downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · web viewfigure...
TRANSCRIPT
![Page 1: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/1.jpg)
SUPPLEMENTARY MATERIAL
![Page 2: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/2.jpg)
Figure S1. Electrostatic potential surface representations of AraC/XylS family members. The electrostatic potentials were calculated
with the software DelPhi version 4 release 1.1 and the surfaces and images were generated with PyMOL. A) View on the side of the
proteins facing DNA. B) View on the opposite side of the protein, by rotation of the proteins by 180 degrees. Blue color indicates a
positive potential, red color indicates a negative potential and white color indicates a neutral potential.
![Page 3: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/3.jpg)
Figure S2. Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription factors.
Distance (in base pairs) from the hypothetical binding site is provided for each gene. In blue are genes with
a function related with the proposed biological role of the AraC/XylS transcription factor. In black, genes
with unknown or not obviously related function. In the majority of the cases, the function of these genes
was obtained by sequence similarity to other genes or by the annotation of the InterPro database for their
families.
![Page 4: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/4.jpg)
Table S1. List of 62 well-characterized AraC/XylS-family transcriptional regulators with
known biological function
Proteina Organism Biol. proccessb Regulatory function Categoryc Ref.d
AarP (P43463)
Providencia stuartii
Antibiotic resistance
Regulates the transcription of 2'-N-acetyltransferase, which is capable of acetylating both peptidoglycan and certain aminoglycoside antibiotics.
S + V 7768849, 10390241
Ada (P06134)
Escherichia coli (strain K12)
DNA damage response
Repairs O6-methylguanine and O4-methylthymine and induces transcription of genes involved in the adaptive response to alkylation damage in DNA
S + V 3529081
Ada (P26189)
Salmonella typhimurium
DNA damage response
Repairs O6-methylguanine and O4-methylthymine and induces transcription of genes involved in the adaptive response to alkylation damage in DNA
S + V 1904855
AdaA (P19219)
Bacillus subtilis DNA damage response
Repairs O6-methylguanine and O4-methylthymine and induces transcription of genes involved in the adaptive response to alkylation damage in DNA
S + V 8376346, 2120677
AdiY (P33234)
Escherichia coli (strain K12)
Acid resistance Regulates arginine-dependent acid resistance, is involved in glutamate-dependent response to acid stress, and is associated with activation of virulent strains of E. coli in the stomage
S + V 8795195, 21034467
AggR (P43464)
Escherichia coli Cell adhesion Transcriptional activator of aggregative adherence fimbria I expression in enteroaggregative E. coli
V 7913930
AlkR (O31249)
Acinetobacter sp. (strain ADP1)
Alkane metabolism
Activates the expression the alkane 1-monooxygenase that permits the use of alkanes with at least twelve carbon atoms as the sole source of carbon and energy
M 9811637
AppY (P05052)
Escherichia coli (strain K12)
Phosphate starvation response
Induces the synthesis of acid phosphatase (AppA) and several other polypeptides (such as AppBC) during the deceleration phase of growth in response to phosphate starvation. Also involved in the stabilization of the sigma stress factor RpoS during stress conditions
S 18383615
AraC (P07642)
Erwinia chrysanthemi
Plant carbohydrates metabolism
Controls the expression of at least six genes that are involved in the transport and catabolism of L-arabinose an aldopentose sugar found in plant gums, pectins and bacterial cell wall polysaccharides
M 3902795
![Page 5: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/5.jpg)
Proteina Organism Biol. proccessb Regulatory function Categoryc Ref.d
AraC (P0A9E0)
Escherichia coli (strain K12)
Plant carbohydrates metabolism
Controls the expression of at least six genes that are involved in the transport and catabolism of L-arabinose an aldopentose sugar found in plant gums, pectins and bacterial cell wall polysaccharides
M 12596232
Caf1R (P26950)
Yersinia pestis Capsule formation
Regulates the caf1M1A1 operon. The caf operon products constitute a fimbrial chaperone-usher system that acts to assemble and export F1 capsule components
V 1633857, 19103769
CfaD (P25393)
Escherichia coli Cell adhesion Transcriptional activator of the CFA/I adhesin (cfAA) gene of enterotoxigenic E. coli
V 1971911
ChbR (P17410)
Escherichia coli (strain K12)
Carbohydrates metabolism
Regulates the expression of the chbBCARFG operon for the uptake and metabolism of chitobiose (the major breakdown product of chitin degradation)
M 15066032
CsvR (P43460)
Escherichia coli Cell adhesion Transcriptional activator of the fimbrial gene in enterotoxigenic E. coli
V 1685133
EnvY (P10805)
Escherichia coli (strain K12)
Temperature stress response
Regulates the temperature-dependent expression of several E. coli envelope proteins, most notably the porins ompF and ompC and the lambda receptor, lamB
S 2536924
EutR (P36547)
Escherichia coli (strain K12)
Amine metabolism
Activates the transcription of the eut operon, neccesary for uptake and metabolism of ethanolamine. It was suggested that the breakdown of ethanolamine contributes to disrupting gut functions, in particular innate immune functions
M + V 20234377
ExsA (P26993)
Pseudomonas aeruginosa
Type III secretion system
Promotes the expresion of type III secretion system in response of low levels of Ca2+
V 16714561, 9618447, 11119548
FapR (P23774)
Escherichia coli Cell adhesion Regulates the expression of the 987P operon for the fimbrial protein in enterotoxygenic E. coli
V 2077360
FeaR (Q47129)
Escherichia coli (strain K12)
Amine metabolism
Regulates tynA/maoA and feaB/padA genes necessary for 2-phenylethylamine catabolism
M 9043126
GadW (P63201)
Escherichia coli (strain K12)
Acid resistance GadW regulates the gadA and gadBC genes that regulate acid tolerance and virulence gene expression in response to environmental cues within the gastrointestinal tract
S + V 12730179
GadX (Q9EYV5)
Escherichia coli O127:H6
Cell adhesion, Type III secretion system, Acid resistance
GadX regulates perABC and gadA and gadB, that regulate acid tolerance and virulence gene expression in response to environmental cues within the gastrointestinal tract
S + V 17576759
HilD (P0CL08)
Salmonella typhimurium
Type III secretion system
Regulates the expression of the main transcriptional regulator of the Salmonella pathogenicity island 1 (SPI1) hilA
V 11442828
![Page 6: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/6.jpg)
Proteina Organism Biol. proccessb Regulatory function Categoryc Ref.d
HrpB (P31778)
Ralstonia solanacearum (Pseudomonas solanacearum)
Type III secretion system
Regulates the hrp operon. hrp genes encode a specialized type III secretion system
V 12374732
InvF (P69343)
Salmonella typhimurium
Type III secretion system
Regulates the expression of genes encoding the secreted effector molecules Sip/Ssp ABCD, SigD, SptP and SopE, necessary for type III secretion system
V 11296219
LacR (O33813)
Staphylococcus xylosus
Mammalian carbohydrates metabolism
Regulates the expression of lacPH (lactose permease and the beta-galactosidase) genes for lactose utilization
M 9573174
LumQ (Q51872)
Photobacterium leiognathi
Riboflavin synthesis and/or luminescence
Probably regulates the riboflavin synthesis and/or luminescence. Is encoded in the lux operon that is linked to the luminescence genes in some photobacterium species
M 17586644
MarA (P0ACH5)
Escherichia coli (strain K12)
Antibiotic resistance
Regulates the expression of the mar regulon that confers resistance to a variety of antibiotics
S + V 9333027, 11104814
MelR (P0ACH8)
Escherichia coli (strain K12)
Plant carbohydrates metabolism
Transcriptional activator for the expression of the melAB operon in response to the availability of melibiose
M 16621812
MmsR (P28809)
Pseudomonas aeruginosa
Amino acid metabolism
Regulates the expression of the mmsAB operon. The operon contains two structural genes involved in valine metabolism
M 1339433
MsmR (Q00753)
Streptococcus mutans
Plant carbohydrates metabolism
Regulates the expression of the msm operon responsible for the transport and metabolism of melibiose, raffinose, and isomaltosaccharides
M 1537846, 8432594
MxiE (P0A2S7)
Shigella flexneri Type III secretion system
Controls transcription of a set of genes encoding proteins that transit through the type III secretion system apparatus.
V 16428428
OruR (P72171)
Pseudomonas aeruginosa
Amino acid metabolism
Regulates the expression of genes involved in ornithine metabolism
M 9401045
PchR (P40883)
Pseudomonas aeruginosa
Iron stress Regulates the expression of pyoverdin and pyochelin siderophores (iron chelators) which contribute to virulence
S + V 10722571, 15375116
PerA (P43459)
Escherichia coli O127:H6
Cell adhesion Regulates the expression of the eaeA gene that is associated with attaching and effacing lesions and encodes intimin, a 94-kDa outer membrane protein
V 7729884
PocR (Q05587)
Salmonella typhimurium
Carbohydrates metabolism
Regulates the expression of pdu and cob operons that regulate the meabolism of the L-fucose subproduct anaerobic metabolite 1,2-propanediol
M 8071226
PqrA (Q52620)
Proteus vulgaris Antibiotic resistance, Oxidative stress response
Confers multidrug resistance in a way similar to that of the soxS and marA genes in E. coli
S + V 7726514
![Page 7: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/7.jpg)
Proteina Organism Biol. proccessb Regulatory function Categoryc Ref.d
RafR (P43465)
Pediococcus pentosaceus
Plant carbohydrates metabolism
Regulates the raffinose operon. Raffinose is a trisaccharide composed of galactose, fructose, and glucose found in many plants
M 2180920
RamA (P55922)
Enterobacter cloacae
Antibiotic resistance
Is Involved in resistance to multiple antibiotics through the expression regulation of the OmpF porin and the efflux pump AcrAB
S + V 21811569
RhaR (P09378)
Escherichia coli (strain K12)
Plant carbohydrates metabolism
Regulates the rhaBAD operon that encode enzymes for catabolism of rhamnose
M 8757746
RhaS (P09377)
Escherichia coli (strain K12)
Plant carbohydrates metabolism
Regulates the rhaBAD operon that encode enzymes for catabolism of rhamnose
M 8230210
RhrA (Q9Z3Q6)
Rhizobium meliloti (Ensifer meliloti)
Activation of siderophores, Iron stress
Regulates the transcription of the rhbABCDEF operon involved in biosynthesis of rhizobactin 1021, a siderophore produced under iron stress. Also regulates the rhtA gene which encodes an membrane receptor protein for rhizobactin 1021
BPI + S 11274118
RipA (Q8NRR3)
Corynebacterium glutamicum
Iron stress response
Under iron limitation, RipA acts as a repressor of several genes encoding prominent iron-containing proteins (e.g. aconitase and succinate dehydrogenase)
S 21217007, 16179344
Rns (P16114)
Escherichia coli Cell adhesion Regulates the expression of the CS1 and CS2 adhesins
V 2563591
Rob (P0ACI0)
Escherichia coli (strain K12)
Antibiotic resistance
Regulates the expression of genes that confer multiple antibiotic resistance. Overexpression causes antibiotic resistance, organic solvent tolerance and heavy metal resistance
S + V 7896685, 7793951
SirC (Q8Z4A6)
Salmonella typhi Type III secretion system
Regulates the expression of the invasion-associated type III secretion system encoded within the SPI-1 plasmid
V 10322010
SoxS (P0A9E2)
Escherichia coli (strain K12)
Oxidative stress response
Regulates the transcriptional activation of a complex oxidative stress regulon in response to superoxide-generating agents
S + V 1653416, 7726514
TcpN (P0C6D6)
Vibrio cholerae Pilus formation Regulates the tcp gene cluster, associated with the biosynthesis and assembly of the toxin-coregulated pilus
V 1352761
TetD (P28816)
Escherichia coli Antibiotic resistance
Regulates the transcripcion of the mar regulon that confers the multiple antibiotic resistance phenotype
S + V 6094472, 9333027
ThcR (P43462)
Rhodococcus erythropolis (Arthrobacter picolinophilus)
Organosulfur compound metabolism
Regulates the transcription of the thc operon for the degradation of the thiocarbamate herbicide EPTC
M 7836301
UreR (P32326)
Escherichia coli Urease activation
Regulates the expression of the urease operon, related with uropathogenic strains of E. coli and Proteus mirabilis
V 11724879, 11119505
![Page 8: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/8.jpg)
Proteina Organism Biol. proccessb Regulatory function Categoryc Ref.d
UreR (Q02458)
Proteus mirabilis (strain HI4320)
Urease activation
Regulates the expression of the urease operon, related with uropathogenic strains of E. coli and Proteus mirabilis
V 7678244, 18202436
VirF (P0A2T1)
Shigella flexneri Type III secretion system
Primary regulator of plasmid-encoded virulence genes. VirF activates the second essential virulence plasmid regulator VirB (type III secretion system) and the actin nucleator protein IcsA
V 18202440
VirF (P0C2V5)
Yersinia enterocolitica
Type III secretion system
Transcriptional activator of the Yersinia Yop virulence regulon that encodes 11 different secreted antihost proteins called Yops, as well as a type III secretion machinery that is required for their secretion
V 9841674, 9618447
VqsM (Q9I1P2)
Pseudomonas aeruginosa
Quorum sensing Regulates dozens of genes which are implicated in quorum sensing, virulence and multidrug resistance
V 16194239
XylR (P0ACI3)
Escherichia coli (strain K12)
Plant carbohydrates metabolism
Regulatory protein for the xylBAFGHR operon involved in the transport and metabolism of D-xylose
M 9371449
XylS (P07859)
Pseudomonas putida (Arthrobacter siderocapsulatus)
Benzene derivatives metabolism
Regulates the xylXYZLTEGFJQKIH operon of TOL plasmid, required for the degradation of toluene, m-xylene and p-xylene
M 18296514
XylS1 (Q04713)
Pseudomonas putida
Benzene derivatives metabolism
Regulates the xylXYZLTEGFJQKIH operon of TOL plasmid, required for the degradation of toluene, m-xylene and p-xylene
M 8473862
XylS2 (Q05092)
Pseudomonas putida
Benzene derivatives metabolism
Regulates the xylXYZLTEGFJQKIH operon of TOL plasmid, required for the degradation of toluene, m-xylene and p-xylene
M 1331988
XylS3 (Q05335)
Pseudomonas putida
Benzene derivatives metabolism
Regulates the xylXYZLTEGFJQKIH operon of TOL plasmid, required for the degradation of toluene, m-xylene and p-xylene
M 8473862
Y4fK (P55449)
Rhizobium sp. (strain NGR234)
Nodulation induction
Regulates the nod operon that controls nodulation factors that promote nitrogen fixation in symbiotic bacteria-plant interaction
BPI 9669339
YesN (O31517)
Bacillus subtilis Plant carbohydrates metabolism
Probably activates the expression of genes that regulate the metabolism of plant cell wall polysaccharides
M 17921311, 19651770
YesS (O31522)
Bacillus subtilis Plant carbohydrates metabolism
Probably regulates the pathway involve in rhamnogalacturonan (plant cell wall polysaccharides) depolymerization
M 17449691
a Protein name and UniProt accession number in parenthesis.
b General biological process. Multiple processes are separated by a comma.
![Page 9: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/9.jpg)
c Functional category: Bacteria-plant interaction (BPI), metabolism (M), stress response (S)
and virulence (V).
d PubMed ID of references describing the biological function.
![Page 10: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/10.jpg)
Table S2. Details of the analysis of the genetic context for predicted binding sites of the uncharacterized AraC/XlyS transcription factors.
PDB structure 3mn2 3oio 3lsg 3oou
Organism Rhodopseudomonas palustris TIE-1
Chromobacterium violaceum ATCC 12472
Chromobacterium violaceum ATCC 12472
Fusobacterium nucleatum subsp.
nucleatum ATCC 25586Listeria innocua Listeria innocua
Genome strand of Binding Site
- - - + - -
Binding Site start / end
1283534 / 1283555 3284826 / 3284847 2429687 / 2429708 1447985 / 1448006 2208002 / 2208023 2849441 / 2849462
Binding Site sequence
GATCTGCCCGAGGGCGCCACGC
AGGCGCACCAGCTCCTTGACGA
GATGACGCCGTTTTCCGCCTTC
TCTGGATTCATGATAGTTCAAT
TCAAATAAAGGATCCCCGAACT
AGACGAACAAATCGCCCAAGCA
Gene 1 Locus: Rpal_1214 / UniProtKB: B3QHJ6
Gene: ibeB / UniProtKB: Q7NVV0
Locus: CV_3010 / UniProtKB: Q7NTP4
Locus: FN0792 / Uniprot: Q8RFC1
Locus: lin2190 / Uniprot: Q929T4
Locus: 2833 / Uniprot: Q7ANT9
Genome start / end / strand
1285065 / 1285718 / + 2430434 / 2431813 / + 3286108 / 3286602 / - 1448403 / 1450424 / + 2207728 / 2208621 / - 2849334 / 2849636 / +
DescriptionDSBA oxidoreductase /
protein disulfide oxidoreductase activity
Lipoprotein / outer membrane drug efflux
lipoprotein
oxidation-reduction process / electron carrier
activityurocanate hydratase Aminoglycoside 3'-
phosphotransferaseIIA PTS Lactose / cellobiose
uptake / enzyme IIA
Distance from sequence
1510 726 1261 419 598 0
Gene 2 Locus: Rpal_1215 / UniProtKB: B3QHJ7
Locus: CV_2243 / UniProtKB: Q7NVU9
Gene: flaD / UniProtKB: Q7NTP3
Locus: FN0793 / Uniprot: Q8RFC0 tRNA Locus: lin2834 / Uniprot:
Lin2834 protein
Genome start / end / strand
1285927 / 1286238 / + 2431827 / 2432282 / - 3286802 / 3287920 / - 1450652 / 1451851 / + 2208754 / 2208837 / + 2850081 / 2851184 / -
Description hypothetical protein conserved hypothetical protein
ciliary or flagellar motility / structural molecule
activityL-glutamato Transporter tRNA Family FtsW_RodA_SpoVE
Implicated in Cell division
Distance from sequence
2372 2140 1955 2668 731 619
![Page 11: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/11.jpg)
PDB structure 3mn2 3oio 3lsg 3oou
Gene 3 Locus: Rpal_1216 / UniProtKB: B3QHJ8
Gene: nfnB / UniProtKB: Q7NVU8
Locus: CV_3012 / UniProtKB: Q7NTP2
Locus: FN0794 / Uniprot: Q8RFB9
Locus: lin2191 / Uniprot: Q929T3
Locus: lin2835 / Uniprot: Q927F4
Genome start / end / strand
1286243 / 1287505 / + 2432321 / 2432974 / - 3288132 / 3289388 / + 1451930 / 1452343 / - 2208964 / 2210244 / - 2851181 / 2852311 / -
Description
electron carrier activity / flavin adenine
dinucleotide binding / iron ion binding /
oxidoreductase activity
oxygen-insensitive NAD(P)H nitroreductase
/ 6,7-dihydropteridine reductase activity
proteolysis / serine-type carboxypeptidase
activityUnknown DNA binding protein (HTH
motif)Family FtsW_RodA_SpoVE Implicated in Cell division
Distance from sequence
2688 2613 3285 3964 941 1719
Gene 4 Locus: Rpal_1213 / UniProtKB: B3QHJ5
Gene: acrB / UniProtKB: Q7NVV1
Locus: CV_3009 / UniProtKB: Q7NTP5
Gene: hutH1 / Uniprot: Q8RFC2
Locus: lin2189 / Uniprot: Q929T5
Locus: lin2832 / Uniprot: Q927F7
Genome start / end / strand
1281779 / 1285003 / + 2427309 / 2430437 / + 3284381 / 3286096 / - 1446836 / 1448386 / + 2207105 / 2207731 / - 2847990 / 2849297 / +
Descriptiontransporter activity / acriflavin resistance
protein
transporter activity / acriflavin resistance
protein B
peptidyl-histidine phosphorylation /
regulation of transcription, DNA-dependent
Enzyme, catalyzes: L-histidine = urocanate +
NH3
Protein with structural similarity with: Regulation domain of Rob, multidrug
effect transporter regulator and heme
binding protein2
PTS, cellobiose uptake / enzyme IIC
Distance from sequence
0 0 0 0 293 166
Gene 5 Locus: Rpal_1212 / UniProtKB: B3QHJ4
Locus: CV_2240 / UniProtKB: Q7NVV2
Locus: CV_3008 / UniProtKB: Q7NTP6
Locus: FN0790 / Uniprot: Q8RFC3
Gene: crcB2 / Uniprot: Q929T6
Locus: lin2831 / Uniprot: Q927F8
Genome start / end / strand
1280787 / 1281782 / + 2426145 / 2427305 / + 3283449 / 3284312 / + 1445384 / 1446547 / - 2206609 / 2206998 / - 2847548 / 2847853 / +
Descriptionefflux transporter, RND family, MFP subunit /
transmembrane transport
transmembrane transport / probable
multidrug efflux protein
regulation of transcription, DNA-dependent / two-
component response regulator activity
Xylose repressor Protein CrcB homolog 2 PTS Lactose / cellobiose uptake / enzyme IIB
![Page 12: downloads.hindawi.comdownloads.hindawi.com/journals/bmri/2012/103132.f1.docx · Web viewFigure S2.Genetic context of predicted binding sites of the uncharacterized AraC/XlyS transcription](https://reader036.vdocuments.mx/reader036/viewer/2022070623/5e4e9ad7a34c370a257797c2/html5/thumbnails/12.jpg)
PDB structure 3mn2 3oio 3lsg 3oou
Distance from sequence
1774 2404 536 1438 1026 1610
Gene 6 Locus: Rpal_1211 / UniProtKB: B3QHJ3
Gene: fepB / UniProtKB: Q7NVV3
Gene: fhiA / UniProtKB: Q7NTP7
Locus: FN0789 / Uniprot: Q8RFC4
Gene: crcB1 / Uniprot: Q929T7
Gene: kdpA / Uniprot: Q927F9
Genome start / end / strand
1280444 / 1280785 / + 2424881 / 2425849 / - 3281425 / 3283137 / + 1444526 / 1445368 / - 2206263 / 2206619 / - 2845522 / 2847207 / -
Description
Transcriptional regulator, ArsR family / sequence-specific DNA
binding transcription factor activity / HTH
arsR-type DNA-binding domain
high-affinity iron ion transport /
ferrienterobactin-binding periplasmic protein
precursor
protein secretion Unknown Protein CrcB homolog 1 Potassium-transporting ATPase A chain,l
Distance from sequence
2771 3860 1708 2617 1404 2256