what’s my name? · 2020. 8. 13. · atlantic medical imaging the region’s premier medical...
TRANSCRIPT
CHURCH OF ST. William the
Abbot Roman Catholic Church
2740 Lakewood Allenwood Road, Howell, NJ 07731
December 20, 2020
fourth Sunday of advent
Fr. Thomas Maher, Pastor Fr. James Redstone, Weekend Assistant
Deacon Michael Abatemarco
Deacon George A. Prevosti
Deacon Kevin Smith
MASS TIMES
DAILY Monday, Tuesday: 9AM
Wednesday: 9AM & 7PM
Thursday, Friday: 9AM
Saturday: 9AM CONFESSION AND RECONCILIATION Every Saturday after the 9:00AM Mass, 1/2 hour be-
fore each weekend Mass, Wednesday at 6:00PM
WEEKEND Saturday: 5:00PM
Sunday: 8:00AM,
10:15AM, & 11:45AM
HOLY DAYS: will be announced in the bulletin and on the website.
OUR PARISH MISSION STATEMENT
We, the parish family of St. William the Abbot, a welcoming Catholic community, led by the Holy Spirit, are called to proclaim, and to witness to, the Good News of Salvation, so that we may grow to-gether, among all generations, and advance the Kingdom of God, in our love and service of God and neighbor.
OFFICE HOURS:
Monday thru Friday:
9:30AM to 2:00PM
CONTACT US: Phone: 732-840-3535 Fax: 732-840-3663 Website: www.stwilliamtheabbot.com Email: [email protected]
STAFF
Clergy Rev. Thomas Maher, Pastor [email protected] Office Staff Maureen Cisek, Secretary [email protected] Elaine Ferraro, Accountant [email protected] Dawn Cappetto, Administrator School of Religion [email protected] Billy Lawlor, Director of Music
Anointing of the sick: To schedule an anointing call the parish office. Baptism: Baptisms may be arranged for most Sundays of the year at 1:00PM. Please call the parish office to schedule a baptism. Matrimony: Engaged couples should call the parish of-fice for an interview appointment one year before the wedding date. Obtain a Mass Card: During office hours we welcome those who would like to request that their special inten-tions or deceased loved ones be prayed for particularly at a weekday or weekend Mass. We ask a donation of $10 per Mass. Obtain a Certificate of Eligibility: Registered parishioners who have been asked to be a Godparent or Confirma-tion Sponsor, should call the parish office to request a certificate of eligibility. Eligible individuals (according to Canon Law) are at least 16 years old, fully initiated, married in the Catholic Church (if married) and partici-pating in the life of our faith regularly and are not the child’s parents. Register for the parish: We are so happy to welcome new members to our Parish Family! Please come and see us at the Parish Office, so that we can get your information and meet you.
Why is it so important to register with a parish? Registration is the official way we join a parish community. Some people think that because they attend a particular parish they automatically belong. Registering as parishioners requires signing up, formally enrolling yourself in a parish. Registration is a commitment to a community, a way to be included in the religious, social and ministerial activities of your parish. Registration shows you belong. It is also necessary for cer-tain benefits, like scheduling sacraments, obtain-ing a sponsor certificate, and getting donation statements for your taxes. Most importantly, it lets the parish count on you, to call on you to assist in its mission. Registering in your parish is a statement of faith and confidence in the life and work of your parish.
Rosary
Thank you to everyone who handed in their tally sheets for praying the ro-sary. So far we have prayed the ro-sary 2,234 times. Congratulations! Keep up the good work! Remember
to pray one decade for St. William the Abbot Parish. Thank you to everyone who is praying the rosary even more during the pandemic.
Here is the link to our Facebook page: https://m.facebook.com/Saint-William-the-Abbot-Catholic-Church-174135519840986/?tsid=0.37482415393666724&source=result
December 20, 2020 Fourth Sunday of Advent Page 1 #566
Weekly Collection for Dec. 13 $3,871.00 Flowers 210.00 Immaculate Conception 759.00 Capital Contribution 957.00 Total $5,797.00 Weekly Envelopes Thank you for your generosity! If you are inter-ested in our online giving program, please go to our website and click on the link for WeShare. We are now only $4,504 away from our goal for the Annual Catholic Appeal. Thank you to eve-ryone who contributed. If you still would like to contribute it is not too late. Send a check to us or go online to the Diocese.
Please bring health, healing and hope to those
in our community who are sick especially Ana
Guillermo, Jonathon Capriotti, Emily Capriotti,
Dakota Schick, Don Goletz, Judy O’Connor,
Anna O’Connor, Evelyn Zeliff, Mary Lally, Rob-
by Isabella, Liz Czar, Elizabeth Mangine,
Michele Barbito, Maribel Mejias, Tony Liott, we
also ask you Lord, to watch over all those with
incurable autoimmune diseases and for all
those who are afflicted with MS, CF, Lou Geh-
rig’s disease, for those who suffer from Alz-
heimer disease, dementia, addictions, and their
families.
God of all consolation, give life and health
to our sisters and brothers for whom we
pray in your Holy Name. Amen.
“It is a holy and wholesome thing to pray for the living and the dead.” II Mac. 12:46
Saturday, December 19 5:00 John & Anna Gryglak r/o Daughter & Family Sunday, December 20 8:00 Anthony Pasquariello r/o M/M Ron Neal 10:15 Nicholas Mariniello r/o M/M Rich Capitan 11:45 People of the parish Monday, December 21 9:00 Marguerite Scott r/o M/M Billy Lawlor Tuesday, December 22 9:00 Vivian Goff r/o Her daughter Wednesday, December 23 9:00 Special Intention for Bob & Mary Ellen Weinel r/o Diane Verdon 7:00 Robert Galloso r/o M/M Puglisi Thursday, December 24—Christmas Eve No morning Mass 2:00 People of the parish 4:00 The Haberjan, Gates & Aberer Families r/0 Liz Cerbie 6:00 John Duffy r/o M/M Kevin Moroney 8:00 Special Intention for Fr. Jim Redstone r/o St. William the Abbot Friday, December 25—Christmas Day 10:15 Robert Kalinofski r/o The Pangaro Family 11:45 Deceased members of the Bonner & Pangaro Family Saturday, December 26 9:00 Robert Dougherty r/o The Dougherty Family 5:00 People of the parish Sunday, December 27 8:00 John Duffy r/o Lenny Munyer 10:15 Special Intention for Hailey Raiser r/o Bill Raiser 11:45 Augustus Maggio r/o The Marks Family
December 20, 2020 Fourth Sunday of Advent Page 2 #566
Rest in peace Please pray for those who have recently died, may they rest in peace. Eternal rest grant unto them, O Lord, and let thy per-petual light shine upon them. And may the souls of all the faithful departed, through the mercy of God, rest in peace. Amen
The Sanctuary Lamp is lit this week in
memory of John & Anna Gryglak, re-
quested by their daughter and family.
Christmas Mass Times Thursday, December 24th, Christmas Eve:
2:00, 4:00, 6:00, and 8:00
Friday, December 25th, Christmas Day: 10:15 and 11:45
December 20, 2020 Fourth Sunday of Advent Page 3 #566
Christmas Flower Remembrance . . .Mauro DIOCESE OF TRENTON FAITH IN OUR FUTURE
St. Catherine of Siena www.sienachurch.org
St. Veronica
www.stveronica.com
St. William the Abbot www.stwilliamtheabbot.com
Catholic Charities pro-vides assistance with food, housing, drug ad-diction, domestic vio-lence and immigration services. If you know of a parishioner needing
help, please contact us at www.catholiccharitiestrenton.org or call 800-360-7711.
Since we are not able to give out the mis-sals for Mass, we are going to order the paperback The Word Among Us. They will be $5 each and you must take them
home with you and bring them back when you come to Mass. We can’t leave anything in the church. Stop by the office to get yours.
Christmas Flower Remembrance . . .Mauro Gadaleta, Rita Gadaleta, Emmanuel Puglisi, Titus & Mil-
dred Casazza, John & Stella Jankowski, Jas Jankowski, William Clark, Ann Sanguinetti, John Duffy, Alice &
Eugene Cisek, Norma Moore, Fr. Charles Moore, Patricia & Gene Kelly, Jill Galante, Keith Hagelgans, Thomas
Kearney, Mary Grob, Michael Hagelgans, Mary & William Hagelgans, P.J. McMahan, Anna Guillermo, Rosa
Sofia Guillermo, Jose Guillermo, Antonia Ramey, Ralph Pizzano, Anthong DelGuercio, Christine Pizzano, Ann
DelGuercio, M/M Joseph Smoyak, M/M Louis Angelucci, Jr., Josephine Rizzo, Ann Serra, Marie DeSantis, Mi-
na Beyer, Patsy & Marie Franzese, Catherine Acconzo, Janice Ciardielli, Vincent Ciardiello, Jennie Ciardiello,
Wallace Osborne, Artie & Birdie Fagen, Manzella Family – Ralph & Florence, Effertz Family – Maria, Mary &
Tony Grifa, Irene & Jim Miller, Ruth Miller, Russel Grifa, Robert Pignatore, Veronic Malecki, Edward Malecki,
John R. Ball, Jr., Harry A. Stafford, Sr., Sister Catherine Henrietta, John Cartiglia, Leo A. Kelty, Erica
Dahlkemper Baughman, John & Mildred Gilbert, Robert & Laura Camp, Jack Culbertson, Ann Nucciarone,
Philip Macrino, Sarah Gilbert, Michael Gilbert, James Dahlkemper, Haberjan & Passarella Families, Frank Au-
gustyniak, Ruth Augustyniak, Joseph Szynal, Eleanor Szynal, John Szynal, Alfred DeDominicis, Helen DeDomi-
nicis, Vincent Scalese, Sr., Lenardo Family, Martino Family, Bradfield Family, DeSousa-Tavolmina Families, M/
M Domenico Mircovich, Domenico Mircovich, Jr., Nicolina Morin, Alva Kelly, Beatrice Anderson, Joan Spence,
Rosie Woodside, Kay & Harry Redmond, Mary & Warren Dougherty, Richard Grasso, A.L. Grasso, Agnes &
Robert Guiff, Violet & Frank Ulon, Mary Krey, Barbara DeStefano, Eddie Ulon, Mildred Benson, Philip Krey,
Dorothea Gleason, Robert Gleason, Harriet Rodney, Our Parents, Violet & Joseph Modica, Louise Lore, Mary
Somma, Anthony Somma, M/M Kenneth Mayer, Mircovich & Seymour Families, Alma Bartkowski, Mary Ellen
Spall, Alma Foley, Alex & Mary Kubik, Albert & Jane Zisko, Robert Zisko, Thomas & Susan Christman, Ronald
& Ronnie Kubik, Gaul and Gray Families, Jones & Eckert Families.
December 20, 2020 Fourth Sunday of Advent Page 4 #566
An Ancient Prayer to Saint Joseph O St. Joseph, whose protection is so great, so strong, so prompt
before the throne of God, I place in thee all my interests and de-
sires. O St. Joseph, do assist me by thy powerful intercession and
obtain for me all spiritual blessings through thy foster Son, Jesus
Christ Our Lord, so that, having engaged here below thy heaven-
ly power, I may offer thee my thanksgiving and homage to the
most loving of fathers.
O St. Joseph, I never weary contemplating thou and Jesus asleep
in thine arms. I dare not approach while He reposes near thy
heart. Press Him in my name and kiss His fine Head for me,
and ask Him to return the kiss when I draw my dying breath.
St. Joseph, patron of departing souls, pray for me. Amen.
Let us sing
O Blessed Saint Joseph
The Patronage of St. Joseph
Father Faber
Melody from the Trier Gesangbuch (1872)
Moderato
O blessed Saint Joseph, how great was thy worth,
The one chosen shadow of God upon earth,
The father of Jesus, Ah then, wilt thou be,
Sweet spouse of our Lady! A father to me?
For thou to the pilgrim art father and guide,
And Jesus and Mary felt safe by thy side;
Ah, blessed Saint Joseph, how safe I should be,
Sweet spouse of our Lady! If thou wert with me!
When the treasures of God where unsheltered on earth,
Safe keeping was found them both in thy worth;
O father of Jesus, be father to me,
Sweet spouse of our Lady! And I will love thee. (from www.traditionalmusic.co.uk)
December 20, 2020 Fourth Sunday of Advent Page 5 #566
Celebrate Advent with Formed!
The Road to Bethlehem Week 3 Dr. Gray invites you to continue down the Road to Bethlehem during week 3 of Advent. In this video, he highlights all the great resources available as you continue your Advent journey. Forgiven: The Transforming Power of Confession This past Sunday, John the Baptist urged us to repent! This episode of Forgiven provides insights into all the details of Confession as we heed this call for repentance! The Search: Who is Jesus? Through Jesus’ humanity, we are invited to know God in a very per-sonal way. But how exactly did this lowly carpenter become the most pivotal figure of all time? Find out in this episode of The Search. Show your children “Jesus is Coming: The Blessings of Advent and Christmas” to prepare them for the coming of Christ. This special program will be accessible for free exclusively on Sundays of Advent.
Go to www.formed.org. Click on 'sign up', then click on 'belong to a parish or organization', enter St. William the Abbot, and choices will then pop up, pick our parish, then fill out the information asked, name and email. Then you are in!
Please DO NOT USE MICROSOFT EDGE OR INTERNET EXPLORER to access this link. These browsers do not allow the FORMED website to function properly.
Remember—FORMED is free!
566 St. William the Abbot, Howell, NJ (inside) Sh John Patrick Publishing Company (800) 333-3166 • www.jppc.net
Quail Creek Pharmacy2 Ramtown-Greenville Rd
Corner Newtons Corner Rd., Howell785-9711 • Fax 785-1543
Open EverydayMona Salama - PharmacistRaouf Salama - Pharmacist
Personalized Service • Gifts • Greeting Cards
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O
To all thosenforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keepingechnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati
echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community
What’s My Name?The #WHATSMYNAME
Movement asks everyone to simply ask drivers “What’s my name?” before entering their
vehicle to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
566 St. William the Abbot-Howell, NJ (BACK) Sh John Patrick Publishing Company (800) 333-3166 • www.jppc.net
Kevin C. O’Brien, Manager - NJ Lic. No. 4805Kevin C. O’Brien, Manager - NJ Lic. No. 4805www.obrienfuneralhome.comwww.obrienfuneralhome.com
505 Burnt Tavern Road • Brick, NJ 08724505 Burnt Tavern Road • Brick, NJ 08724732-899-8600732-899-8600
2028 Highway 35 • Wall Twp., NJ 077192028 Highway 35 • Wall Twp., NJ 07719732-449-6900732-449-6900
Family Owned-Family Owned-Family FirstFamily First-Family Operated-Family Operated
FUNERAL HOME
Residential & Commercial
751-1560~ Parishioner ~NJ State Lic. #10329
LANGAN’SLANGAN’S P
H LLC
EmergencyService
Fully Insured
Atlantic Medical ImagingThe region’s premier medical imaging experts
MRI • CT • Coronary CTA • UltrasoundNuclear Medicine • DexaMammography • PET/CT
Centers of Excellence:Wall, Brick, Toms River, Galloway, Mays Landing, Egg Harbor Township, Northfi eld, Somers Point, Cape May, Hammonton
(732) 223-XRAY (9729)
Mark A. Santomenna, D.D.S.
Experience Positive, Personalized CareRamtown Plaza • 137 Newton’s Corner RoadHowell, New Jersey 07731
Tel 732-206-0408Fax 732-206-9807 www.RamtownDental.com
BASEMENT WATERPROOFINGMOLD REMEDIATIONFOUNDATION REPAIR
732-308-9988www.RightwayWaterproofi ng.com
RIGHTWAY WATERPROOFING CO.
FREE INSPECTIONLicensed & Insured
Family Owned and Operated Since 1987
Church
Member
Discounts
Gerald “Jerry” DeToroSales AssociateSt. William the Abbot Parishionerand 30 Year Ramtown Resident
732-974-8700 732-908-9193
[email protected] Washington Blvd., Sea Girt, NJ 08750
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday Cards
Log onto Log onto www.jppc.netwww.jppc.net conveniently from yourconveniently from your
home or office.home or office.Online Catalog • Online OrderingOnline Catalog • Online Ordering
Online Proo ngOnline Proo ngAll Major Credit Cards AcceptedAll Major Credit Cards AcceptedFREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send
your email address by text message: Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you moneywith your monthly payments on your
commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos.
Can close in as little as 45 days! Four season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
Advertise Your Business Here800-333-3166
ext. 161or visit
www.jppc.net