wildsi 3 open access dsi scenarios - dsmz.de...leibniz-institut • dsmz-deutsche sammlung von...
TRANSCRIPT
![Page 1: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/1.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
WiLDSI 3 open access DSI scenarios “Science-based solutions for Digital Sequence Information (DSI) in preparation for COP 15” „Wissenschaftsbasierte Lösungsansätze für Digitale Sequenzinformation (DSI)“
Dr. Amber Hartman Scholz, Deputy to the Director Dr. Jens Freitag, Head of Managing Office
![Page 2: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/2.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
The story begins with a registered collection
![Page 3: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/3.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
0
20
40
60
80
100
120
140
Waiting list No answer Answer Bounced email
2017
2018
2019
We wrote to every country in the ABS-CH
![Page 4: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/4.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Survey of academic research projects after 2014
• Short survey of 20 institutes involved in biodiversity research
• 40 projects • 23 countries • Average:
• 3 year project length • 65,000 Eur
![Page 5: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/5.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
The Nagoya Protocol and CBD cause delays in biodiversity research
0
2
4
6
8
10
12
14M
onth
s
Country of origin Nagoya Protocol Country
CBD Country
Time to permit
![Page 6: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/6.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
1. Global health, biodiversity, other public goods are very
rarely given „simplified measures“ (Art.8) by Parties
2. Scientific reality: lots of organisms have cosmopolitan
distribution. Jurisdiction shopping frustrates everyone.
3. Lack of capacity in provider countries
4. A 2-tier system could bring paralysis
either Nagoya-like or very easy
Learning from Nagoya
![Page 7: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/7.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
2 years ago…
Source: https://www.onthisday.com/photos/julis-caesar-crosses-the-rubicon
![Page 8: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/8.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Source: https://www.onthisday.com/photos/julis-caesar-crosses-the-rubicon
So why cross the Rubicon?
![Page 9: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/9.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
1. Sequence data are important & growing
PLoS Biol. 2015 Jul; 13(7): e1002195. doi: 10.1371/journal.pbio.1002195
![Page 10: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/10.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Christian R. Boehm, and Ralph Bock Plant Physiol. 2018;179:794-802 ©2019 by American Society of Plant Biologists
2. DSI can reduce but not replace physical GR Biological properties and existing technical capacities for synthetic biology of plastids
compared to bacteria, yeast and the plant nucleus.
![Page 11: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/11.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH Porter TM, Hajibabaei M (2018) Over 2.5 million COI sequences in GenBank and growing. PLOS ONE 13(9): e0200177. https://doi.org/10.1371/journal.pone.0200177
3. Biodiversity needs DSI: we have to fill in the map
![Page 12: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/12.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
4. We are students of history:
we expect a horse trade
2010: Nagoya & Aichi
2020: DSI & post-2020 Framework
![Page 13: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/13.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Crash course on DSI infrastructure
![Page 14: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/14.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
The INSDC is the core infrastructure for NSD (DSI)
~$50 USD mil./year -Free to all users -No registration
![Page 15: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/15.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
99.9% of NSD databases depend on INSDC
The rest use INSDC unique id’s
95% directly link to or download NSD from the INSDC
99.9% of public NSD databases rely on the INSDC
![Page 16: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/16.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
Half of INSDC is out of geographical scope
52% of NSD comes from 4 countries (3 free access, China unclear)
![Page 17: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/17.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
~37% of INSDC is out of material scope
![Page 18: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/18.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
Key lessons learned from CBD database study
Companies download
entire INSDC
monthly
43% no country tag
Beyond INSDC: ~5x more users (>50 million)
![Page 19: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/19.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
WiLDSI goals: a new DSI ABS system should be....
1. Compatible with free, open access INSDC
2. Integrated and NOT a stand-alone system (e.g., blockchain)
3. Administratively nimble or invisible for scientists
4. Ideally compatible with other international fora
5. Income-generating without explicit public sector funds
6. Acknowledge the demands of the developing world
7. Stop being „DSI“ and become something else
![Page 20: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/20.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
If the solution has to be bilateral….. (A) Nagoya plus
???
![Page 21: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/21.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
(A) Nagoya plus
ABS-CH
IRCC or Country tag
?
?
?
? ?
?
![Page 22: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/22.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Key components of (A) Nagoya plus
1. DSI Handling: stable, verifiable, online objects that can be linked via ABS-CH • IRCCs with standardized terms & conditions • Alternative: Country tags linked to BS instructions • Other forms of PIC/MAT invalid for DSI Party forfeits BS
2. Benefit sharing: Bilateral, Nagoya-like
![Page 23: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/23.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
(B) Country Tag
![Page 24: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/24.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Country tag
(B) Country Tag
New use policy Open + click Can use policy extend
here too?
![Page 25: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/25.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
How could a click work?
![Page 26: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/26.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
INSDC use policy has changed little since 2002
1. …uniform policy of free and unrestricted access to all of the data records their databases contain.
2. The INSD will not attach statements to records that restrict access to the data, limit the use of the information in these records, or prohibit certain types of publications based on these records. Specifically, no use restrictions or licensing requirements will be included in any sequence data records...
3. All database records submitted to the INSD will remain permanently accessible as part of the scientific record...
4. ..information displayed on the Web sites maintained by the INSD is fully disclosed to the public…
Science 298 (5597): 1333 15 Nov 2002 http://www.insdc.org/policy.html
![Page 27: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/27.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Key components of (B) Country Tag
1. Country tag becomes mandatory during submission • INSDC curates, needs additional funding
2. INSDC use policy would change • Benefit sharing obligations for commercial use • Annual contribution • Acknowledged through „click“ acceptance
3. Open access remains 4. Distribution of funds proportional to country tag in
database
![Page 28: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/28.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
(C) De-coupled
![Page 29: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/29.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
(C) De-coupled
For legal certainty,
contribute here!
![Page 30: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/30.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Key components of (C) De-coupled
1. All non-human (biodiversity-based) DSI is in • No tracing, tracking, scoping necessary • Easily used by other international fora
2. Because no tracing necessary, monetary BS triggered at market entry
3. No change from INSDC required 4. BS mechanism is voluntary but provides legal certainty
• NP already creates obligations. Voluntary mechanism provides certainty.
5. Fund distribution based on application (like GEF)
![Page 31: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/31.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Add-on options
1. Extend MLS to physical GR • Especially publicly availalable GR in ex situ collections
2. Needs-based targeting: INSDC mirror sites?
• Learn from the CGIAR model
3. Alternative to country-tag could be a single data tag (like PAT)
![Page 32: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/32.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Additional monetary mechanisms compatible with open access
1. Innovative finance:
• Micro-levy (on sequencing machines?) (e.g. UNITAID)
• Certification scheme (voluntary) (e.g., RED label)
• PPP with grants, loans, equity investment (e.g. GAVI)
2. Sector-dependent royalties (patent pools, CHs)
3. Open-access publishing fee
![Page 33: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/33.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
WiLDSI Steering Committee
Dr. Carmen Richerzhagen DLR/DIE
Dr. Amber H. Scholz DSMZ
Prof. Dr. Esther van Zimmeren Uni Antwerp
Dr. Jens Freitag IPK Gaterseleben Dr. Guy Cochrane
EMBL-EBI
Prof. Dr. Claudia Seitz Uni Bonn
Thomas Greiber BfN
Dr. Jean Carlos Rodriguez DIE Fabian Rohden
DSMZ (former) Dr. Upneet Hillebrand
DSMZ
Torsten Thiele IASS
Marliese von den Driesch BLE
Legal expertise
Financial expertise
Regulatory expertise (external advisors)
Database expertise
Development expertise Scientific expertise
![Page 34: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/34.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Thank you! [email protected]
Dr. Hilke Marie Püschner
Prof. Dr. Jörg Overmann
![Page 35: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/35.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Quantifying non-monetary benefits
![Page 36: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/36.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
NSD usage by international scientists
4 target countries for interviews (36 so far) • Colombia (10), South Africa (11), Brazil (10), India (5)
Results: • Everyone generates sequence data • Have knowledge on origin of the material • All rely on sequencing; “very critical” for their work • NSD is submitted to INSDC before publication
Requirement Accession Number • Databases used: Genbank, ENA (INSDC), JGI, iBOL, TAIR, MtGEA • NSD shared with others • Common condition: co-authorship
![Page 37: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/37.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
There are 10-15 million total users of INSDC. They live in every country in the world.
Costs: $3-5 per user 50% of users live in countries that do not contribute to NSD infrastructure costs ~$25 Mil.
![Page 38: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/38.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
These countries use more DSI than they provide
![Page 39: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/39.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Strategy suggestion: Integrate DSI and its importance for
biodiversity into the post-2020 Framework
![Page 40: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/40.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Hot of the press: Post-2020 goals overlook genetic diversity
![Page 41: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/41.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Timeline
• Research (6 months) • Sept: Discuss ideas, assign sub-contracts • Nov: Integrate results • Feb: finalize scenarios
• Scientific community input (4 months) • Jan. 21-22: German scientific stakeholder workshop • March 10-11: EU scientific stakeholder workshop • April (TBD): follow-up stakeholder workshop
• Socialize ideas (6 months) • March: release project summary report • April: Science Policy Forum article submitted (for July) • May-July: SBI, OEWG3 Side events
![Page 42: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/42.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Identify regulations/ authorities
ABS clearing house
ABS case No
Yes
other permits
Research & Development
Yes No
Permits
Reporting
Project
Identify regulations/ authorities
PIC MAT
MTAs
Sampling
Procedure to comply with CBD and NP
Overmann and Scholz. Trends in Microbiology. Volume 25, ISSUE 2, 2017
![Page 43: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/43.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
DSI Scenarios we eliminated
![Page 44: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/44.jpg)
Leibniz Institute • DSMZ – German Collection of Microorganisms and Cell Cultures
Pop quiz: What does this mean? AACCGTCTACGGCCCGATCTCCCTGCACCCTGGCCCCACCCTTCCAAATGCGGCATATCCAGT
A separate database for CBD stuff? No! A complete dataset is needed to understand new biodiversity!
Sikorski, Overmann. BioSpektrum. July 2017.
Coverage
100
75
50
25
0
Prop
ortio
n of
unk
now
n or
hyp
othe
tical
gen
es (%
)
high
Median: 2527 Species/Phylum
low
Median: 12 Species/Phylum
none
4 Phyla (P, A, F, B)
29 Phyla (R) 85 Phyla
![Page 45: WiLDSI 3 open access DSI scenarios - dsmz.de...Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH 0. 20. 40. 60. 80. 100. 120. 140. Waiting list](https://reader033.vdocuments.mx/reader033/viewer/2022060907/60a1acd5d54f251c1a147ab2/html5/thumbnails/45.jpg)
Leibniz-Institut • DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
Blockchain or external tracing system? The existing data infrastucture could not be used
„A bitcoin outside of blockchain is worthless, a sequence outside of blockchain is still a sequence.“