Proc. Natl. Acad. Sci. USAVol. 84, pp. 2575-2579, May 1987Biochemistry

y-Actin: Unusual mRNA 3'-untranslated sequence conservation andamino acid substitutions that may be cancer related

(mutation/neoplasm/cytoskeleton/oncogene/promyelocytic leukemia)

CHUAN-CHU CHOU*t, RICHARD C. DAVIS*, MICHAEL L. FULLER*, JANET P. SLOVIN*t, ALLAN WONG*,JOCYNDRA WRIGHT*§, STEPHEN KANIA*, ROY SHAKED¶, RICHARD A. GATTI$, AND WINSTON A. SALSER*1I*Department of Biology and Molecular Biology Institute, University of California, Los Angeles, CA 90024; and TDepartment of Pathology, UCLASchool of Medicine, Los Angeles, CA 90024

Communicated by Everett C. Olson, November 17, 1986

ABSTRACT f3-Actin mutations in chemically transformedhuman cell lines have been associated with tumorigenicity, anassociation consistent with other evidence suggesting thataltered cytoskeletal proteins may have an important role incancer initiation or progression. From a human promyelocyticleukemia cell line, we have isolated a y-actin cDNA clone withamino acid substitutions in a region highly conserved in themany actins analyzed. To our knowledge, this is the firstexample of a variant y-actin in a human neoplasm. A separatefinding from the analysis of this clone is that the y-actin3'-untranslated region is among the most highly conserved ofall 3'-untranslated sequences so far reported, but is entirelydifferent from the P-actin 3'-untranslated region. The highdegree of evolutionary conservation suggests that the 3'-untranslated regions of these two mRNAs have important anddistinct functional roles that were already fully differentiatedmore than 100 million years ago. Mutations affecting fourmajor cytoskeletal components have now been identified inhuman neoplastic cells. These findings suggest that mutatedcytoskeletal genes may be members of a class of oncogenes,fundamentally different from both the nuclear-acting (e.g.,myc and simian virus 40 large tumor antigen) and growth fac-tor/receptor/protein kinase-related (e.g., sis, erbB, and ras)types of oncogenes.

Actins play important roles in muscle contraction, cellmotility, mitosis, and the maintenance of cytoskeletal struc-ture (1, 2). Expression of the different muscle actins is tissuespecific (3), and the synthesis of cellular actins is develop-mentally regulated (4, 5), perhaps in correlation with changesin cell configuration (6). In contrast to muscle actins, the ,B-and y-cytoplasmic actins are expressed in the cells of alltissues so far tested. While the two cytoplasmic actin genesappear to be regulated differently (3, 4, 8), there is no clearevidence that they differ in function.Although extensive nucleotide sequence information is

available for vertebrate a- and P-actin genes (for review seerefs. 9 and 10), the only published sequence identified as ay-actin is a 57-nucleotide region containing the N-terminalcoding region of a human fibroblast gene (11). Here wepresent a 1210-nucleotide sequence for a human y-actincDNA clone and also demonstrate that a published bovineactin sequence, pBA1 (12), is derived from a y-actin gene inwhich the 3'-untranslated (3'-UT) sequence is highly con-served.We also find that the HL-60 cell line has mutations in

cytoskeletal protein genes that may be related to cancerinitiation or progression. It has long been recognized thatcytoskeletal alterations seem to inevitably accompany neo-

plastic growth. If the mutations were selected because theyconferred a growth advantage during initiation or progres-sion, then this mutated -y-actin gene wouldjoin the increasingarray of cytoskeletal mutations from neoplastic cells thatmay form the basis of a new class of cytoskeletal-actingoncogenes.

EXPERIMENTAL PROCEDURESMaterials. HL-60 cells from original passage numbers

ranging from 50 to 100 were obtained from A. Deisseroth andH. P. Koeffler. Nylon membranes (Zetapor and Zeta-Probe)were supplied by Amf-Cuno (Meriden, CT) and Bio-Rad,respectively. Clone pHFyA-3'ut was provided by L. Kedesand the chicken P-actin cDNA clone was provided by D.Cleveland. Human fetal tissue poly(A)-enriched RNAs werethe gift of K. Kronquist, and the human hepatoma (Hep G2)poly(A)-enriched RNA was provided by A. J. Lusis.

Isolation and Sequence Analysis of the HL-60 y-Actin Clone.Construction of the cDNA libraries is presented in detailelsewhere (13, 14). The pHL1311 clone was selected byscreening about 2000 clones of an HL-60 neutrophil cDNAlibrary with a chicken 8-actin probe (gift of D. Cleveland).This library of clones had been inserted at the Pst I site ofpBR322. Subclones of pHL1311 in bacteriophage M13 vec-tors or in the miniplasmid pSDL12 (gift of Brian Seed) weresequenced by dideoxy chain-termination. Internal primerswere used to resequence regions including the amino acidsubstitutions. Sequence comparisons were made using theGenBank** and other data bases.

Radioactive Probes and Gel Blot Analyses. Radioactiveprobes specific for the 3'-UT regions of the y- and 8-actinmRNAs were prepared using the primer extension method (15)to label either the 402-nucleotide HindIII-Pst I fragment ofpHL1311 (subcloned in the M13 bacteriophage vector mplO) orclone pHL1216 (containing 371 nucleotides of the human13-actin 3'-UT region in an M13 vector; ref. 13). a-TubulinmRNA was assayed using clone pHL1301 (13), which hybrid-izes to all known human a-tubulin genes (29). For the Southernblot comparison of y-actin clones, the 3'-UT sequence in theHindIII-Pst I subclone of HL-60 y-actin clone pHL1311 waslabeled by primer extension while random priming was used tolabel the 3'-UT subclone of the human fibroblast y-actin(pHFyA-3'ut; ref. 10). Southern blot analysis was carried out as

Abbreviations: SV40, simian virus 40; 3'-UT, 3'-untranslated.tPresent address: Amgen, Inc., Thousand Oaks, CA 91320.tPresent address: U.S. Department of Agriculture AgriculturalResearch Center, Beltsville, MD 20705.§Present address: University of Massachusetts Medical Center,Worcester, MA 01605.ITo whom reprint requests should be addressed.**National Institutes of Health (1985) Genetic Sequence Databank:GenBank (Research Systems Div., Bolt, Beranek, and Newman,Inc., Boston), Tape Release 38.

2575

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Sep

tem

ber

25, 2

020

Proc. Natl. Acad. Sci. USA 84 (1987)

described elsewhere (13, 15). For RNA gel blots, the RNAsamples were treated with glyoxal; 10 ,tg was electrophoresedon each track and blotted as described (13, 14).

Cell Culture and RNA Preparation. HL-60 cells wereinduced to differentiate into neutrophil-like cells (by dimethylsulfoxide plus amiloride treatment) (16, 17) or into macro-phage-like cells (by phorbol 12-myristate 13-acetate treat-ment) (14, 18). HL-60 macrophages were isolated by scrapingmonolayers that were then resuspended in ice-cold Dulbecco'sphosphate-buffered saline with Ca2' and Mg2+ (GIBCO). Cyto-plasmic poly(A)+ RNA was prepared as described (13, 14), usinga procedure which included one cycle of oligo(dT)-cellulose chro-matography.

RESULTS

Isolation of the y-Actin cDNA Clone pHL1311. This humany-actin clone was isolated by screening a cDNA library (13)from the promyelocytic leukemia cell line HL-60 using achicken 8-actin cDNA probe. Fig. 1 shows the pHL1311cDNA sequence and the deduced amino acid sequence thatincludes the C-terminal 232 amino acids.While pHL1311 has strong homology to P-actin, it differs

from ,-actin gene sequences (20) by two amino acid changesand 54 silent mutations and shows almost no significanthomology with human /-actin in its 514-nucleotide 3'-UTregion. This suggested that pHL1311 might correspond to adifferent member of the actin gene family, perhaps y-actin.The mammalian /8- and y-actin proteins are distinguished byonly four-amino acid substitutions that are clustered withinthe first 10 residues at the N terminus (21, 22), a region notincluded in clone pHL1311. Therefore, we have used homol-ogy within the 3'-untranslated region to show that pHL1311is a y- rather than P-actin clone.Ponte et al. (10) have shown that the 3'-UT sequences for

human actins are isotype specific and that each hybridizes toa distinct set of bands in a human genomic Southern blot. Weprobed human genomic Southern blots with a 3'-UT subclone

ofpHL1311 and pHFyA-3'ut, a 3'-UT subclone of the Kedes'fibroblast-derived y-actin (10). Identical hybridization pat-terns were obtained with the two probes (Fig. 2), and thesewere very different from patterns obtained with the 8-actin3'-UT probe pHL1216 (data not shown), confirming thatpHL1311 is a y-actin gene clone.

Evolutionary Conservation of the 3'-Untranslated Region.Because the only sequence identified as a y-actin genesequence (11) was the 57-nucleotide N-terminal region, weused the program of Wilbur and Lipman (19) to search theGenBank data base for sequences homologous to pHL1311.We noted strong homology with a bovine actin sequence (12).The bovine cDNA clone contained 442 nucleotides of 3'-UTsequence. This untranslated region of the bovine sequenceshows 83% overall homology to pHL1311 and contains twosubregions of 63 and 164 nucleotides showing greater than90% homology (Fig. 1).

y-Actin Mutations in the HL-60 Promyelocytic Leukemia.Protein sequence analysis (21, 22) of normal mammaliany-actins shows an amino acid sequence identical to thatderived from pHL1311 except at amino acids 316 and 344,where glutamic acid and serine are replaced by lysine andphenylalanine, respectively. Our examination of the Gen-Bank data base reveals that positions 316 and 344 areinvariant not only among cytoplasmic actins but also amongthe several mammalian muscle actin sequences. Actins asdiverse as yeast and maize, which differ by 77 amino acidsubstitutions, conserve both of these residues. Interestingly,the only other case of a variant cytoplasmic actin occurred inthe HuT 14 human cancer cell line that had been transformedby chemical mutagenesis. In that case three distinct muta-tions in the /3-actin gene were shown to be correlated withincreased tumorigenicity when derivatives of this humancancer cell line were tested in nude mice (23-27).

Tissue Distribution and Developmental Regulation of ActinmRNAs. Using our y-actin 3'-UT region subclone to probeRNA gel blots, we measured the expression of y-actin in avariety of human tissues (Fig. 3). y-Actin mRNA was found

150 160 170Ala Ser Gly Arg Thr Thr Gly Ile Val Met Asp Ser Gly Asp Gly Val Thr His Thr Val Pro Ile Tyr Glu Gly Tyr Ala Leu Pro His

Pat I site (poly G) CCC TCT GGG CGC ACC ACT GGC ATT GTC ATG GAC TCT GGA GAC GGG GTC ACC CAC ACG GTG CCC ATC TAC GAG GGC TAC GCC CTC CCC CAC 90180 190 200

Ala Ile Leu Arg Leu Asp Leu Ala Gly Arg Asp Leu Thr Asp Tyr Leu Met Lys Ile Leu Thr Glu Ar GYl TYr Ser Phe Thr Thr Thr Ala Glu Arg Glu IleGCC ATC CTG CGT CTG GCA CTG GCT GGC CCG CAC CTG ACC GAC TAC CTC ATG AAG ATC CTC ACT GAG CG CG TAC AGC TTC ACC ACC ACG GCC GAG CCG CAA ATC 195

210 220 230 240Val Ar As Ile Lys Glu Lys Leu Cys Tyr Val Ala Leu Asp Phe Glu Gln Glu Met Ala Thr Ala Ala Ser Ser Ser Ser Leu Glu Lys Ser TYr Clu Lou ProGTG CCC GAC ATC AAG GAG AAG CTG TMC TA GTC GCC CTG GAC TTC GAG CAC GAG ATG GCC ACC GCC GCA TCC TCC TCT TCT CTG GAG AAG AGC TAC GAG CTG CCC 300

250 260 270Asp Gly Gln Val Ile Thr Ie GCly Asn Glu Arg Phe Arg Cys Pro Glu Ala Lou Phe Gln Pro Ser Phe Lou Gly Met Glu Ser C Gly Ile His Glu Thr ThrAGGC CAG GTC ATC ACC ATT GCC AAT GAG CCC TTC CC TGT CCC GAG GCC CTC TTC CAG CCT TCC TTC CTG GT ATG GAA TCT TCC GCC ATC CAC GAG ACC ACC 405

280 290 300 310Ph. Asn Ser Ile Met Lye Cys Asp Val Asp Ile Arg Lye Asp Leu Tyr Ala Asn Thr Val Leu Sor Gly Gly Thr Thr NMt Tyr Pro Gly Ile Ala Asp Arg MetTTC AAC TCC ATC ATG LAG TCTCAC CGTG AC ATC CCC A=A CgA CTG TAC GCC AAC AC_ GTG CTG TCG GGC GCC ACC ACC ATG TAT CCG GGC ATT GCC Q ACAG ATG 510

MT 320 330 340 ITRIGln Ly lLysjIle Thr Ala Leu Ala Pro Ser Thr Met Lys Ile Lys Ile Ile Ala Pro Pro Glu Arq Lye Tyr Ser Val Trp Ile Gly Gly Ph. Ill Leu Ala SerCAG jAAGAAGATC AGC GCC CTG GCG CCC AGC ACC ATG AAG ATC AAG ATC ATC GCA CCC CCA GAG CC A TAC TCC GTG TGG ATC GCC GCCCTTCI ATC CTGCGCC TCL 615

350 360 370 375Leu S-r Thr Ph. Gln Gln Met Trp Ile Ser Lys Gln Glu Tyr Asp Glu Ser Gly Pro Ser Ile Val His Arg Lys Cys Phe TermCTG TCC ACC TTC CAG CAG ATG TGG ATT AGC AAG CAG GAG TAC GAC GAG TCG GGC CCC TCC ATC GTC CAC CGC AAA TGC TTC TAA ACGGACTCAGCAGATGCGTAGCkTTTG 726

bovine 3' -untranslated sequene* ..CC.C-GC. -.--.- (bov)Rind IIT

CTGCATGGGTTAATTGAGAA-TAGAAATTTGCCCCTGGCAAATGCACACACC TCATGCTAGCCTCAcGAAACTGGAATAAGCCCATCC T-GTCCTTGAAGCTTGT-ATCTG-ATATCAGCACTGCATTGT 860.A. C... ...T. ..G- ....T.T........ T. T. T.T. (bov)

AG-AACTTGTTGCTGATTTTGACCTTGTATTGAAGTTAACTGTTCCCCTTGGTATTTGTTTAATACCCTGTACATATCT TTGAGTTC-AACCTTTAGT-ACGTGTGGCTTGCTCACTTCGTGGCTAAGGTAAGAACGT 995TAG. C.A-. A . .G ....T..AA....CC....T.TA..C....CTC....C...A-...G ....G ....T.. (bov)

GCTTGTGGAAGACAAGTCTG--TGGCTTGGTGAGTCTGTGTGGCCAGCAGCCTCTGA- TCTGTGCAGGGTATTAACGTGTCAGGGCTGAGTGTTCTGGGATTTCTCTkGAGGCTGGCAACAIA-CCAGTTGTTTTGTC 1128..A..CTAA. A.A..AA.C..G.AGACTG..T....C.I...T .A....CC.A....A.IGT..T--..(.nd bovine

homology)TTGCGGGTCTGTCAGGGTTGGAAGTCCAAGCCGTAGGACCCAGTTTCCTTTCTTAGCTGATGTCTTTGGCCAGAACACCGT (poly C) Pat I site o 210

FIG. 1. Nucleotide sequence of the y-actin cDNA clone pHL1311 and evolutionary conservation of the 3'-UT sequence. The HindIII andPst I restriction sites used for constructing the 3'-UT subclone are indicated. Boxes around residues 316 and 344 indicate amino acid substitutionsconfirmed using internal primers to resequence. Underlining is used to indicate the positions within the coding sequence at which the y- and/3-actin mRNA sequences (20) differ by silent base substitutions. The 3'-UT sequence of the human t-actin clone is compared with that of apartial sequence from a bovine clone (12). The program SRCHN (19) was used to align the sequences for maximal homology. In the 3'-UT regionthe upper sequence is human and the lower is bovine. Nucleotides in the bovine 3'-UT sequence, which are identical to the human sequence,are indicated by periods (....) below the corresponding nucleotides of the human sequence. Dashes (---) in either the human or bovine sequenceindicate gaps inserted to align the sequences. In computing the sequence conservation we have weighted insertion or deletion of n nucleotidesto be equal with n base substitutions since this gives the most conservative estimation of sequence conservation. Calculated in this way, theconservation for the entire y-actin 3'-UT sequence shown here is 83% while that for the human and rat ,B-actin 3'-UT sequences, recalculatedin the same way from Ponte et al. (20), is 74%. The two most highly conserved subregions (>90% homology) of about 164 and 63 nucleotidesare boxed.

2576 Biochemistry: Chou et aL

Dow

nloa

ded

by g

uest

on

Sep

tem

ber

25, 2

020

Proc. NatL. Acad. Sci. USA 84 (1987) 2577

A

Days of differentiationNeutrophils - Macrophages

I 1 1 3

0. ~ 4'?-

FIG. 2. pHL1311 (lanes 1and 3) and pHFyA-3'ut (humanfibroblast y-actin 3'-UT se-quences) (lanes 2 and 4) probeshave identical hybridization pat-terns to Southern blots ofhumangenomic DNA digested with ei-ther EcoRI (lanes 1 and 2) orMsp I (lanes 3 and 4). ThepHL1311 subclone containedthe HindIII-Pst I fragment (seeFig. 1). The size marker was XDNA digested with HindIll.

to be more abundant in the cytoplasmic poly(A)+ RNAs offetal brain, fetal kidney, a hepatoma cell line, and undiffer-entiated HL-60 cells than in fetal liver and trophoblasts.Using 3'-UT sequences from -t-actin or p-actin as isotype-specific probes, we measured changes in the ,3- and y-actinmRNA concentrations on RNA gel blots of cytoplasmicpoly(A)+ RNA from HL-60 cells before and after exposure tovarious inducing agents. These cells can be induced to ceasereplication and differentiate to either macrophages or neu-trophils (16, 18). The resulting cell types differ markedly inmorphology, biological properties, and in the proteins theyexpress (28). The changes in messenger levels for P, andy-actin during this differentiation are compared with those fora-tubulin in Fig. 4. Interestingly, the regulation of P-actinmRNA levels paralleled that of a-tubulin mRNA but wasvery different from that of y-actin. The ratio of y- to P-actinmRNAs increased more than 10-fold during the first 2 days ofmacrophage differentiation (Fig. 4B).

DISCUSSIONAside from the AATAAA polyadenylylation signal, the roleof 3'-UT sequences is little understood. It was initially, anderroneously, claimed that the 3'-UT regions of actin mRNAsare not conserved (30, 31). In fact, we have found a markedhomology between the 3'-UT regions of human and bovine-actin clones which indicates that these 3'-UT sequences are

among the most strongly conserved of all mRNA untrans-lated regions thus far studied. Although mammalian -actin3'-UT regions are less strongly conserved, we compute a 74%homology (see legend to Fig. 1), which suggests that the

1 2 3 4 S h

- - 6

FIG. 3. Differential expression of y-actin in various human celllines and tissues. The RNA gel blot was probed with the 3'-UTsequence from pHL1311. Lanes contained 10 ,ug of poly(A)+cytoplasmic RNA as follows: 1, human fetal brain; 2, human fetalkidney; 3, human fetal liver; 4, human fetal trophoblasts; 5, Hep G2hepatoma cells; and 6, HL-60 cells. The band position indicates a sizeof 2.35 kilobases.

B

la

0- :

f X0

3 2 1 0 1 2 3Neutrophils - Macrophages

Days of differentiation

FIG. 4. y-Actin RNA concentration during induction of HL-60monocytic (phorbol 12-myristate 13-acetate) and neutrophilic (di-methyl sulfoxide and amiloride) differentiation. Poly(A)+ RNAsamples were from HL-60 cells or HL-60 cells treated with phorbol12-myristate 13-acetate or dimethyl sulfoxide and amiloride for 1, 2,and 3 days (13). (A) RNA gel blot of 5-,ug samples of cytoplasmicpoly(A)+ RNA hybridized with a probe made from the 3'-UT regionof pHL1311. The hybridized band was 2.35 kilobases long. (B)Concentrations of,3- and y-actin mRNAs (O and X, respectively) anda-tubulin mRNA (e) during HL-60 differentiation. Days of phorbol12-myristate 13-acetate or dimethyl sulfoxide and amiloride treat-ment are indicated by the rightward and leftward arrows, respec-tively. The RNA concentrations are indicated as percentages of eachmRNA's maximal concentration. The data are derived from severalseparate blots similar to the one shown in A, each of which wassuccessively hybridized with several probes. The probes used wereall HL-60 cDNA clones as follows: t-actin (3'-UT HindIII-Pst Ifragment of pHL1311), 1-actin (clone pHL1216), or a-tubulin(pHL1301). The use of successive hybridization of the same blot tomeasure the ratios of mRNAs corresponding to the different probeseliminates artifacts that could arise from uncertainties in lane-to-laneRNA concentration.

3'-UT sequence of p-actin mRNA may also have a functionalrole. The remarkable thing about this strong evolutionaryconservation is that the -y- and 8-actin 3'-UT sequences areso dissimilar! There is no significant homology other than theunderlined six-nucleotide sequence following the terminationcodon (Fig. 1). This suggests that they have distinct func-tional roles that were fully distinguished well before thedivergence of the primate and bovine lines of descent about70 million years ago, in the late Cretaceous period.The observation that the cytoplasmic actin mRNAs have

such different and yet highly conserved 3'-UT sequences isinteresting because no distinctions between the roles of ,B-and y-actins have been proposed and because they differ atonly 4 amino acid residues clustered within 10 residues of theN terminus (22). We also demonstrate for the first time thatthe ratio of y- to ,B-actin mRNA levels is strongly regulatedduring differentiation. This is consistent with reports that they- and ,B-actin protein ratios change dramatically in otherlifferentiation processes (8).

It is possible that the 3'-UT regions could play a role in thisregulation of actin genes or in the targeting of actin mRNAsto the ruffling edge of lamellipodia (32). Such alternative

4m..W-'

* v -) ,v

kh

-w 9.,. --.6

b

i -2.

1s i I_

14 r

Biochemistry: Chou et aL

5

Dow

nloa

ded

by g

uest

on

Sep

tem

ber

25, 2

020

Proc. Natl. Acad. Sci. USA 84 (1987)

hypotheses might be tested by using site-directed mutagen-esis techniques, now that we have demonstrated that genom-ic clones for several different mRNAs are expressed andregulated when transfected into HL-60 cells (33, 34).

It is interesting that another of the cytoskeletal proteins ofthe HL-60 promyelocytic cell line, a-tubulin, also showsevidence of somatic mutation (ref. 34; S. Teraoka, C.-C.C.,A. Thomason, G. Yasuda, and W.A.S., unpublished data)that includes the deletion of a pair of amino acids and twoamino acid substitutions. One set of changes inserts anarginine in place of the Asp-Leu-Glu at residues 69-71,conserved in all other a-tubulins and lying squarely in themiddle of a region identified as an important part of the GTPbinding site (7). The other change, substitution of arginine forglutamine at position 233, is also in a region that is invariantin all other a-tubulins so far reported, including such diversespecies as yeast and Chlamydomonas. In the case of actin, itis more difficult to say what function could be affected by theamino acid substitutions at positions 316 and 344. Theextraordinary degree of evolutionary conservation of theactins has led to proposals that the surface is covered with alarge number of specific binding sites for the many differentproteins thought to be important in regulating its higher-orderstructure. Actin-actin intermolecular contacts and interac-tions with both myosin light chain and depactin have beenlocalized in the nearby carboxyl-terminal region stretchingfrom amino acid residue 355 to position 375 (reviewed in ref.35). In addition, photoaffinity labeling techniques place theATP binding site in the vicinity of the amino acid substitu-tions at residues 316 (glutamic acid to lysine) and 344 (serineto phenylalanine), since 8-azido-ATP labels Lys-336 andTrp-356 (36) while 2-azido-ADP labels Tyr-306 (37).Changes in cytoskeletal function might influence the ma-

lignant phenotype of the HL-60 leukemic cells by a variety ofmechanisms. Changes in cytoarchitecture have been associ-ated with changes in growth rate, attachment, saturationdensity, and the expression of differentiated phenotypes.Changes in any of these properties could favor neoplasticgrowth and play a role in either tumor initiation or progres-sion. The observation that all transformed cells have de-ranged cytoskeletal architecture (38, 39) suggests an involve-ment with neoplastic growth that is supported by experimentswith simian virus 40 (SV40) small tumor antigen (see below).

In some cases the altered cytoskeleton may be a directeffect of the expression of viral oncogenes. For instance, theSV40 small tumor antigen has been shown by direct injectionexperiments to promptly promote dissolution of the actincytoskeleton (for review see ref. 42). Mutations that eliminatesynthesis of small tumor antigen (but do not affect largetumor antigen) do not prevent transformation of cells bySV40, but the cells transformed by the mutant virus areunable to form colonies in soft agar (42). Since ability to formcolonies in soft agar correlates well with ability to formtumors, the result suggests that, in this case, cytoskeletalalterations are necessary for tumorigenic growth (42).

In other cases, such as the HL-60 and HuT 14 cell lines,mutations in the cytoskeletal proteins themselves may be thecause of the transformation-related changes in cytoskeletalarchitecture correlated with neoplastic growth. Leavitt,Kakunaga, and their coworkers (23-27) found that a clonalchemically transformed human fibroblast cell line (HuT 14)had an amino acid substitution in its 1-actin. They furtherfound that a subclone (HuT 14T) exhibiting increased tumor-igenicity in nude mice had two additional amino acid substi-tutions in,3-actin and that this mutant B3-actin interacted withfibronectin in an abnormal fashion. Interestingly, Leavitt etal. (43) have also reported that the HuT 14 transformed cellline is altered in its tropomyosin gene expression in additionto having the P3-actin mutations discussed above.

The clone pHL1311 is, to our knowledge, the first reportedexample of cancer-associated amino acid substitutions in thestructure of a y-actin. Could this y-actin amino acid substi-tution be associated with the HL-60 cell line by chance ratherthan having appeared because it confers a growth advantageon the neoplastic cells that contain it? We cannot answer thisquestion directly; however, the potential significance of thecancer association is increased by the fact that the HL-60 cellline was derived from a leukemic patient and was notsubjected to intentional mutagenesis such as was used increating the HuT 14 transformed cell line. Moreover, theobservation of multiple independent cytoskeletal mutationsin the same neoplastic cell line (observed for both the HL-60and HuT 14 cell lines) can be easily understood if these aresuccessive mutations that confer growth advantages butwould be statistically improbable if they are interpreted as achance occurrence of several independent mutations confer-ring no growth advantage. It is interesting to note thatcytoskeletal somatic mutations may be more commonlyassociated with neoplasms than is generally recognized: fewcytoskeletal protein genes from neoplastic cells have beensequenced.

It has long been proposed that tumor initiation and pro-gression require a series of mutational alterations. This issupported by the observation that metastatic tumor samplesfrequently show evidence of additional oncogene activitiesnot present in the primary tumor and by the fact that primarytumors frequently contain several activated oncogenes. HL-60 cells are known to contain amplified c-myc genes (44), ap53 deletion (45), and an activated N-ras gene (46) in additionto the cytoskeletal gene alterations discussed here. Classicaloncogenes have been categorized into those such as myc andSV40 large tumor antigen, which show an affinity for thenucleus, and those such as sis, erbB or ras, which inappro-priately stimulate parts of control pathways leading fromgrowth factors through growth-factor receptors and proteinkinases to GTP-binding (G) proteins. The cancer-associatedalterations that have been reported to affect four humancytoskeletal proteins (/3-actin, y-actin, a-tubulin, andtropomyosin) appear to fall outside these two categories. Wepropose that such cancer-associated cytoskeletal gene alter-ations may constitute a new class of oncogenes. This class ofoncogenes would also include proteins such as the SV40small tumor antigen, since it has been shown to have a directeffect in altering the cytoskeleton (see above). It might alsoinclude oncogenes such as v-fgr, which is a fusion betweenportions of y-actin and a protein kinase (47), or trk, which isa fusion of a tropomyosin gene with a protein kinase (40). Ithas been proposed that the actin moiety of v-fgr may interferewith the formation of proper cytoskeletal structure (47).We propose that a cytoskeleton-related oncogene class

would contribute to oncogenic initiation or progression bydisrupting the regulatory functions of the cytoskeleton.These cytoskeletal alterations seem to be required for cancerinitiation or progression but their effects also appear to befundamentally different from those of the nuclear protein- orgrowth factor/receptor/protein kinase-related classes of on-cogenes. It is because of this distinction that we feel it isuseful to consider them as a separate class of oncogenes.

Ideally we would like to be able to directly test whetherthe cytoskeletal mutations detected in actin and tubulin genesconfer a growth advantage at some stage of cancer initiationor progression. Unfortunately there are several reasons whysuch tests may give negative results, even if our hypothesisis correct. First, the fact that many oncogenes that transformNIH 3T3 cells will not transform a variety of other cell linessuggests not only that NIH 3T3 cells are unusual but alsothat NIH 3T3 cells and the other test cells currently usedmay provide an assay for only a limited range of oncogenetypes. It may be difficult to find such an assay for other

2578 Biochemistry: Chou et aL

Dow

nloa

ded

by g

uest

on

Sep

tem

ber

25, 2

020

Proc. Natl. Acad. Sci. USA 84 (1987) 2579

types of oncogenes. Second, cytoskeletal mutations mightfrequently fall into the recessive class of oncogene defects.Recessive oncogenes, such as that demonstrated for retino-blastoma (41), may be common and yet would be difficult todemonstrate in an in vitro system. Finally, some aspects ofcancer progression (e.g., invasiveness and changes in meta-static potential) involve growth advantages that would be es-pecially difficult to demonstrate in an in vitro system eventhough they may have great clinical importance. For thesereasons we believe it is helpful to focus attention on cyto-skeletal alterations as a possible new class of oncogenes,even though the cancer associations described in this reportprovide only circumstantial evidence in favor of the model.

Note Added in Proof. After this paper was in press, we learned ofpublication of the sequence for human y-actin mRNA by Erba et al.(48). The sequence we report differs from their figure 2 but appearsto be identical to their gamma A-2 allele except at the positions of thetwo amino acid substitutions. Also we note 97% conservation of the164-nucleotide region boxed in our Fig. 1 when the bovine sequenceis compared with a mouse y-actin pseudogene (49).

We thank Dr. K. Kronquist and Dr. A. J. Lusis for human RNAand Hep G2 RNA samples and D. Cleveland and L. Kedes for 13-actinand y-actin clones. We thank Michele Lau for her expert technicalassistance. We also thank Robert Weinberg, Sheldon Penman, EliasLazarides, Flossie Wong-Staal, Helga Boedtker, Philip Koeffler, andHarvey Herschman for helpful comments on the manuscript. Thiswork was supported by Grant PCM-82-04182 from the NationalScience Foundation and Public Health Service Grants CA32186,CA40969, and GM18586 from the National Institutes of Healthawarded to W.A.S. Support for the Southern blot analysis wasprovided in part by Public Health Service Grant CA35966 from theNIH to R.A.G.

1. Goldman, R., Pollard, T. & Rosenbaum, J., eds. (1976) Cell Motility(Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).

2. Pollard, T. D. & Weihing, R. R. (1974) Crit. Rev. Biochem. 2, 1-65.3. Vandekerckhove, J. & Weber, K. (1979) Differentiation 14, 123-133.4. Bains, W., Ponte, P., Blau, H. & Kedes, L. (1984) Mol. Cell. Biol. 4,

1449-1453.5. Bond, J. F. & Farmer, S. R. (1983) Mol. Cell. Biol. 3, 1333-1342.6. Farmer, S. R., Wan, K. M., Ben-Ze'ev, A. C. & Penman, S. (1983) Mol.

Cell. Biol. 3, 182-189.7. Leberman, R. & Egner, U. (1984) EMBO J. 3, 339-341.8. Gerstenfeld, L. C., Finer, M. H. & Boedtker, H. (1985) Mol. Cell. Biol.

5, 1425-1433.9. Bergsma, D. J., Chang, K. S. & Schwartz, R. J. (1985) Mol. Cell. Biol.

5, 1151-1162.10. Ponte, P., Gunning, P., Blau, H. & Kedes, L. (1983) Mol. Cell. Biol. 3,

1783-1791.11. Gunning, P., Ponte, P., Okayama, H., Engel, J., Blau, H. & Kedes, L.

(1983) Mol. Cell. Biol. 3, 787-795.12. Degen, J. L., Neubauer, M. G., Friezner Degen, S. J., Seyfried, C. E.

& Morris, D. R. (1983) J. Biol. Chem. 258, 12153-12162.13. Davis, R. C., Thomason, A. R., Fuller, M. L., Slovin, J. P., Chou,

C.-C., Chada, S., Gatti, R. A. & Salser, W. A. (1987) Dev. Biol. 119,164-174.

14. Chou, C.-C., Gatti, R., Fuller, M. L., Concannon, P., Wong, A., Chada,S., Davis, R. & Salser, W. (1986) Mol. Cell. Biol. 6, 566-573.

15. Gatti, R. A., Concannon, P. & Salser, W. A. (1984) Biotechniques 2,148-155.

16. Rovera, G., Santoli, D. & Damsky, C. (1979) Proc. Natl. Acad. Sci.USA 76, 2779-2783.

17. Carlson, J., Dorey, R. & Koeffler, H. P. (1984) J. Natl. Cancer Inst. 72,13-17.

18. Collins, S. J., Ruscetti, F. W., Gallagher, R. E. & Gallo, R. C. (1978)Proc. Natl. Acad. Sci. USA 75, 2458-2462.

19. Wilbur, W. J. & Lipman, D. J. (1983) Proc. NatI. Acad. Sci. USA 80,726-730.

20. Ponte, P., Ng, S.-Y., Engel, J., Gunning, P. & Kedes, L. (1984) NucleicAcids Res. 12, 1687-16%.

21. Lu, R. C. & Elzinga, M. (1977) Biochemistry 16, 5801-5806.22. Vandekerckhove, J. & Weber, K. (1978) Eur. J. Biochem. 90, 451-462.23. Vandekerckhove, J., Leavitt, J., Kakunaga, T. & Weber, K. (1980) Cell

22, 893-899.24. Hamada, H., Leavitt, J. & Kakunaga, T. (1981) Proc. Natl. Acad. Sci.

USA 78, 3634-3638.25. Leavitt, J., Bushar, G., Kakunaga, T., Hamada, H., Hirakawa, T.,

Goldman, D. & Merril, C. (1982) Cell 28, 259-268.26. Lin, C.-S., Ng, S.-Y., Gunning, P., Kedes, L. & Leavitt, J. (1985) Proc.

Natl. Acad. Sci. USA 82, 6995-6999.27. Leavitt, J., Gunning, P., Porreca, P., Ng, S.-Y., Lin, C.-S. & Kedes, L.

(1984) Mol. Cell. Biol. 4, 1961-1969.28. Salser, W. A., Davis, R. C., Chou, C.-C., Teraoka, S. N., Thomason,

A., Nelson, R. & Slovin, J. (1986) in Molecular Approaches to Devel-opmental Biology, eds. Firtel, R. A. & Davidson, E. H. (Liss, NewYork), Vol. 51, in press.

29. Salser, W. A., Chou, C.-C., Davis, R. C., Slovin, J. P. & Thomason, A.(1985) in Leukemia: Recent Advances in Biology and Treatment, eds.Gale, R. P. & Golde, D. W. (Liss, New York), pp. 349-379.

30. Hanukoglu, I., Tanese, N. & Fuchs, E. (1983) J. Mol. Biol. 163,673-678.

31. Cleveland, D. W., Lopata, M. A., MacDonald, R. J., Cowan, N. J.,Rutter, W. J. & Kirschner, M. W. (1980) Cell 20, 95-105.

32. Lawrence, J. B. & Singer, B. H. (1986) Cell 45, 407-415.33. Concannon, P., Teraoka, S. N., Nelson, R. & Salser, W. A. (1985) in

Leukemia: Recent Advances in Biology and Treatment, eds. Gale, R. P.& Golde, D. W., (Liss, New York), pp. 73-89.

34. Teraoka, S. N., Concannon, P., Chou, C.-C., Fuller, M. L., Chada, S.,Wong, A., Wright, J., Kania, S., Snyder, C., Hwa, J., Davis, R.,Nelson, R., Thomason, A. & Salser, W. (1985) in Proteins of IronStorage and Transport, eds. Spik, G., Montreuil, J., Crichton, R. R. &Mazurier, J. (Elsevier, Amsterdam), pp. 349-356.

35. Pollard, T. D. & Cooper, J. A. (1986) Annu. Rev. Biochem. 55, 987-1035.

36. Hegyi, G., Szilagyi, L. & Elzinga, M. (1986) Biochemistry 25, 5793-5798.

37. Kuwayama, H. & Yount, R. G. (1986) Biophys. J. 49, 454a (abstr.).38. Pollack, R. (1981) in Cancer: Achievements, Challenge, and Prospects

for the 1980's, eds. Burchenal, J. H. & Oettgen, H. F. (Grune &Stratton, New York), pp. 501-515.

39. Tucker, R. W., Sanford, K. K. & Frankel, F. R. (1978) Cell 13, 629-642.

40. Martin-Zanca, D., Hughes, S. H. & Barbacid, M. (1986) Nature (Lon-don) 319, 743-748.

41. Benedict, W. F., Murphree, A. L., Banerjee, A., Apina, C. A.,Sparkes, M. C. & Sparkes, R. S. (1983) Science 219, 973-975.

42. Bikel, I., Mamon, H., Brown, E. L., Boltax, J., Agha, M. & Livingston,D. M. (1986) Mol. Cell. Biol. 6, 1172-1178.

43. Leavitt, J., Latter, G., Lutomski, L., Goldstein, D. & Burbeck, S. (1986)Mol. Cell. Biol. 6, 2721-2726.

44. Dalla-Favera, R., Wong-Staal, F. & Gallo, R. C. (1982) Nature (London)299, 61-63.

45. Wolf, D. & Rotter, V. (1985) Proc. Natl. Acad. Sci. USA 82, 790-794.46. Murray, M. J., Shilo, B.-Z., Shih, C., Cowing, D., Hsu, H. W. H. &

Weinberg, R. A. (1981) Cell 25, 355-361.47. Naharro, G., Robbins, K. C. & Reddy, E. P. (1984) Science 223, 63-66.48. Erba, H. P., Gunning, P. & Kedes, L. (1986) Nucleic Acids Res. 14,

5275-5295.49. Tokunaga, K., Yoda, K. & Sukiyama, S. (1985) Nucleic Acids Res. 13,

3031-3043.

Biochemistry: Chou et aL

Dow

nloa

ded

by g

uest

on

Sep

tem

ber

25, 2

020