09_rreth nesh vt c back2

THE BUTRINT FOUNDATION AND W W W W W W W W W W W W W W W W W W . . . . . . B B B B B B U U U U U U T T T T T T R R R R R R I I I I I I N N N N N N T T T T T T . . . . . . O O O O O O R R R R R R G G G G G G ᠅ ᠅ ᠅ ᠅ ᠅ ᠅ ᠅ Success Stories in Efforts to Preserve Our Albanian Heritage Albanian American Alliance 1 S 450 Summit Ave, Suite 180 Oakbrook Terrace, IL 60181 PRSRT STD US POSTAGE PAID MILWAUKEE, WI PERMIT No. 5654 The Albanian Ministry of Culture, UNESCO and few other international groups founded the Butrint National Park in March, 2000, to protect the surrounding archaeology and terrain. Butrint is the most important historical site of the region and has an archae- ological sequence that runs from the Bronze Age to the 19th century. The Park’s founders aimed at using local and international institutions to build a model for other Albanian parks and, so far, the results are impressive. The success of the Butrint National Park can be attributed in major part to the role played in this noble cause by the Butrint Foundation for over 17 years. The Butrint Foundation was founded by Lord Rothschild and Lord Sainsbury of Preston Candover in 1993 as a charitable trust, with its principal objective to restore and preserve the Butrint site for the benefit of the general public. More about the Butrint Foundation can be found at: www.butrintfoundation.co.uk. The Foundation has a long list of accomplishments, such as: assembling and managing the contributions of do- zens of talented and generous profess- ionals, securing the stream of recogn- ition and support for those efforts, and augmenting public awareness of the region’s heritage in numerous books and over the internet. Its remarkable effect can be experienced at each page of www.butrint.org, a website that sets the bar high for similar projects. Butrint.org takes you through the his- tory, landscape and people who defined Butrint over the centuries. Lively pictu- res and visual recreations accompany the story of Butrint, told with the ease and pride that come with a job well done. One such page is on the left and the rest are just as enjoyable to read. We found ourselves learning about Butrint and admiring the quality that reverberates throughout the website. We salute the Butrint Foundation, butrint.org and the Butrint National Park and praise them for embracing the Albanian Heritage.

Upload: frankpapa

Post on 26-Sep-2015

8 views

Category:

Documents

3 download

Report

Download

Embed Size (px):

DESCRIPTION

Rrreth nesh Vol 9

TRANSCRIPT

TTTTTTTTHHHHHHHHEEEEEEEE BBBBBBBBUUUUUUUUTTTTTTTTRRRRRRRRIIIIIIIINNNNNNNNTTTTTTTT FFFFFFFFOOOOOOOOUUUUUUUUNNNNNNNNDDDDDDDDAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN AAAAAAAANNNNNNNNDDDDDDDD WWWWWWWWWWWWWWWWWWWWWWWW........BBBBBBBBUUUUUUUUTTTTTTTTRRRRRRRRIIIIIIIINNNNNNNNTTTTTTTT........OOOOOOOORRRRRRRRGGGGGGGG

SSSSSSSSuuuuuuuucccccccccccccccceeeeeeeessssssssssssssss SSSSSSSSttttttttoooooooorrrrrrrriiiiiiiieeeeeeeessssssss iiiiiiiinnnnnnnn

EEEEEEEEffffffffffffffffoooooooorrrrrrrrttttttttssssssss ttttttttoooooooo PPPPPPPPrrrrrrrreeeeeeeesssssssseeeeeeeerrrrrrrrvvvvvvvveeeeeeee OOOOOOOOuuuuuuuurrrrrrrr

AAAAAAAAllllllllbbbbbbbbaaaaaaaannnnnnnniiiiiiiiaaaaaaaannnnnnnn HHHHHHHHeeeeeeeerrrrrrrriiiiiiiittttttttaaaaaaaaggggggggeeeeeeee

Albanian American Alliance 1 S 450 Summit Ave, Suite 180 Oakbrook Terrace, IL 60181 PRSRT STD

US POSTAGE PAID

MILWAUKEE, WI

PERMIT No. 5654

The Albanian Ministry of Culture, UNESCO and few other international groups founded the Butrint National Park in March, 2000, to protect the surrounding archaeology and terrain. Butrint is the most important historical site of the region and has an archae-ological sequence that runs from the Bronze Age to the 19th century. The Parks founders aimed at using local and international institutions to build a model for other Albanian parks and, so far, the results are impressive. The success of the Butrint National Park can be attributed in major part to the role played in this noble cause by the Butrint Foundation for over 17 years. The Butrint Foundation was founded by Lord Rothschild and Lord Sainsbury of Preston Candover in 1993 as a charitable trust, with its principal objective to restore and preserve the Butrint site for the benefit of the general public. More about the Butrint Foundation can be found at: www.butrintfoundation.co.uk. The Foundation has a long list of accomplishments, such as: assembling and managing the contributions of do-zens of talented and generous profess-ionals, securing the stream of recogn-ition and support for those efforts, and augmenting public awareness of the regions heritage in numerous books and over the internet. Its remarkable effect can be experienced at each page of www.butrint.org, a website that sets the bar high for similar projects. Butrint.org takes you through the his-tory, landscape and people who defined Butrint over the centuries. Lively pictu-res and visual recreations accompany the story of Butrint, told with the ease and pride that come with a job well done. One such page is on the left and the rest are just as enjoyable to read. We found ourselves learning about Butrint and admiring the quality that reverberates throughout the website. We salute the Butrint Foundation, butrint.org and the Butrint National Park and praise them for embracing the Albanian Heritage.