welcome to introduction to bioinformatics monday, 28 february 2005 introduction to research projects
TRANSCRIPT
![Page 1: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/1.jpg)
Welcome toIntroduction to Bioinformatics
Monday, 28 February 2005
Introduction to Research Projects
![Page 2: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/2.jpg)
Prochlorococcus MED4
Prochlorococcus SS120
CO2
Fixed C
N2
Fixed N
Trichodesmium erythraeum
Crocosphaera watsonii
Wolfgang Hess, U. Freiburg
Brian Palenik, Scripps
Eric Webb, Woods Hole
Rakefet Schwarz, Bar Ilan U Jon Zehr, UC Santa Cruz
Oceanic Cyanobacteria
![Page 3: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/3.jpg)
Differentiation by N2-Fixing Cyanobacteria
Peter Wolk, Michigan StJim Golden, Texas A&MTerry Thiel, U. Missouri-St.LouisMike Summers, Cal State-NorthridgeJack Meeks, U California-Davis
![Page 4: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/4.jpg)
Cyanobacterial Genomes
You Chen, Texas A&MJames Godde, MonmouthPeter Wolk, Michigan StJack Meeks, U California-Davis
AATAAAGCTTTACAAACCAAACTCTGGCTTCAATTGTGTAACCCAAGCTTTGATTCTTTCCTCTGTTAAATCGGATTGATTATCTTCATCAAGGGCAAGACCTACAAATTTACCATCACGAACAGCTTTAGACTCACTGAATTCATAACCTTCTGTAGGCCAATAGCCAACTGTTTCACCACCATTTTCTGAAATTTTTTCCTCTAGAATACCGCAACACTATCACCACCAAACTCCTTCTGAATTATTTCTGATTCAGTTTGGGTATTGCCTGTTTGAGTACCAAAAAATAAACCAATATTAGACAATAAAGCTTTACAAACCAAACTCTGGCTTCAATTGTGTAACCCAAGCTTTGATTCTTTCCTCTGTTAAATCGGATTGATTATCTTCATCAAGGGCAAGACCTACAAATTTACCATCACGAACAGCTTTAGACTCACTGAATTCATAACCTTCTGTAGGCCAATAGCCAACTGTTTCACCACCATTTTCTGAAATTTTTTCCTCTAGAATACCGCAACACTATCACCACCAAACTCCTTCTGAATTATTTCTGAT
![Page 5: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/5.jpg)
RNA-mediated Gene Regulation in Synechococcus PCC 7942
Circadian rhythmYou ChenTexas A&M
C
Crp
5’-GTGAGTTAGCTCACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CACTCAATCGAGTGNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN
lacZ
RNA Polymerase
![Page 6: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/6.jpg)
RNA-mediated Gene Regulation in Synechococcus PCC 7942
Circadian rhythmYou ChenTexas A&M
???
5’-GTGAGTTAGCTCACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CACTCAATCGAGTGNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN
photosynthesis
RNA Polymerase
![Page 7: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/7.jpg)
RNA-mediated Gene Regulation in Synechococcus PCC 7942
You ChenTexas A&M
???
5’-GTGAGTTAGCTCACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CACTCAATCGAGTGNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN
photosynthesis
RNA Polymerase
Genomic search for potential regulatory RNA molecules
![Page 8: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/8.jpg)
RNA-mediated Gene Regulation in Anabaena PCC 7120
Peter WolkMichigan State U Heterocyst differentiation
- N
![Page 9: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/9.jpg)
RNA-mediated Gene Regulation in Anabaena PCC 7120
Peter WolkMichigan State U
- N
Genomic search for potential regulatory RNA molecules
![Page 10: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/10.jpg)
Factors mediating patterned differentiation by Anabaena PCC 7120
Jim GoldenTexas A&M Heterocyst differentiation
![Page 11: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/11.jpg)
Motifs regulating akinete expression in Nostoc punctiforme
Mike SummersCal State-Northridge
Dark+
fructose
heterocyst akinetes
![Page 12: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/12.jpg)
Motifs regulating akinete expression in Nostoc punctiforme
Mike SummersCal State-Northridge
Dark+
fructose
Search for sequence patterns upstream from akinete-specific genes
![Page 13: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/13.jpg)
Generalized motif discovery in small marine cyanobacteria
Wolfgang HessU Freiburg
Dark+
fructose
![Page 14: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/14.jpg)
Generalized motif discovery in small marine cyanobacteria
Wolfgang HessU Freiburg
Prochlorococcus MED4Prochlorococcus SS120Prochlorococcus MIT9313Synechococcus WH8302
![Page 15: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/15.jpg)
Function prediction by conserved gene position in marine cyanobacteria
Jon ZehrU California-Santa Clara
Why not more?
CO2 N2
sugar
NH3
- Limitation by iron- Limitation by nitrogen
Fe-related??
![Page 16: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/16.jpg)
Motifs governing expression of iron-related genes in marine cyanobacteria
Eric WebbWoods Hole
Why not more?
CO2 N2
sugar
NH3
- Limitation by iron- Limitation by nitrogen
Fe-related
![Page 17: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/17.jpg)
Genome families of Nostoc punctiforme compared to smaller cyanobacteria
Jack MeeksU California-Davis
?heterocyst Symbiosis
with plants
9.1 Mb
Prochlorococcus
1.7 Mb
Why is the Nostoc genome so large?
![Page 18: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/18.jpg)
Characterization of nitrogenase complexes in Anabaena variabilis
Terry ThielU Missouri-St. Louis
heterocyst
N2
NH3nitrogenase
Molybdenum
Vanadium
![Page 19: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/19.jpg)
Characterization of nitrogenase complexes in Anabaena variabilis
Terry ThielU Missouri-St. Louis
Vanadium
What genes encode each machine?Where did they come from?
![Page 20: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/20.jpg)
Protein quorum sensing signals between marine cyanobacteria
Rakefet Schwarz Bar Ilan U
?
Vs
![Page 21: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/21.jpg)
Protein quorum sensing signals between marine cyanobacteria
Rakefet Schwarz Bar Ilan U
?
Vs
What proteins mediate communication between
cyanobacteria?
![Page 22: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/22.jpg)
Protein quorum sensing signals between marine cyanobacteria
Brian PalenikScripps Ocean. Inst.
What signals determine protein transport through
membranes?
![Page 23: Welcome to Introduction to Bioinformatics Monday, 28 February 2005 Introduction to Research Projects](https://reader036.vdocuments.mx/reader036/viewer/2022070410/56649ec95503460f94bd6230/html5/thumbnails/23.jpg)
Unusual repeated sequences in genomic DNA
James GoddeMonmouth College
• Tandem repeats
• Dispersed repeats• CRISPRs
What is the mechanism by which CRISPRs propagate?