welcome to the webinar - eurofins genomics€¦ · microsoft powerpoint - eurofins webinar 23042013...
TRANSCRIPT
![Page 1: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/1.jpg)
![Page 2: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/2.jpg)
Welcome to the webinar:
TINA - Twisted Intercalating Nucleic Acid
Improve the efficiency of your stressed PCR
![Page 3: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/3.jpg)
TINA - Twisted Intercalating Nucleic Acid
Improve the efficiency of your stressed PCR
Dr. Jutta HuberManaging Director
Eurofins MWG GmbH
![Page 4: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/4.jpg)
Introduction• Eurofins MWG Operon is serving a large global customer base as provider for
oligonucleotides which are used in
– Research and development
– Kit components
– Diagnostic assays
• As a member of the Eurofins Scientific group we have an intensive exchange on
performance criteria for
– PCR assays and assay developments
– GMO and food testing
– Forensic and regulatory requirements
![Page 5: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/5.jpg)
Our Focus in DNA Synthesis
• Bridging know-how in chemistry to applications.
• Adapting synthetic procedures to best performance results in specific applications –
“Optimised Application Oligos”.
• Finding new interesting molecules which can contribute to better results and efficiency in
a diversity of applications.
![Page 6: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/6.jpg)
Cooperation with QuantiBact Inc.
• QuantiBact is developing novel amplification and quantification procedures utilising
nucleic acid intercalators, such as TINA.
• Eurofins MWG Operon is happy to be the preferred supplier for TINA modified
oligonucleotides.
• We are pleased to work with QuantiBact and our customers to identify interesting
applications where TINA can make a difference.
![Page 7: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/7.jpg)
TINA - Twisted Intercalating Nucleic Acid
Improve the efficiency of your stressed PCR
Gorm Lisby, MD PhDSenior Vice President, Founder
QuantiBact, Inc.
![Page 8: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/8.jpg)
PCR
- frequent challenges….
![Page 9: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/9.jpg)
- primer-limiting situations
- complex sample material
- multiplexing
![Page 10: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/10.jpg)
PCR with TINA-modified Primers
![Page 11: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/11.jpg)
TINA primers
• 5´ modification• Re-design of primers not necessary• Works with end-point as well as Real-time PCR• Increases “on-time” in primer/template hybridization• Protects primers against exonucleases• Stability and storage as conventional DNA primers• Tested successfully with many different buffer/enzymes• Available from Eurofins MWG Operon
![Page 12: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/12.jpg)
Twisted Intercalating Nucleic AcidTINA
![Page 13: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/13.jpg)
TINA-PCRPCR components
TINA intercalator
5´ATAATCGACGTACGAGTC3´
3´CGCATTACGTGACTCATC 5´
3´………TATTAGCTGCATGCTCAG………………………………CGCATTACGTGACTCATC……………5´
5´………ATAATCGACGTACGAGTC………………………………GCGTAATGCACTGAGTAG……………3´Target
Forward primer
TINA intercalator
Reverse primerPlus:
PCR buffer
Nucleotides
DNA polymerase
z
z
![Page 14: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/14.jpg)
TINA-PCRPCR amplicons
TINA intercalator
ATAATCGACGTACGAGTC………………………………GCGTAATGCACTGAGTAGTATTAGCTGCATGCTCAG………………………………CGCATTACGTGACTCATC
PCR amplicon
TINA intercalator
zz
![Page 15: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/15.jpg)
TINA-modified Primers
Impact on Annealing TemperaturePrimer Concentration
![Page 16: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/16.jpg)
Effect of annealing temperature and different primer concentrations
![Page 17: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/17.jpg)
TINA-modified Primers
Impact on Design Flexibility
![Page 18: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/18.jpg)
• Preliminary singleplex PCR test of “xxx” primers• Annealing gradient from 55 to 70°C.• TINA primers increase annealing:
HPLC DNA primers HPLC TINA primers (2bp shorter)HPLC TINA primers
TINA PCR
![Page 19: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/19.jpg)
TINA-modified Primers
Impact on PCR Efficiency
![Page 20: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/20.jpg)
Streptomyces detectionComparison of amplification curves with TINA-modified primers (high fluorescence) and non-modified primers (low fluorescence), detection with SYBR Green - 500.000 to 50 target copies. All negative controls were negative (data not shown).
50 target copies, DNA primers Cq = 35
50 target copies, TINA primers Cq = 27
5 target copies, DNA primers
5 target copies, TINA primers
![Page 21: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/21.jpg)
TINA-modified Primers
Impact on Multiplex PCR
Complex sample material
![Page 22: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/22.jpg)
crud
e10 10
010
0010
000
NC
crud
e10 10
010
0010
000
NC
rrselt
estAhUnmodified
primers5’-TINA mo-
dified primers
500400
300
200
100
1000 bp
Octaplex end-point PCR by unmodified primers and 5’-TINA modified primers. The red box highlights the lack of amplicons for the estAh gene with unmodified primers. 10-fold target dilution series for an Escherichia coli strain entailing three of eight target genes. Assay with unmodified primers published by Brandal et al, J Microbiol Meth (2007) 68:331-341
TINA Multiplex PCR
![Page 23: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/23.jpg)
Multiplex PCRcomplex test material
• Soil• Feces
![Page 24: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/24.jpg)
TINA Multiplex PCRDegenerate Primers
TINA improves:multiplex PCR efficiency - from 82.6% to 95.6%multiplex PCR sensitivity - from Cq=27.0 to Cq=25.5 (103 copies)
TINA primersDNA primers 25.527.0
![Page 25: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/25.jpg)
Direct detection of DEC in feces with Multiplex TINA-PCR Assay
Laboratory workflow:Total turn-around time: 2.5 hrs
Standardsampling
Patient
Transport tolaboratory
Multiplex TINA-PCRwith MagPlex beads
Simple lysisat 95CTurn-around Time
Sample prep.
PCR prep.
PCR run
MagPix detc.
![Page 26: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/26.jpg)
Standard PCR
Cliffhanger
05
10152025
30
35
40
45
stx1eae
estAhestAp
rrs(internalcontrol)
ipaHelt
stx2
No. of p
atients
stx1 eae estAh estAp rrs(internal control) ipaH elt stx2
Standard PCR 1 12 1 1 44 1 1 0Cliffhanger 3 19 3 6 44 6 10 2
Cliffhanger vs. Current Gold Standard PCR
All ”Standard PCR” positive samples were also tested positive by Cliffhanger
![Page 27: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/27.jpg)
TINA PCR - ConclusionImproved PCR efficiency
• No need for special primer design, just add TINA to the 5´ terminal position of the priming sequence
• Works with end-point as well as Real-time PCR• Increases Ta and decreases C primer• Increased freedom of primer design• Improves PCR efficiency whenever primers are limiting• Improves sensitivity• Faster cycling parameters
Improved PCR robustness• Protects primers against exonuclease activity
Improved multiplexing• Improved efficiency and sensitivity of multiplex PCR
![Page 28: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/28.jpg)
When to use TINA-modified primers
When you need a more efficient PCR- the primers are limiting the reaction
- you need design freedom (e.g. shorter primer)
- you want to shorten the PCR cycle parameters
- you want to use more stringent buffers (low salt buffer)
When you are working with “complex” test material- you are testing impure sample material (you need robustness)
- you are designing degenerated primers
When you are designing multiplexed PCR assays- you are designing a multiplex real-time PCR
- you are designing a multiplex end-point PCR
![Page 29: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/29.jpg)
Thank you for your attention!
We are looking forward to your questions:
Dr. Jutta HuberManaging Director
Eurofins MWG GmbH
Gorm Lisby, MD PhDSenior Vice President, Founder
QuantiBact, Inc.
Ursula DoerProduct Manager
Eurofins MWG GmbH
![Page 30: Welcome to the webinar - Eurofins Genomics€¦ · Microsoft PowerPoint - Eurofins Webinar 23042013 v7 final.ppt [Kompatibilitätsmodus] Author: gcag Created Date: 5/7/2013 10:17:15](https://reader033.vdocuments.mx/reader033/viewer/2022050223/5f68cd142e04a56cd06b2d75/html5/thumbnails/30.jpg)