Materials and Methods

Identification of mutations

Mutations altering stomatal pattern were identified in a population of EMS-mutagenized

seedlings in the C24 ecotype that express green fluorescent protein (GFP) primarily in

guard cells (ABRC stock CS9159). Seedlings were visually screened at 5-days post

germination (dpg) at 200x on a Leica compound microscope using epifluorescence and

FITC filter to visualize GFP expression. Six alleles of YDA were found in ~40,000 M2

seedlings derived from 400 pools of 10 M1 plants. Segregating lines of yda were found

among sibling from the same M1 pool and were backcrossed 2x to C24 and outcrossed to

Ler for mapping. Bulk segregant analysis of the alleles placed them all on Chromosome

I, between markers nga280 and nga111. Identification of these mutations as alleles of

yda was by complementation crosses to yda-1 and by sequencing of 2 alleles, Y295

(R385 *) and Y360 (446Q *).

Marker lines and microscopy

Time course

yda mutant embryos have a characteristic dried seed morphology and could be identified

in a segregating population before imbibition. Wild type and yda-Y295 seeds were

sterilized in 20% bleach solution for 10 minutes, rinsed 6x with sterile water and sown on

1% agar plates containing 1/2 strength MS media and 1% sucrose. Seeds were kept at 4C

in the dark for 72 hours. Plates were incubated in a Percival growth chamber at 22°C and

24 hour light (~75 µmol/m2s) during the timecourse. Timepoints were taken every 12

hours from 0 to 96 hours and at 120 hours after moving plates to growth chambers.

Lineage analysis by serial dental resin impressions was not possible due to the small size

and wrinkled morphology of yoda cotyledons and leaves. Instead, 10 seedlings of each

genotype were imaged with a Bio-Rad M1024 confocal microscope for each timepoint.

Cell outlines were visualized by propidium iodide or by inclusion of marker Q8::GFP

(27) that marks the plasma membrane.

Cell fate markers

Marker lines were introgressed into yda-Y295 and yda-Y360. Expression of the markers

was identical in both alleles and all images were taken of yda-Y295. The following

markers were used: TMMpro::GFP(6); TMM::GFP(6); Q8::GFP(27); N7::GFP(27),

TUB::GFP(27). The TMM::GFP marker is expressed at high levels in meristemoids and

GMCs and is then downregulated in the guard cells. Young guard cells sometimes

express GFP and it is not yet resolved whether this reflects perdurance of the GFP protein

or whether TMM transcription is not downregulated until guard cells mature.

YDA expression

A transcriptional reporter was created by cloning a 3.2 kb fragment from the YDA locus,

extending from a genomic KpnI site to a NcoI site at the ATG start codon (the latter

introduced in vitro) into pCAMBIA 3201. 5 T2 lines derived from Basta-resistant T1

transformants were analyzed for reporter activity by incubating for 4 or 12 hours at 37°C

in 1 mg/ml X-glucuronic acid, 1 mM EDTA, 1% Tween-20 and 1-5 mM potassium

ferri/ferrocyanide in 100 mM phosphate buffer pH 7. Stained tissues were cleared in

70% ethanol and mounted in water for microscopy.

Double mutant construction

∆N-YDA heterozygous plants were crossed to tmm-1, sdd1 and flp-1 homozygous mutant

plants and the F1s selected for presence of ∆N-YDA by growth on soil containing 433 ul/L

Finale (Aventis). In the progeny of flp/+; ∆N-YDA /+, 23/100 healthy seedlings displayed

a flp phenotype. In contrast, in the progeny of crosses with tmm1 and sdd1, the expected

clustered phenotypes were present in fewer than 25% of the seedlings (13/200 (6.5%)

tmm and (3/120 (2.5%) sdd1), suggesting a genetic interaction with ∆N-YDA. From the

F2 population, 3-12 phenotypically mutant seedlings of sdd-1, tmm-1 and flp-1 were

grown on soil. F3 seeds from each population were sown on soil containing Finale to test

for the presence of the ∆N-YDA transgene. None of the seeds from the sdd1 or tmm-1

lines were resistant to Finale, indicating that the mutant phenotypes are only revealed in

the absence of the ∆N-YDA transgene.

We examined the phenotype of ∆N-YDA/+; tmm-1 and ∆N-YDA/+ ; sdd-1 by selecting F2

seedlings on Finale and genotyping for the presence of the tmm-1 or sdd-1 alleles using

the dCAPS markers detailed below. In addition, 3 tmm-1 homozygotes and 1 sdd1

homozygote were followed through successive generations. Loss of the transgene

through segregation was accompanied by the return of the expected tmm or sdd1

clustered stomatal phenotype. The cotyledon epidermis of 5 and 7 dpg double mutant

seedlings was visualized by clearing in 70% ethanol and mounting for microscopy in

Hoyer's medium (70% chloral hydrate, 4% glycerol, 5% gum arabic). Images (0.714

mm2) from the midline to the margin on abaxial surfaces of 7-dpg seedlings were used to

quantify clustering, stomatal index and stomatal density. All cells from 10 images were

counted for each genotype.

dCAPs markers

All samples were amplified with a touchdown PCR profile of 10 cycles (94C 30s;

65 55C 30s; 72C 90s) followed by 25 cycles of (94C 30s; 55C 30s; 72C 90s) and cut

with the appropriate enzyme.

Primer name sequence enzyme

tmmF ttcaaagggctcaagaactg BsrI

tmmR tgttatcgttgagcctcagc

sdd1F tggtacggtgattgggagct SacI

sdd1R taaggaagtccggttggtcc

Microarray analysis

Seeds from yda-Y295/+, ∆N-YDA/+, C24 and Ler plants were sterilized and kept for 3

days at 4(C in the dark on plates containing 1% agarose, 1/2 strength MS and 1% sucrose.

At 8 am, plates were oriented vertically and incubated at 22(C with 24 hr light (~75

µmol/m2s). At 4 1/2 days (8 pm), homozygous mutant seedlings were selected from the

population and transferred to new plates (of the same formulation). Seedlings from wild

type plates were also transferred. Plates were incubated for a further 2 1/2 days. At 8 am

7 dpg, seedlings were washed from plates with sterile water, briefly dried on paper and

frozen in liquid nitrogen. Samples were kept at -80(C until ready for processing.

Approximately 500 seedlings were used for each of 3-4 independent 500 mg tissue

samples from which RNA was extracted using the Qiagen RNA midi prep plant tissue

protocol. cDNA synthesis followed the protocol provided by Affymetrix, using Gibco

BRL Superscript reagents. 20 µg of total RNA was used as starting material.

Biotinylated complementary RNA (cRNA) was prepared with the bioarray high yield

transcript labeling kit (Enzo). 20 µg of the resulting cRNA was used to hybridize to each

ATH1 Arabidopsis GeneChip (Affymetrix) using the manufacturer’s protocols. The array

images were analyzed with the Affymetrix Microarray Suite 5.0 with the target intensity

set to 500. The expression levels of the genes were analyzed using GeneSpring 4.2

software (Silicon Genetics) Genes that consistently increase or decrease in their

expression levels relative to the expression level in the corresponding wildtype samples

were identified using the Significance Analysis of Microarrays software with delta value

>10 and FDR <.01% . This list was further narrowed by selecting genes showing two-

fold change in expression levels relative to the corresponding wild type samples and

eliminating transcripts that changed in the same direction relative to wildtype in both the

yda and ∆N-YDA samples. Expression data sets have been deposited in the Gene

Expression Omnibus at the National Center for Biotechnology Information

(http://www.ncbi.nlm.nih.gov/geo/) with sample IDs GSM 15661-15674 and Series ID

GSE991.

Characterization of SALK TDNA insertion lines

Seeds were obtained from the Arabidopsis Stock center (ABRC accessed through

http://www.Arabidopsis.org). T-DNA insertions in genes identified in the microarray

experiment were sown on plates (see timecourse) and the stomatal phenotype of 5-dpg

cotyledons assayed by visual inspection at 200X on a Leica compound microscope

equipped with DIC optics. The presence of the T-DNA at the appropriate site was

confirmed by PCR genotyping using primers designed by the SALK iSECT online tools

(http://signal.salk.edu/isects.html). At3g24140 was named FAMA after the goddess of

rumor. A second independent T-DNA insertion at the 3' end of the FAMA gene

(SALK_010525) results in a similar but weaker stomatal defect than SALK_100073

where ~10% of the stomata are surrounded by 3 or 4 contiguous guard cells (not shown).

Plants whose epidermis contains only the clusters of partially differentiated guard cells

are dwarfed and sterile.

Supplemental Figures

Fig. S1 (A) Fraction of epidermal cells with given identity in 7dpg abaxial cotyledons.

(B) Fraction of stomata obeying 1-cell spacing rule. Genotypes indicated on X-axes.

Although ∆N-YDA/+ does not have a dramatic effect on guard cell (or precursor) index,

it can rescue both the increased stomatal density (in A) and cell spacing defects (in B) of

tmm mutants.

A

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

wt yda DN-YDA

DN-YDA/+

tmm DN-YDA/+;

tmm

%pavement%M+GMC% GC

wt yda

∆N-

YDA

∆N-

YDA/+ tmm

∆N-YDA/+;

tmm

% GC 0.36 0.88 0 0.35 0.66 0.42

%M+GMC 0.081 0.075 0 0.07 0.06 0.038

%pavement 0.56 0.045 1 0.58 0.28 0.54

S1B

0

0.2

0.4

0.6

0.8

1

wt DN-YDA/+ tmm DN-YDA/+; tmm

wt ∆N-YDA/+ tmm ∆NYDA/+; tmm

% 1-cell space 0.995 0.995 0.12 0.995

Fig. S2 (A-D) Expression of YDA in developing seedlings as visualized by

YDApromoter::GUS fusion construct. A, B, D stained for 12 hr; C for 4 hours (A)

Whole wildtype (Ler) seedling 7-dpg, expression is highest in dividing tissues

(arrowhead indicates lateral root primodium) and in the vasculature (B) whole yda

seedling, expression is also visible in the vasculature. (C) 7-dpg seedling emphasizing

upregulation of YDApro::GUS in the shoot meristem (arrowhead). (D) Cotyledon

epidermis 7-dpg; guard cells (arrowheads) strongly express the YDApro::GUS reporter,

but weak expression is also seen in the cytoplasm of other epidermal cells. (E) Cleared

adaxial leaf surface of 28 dpg ∆N-YDA seedling. Although no stomata are formed, the

plant does produce trichome and support cells. Scale bar = 5 mm.

Fig. S3 (A) Table of 109 genes up regulated in yda and downregulated in ∆N-YDA.

Columns from left to right contain: Affymetrix ID, unique ID for array feature; Gene ID,

designation of gene obtained from TAIR microarray elements search

(http://www.arabidopsis.org/tools/bulk/microarray/index.jsp); Genotype ex, expression

values and SD, standard deviation for 3 (C24 or Ler) or 4 (DN-YDA or yda) biological

replicates; Category, functional category for each annotated gene from which chart in B

is derived; Description, annotation provided by TAIR microarray elements search tool

(B) Pie chart of functional classes found among the transcripts described in (A).

A Affymetrix ID Gene ID

C24 ex SD

Ler ex SD

∆N-YDA SD Y295 SD Category Description

264319_at At1g04110 134.8 31.2 155.5 17.3 59.88 12.7 398 30.3 S subtilisin-like serine protease 264525_at At1g10060 116.7 40.5 316.2 13.6 89.93 8.97 325 20.6 B unknown protein 264434_at At1g10340 150.6 59.4 142.9 34.5 177.4 30.4 1667 100 U hypothetical protein 263210_at At1g10585 25.9 16.3 14.13 7.08 40.7 8.17 171 19.8 U Expressed protein 261203_at At1g12845 272.7 33.8 320.5 10 223.1 8.19 520 15.7 U Expressed protein 261934_at At1g22400 286.3 66.2 221.8 28.5 277.7 39.8 1533 184 B UDP-glucose glucosyltransferase, 264195_at At1g22690 2035 677 2597 83.3 346.8 49.9 4867 255 H putative gibberellin-regulated protein 263032_at At1g23850 447.1 22.4 274.5 26.8 278.2 34.5 1168 79.4 U unknown protein 264872_at At1g24260 111 42.8 114.3 31.6 99.15 3.39 353 43 S putative floral homeotic protein, AGL9 261001_at At1g26530 72.37 8.03 44.1 5.77 40.13 5.58 133 16.8 U hypothetical protein 261567_at At1g33055 199 65.4 274.5 51.9 274.6 90.2 1907 321 U Expressed protein 261981_at At1g33811 982.8 188 1523 114 268.4 42.3 4117 579 U unknown protein 261323_at At1g44760 411.9 20.9 448.9 47.7 211.1 26.2 815 81 U hypothetical protein 261691_at At1g50060 215.2 86.9 247.6 34.4 69.13 21.1 429 41.2 B branched-chain amino acid aminotransferase 256177_at At1g51620 52.7 7.61 39.33 10.1 55 13.7 276 34.2 S protein kinase 256178_s_at At1g51780 417.5 92.5 346.4 12.6 326.1 32 1215 103 H auxin conjugate hydrolase 256170_at At1g51790 140.6 25.6 186.6 29.1 133 12.8 440 10.7 S receptor protein kinase 256169_at At1g51800 196.6 31.6 203.8 22.1 203.8 17.6 759 83.1 S receptor protein kinase 246366_at At1g51850 59 10.8 109.6 16.1 42.68 7.66 365 15.5 S light repressible receptor protein kinase 246401_at At1g57560 116.7 7.28 92.2 4.16 68.08 8.77 239 21.9 S DNA-binding protein 262905_at At1g59730 109.3 12.8 155 9.2 49.25 12.3 198 25.3 S thioredoxin 264213_at At1g65400 748 226 147.9 8.79 161.5 20 2618 284 S/D hypothetical protein 262314_at At1g70810 180.5 51.5 132.9 30.1 183.5 23.3 637 68 S unknown protein 266743_at At2g02990 154 47 95 39.4 144.5 18.6 658 72.6 B ribonuclease, RNS1 263851_at At2g04460 95.97 51.5 68.67 23.8 65.85 0.88 238 13.4 B putative retroelement pol polyprotein 263809_at At2g04570 271.3 45.1 334.8 35.9 287.5 12.4 1167 44.6 L putative GDSL-motif lipase/hydrolase 265411_at At2g16630 448.8 157 396.9 11 441.8 35.5 1369 121 U unknown protein 266061_at At2g18720 59.47 7.77 65 8.52 58.05 5.71 124 4.68 B initiation factor eIF-2B gamma subunit 265586_at At2g19990 60.3 23.7 63.23 12.6 18.28 10.5 162 24.6 D pathogenesis-related protein (PR-1) 257396_at At2g20875 133.4 13.2 100.4 8.56 32.03 14.6 353 52.4 U predicted protein 264007_at At2g21140 586.4 168 1174 60.9 574.1 32.3 1948 223 W putative proline-rich protein 245076_at At2g23170 348.5 47.6 554.4 47.7 300 32.1 1196 78.2 U unknown protein

267128_at At2g23620 224.8 62.2 239.6 17.6 180.7 11 576 54.5 D putative acetone-cyanohydrin lyase 266247_at At2g27660 148 42.4 136.1 21.1 133.5 9.98 537 82.1 U hypothetical protein 266271_at At2g29440 130.1 30.8 165.4 35.1 91.25 5.23 312 20.3 D putative glutathione S-transferase 267317_at At2g34700 145.3 35 66.2 19.8 28.18 25.6 962 45.9 W putative proline-rich glycoprotein 265208_at At2g36690 245.8 70.5 503 23.6 165.4 25.2 882 15.6 H putative giberellin beta-hydroxylase 267147_at At2g38240 46.93 29.2 52.3 8.89 65.23 8.72 725 131 D putative anthocyanidin synthase 266992_at At2g39200 175.9 2.4 277.7 13.8 234.9 6.59 511 26.8 D similar to Mlo proteins 266989_at At2g39330 79.5 11.9 57.43 9.62 44.78 7.01 295 54.9 D putative myrosinase-binding protein 267622_at At2g39690 116 4.9 129.4 24.9 71.5 6.11 229 12.9 U hypothetical protein 265853_at At2g42360 52.13 13.2 51.93 9.47 69.4 17.2 431 76.1 S putative RING zinc finger protein 260546_at At2g43520 217.6 58.9 927.9 78.6 167.2 11.9 895 46.6 B putative trypsin inhibitor 266600_at At2g46070 315.7 28 206.6 25.4 68.3 5.92 562 37.3 S putative mitogen-activated protein kinase 266319_s_at At2g46720 201.5 67 366.8 34.7 91.7 17 587 32 S/L putative beta-ketoacyl-CoA synthase 260531_at At2g47240 254 45.3 263.5 50.8 112.8 12.3 468 46.5 L putative acyl-CoA synthetase 245173_at At2g47520 13.17 6.43 11.37 6.3 15.1 10.5 116 17.1 S putative AP2 domain transcription factor 258487_at At3g02550 468.3 145 171.2 24.7 217.3 63.6 3033 563 U unknown protein 258897_at At3g05730 5004 207 3944 97.2 1273 72.5 #### 1520 U unknown protein 258941_at At3g09940 755 158 459 13.4 231.7 32.1 1168 59.9 B putative monodehydroascorbate reductase 257206_at At3g16530 1131 142 814.9 31 1535 62.4 5665 663 S/D putative lectin 258418_at At3g16660 295.7 49.9 355.3 11.9 218.1 14.3 2878 152 U unknown protein 258419_at At3g16670 397.3 193 353.9 36.4 294.1 18.9 5115 349 U unknown protein 258008_at At3g19430 171 72.3 208.2 34.9 59.38 16.4 303 43.8 E putative late embryogenesis abundant protein 256942_at At3g23290 106.7 6.71 85.83 9.23 60.75 20.9 380 23.8 U hypothetical protein 256860_at At3g23840 62.37 22 47.4 5.8 35.15 6.15 148 23.1 B acetyl-CoA:benzylalcohol acetyltranferase 257247_at At3g24140 186.6 47.3 254.2 6.49 85.13 11.3 332 38 S helix-loop-helix DNA-binding protein 257153_at At3g27220 81.73 13.9 71.77 2.97 70.4 15.9 676 150 U unknown protein 257890_s_at At3g42570 107.3 16.2 202.2 16.9 4.825 1.85 356 63.2 B/D putative protein peroxidase 246340_s_at At3g44860 73.37 18.9 40.03 2.35 78.88 7.63 599 82 D AtPP -like protein 252511_at At3g46280 522.5 130 461 51.2 339.6 26.2 2592 476 S putative serine/threonine-specific kinase 252417_at At3g47480 42.73 8.29 30.73 15.3 95.63 23.7 444 85 S putative calcium-binding protein 252421_at At3g47540 333.7 76.2 290 6.35 226.1 17.5 1173 91.6 W endochitinase-like protein 252240_at At3g50010 55.3 29.2 54.63 2.41 35.3 7.76 177 14.5 U putative protein 252114_at At3g51450 440 91.9 279.6 18.9 313.3 14 1302 75.8 D mucin -like protein 252014_at At3g52870 696.6 24.7 487 34.9 360.6 24 1483 84.3 U putative protein 251791_at At3g55500 57.97 24.6 156.7 9.51 63.95 17.1 251 34.6 W expansin At-EXP6 251603_at At3g57760 102.9 21.7 40.77 0.12 63.48 11 255 23.1 W/S putative protein wall-associated kinase 251181_at At3g62820 404.4 99.8 476.2 38.6 114.6 7.66 1434 30.3 W putative protein pectinesterase 255595_at At4g01700 372.3 35.3 244.8 49.9 272.4 25.9 942 115 W putative chitinase 255532_at At4g02170 163.4 46.4 63.53 3.27 58.48 8.25 440 20.3 U hypothetical protein 255467_at At4g03010 78.53 15.3 63.2 7.93 22.63 17.9 114 10.8 S putative leucine-rich repeat protein 255261_s_at At4g05110 55.6 3.56 64 14.6 82.7 13 199 9.68 T putative equilibrative nucleoside transporter 255142_at At4g08390 1019 80.2 1111 13.2 1052 115 2397 103 B stromal ascorbate peroxidase 254772_at At4g13390 126.9 53.2 74.8 30.4 39.43 3.52 191 12 W extensin-like protein 245616_at At4g14480 175.1 42.7 210.4 21 59.28 6.72 357 49.6 S kinase like protein 245275_at At4g15210 16.27 17.1 14.8 9.18 47.95 10.8 348 18.9 W beta-amylase 254697_at At4g17970 200.5 41.5 148.3 1.86 78.73 9.56 404 45.8 U putative protein 254387_at At4g21850 2507 479 2482 68 1247 43.7 4011 108 U putative protein 254242_at At4g23200 121.7 19.4 122.2 7.79 93.25 5.8 347 30.5 S serine /threonine kinase 254243_at At4g23210 56.1 18.4 47.57 2.8 79.88 12.4 306 53.1 S serine/threonine kinase 254255_at At4g23220 87.63 22.6 8.7 6.66 16.78 6.97 634 89 S serine/threonine kinase

254044_at At4g25820 591.5 80.2 533.9 68.3 233.1 31.7 912 136 W putative xyloglucan endo-1,4-beta-D-glucanase

253998_at At4g26010 979.8 352 519.9 94.6 263.4 25.2 1565 107 D peroxidase ATP13a 253271_s_at At4g34210 41.8 7.55 43.73 7.84 62.7 7.16 234 35.5 S SKP1/ASK1 (At11) 246238_at At4g36670 520.9 22.4 533.7 21.3 489.5 31.1 1738 111 T sugar transporter like protein

252989_at At4g38420 311.8 52.3 247.7 9.74 158.7 27.1 1434 100 W putative pectinesterase 252977_at At4g38560 30.9 11.8 12.4 8.38 18.9 15.4 137 16.2 S/L Phospholipase like protein 251065_at At5g01870 1003 33.1 840.2 15.1 437.8 33.8 1538 56.2 L lipid-transfer protein-like 250793_at At5g05600 845 108 713 8.35 755.9 38.8 2352 133 D leucoanthocyanidin dioxygenase-like 250152_at At5g15120 195.4 43.5 126.5 20.6 165.7 9.9 2036 396 U putative protein 250043_at At5g18430 68.97 15.2 73.73 26.8 38.23 5.69 317 39.1 W proline-rich protein 245946_at At5g19580 76.2 38.7 138.7 19.3 20.78 5.61 193 3.71 B putative protein glyoxal oxidase precursor 246073_at At5g20180 963.6 34.3 944.7 68.7 892.3 68.9 1954 69.3 B ribosomal protein L36-like 246944_at At5g25450 771.1 180 342.5 44.9 340.7 18.9 2406 164 B ubiquinol--cytochrome-c reductase-like 246860_at At5g25840 253.6 83.8 302.1 41.1 35 11.7 343 75.9 U putative protein 246620_at At5g36220 202.7 22.4 23.4 15.4 49.43 12.5 809 37.5 B cytochrome P450 249581_at At5g37600 2346 412 1561 30.8 1208 71.2 4611 233 D glutamate--ammonia ligase 249037_at At5g44130 2552 335 3693 64.7 2560 63 4836 151 U putative protein 254521_at At5g44810 48.4 16.9 31.77 2.9 46.03 10.5 271 32.5 U putative protein 249021_at At5g44820 109.9 13.6 88 9.63 108.2 3.05 513 46.4 U putative protein 248895_at At5g46330 155.5 33.7 121.6 8.35 181.4 10.6 581 41.1 S receptor protein kinase 248236_at At5g53870 110.8 16.9 52.03 13.9 75.73 2.85 274 43 U putative protein 248139_at At5g54970 523.1 17.7 519 25.1 492.1 78.1 1042 45.7 U putative protein 247871_at At5g57530 202.9 38 274.5 19.3 80.68 17.3 297 17.7 W xyloglucan endotransglycosylase 247812_at At5g58390 223.1 29.6 236.4 13.8 272.9 13.2 640 23.9 D peroxidase 247610_at At5g60630 130 35.2 113.8 5.8 65.85 16.4 196 26.1 U putative protein 247317_at At5g64060 135 7.74 116.7 22.2 82 10.1 237 35.4 S similarity to NAM protein 246991_at At5g67400 368.7 84.9 311.1 49.8 101.5 17.2 628 65.7 B/D peroxidase

Fig S3B

signalingwalldefenseunknownbasichormonelipid

Fig. S4 (A) Table of 111 genes up regulated in ∆N-YDA and down regulated in yda.

Table and chart (B) are in same format as S3A and B.

Figure S4 (A) Affymetrix ID Gene ID

C24 ex SD Ler SD

∆N-YDA SD Y295 SD Category Description

261785_at At1g08230 245 34.41 278 29.4 666.5 39.8 204.8 44.7 B amino acid permease 264777_at At1g08630 106.8 23.05 172 14.3 624.9 11.2 166.8 9.7 B similar to L-allo-threonine aldolase 264923_s_at At1g60740 457.7 123.3 1401 229 2065 86.5 184.2 18.5 B peroxiredoxin 260396_at At1g69720 17.03 8.673 201 11.9 293 30.4 28.1 5.58 B putative heme oxygenase 264300_at At1g78670 448.6 118.3 1463 48.2 1943 33.4 230.1 30.3 B gamma glutamyl hydrolase 265817_at At2g18050 583.5 165 746 121 1564 65.4 271.4 13.7 B histone H1 267265_at At2g22980 1092 857.2 1955 361 1943 217 250.3 53.4 B putative serine carboxypeptidase I 266279_at At2g29290 2560 186.7 1832 71.4 1936 49.6 748.1 136 B putative tropinone reductase 263491_at At2g42600 915 85.88 1630 47.6 2474 115 612.8 71.3 B phosphoenolpyruvate carboxylase 250753_at At5g05860 256.2 39.52 493 41.5 705.3 21 157.5 82.2 B glucuronosyl transferase-like protein 250702_at At5g06730 9.367 1.168 24.5 20 122.9 24.5 8.6 0.46 B peroxidase 250351_at At5g12030 47.77 11.3 54.8 2.96 210.7 2.26 41.83 12.3 B heat shock protein 17.6A 246464_at At5g16980 34.6 3.727 127 11.4 323.8 41.3 43.45 10.3 B quinone oxidoreductase -like 248181_at At5g54290 450.1 76.12 1083 58.1 1487 56.8 319.4 22.4 B cytochrome c biogenesis protein 264514_at At1g09500 105.9 33.54 109 10.3 587.8 47 76.17 20.3 B/D putative cinnamyl alcohol dehydrogenase 264527_at At1g30760 44.17 25.87 69.5 9.15 240.7 29 23.1 11.5 B/D putative reticuline oxidase-like 266141_at At2g02120 384.8 258.9 196 11 1058 107 97.23 6.4 B/D protease inhibitor 251731_at At3g56350 230.7 143.6 197 13.9 539.8 27.3 66.97 8.22 B/D manganese superoxide dismutase-like 246144_at At5g20110 179.5 20.12 153 8.3 341.6 7.48 125.3 7.62 C dynein light chain 253217_at At4g34970 108.3 37.08 251 17.1 479.8 22.1 37.05 19 C actin depolymerizing factor 267565_at At2g30750 25.17 19.61 25.9 8.25 237.7 16.5 40.13 11.6 CYT putative cytochrome P450 266756_at At2g46950 475.7 43.07 460 51.6 429.5 27.8 241.7 19.2 CYT putative cytochrome P450 252629_at At3g44970 91.9 9.277 129 16.2 1197 43.9 90.67 28.6 CYT cytochrome P450 254440_at At4g21020 104.1 19.32 46.3 14.4 197.3 12.2 25.63 12.3 D desiccation-related protein 264751_at At1g23020 617.9 81.45 474 39.6 1416 56.1 578.4 41.4 D superoxide-generating NADPH oxidase 260116_at At1g33960 7.5 5.631 16.3 9.53 222 21.3 13.2 6.53 D AIG1 259615_at At1g47980 563.6 204.2 213 22.5 987.9 53.3 261.5 10.6 D dessication-related protein 260716_at At1g48130 1586 631.3 704 24.1 2829 142 330.7 71.6 D peroxiredoxin 261957_at At1g64660 139.9 54 212 18.8 889.9 12.7 183.6 21.6 D methionine/cystathionine gamma lyase 265511_at At2g05540 1358 32.32 2397 55.5 3563 204 644.8 80.1 D putative glycine-rich protein 265891_at At2g15010 309 215.9 173 32.1 920 9.61 67.13 12.5 D putative thionin 258544_at At3g07040 40.37 21.07 155 31.5 230 7.02 39.63 13.9 D disease resistance gene (RPM1) 254835_s_at At4g12310 576.1 88.98 1020 63.2 1697 28 442.3 29.5 D flavonoid 3,5-hydroxylase -like 245454_at At4g16920 85.47 46.63 159 24.9 359 52.8 75.9 23.3 D disease resistance RPP5 like protein 250419_at At5g11250 60.87 13.57 156 9.88 285.4 14 85.95 21.7 D RPP1 disease resistance protein - like 249215_at At5g42800 187.6 20.09 127 15.8 426.8 11.3 209.4 22.4 D dihydroflavonol 4-reductase 251642_at At3g57520 1511 232.6 3228 296 5143 285 1229 77.2 D imbibition protein 245982_at At5g13170 271.9 2.06 181 9.38 1221 136 242.2 32.7 D senescence-associated protein (SAG29) 261768_at At1g15550 119.3 43.83 312 62.3 627.7 35 130.6 13.5 H gibberellin 3 beta-hydroxylase 259790_s_at At1g29430 968.9 227.5 1172 32.7 970.9 56.8 173.9 14.8 H auxin-induced protein 259783_at At1g29510 552.2 43.18 797 40.1 822.3 54.1 201.7 44.6 H auxin-induced protein 260221_at At1g74670 3541 644.8 5174 545 5474 459 1387 63.5 H GAST1-like protein 246932_at At5g25190 227.1 19.46 156 43.1 736.7 26.1 156.9 29.3 H ethylene-responsive element

249265_at At5g41700 1251 65.13 4738 216 5639 175 832.3 12.2 H E2, ubiquitin-conjugating enzyme 8 261667_at At1g18460 964.8 100.1 1029 48.6 1045 41 368.7 37.1 L putative lipase 255007_at At4g10020 38.63 20.19 45.8 26.3 127.2 9.54 7.333 3.23 L putative oxidoreductase 264148_at At1g02220 69.1 3.1 140 17.5 229.7 25 59.83 22.1 S NAM (no apical meristem)-like protein 265084_at At1g03790 174.7 48.87 68.2 69.8 408.1 25.5 59.83 30.9 S Cys3His zinc finger domain 260855_at At1g21920 1272 479.6 2183 361 2282 168 517.5 8.6 S phosphatidylinositol-4-phosphate 5-kinase 260291_at At1g63700 443.8 99.21 345 15 1581 35 274.6 14.5 S YODA 256528_at At1g66140 315.9 84.5 427 24 453.5 13.6 144.6 22.6 S C2H2-type zinc finger protein 259982_at At1g76410 123.8 9.005 270 4.2 668 73.7 92.98 15.4 S putative RING zinc finger protein 261395_at At1g79700 504.5 83.97 677 48.3 789.9 30.2 223.6 28.9 S putative AP2 domain transcription factor 265249_at At2g01940 171.9 9.113 161 8.62 363.4 4.62 125.7 18.5 S putative C2H2-type zinc finger 264788_at At2g17880 56.8 49.54 243 30.9 404.5 6.25 8.3 2.06 S putative DnaJ protein 266663_at At2g25790 349.6 17.88 579 15.5 1147 58.5 148.1 12.2 S putative receptor-like protein kinase 266656_at At2g25900 1008 222.4 1313 55 1306 43.8 426.8 14.4 S putative CCCH-type zinc finger protein 260494_at At2g41820 226 50.32 356 45.2 366.4 38.3 85.33 5.09 S putative receptor-like protein kinase 265260_at At2g43000 94.33 22.11 65 10.2 221 26.9 66.27 7.2 S NAM (no apical meristem)-like protein 257866_at At3g17770 420.7 34.37 385 9.39 872.3 36.8 359.1 6.06 S dihydroxyacetone kinase 257062_at At3g18290 712 173.9 753 54.6 1877 45.5 556.2 50.1 S zinc finger protein 251575_at At3g58120 733.5 44.66 914 102 958.7 45.2 175.4 47.9 S basic leucine zipper transcription activator 254714_at At4g13480 39.03 16.14 62.1 14.1 229.8 13.4 38 20.4 S myb-like protein 252991_at At4g38470 1311 65.65 1521 38.7 1483 121 595.7 54.5 S protein kinase like 250982_at At5g03150 169.5 23.91 222 17.8 237.2 30.7 27.27 19.1 S putative protein zinc finger protein 245692_at At5g04150 26.93 14.41 51.2 27.5 343.2 33.4 15.87 9.06 S myc - like protein 250468_at At5g10120 132.3 70.03 207 25.1 235.2 9.21 55.43 11.9 S transcription factor TEIL 250167_at At5g15310 333 67.34 301 1.96 321.4 53.6 114.2 10.1 S myb-related protein 254095_at At4g25140 522.4 260.6 336 25.3 1374 29.6 90.1 23.3 SS oleosin, 18.5K 253930_at At4g26740 83.37 28.04 53.3 4.59 167.9 33.7 29.2 19.6 SS embryo-specific protein 1 (ATS1) 253904_at At4g27140 34.3 1.868 25.1 10.2 212.1 12.4 71.3 16.9 SS NWMU1 - 2S albumin 1 precursor 253894_at At4g27150 15.7 9.597 12.1 6.59 192.5 22.4 7.3 4.06 SS NWMU2 - 2S albumin 2 precursor 253895_at At4g27160 18.63 19.8 20.8 14.7 135 7.09 2.2 0.75 SS NWMU3 - 2S albumin 3 precursor 253767_at At4g28520 1876 1307 1323 39.7 6411 157 400.5 70 SS 12S cruciferin seed storage protein 248125_at At5g54740 100.1 20.45 93.8 15.2 281.3 16.7 73.37 9.34 SS 2S storage protein-like 255877_at At2g40460 352.5 15 240 37.1 262.7 30.5 167.1 15 T putative PTR2 family peptide transporter 247304_at At5g63850 944.3 23.62 1060 36.9 1906 24.3 409.6 26.3 T amino acid transporter AAP4 255763_at At1g16730 35.7 28.84 15.5 4.13 157.3 21.7 16.67 1.34 U hypothetical protein 259398_at At1g17700 267.6 28.25 275 19.3 537.9 43.9 159.4 48.8 U hypothetical protein 261407_at At1g18810 176.2 64.94 322 35.2 315 35.2 63.73 5.97 U unknown protein 256497_at At1g31580 83.9 13.83 180 99.7 937.9 44.6 111.4 7.72 U putative similar to ORF1 261684_at At1g47400 428 28.02 344 27 2259 40.9 375.3 31.2 U hypothetical protein 260155_at At1g52870 3372 106.8 3316 60.4 3374 82.2 1433 72.4 U unknown protein 262679_at At1g75830 65.2 24.46 50.9 11.5 311.1 56.4 61.5 15.6 U unknown protein 261782_at At1g76110 681.4 27.96 758 65.6 795 43.6 191.9 47.6 U unknown protein 259977_at At1g76590 264.6 60.65 326 30.8 687.7 55.1 198.7 14.4 U unknown protein 263881_at At2g21820 199.6 136.8 83 9.61 478.3 24.3 50.47 8.15 U unknown protein 265644_at At2g27380 351.7 138.5 698 124 784.6 85.2 99.8 24 U hypothetical protein 265547_at At2g28305 394.9 70.52 372 12.4 376 25.3 98.7 3.36 U hypothetical protein 266551_at At2g35260 2452 39.37 2569 109 2833 49.2 1191 58.6 U unknown protein 263909_at At2g36490 165.2 10.97 207 15.1 229.5 18.7 58.87 21.4 U hypothetical protein 260527_at At2g47270 100.9 12.49 151 24.3 296.7 14.8 60.3 7.47 U unknown protein 257670_at At3g20340 179 44.34 253 9.39 463.2 21.5 161 22 U unknown protein 251677_at At3g56980 138.3 45.79 160 12.1 762.5 36.7 119.2 4.02 U putative protein 251438_s_at At3g59930 74.77 24.65 87.2 9.28 533.9 21 97.07 20.2 U putative protein 251356_at At3g61060 1299 130.4 2058 128 2166 78.3 347.2 22.8 U putative protein 255331_at At4g04330 1306 174.3 1599 24 1672 92.3 438.9 21.4 U hypothetical protein 254561_at At4g19160 631.5 185.4 1874 92.5 2766 51.9 365.5 62.8 U putative protein

251039_at At5g02020 248 105.4 232 59.1 682.2 124 189.1 35.2 U putative protein 250366_at At5g11420 4165 422 3350 37.4 3238 81.1 1662 245 U putative protein 250265_at At5g12900 372.8 52.27 235 14.1 230.7 35.8 186.7 20 U putative protein 248270_at At5g53450 722.6 59.91 538 10.8 2367 25.2 626 90.8 U putative protein 267138_s_at At2g38210 1105 263.4 1835 48.8 3207 145 835.2 132 U similar to SOR1 258049_at At3g16220 194.8 39.5 550 45 806.9 15.9 73.13 16.1 U hypothetical protein 253182_at At4g35190 81.47 23.71 84 11.2 222 10.2 63.3 14.5 U putative protein 264433_at At1g61810 54.13 16.74 303 9.2 546.7 9.37 45.05 7.76 W beta-glucosidase 256299_at At1g69530 859.5 210 1620 141 2380 182 506.8 63.5 W expansin (At-EXP1) 265499_at At2g15480 74.13 16.07 118 9.76 380.3 18.5 122 28 W putative glucosyltransferase 265501_at At2g15490 61.43 22.61 226 8.27 344.9 38 73.35 18.8 W putative glucosyltransferase 251428_at At3g60140 255.2 176.2 208 12.6 870.2 105 55.13 7.68 W beta-glucosidase-like protein 253835_at At4g27820 157.8 5.713 370 44.9 798.7 74.8 94.9 28.3 W putative beta-glucosidase

Figure S4B

signalingwalldefenseunknownbasichormonelipidseed storagecytoskeleton

Fig. S5 Epidermally expressed transcription factors that are not implicated in stomatal

regulation are not differentially regulated in yda and ∆N-YDA. Genespring cluster

analysis of 7 genes across: C24 (lanes 1-3) Ler (lanes 4-6) ∆N-YDA (lanes 7-10) and yda

(lanes 11-14). The stomatal regulators HIC1 and SDD1 and YODA are aligned at the top

and bottom of the cluster for comparison, and expression changes are indicated in the bar

at the upper left side. GL1, glabra1; CPC, caprice; GL2, glabra2; WER, werewolf.

Figure S5