Kok KH, Yuen KS, Kew C, Lui PY, Chan CP, Tse H, Woo PC, Yuen 579 KY, Jin DY. 2014. Middle east respiratory syndrome coronavirus 4a protein is a 580 double-stranded RNA-binding protein that suppresses PACT-induced activation of 581 RIG-I and MDA5 in the innate antiviral response. J Virol 88:4866-4876. 582

45. Niemeyer D, Zillinger T, Muth D, Zielecki F, Horvath G, Suliman T, Barchet W, Weber F, 583 Drosten C, Muller MA. 2013. Middle East respiratory syndrome coronavirus accessory 584 protein 4a is a type I interferon antagonist. J Virol 87:12489-12495. 585

46. Yang Y, Zhang L, Geng H, Deng Y, Huang B, Guo Y, Zhao Z, Tan W. 2013. The 586 structural and accessory proteins M, ORF 4a, ORF 4b, and ORF 5 of Middle East 587 respiratory syndrome coronavirus (MERS-CoV) are potent interferon antagonists. 588 Protein Cell 4:951-961. 589

47. Ye Y, Hauns K, Langland JO, Jacobs BL, Hogue BG. 2007. Mouse hepatitis 590 coronavirus A59 nucleocapsid protein is a type I interferon antagonist. J Virol 591 81:2554-2563. 592

48. Munir M. 2010. TRIM proteins: another class of viral victims. Sci Signal 3:jc2. 593 49. Nisole S, Stoye JP, Saib A. 2005. TRIM family proteins: retroviral restriction and 594

antiviral defence. Nat Rev Microbiol 3:799-808. 595 50. Ozato K, Shin DM, Chang TH, Morse HC, 3rd. 2008. TRIM family proteins and their 596

emerging roles in innate immunity. Nat Rev Immunol 8:849-860. 597 51. Castanier C, Zemirli N, Portier A, Garcin D, Bidere N, Vazquez A, Arnoult D. 2012. 598

MAVS ubiquitination by the E3 ligase TRIM25 and degradation by the proteasome is 599 involved in type I interferon production after activation of the antiviral RIG-I-like 600 receptors. BMC Biol 10:44. 601

52. Lee NR, Kim HI, Choi MS, Yi CM, Inn KS. 2015. Regulation of MDA5-MAVS Antiviral 602 Signaling Axis by TRIM25 through TRAF6-Mediated NF-kappaB Activation. Mol Cells 603 38:759-764. 604

53. Manokaran G, Finol E, Wang C, Gunaratne J, Bahl J, Ong EZ, Tan HC, Sessions OM, 605 Ward AM, Gubler DJ, Harris E, Garcia-Blanco MA, Ooi EE. 2015. Dengue subgenomic 606 RNA binds TRIM25 to inhibit interferon expression for epidemiological fitness. Science 607 350:217-221. 608

54. Totura AL, Baric RS. 2012. SARS coronavirus pathogenesis: host innate immune 609 responses and viral antagonism of interferon. Curr Opin Virol 2:264-275. 610

55. Lu X, Pan J, Tao J, Guo D. 2011. SARS-CoV nucleocapsid protein antagonizes 611 IFN-beta response by targeting initial step of IFN-beta induction pathway, and its 612 C-terminal region is critical for the antagonism. Virus Genes 42:37-45. 613

56. Channappanavar R, Fehr AR, Vijay R, Mack M, Zhao J, Meyerholz DK, Perlman S. 614 2016. Dysregulated Type I Interferon and Inflammatory Monocyte-Macrophage 615


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Responses Cause Lethal Pneumonia in SARS-CoV-Infected Mice. Cell Host Microbe 616 19:181-193. 617

57. Haagmans BL, Kuiken T, Martina BE, Fouchier RA, Rimmelzwaan GF, van 618 Amerongen G, van Riel D, de Jong T, Itamura S, Chan KH, Tashiro M, Osterhaus AD. 619 2004. Pegylated interferon-alpha protects type 1 pneumocytes against SARS 620 coronavirus infection in macaques. Nat Med 10:290-293. 621

58. Chan JF, Yao Y, Yeung ML, Deng W, Bao L, Jia L, Li F, Xiao C, Gao H, Yu P, Cai JP, 622 Chu H, Zhou J, Chen H, Qin C, Yuen KY. 2015. Treatment With Lopinavir/Ritonavir or 623 Interferon-beta1b Improves Outcome of MERS-CoV Infection in a Nonhuman Primate 624 Model of Common Marmoset. J Infect Dis 212:1904-1913. 625

59. Loutfy MR, Blatt LM, Siminovitch KA, Ward S, Wolff B, Lho H, Pham DH, Deif H, 626 LaMere EA, Chang M, Kain KC, Farcas GA, Ferguson P, Latchford M, Levy G, Dennis 627 JW, Lai EK, Fish EN. 2003. Interferon alfacon-1 plus corticosteroids in severe acute 628 respiratory syndrome: a preliminary study. JAMA 290:3222-3228. 629

60. Zhao Z, Zhang F, Xu M, Huang K, Zhong W, Cai W, Yin Z, Huang S, Deng Z, Wei M, 630 Xiong J, Hawkey PM. 2003. Description and clinical treatment of an early outbreak of 631 severe acute respiratory syndrome (SARS) in Guangzhou, PR China. J Med Microbiol 632 52:715-720. 633

61. Al-Tawfiq JA, Momattin H, Dib J, Memish ZA. 2014. Ribavirin and interferon therapy in 634 patients infected with the Middle East respiratory syndrome coronavirus: an 635 observational study. Int J Infect Dis 20:42-46. 636

637

Figure 1. SARS-CoV N protein interacts with TRIM25. 638

(A) Cell extracts prepared from 293T cells transfected with Flag-SARS N protein (Flag-N) 639

or Flag vector were subjected to anti-Flag immunoprecipitation. The 640

immunoprecipitates were resolved using SDS-PAGE electrophoresis and Coomassie 641

blue staining. 642

(B) The stained bands marked by arrows in Figure 1A were digested with trypsin and 643

analyzed by LC-MS/MS. Two peptides (SDLGAVAKGLSGELGTR and EPEELGK) 644

matching the TRIM25 protein sequence were identified. 645

(C)-(D) 293T cells transfected with the indicated plasmids were infected with or without 646

SeV (C), and the cell lysates were subjected to anti-Flag immunoprecipitation. The 647

immunoprecipitates were analyzed by immunoblotting with anti-TRIM25 (C) or 648


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

anti-Myc (D). 649

(E) HeLa cells transfected with GFP-N were fixed with 4% paraformaldehyde and 650

incubated with anti-TRIM25 and anti-GFP antibodies. An in situ PLA assay was 651

conducted as described and imaged with a confocal microscope at 100X 652

magnification. Red dots indicate the interaction. 653

Figure 2. The interaction domain of the SARS-CoV N protein and TRIM25. 654

(A) Anti-Flag immunoprecipitates prepared from lysates of 293T cells expressing 655

Flag-TRIM25 and GFP-tagged full-length or truncated SARS CoV N protein were 656

analyzed by immunoblotting with anti-Flag and anti-GFP. 657

(B) Anti-Flag immunoprecipitates prepared from lysates of 293T cells expressing Myc-N 658

protein and Flag-B Box/CCD or Flag-SPRY domains were analyzed by 659

immunoblotting with anti-Flag and anti-Myc. 660

(C) Anti-Flag immunoprecipitates prepared from lysates of 293T cells expressing 661

GFP-N or Flag-tagged TRIM25 domains were analyzed by immunoblotting with 662

anti-Flag and anti-GFP. 663

664

Figure 3. The interaction between TRIM25 and RIG-I was inhibited by the SARS-CoV 665

N protein. 666

(A) 293T cells were transfected with Flag-RIG-I and Myc-TRIM25 with or without Myc-N. 667

Anti-Flag immunoprecipitates were analyzed by immunoblotting with anti-Flag or 668

anti-Myc. 669

(B) 293T cells were transfected with Flag-TRIM25, Myc-RIG-I and the indicated 670


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

amount of GFP-N. Anti-Flag immunoprecipitates were analyzed by immunoblotting 671

with anti-Flag, anti-Myc or anti-GFP. 672

(C) HeLa cells expressing the GFP-N or GFP plasmid were fixed with 4% 673

paraformaldehyde and incubated with anti-TRIM25 and anti-RIG-I antibodies. The in 674

situ PLA assay was conducted as described and imaged with a confocal microscope 675

at 100X magnification. Red dots indicate the interaction. 676

(D) Red dots indicating positive PLA signals were counted in 30 randomly selected cells. 677

The data are expressed as the means±SD (*P<0.05). 678

Figure 4. TRIM25-mediated RIG-I ubiquitination was suppressed by the SARS-CoV 679

N protein. 680

(A)(B)(D) 293T cells transfected with the indicated plasmids for 36 h were infected with 681

or without SeV at an MOI of 2 for 12 h. The anti-Flag immunoprecipitates prepared 682

from the cell extracts were analyzed by immunoblotting with the indicated antibodies. 683

(C) 293T cells were transfected with the vector, Flag-2CARD or Myc-N. At 24 h 684

post-transfection, whole-cell lysates were subjected to immunoblotting with anti-IRF3 685

and anti-p-IRF3 (S396) antibodies. 686

Figure 5. The SARS-CoV N protein inhibits TRIM25-mediated RIG-I activation and 687

interferon production. 688

(A)-(C) & (F) 293T cells were co-transfected with the IFN-β-Luc firefly luciferase reporter 689

plasmid, the Renilla luciferase control reporter plasmid pRL and the indicated 690

plasmids for 36 h. The transfected cells were infected with or without SeV at an MOI 691

of 2 for 12 h in (C) and (F). The luciferase activity of the cell lysates was analyzed 692


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

with the Dual Luciferase Reporter Assay System (Promega) and was measured on a 693

Monolight 2010 luminometer. 694

(D)-(E) A549 cells transfected with Myc-N and Flag-TRIM25 were infected with or 695

without SeV at an MOI of 2 for 36 h. The mRNA was extracted, and the IFN-β mRNA 696

expression level was determined by RT-PCR (D). The IFN-β concentrations in the cell 697

culture supernatants were measured using a VeriKine Human IFN-β ELISA kit (E). 698

(G) 293T cells co-transfected with the IRSE-Luc reporter plasmid, pRL and the other 699

indicated plasmids were infected with or without SeV at an MOI of 2 for 24 h. The 700

luciferase activity of the cell lysates was analyzed with the Dual Luciferase Reporter 701

Assay System and was measured using a Monolight 2010 luminometer. 702

(H)-(J) Total RNA was extracted from A549 cells expressing the indicated plasmids. The 703

ISG15, ISG56 and IP10 mRNA expression levels were determined by RT-PCR. All 704

results from (A) to (I) are expressed as the means±S.D. of three independent 705

experiments (ns, nonsignificant; *: P<0.05; **: P<0.01, ***: P<0.001). 706

(K)-(M) A549 cells were transfected with 0.5 μg of the Myc-vector (left and middle) or 707

Myc-N (right) for 24 h. The cells were infected with (middle and right) or without (left) 708

SeV at an MOI of 2 for 16 h. Cell culture supernatants were harvested and incubated 709

with Vero E6 cells for 2 h prior to infection of the Vero E6 cells with NDV-GFP at an 710

MOI of 2. After 24 h, the GFP fluorescence of the Vero E6 cells was detected by flow 711

cytometry. The cell culture supernatants were harvested and incubated with Vero E6 712

cells for 2 h prior to infection of the Vero E6 cells with NDV-GFP at an MOI of 2. The 713

NDV infection rate of the Vero E6 cells was measured by flow cytometry after 24 h of 714


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

infection. 715

716

Figure 6. N protein promotes virus replication by inhibiting TRIM25-mediated IFN-β 717

production. 718

(A) A549 cells were transfected with TRIM25 RNAi or scramble RNAi. At 24 h 719

post-transfection, the cells were infected with recombinant SARS-CoV at an MOI of 720

0.05 PFU per cell for 24 h. The virus particles released into the cell culture 721

supernatants were determined by viral genomic RNA level as assayed by qPCR. The 722

TRIM25 mRNA expression level was determined by RT-PCR (Right). 723

(B) A549 cells transfected with Flag-TRIM25 or Flag vector were infected with 724

recombinant SARS-CoV as described in (A). The virus particles released into the cell 725

culture supernatants were quantified by viral genomic RNA level as assayed by 726

qPCR. 727

(C) A549 cells transfected with GFP vector, GFP-N or GFP-N (1-361) were infected with 728

SARS-CoV as described in (A). The virus particles released into the cell culture 729

supernatants were quantified by viral genomic RNA level as assayed by qPCR. 730

(D) Calu-3 cells were transfected with full-length N protein or N(1-361), and 24 h after 731

transfection, the cells were infected with mouse-adapted SARS-CoV at an MOI of 732

0.05 PFU per cell in the presence/absence of IFN-β-specific neutralizing antibody. 733

Viral RNA from viral particles in the supernatant was quantified by qPCR. The results 734

are expressed as the means±S.D. of three independent experiments. 735

The significance of cells not treated with the antibody from (D) was analyzed using 736


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

the t test. All results from (A) to (D) are expressed as the means±S.D. of three 737

independent experiments (ns, nonsignificant; *: P<0.05; **: P<0.01, ***: P<0.001). 738

739

Figure 7. The MERS-CoV N protein interacts with TRIM25 and inhibits RIG-I 740

interferon signaling 741

(A-B) 293T cells were transfected with 2 µg of the indicated plasmids for 36 h. Whole cell 742

lysates were subjected to anti-Flag immunoprecipitates and immunoblotting with 743

anti-Flag or anti-GFP antibodies. 744

(C-D) 293T cells were co-transfected with the IFN-β-Luc firefly luciferase reporter 745

plasmid, the Renilla luciferase control reporter plasmid pRL, Flag-2CARD and 746

increasing amounts of the GFP-MERS-N plasmid (C), GFP-MERS-N (1~170 aa) or 747

GFP-MERS-N (171 aa~413 aa) (D) for 36 h. The luciferase activity of the cell lysates 748

was analyzed with the Dual Luciferase Reporter Assay System (Promega) and was 749

measured with a Monolight 2010 luminometer. The results are expressed as the 750

means±S.D. of three independent experiments. 751

752

Figure 8. The schematic of N protein inhibiting type I interferon production by 753

interfering with TRIM25-mediated RIG-I ubiquitination. 754


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Table 1. Primers used in real-time PCR

Gene Forward primer (5’ to 3’) Reverse primer (5’ to 3’) β-actin TGACGTGGACATCCGCAAAG CTGGAAGGTGGACAGCGAGG IFN-α CTGAATGACTTGGAAGCCTG ATTTCTGCTCTGACAACCTC IFN-β GTCAGAGTGGAAATCCTAAG ACAGCATCTGCTGGTTGAAG IP10 TCCCATCACTTCCCTACATG TGAAGCAGGGTCAGAACATC ISG15 TCCTGGTGAGGAATAACAAGGG CTCAGCCAGAACAGGTCGTC ISG56 TCGGAGAAAGGCATTAGATC GACCTTGTCTCACAGAGTTC TRIM25 GACCACGGCTTTGTCATCTTC AAAGTCCACCCTGAACTTATACATCA


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


NIV

OF

CA

LIF S

AN

DIE

GO

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2017 the severe acute respiratory syndrome coronavirus nucleocapsid inhibits type i interferon...

Documents