volume 16 - number 7 volume 1 - number 1 may - september
TRANSCRIPT
![Page 1: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/1.jpg)
Volume 1 - Number 1 May - September 1997
Volume 16 - Number 7 July 2012
![Page 2: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/2.jpg)
![Page 3: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/3.jpg)
The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with
the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific
Research (CNRS) on its electronic publishing platform I-Revues.
Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
Scope
The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in
open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases.
It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more
traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology,
and educational items in the various related topics for students in Medicine and in Sciences.
Editorial correspondance
Jean-Loup Huret Genetics, Department of Medical Information,
University Hospital
F-86021 Poitiers, France
tel +33 5 49 44 45 46 or +33 5 49 45 47 67
[email protected] or [email protected]
Staff Mohammad Ahmad, Mélanie Arsaban, Jérémy Cigna, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre,
Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski.
Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave
Roussy Institute – Villejuif – France).
The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times
a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of
the French National Center for Scientific Research (INIST-CNRS) since 2008.
The Atlas is hosted by INIST-CNRS (http://www.inist.fr)
http://AtlasGeneticsOncology.org
© ATLAS - ISSN 1768-3262
![Page 4: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/4.jpg)
![Page 5: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/5.jpg)
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7)
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
Editor
Jean-Loup Huret
(Poitiers, France)
Editorial Board
Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section
Alessandro Beghini (Milan, Italy) Genes Section
Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections
Judith Bovée (Leiden, The Netherlands) Solid Tumours Section
Vasantha Brito-Babapulle (London, UK) Leukaemia Section
Charles Buys (Groningen, The Netherlands) Deep Insights Section
Anne Marie Capodano (Marseille, France) Solid Tumours Section
Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections
Antonio Cuneo (Ferrara, Italy) Leukaemia Section
Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section
Louis Dallaire (Montreal, Canada) Education Section
Brigitte Debuire (Villejuif, France) Deep Insights Section
François Desangles (Paris, France) Leukaemia / Solid Tumours Sections
Enric Domingo-Villanueva (London, UK) Solid Tumours Section
Ayse Erson (Ankara, Turkey) Solid Tumours Section
Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections
Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section
Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections
Anne Hagemeijer (Leuven, Belgium) Deep Insights Section
Nyla Heerema (Colombus, Ohio) Leukaemia Section
Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections
Sakari Knuutila (Helsinki, Finland) Deep Insights Section
Lidia Larizza (Milano, Italy) Solid Tumours Section
Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section
Edmond Ma (Hong Kong, China) Leukaemia Section
Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections
Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections
Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section
Fredrik Mertens (Lund, Sweden) Solid Tumours Section
Konstantin Miller (Hannover, Germany) Education Section
Felix Mitelman (Lund, Sweden) Deep Insights Section
Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section
Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections
Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections
Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section
Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section
Mariano Rocchi (Bari, Italy) Genes Section
Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section
Albert Schinzel (Schwerzenbach, Switzerland) Education Section
Clelia Storlazzi (Bari, Italy) Genes Section
Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections
Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections
Dan Van Dyke (Rochester, Minnesota) Education Section
Roberta Vanni (Montserrato, Italy) Solid Tumours Section
Franck Viguié (Paris, France) Leukaemia Section
José Luis Vizmanos (Pamplona, Spain) Leukaemia Section
Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections
![Page 6: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/6.jpg)
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
Volume 16, Number 7, July 2012
Table of contents
Gene Section
ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1) 442 Hisataka Sabe, Yasuhito Onodera, Ari Hashimoto, Shigeru Hashimoto
CD38 (CD38 molecule) 445 Silvia Deaglio, Tiziana Vaisitti
CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1) 452 Edward J Kelly, Vladimir Yarov-Yarovoy, Allan E Rettie
DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) 458 Chon-Hwa Tsai-Morris, Maria L Dufau
EPHB6 (EPH receptor B6) 462 Lokesh Bhushan, Raj P Kandpal
FOXF1 (forkhead box F1) 466 Pang-Kuo Lo
FXYD3 (FXYD domain containing ion transport regulator 3) 470 Hiroto Yamamoto, Shinji Asano
MCAM (melanoma cell adhesion molecule) 475 Guang-Jer Wu
MIR100 (microRNA 100) 479 Katia Ramos Moreira Leite
MIR145 (microRNA 145) 484 Mohit Sachdeva, Yin Yuan Mo
MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)) 487 Tiangang Zhuang, Mayumi Higashi, Venkatadri Kolla, Garrett M Brodeur
PTBP1 (polypyrimidine tract binding protein 1) 491 Laura Fontana
SOCS3 (suppressor of cytokine signaling 3) 495 Zoran Culig
Leukaemia Section
i(17q) solely in myeloid malignancies 497 Vladimir Lj Lazarevic
inv(11)(q13q23) 501 Adrian Mansini, Claus Meyer, Marta Susana Gallego, Jorge Rossi, Patricia Rubio, Adriana Medina, Rolf
Marschalek, Maria Felice, Cristina Alonso
t(2;9)(q37;q34) 505 Purvi M Kakadia, Stefan K Bohlander
![Page 7: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/7.jpg)
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7)
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
Solid Tumour Section
Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24) 508 Karolin H Nord
Case Report Section
t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia 513 Helena Podgornik, Peter Cernelc
![Page 8: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/8.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 442
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1) Hisataka Sabe, Yasuhito Onodera, Ari Hashimoto, Shigeru Hashimoto
Hokkaido University Graduate School of Medicine, Department of Molecular Biology, Sapporo,
Japan (HS, YO, AH, SH)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/ASAP1ID44351ch8q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI ASAP1ID44351ch8q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity Other names: AMAP1, CENTB4, DDEF1,
KIAA1249, PAG2, PAP, ZG14P
HGNC (Hugo): ASAP1
Location: 8q24.21
DNA/RNA
Description
The ASAP1 locus spans 391,75 kb, on the minus
strand of chromosome 8 from 131456099 to
131064346.
Transcription
Transcription produces 16 different mRNAs, 12
alternatively spliced variants and 4 unspliced forms.
There are 9 probable alternative promotors, 6 non
overlapping alternative last exons and 5 validated
alternative polyadenylation sites.
The mRNAs appear to differ by truncation of the 5'
end, truncation of the 3' end, presence or absence of
15 cassette exons, overlapping exons with different
boundaries (NCBI).
The ASAP1 gene maps on chromosome 8, at 8q24.1-q24.2 according to Entrez Gene (adapted from GeneCards).
![Page 9: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/9.jpg)
ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1)
Sabe H, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 443
Protein
Description
P. Randazzo's group was the first to identify two
variants of a 130-kDa phosphatidylinositol 4,5-
bisphosphate (PIP2)-dependent Arf1 GTPase-
activating protein (GAP), and named them ASAP1a
and ASAP1b (ArfGAP, SH3, ankyrin repeat, PH
protein) (Brown et al., 1998).
At almost the same time, T. Roberts' group isolated
a homologue of ASAP1 from bovine brain as a Src
SH3 domain-binding protein, and named it DEF-1
(differentiation-enhancing factor-1) because its
ectopic expression in fibroblasts resulted in their
differentiation into adipocytes (King et al., 1999).
J. Schlessinger's group also identified a similar
protein as a Pyk2 binding protein, and named it Pap
(Andreev et al., 1999). Later on, we also isolated
several ArfGAPs as paxillin-binding proteins, and
tentatively called them paxillin-associated ArfGAPs
(PAG1, PAG2 and PAG3) (Kondo et al., 2000;
Mazaki et al., 2001; Sabe et al., 2006). ASAPs were
moreover identified as centaurin β3 and β4.
To avoid this confusion of naming, it was proposed
internationally to unify the names according to
functional domains that these proteins bear:
ASAP1, DEF1, PAG2, centaurin β4 were hence
proposed to be called AMAP1 (a multiple-domain
ArfGAP protein 1); and Pap, DDEF2, PAG3,
centaurin β3 to be called AMAP2 (a multiple-
domain ArfGAP protein 2) (Kahn, 2004). Since
then, we have stopped calling these proteins PAG2
and PAG3, and instead now call them AMAP1 and
AMAP2.
Then after, the HUGO Gene Nomenclature
Committee has nevertheless decided to call
AMAP1 as ASAP1, and AMAP2 as ASAP2. We
hereby call these proteins and genes according to
names used in the original reports.
Expression
Epithelial cells, fibroblasts, macrophages, brain (for
references see above), and endothelial cells
(Hashimoto et al., 2011). Not determined with the
other types of cells.
Localisation
Intracellular tubulovesicular structures and vesicles,
plasma membrane protrusions and leading edges,
and invadopodia/podosome structures (Hashimoto
et al., 2004; Hashimoto et al., 2005; Onodera et al.,
2005).
Function
ASAP1 has an ArfGAP zinc-finger domain and
exhibits phosphatidylinositol 4,5-bisphosphate-
dependent GAP activities for Arf1 and Arf5 but
102- to 10
3-fold less activity for Arf6 (Brown et al.,
1998; Andreev et al., 1999). ASAP1 was shown to
enhance cell motility, and this activity was
proposed to be mediated by its GAP activity
towards Arf1 (Furman et al., 2002). ASAP1 was
also shown to associate with focal adhesion kinase
(FAK) and contribute to focal adhesion assembly
(Liu et al., 2002). Hashimoto et al. (2004 and 2005)
have shown that AMAP1 and AMAP2 have the
ability to bind stably with GTP-Arf6, but not GDP-
Arf6 or other GTP-/GDP-Arf isoforms, in vitro and
in vivo. Through this binding, AMAP1 and
AMAP2 appear to function as downstream effectors
for GTP-Arf6 (Hashimoto et al., 2004; Hashimoto
et al., 2005; Onodera et al., 2005). AMAP1 binds to
paxillin and cortactin, which are essential
components of the invadopodia of MDA-MB-231
breast cancer cells, and acts to recruit these proteins
to the sites of Arf6 activation to form invadopodia
(Onodera et al., 2005). AMAP1 is hence essential
for invasion and metastasis of some breast cancer
cells, while AMAP2 is not a component of
invadopodia (Onodera et al., 2005; Hashimoto et
al., 2006; Nam et al., 2007; Morishige et al., 2008;
Sabe et al., 2009). AMAP1 appears to be a useful
diagnostic marker as well as therapeutic target of
different types of human cancers (see below).
Implicated in
Breast cancer
Note
In primary breast cancers, AMAP1 protein, but not
AMAP2 protein, is abnormally overexpressed in
their significant population in a manner
independent of the transcriptional upregulation of
the AMAP1 gene, and levels of AMAP1 protein
expression correlates well with the malignant
phenotypes (Onodera et al., 2005).
Melanoma
Note
With the name DDEF1, this gene was identified to
be located in an amplified region of chromosome
8q24.12, and the amplification of chromosome 8q
in uveal melanomas was found to correlate most
strongly with the expression of this gene in
melanomas (Ehlers et al., 2005).
Colorectal cancer
Note
Protein expression of ASAP1 is upregulated in
colorectal cancer cells, and this expression
correlates with poor metastasis-free survival and
prognosis in colorectal cancer patients (Müller et
al., 2010).
It is worth noting, on the other hand, that a previous
study on the copy number changes at 8q11-24 in
colorectal carcinomas showed that although the
MYC gene, located at 8q24.12-q24.13, is indeed
amplified and correlates with the advanced stages
of colorectal carcinoma, the DDEF1 gene was not
amplified (Buffart et al., 2005).
![Page 10: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/10.jpg)
ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1)
Sabe H, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 444
Prostate cancer
Note
Additional gene copies of ASAP1 were also
detected in a large population of primary prostate
cancers, and ASAP1 protein staining was found to
be elevated in 80% of primary prostate cancers with
substantially higher amounts observed in metastatic
lesions compared with benign prostate tissue (Lin et
al., 2008).
Pancreatic ductal adenocarcinoma
Note
DDEF1 gene was found to be frequently amplified,
most likely to be oncogenic, in pancreatic ductal
adenocarcinomas, accompanied by enhanced
expression of this gene (Harada et al., 2009).
VEGF- and tumor-induced angiogenesis
Note
AMAP1 protein is highly expressed in endothelial
cells upon their treatment with vascular endothelial
growth factor (VEGF), and an essential component
of VEGF- and tumor-induced angiogenesis, and
also choroidal neovascularization (Hashimoto et al.,
2011).
References Brown MT, Andrade J, Radhakrishna H, Donaldson JG, Cooper JA, Randazzo PA. ASAP1, a phospholipid-dependent arf GTPase-activating protein that associates with and is phosphorylated by Src. Mol Cell Biol. 1998 Dec;18(12):7038-51
Andreev J, Simon JP, Sabatini DD, Kam J, Plowman G, Randazzo PA, Schlessinger J. Identification of a new Pyk2 target protein with Arf-GAP activity. Mol Cell Biol. 1999 Mar;19(3):2338-50
King FJ, Hu E, Harris DF, Sarraf P, Spiegelman BM, Roberts TM. DEF-1, a novel Src SH3 binding protein that promotes adipogenesis in fibroblastic cell lines. Mol Cell Biol. 1999 Mar;19(3):2330-7
Kondo A, Hashimoto S, Yano H, Nagayama K, Mazaki Y, Sabe H. A new paxillin-binding protein, PAG3/Papalpha/KIAA0400, bearing an ADP-ribosylation factor GTPase-activating protein activity, is involved in paxillin recruitment to focal adhesions and cell migration. Mol Biol Cell. 2000 Apr;11(4):1315-27
Mazaki Y, Hashimoto S, Okawa K, Tsubouchi A, Nakamura K, Yagi R, Yano H, Kondo A, Iwamatsu A, Mizoguchi A, Sabe H. An ADP-ribosylation factor GTPase-activating protein Git2-short/KIAA0148 is involved in subcellular localization of paxillin and actin cytoskeletal organization. Mol Biol Cell. 2001 Mar;12(3):645-62
Furman C, Short SM, Subramanian RR, Zetter BR, Roberts TM. DEF-1/ASAP1 is a GTPase-activating protein (GAP) for ARF1 that enhances cell motility through a GAP-dependent mechanism. J Biol Chem. 2002 Mar 8;277(10):7962-9
Liu Y, Loijens JC, Martin KH, Karginov AV, Parsons JT. The association of ASAP1, an ADP ribosylation factor-GTPase activating protein, with focal adhesion kinase contributes to the process of focal adhesion assembly. Mol Biol Cell. 2002 Jun;13(6):2147-56
Hashimoto S, Hashimoto A, Yamada A, Kojima C, Yamamoto H, Tsutsumi T, Higashi M, Mizoguchi A, Yagi R, Sabe H. A novel mode of action of an ArfGAP, AMAP2/PAG3/Papa lpha, in Arf6 function. J Biol Chem. 2004 Sep 3;279(36):37677-84
Kahn RA.. The ARF Family. ARF Family GTPases, R.A. Kahn ed., Kluwer Acadmic Publishers, 2004.
Buffart TE, Coffa J, Hermsen MA, Carvalho B, van der Sijp JR, Ylstra B, Pals G, Schouten JP, Meijer GA.. DNA copy number changes at 8q11-24 in metastasized colorectal cancer. Cell Oncol. 2005;27(1):57-65.
Ehlers JP, Worley L, Onken MD, Harbour JW.. DDEF1 is located in an amplified region of chromosome 8q and is overexpressed in uveal melanoma. Clin Cancer Res. 2005 May 15;11(10):3609-13.
Hashimoto S, Hashimoto A, Yamada A, Onodera Y, Sabe H.. Assays and properties of the ArfGAPs, AMAP1 and AMAP2, in Arf6 function. Methods Enzymol. 2005;404:216-31.
Onodera Y, Hashimoto S, Hashimoto A, et al... Expression of AMAP1, an ArfGAP, provides novel targets to inhibit breast cancer invasive activities. EMBO J. 2005 Mar 9;24(5):963-73. Epub 2005 Feb 17.
Sabe H, Onodera Y, Mazaki Y, Hashimoto S.. ArfGAP family proteins in cell adhesion, migration and tumor invasion. Curr Opin Cell Biol. 2006 Oct;18(5):558-64. Epub 2006 Aug 9. (REVIEW)
Nam JM, Onodera Y, Mazaki Y, Miyoshi H, Hashimoto S, Sabe H.. CIN85, a Cbl-interacting protein, is a component of AMAP1-mediated breast cancer invasion machinery. EMBO J. 2007 Feb 7;26(3):647-56. Epub 2007 Jan 25.
Lin D, Watahiki A, Bayani J, Zhang F, Liu L, et al.. ASAP1, a gene at 8q24, is associated with prostate cancer metastasis. Cancer Res. 2008 Jun 1;68(11):4352-9.
Morishige M, Hashimoto S, Ogawa E, Toda Y, et al.. GEP100 links epidermal growth factor receptor signalling to Arf6 activation to induce breast cancer invasion. Nat Cell Biol. 2008 Jan;10(1):85-92. Epub 2007 Dec 16.
Harada T, Chelala C, Crnogorac-Jurcevic T, Lemoine NR.. Genome-wide analysis of pancreatic cancer using microarray-based techniques. Pancreatology. 2009;9(1-2):13-24. Epub 2008 Dec 12. (REVIEW)
Sabe H, Hashimoto S, Morishige M, Ogawa E, Hashimoto A, Nam JM, Miura K, Yano H, Onodera Y.. The EGFR-GEP100-Arf6-AMAP1 signaling pathway specific to breast cancer invasion and metastasis. Traffic. 2009 Aug;10(8):982-93. Epub 2009 Apr 21. (REVIEW)
Muller T, Stein U, Poletti A, Garzia L, Rothley M, Plaumann D, Thiele W, Bauer M, Galasso A, Schlag P, Pankratz M, Zollo M, Sleeman JP.. ASAP1 promotes tumor cell motility and invasiveness, stimulates metastasis formation in vivo, and correlates with poor survival in colorectal cancer patients. Oncogene. 2010 Apr 22;29(16):2393-403. Epub 2010 Feb 15.
Hashimoto A, Hashimoto S, Ando R, Noda K, Ogawa E, Kotani H, Hirose M, Menju T, Morishige M, Manabe T, Toda Y, Ishida S, Sabe H.. GEP100-Arf6-AMAP1-cortactin pathway frequently used in cancer invasion is activated by VEGFR2 to promote angiogenesis. PLoS One. 2011;6(8):e23359. Epub 2011 Aug 15.
This article should be referenced as such:
Sabe H, Onodera Y, Hashimoto A, Hashimoto S. ASAP1 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):442-444.
![Page 11: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/11.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 445
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
CD38 (CD38 molecule) Silvia Deaglio, Tiziana Vaisitti
Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy (SD, TV)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/CD38ID978ch4p15.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CD38ID978ch4p15.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: T10
HGNC (Hugo): CD38
Location: 4p15.32
DNA/RNA
Description
The genomic DNA of CD38 extends for 71172 base
pairs with 8 exons, starting at 15779898 bp and
ending at 15851069 bp. The CD38 gene is located
at 4p15.32. The 5'-flanking promoter region of the
gene contains a CpG island that is ~900 bp long and
includes exon 1 and the 5'-end of the intron 1. This
region contains a binding site for the transcription
factor Sp1 and several potential binding for other
factors such as interleukins, interferon and
hormones. A critical region in the CD38 gene is the
retinoic acid responsive element (RARE)
responsible for the upregulation of CD38
expression induced by all-trans retinoic acid (Nata
et al., 1997; Ferrero and Malavasi, 1999). The 5'-
end of the intron 1 contains also a C→ G single
nucleotide polymorphism (SNP), rs6449182, that
leads to the presence or absence of a PvuII
restriction site (see below). The SNP is located
within a putative E-box, a region of binding of the
E proteins with a consequent regulation of gene
transcription. In the B cell compartment a relevant
role is played by E2A, that controls the expression
of several B lineage genes. E2A was demonstrated
to bind to the E-box of the CD38 gene, regulating
its expression, and the binding of the protein is
influenced by the CD38 genotype, with the G allele
resulting in a stronger binding of E2A (Saborit-
Villarroya et al., 2011).
Transcription
The mRNA of CD38 (NM_001775.2) contains
1494 bp.
Gene structure of CD38. Colored boxes represent the 8 exons; the total length, the starting and ending base pair of the gene are indicated.
![Page 12: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/12.jpg)
CD38 (CD38 molecule) Deaglio S, Vaisitti T
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 446
CD38 protein structure. CD38 is a transmembrane molecule of 300 aa. The intracellular (IC), the transmembrane (TM) and the extracellular domains are indicated in the diagram. The different portions of the aminoacidic chain are shown as coded by the
different exons.
Protein
Description
Human CD38 is made up of a single chain of 300
aa with a corresponding molecular weight of
approximately 45 kDa. It is characterized by a short
cytoplasmic tail (21 aa), a small transmembrane
domain (23 aa) and a large extracellular domain
(256 aa). CD38 is a glycoprotein comprising 2 to 4
N-linked oligosaccharide chains containing sialic
acid residues. The overall structure of the CD38
molecule is stabilized by six pairs of disulphide
bonds.
Besides the monomeric membrane-bound form of
CD38, a soluble form of CD38 of approximately 78
kDa (p78) (Mallone et al., 1998) and a high-
molecular weight form of 190 kDa (p190) (Umar et
al., 1996), have been described. The latter fits with
a tetrameric conformation of the molecule, both
displaying enzymatic activities.
The carboxyl-terminal of the molecule harbors the
catalytic site (CD38 is defined as an ecto-enzyme)
and the binding site for CD31, the non-substrate
CD38 ligand (Deaglio et al., 1998).
The overall structure of the CD38 molecule,
obtained by crystallographic analyses, is "L"-
shaped and can be divided into two separate
domains. The N-terminal domain, formed by a
bundle of α helices (α1, α2, α3, α5, α6) and two
short β strands (β1, β3), and the C-terminal domain,
formed by four-stranded parallel β sheet (β2, β4,
β5, and β6) surrounded by two long (α8 and α9)
and two short α helices (α4 and α7). These two
distinct domains are connected by a hinge region
composed of three peptide chains. The enzyme's
overall topology is similar to the related proteins
CD157 and the Aplysia ADP-ribosyl cyclase, with
the exception of important structural changes at the
two termini. The extended positively charged N
terminus has lateral associations with the other
CD38 molecule in the crystallographic asymmetric
unit. The analysis of the CD38 substrate binding
models revealed three key residues that may be
critical in controlling CD38 enzimatic functions.
Indeed, the positions of residues Glu226, Trp125,
and Trp189, which are essential for the enzyme's
catalytic activity are highly conserved; Trp125 and
Trp189 are suggested as the residues for
recognizing and positioning the substrate by
hydrophobic interactions, while Glu226 is the
catalytic residue that takes part in the formation of
the catalytic intermediate) (Munshi et al., 2000; Liu
et al., 2005).
Expression
Human CD38 is surface expressed by various cells
of both hematopoietic and non-hematopoietic
lineages. In the T cell compartment, CD38 is
expressed by a significant fraction of human
thymocytes, mainly at the double-positive stage. In
B cells, the expression is tightly regulated during
cell ontogenesis, being present at high levels in
bone marrow precursors and in terminally
differentiated plasma cells. CD38 is expressed also
in circulating monocytes, but not in resident
macrophages, and in circulating and residential NK
cells and granulocytes.
CD38 is also present in many tissues other than
haematopoietic cells, including normal prostatic
epithelial cells, pancreatic islet cells and the brain,
where it is detected in perikarya and dendrites of
many neurons, such as the cerebellar Purkinje cells,
in rat astrocytes and in perivascular autonomic
nerve terminals. Other CD38+ cells include smooth
and striated muscle cells, renal tubules, retinal
gangliar cells and cornea (Malavasi et al., 2008).
Localisation
CD38 is a type II transmembrane protein expressed
on plasma and nuclear membranes.
Function
CD38 is a multifunctional ecto-enzyme involved in
signal transduction, cell adhesion and calcium
signaling. The binding to the ligand CD31, initiates
a signaling cascade that includes phosphorylation of
sequential intracellular targets and increases
cytoplasmic Ca2+
levels, mediating different
biological events depending on the cells type (e.g.,
activation, proliferation, apoptosis, cytokines
![Page 13: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/13.jpg)
CD38 (CD38 molecule) Deaglio S, Vaisitti T
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 447
secretion and homing). As an enzyme, CD38
metabolizes NAD+/NADP
+, generating cADPR,
ADP-ribose and NAADP (Lee, 2006). These
products bind different receptors and channels (IP3
receptors IP3R, Ryanodine receptor RyR and
Transient receptor potential cation channel
subfamily M member 2 TRPM2) and are involved
in the regulation of intracellular Ca2+
and activation
of critical signaling pathways connected to the
control of cell metabolism, genomic stability,
apoptosis, cell signaling, inflammatory response
and stress tolerance (Guse, 2005).
Homology
The CD38 gene is conserved in human,
chimpanzee, dog, mouse, rat and chicken. Human
CD38 shares a 25-30% homology in amino acid
sequence to the Aplysia ADP ribosyl cyclase and it
is highly homologous to CD157 (BST-1),
originated by gene duplication (Ferrero and
Malavasi, 1997; Ferrero and Malavasi, 1999).
Mutations
Germinal
Not yet reported.
Implicated in
Chronic lymphocytic leukemia (CLL)
Disease
CLL is the most common adult leukemia in the
United States and Europe that results from the
accumulation of small B lymphocytes expressing
CD19/CD5/CD23 in blood, bone marrow, lymph
nodes and other lymphoid tissues (Chiorazzi and
Ferrarini, 2003). The latter districts represent
permissive niches where lymphocytes can
proliferate in response to microenvironmental
signals (Malavasi et al., 2011). The incidence rates
in men are nearly twice as high as women and it is
less common among people of African or Asian
origin. Advanced age and a family history of
leukemia and lymphoma are additional risk factors
(Dores, 2007).
Prognosis
CLL is currently categorized into prognostic groups
based on the clinical staging systems developed by
Rai and Binet (Rai et al., 1975; Binet et al., 1981).
The disease is heterogenous from the clinical point
of view with at least three group of patients.
Approximately one-third of CLL patients are
affected by an indolent form of disease that does
not require treatment. Another third of patients
presents with a leukemia that will require iterative
therapies, affecting their quality and length of life.
A small fraction of CLL patients will develop
Richter syndrome (RS), represented in most cases
by diffuse large B-cell lymphoma (DLBCL) arising
from the transformation of the original CLL clone.
RS is a highly aggressive syndrome with a median
overall survival of 5 to 8 months (Hallek et al.,
2008). Several molecular markers have been
identified with a prognostic significance to
distinguish among the different groups of patients.
The most credited molecular indicators are the
absence of mutations in the IgVH genes and the
expression of CD38 and Zap70 (Cramer and
Hallek, 2011).
Cytogenetics
CLL is associated with chromosomal deletions and
amplifications: the most frequent is trisomy of
chromosome 12 (+12; 16%) and deletion of
chromosomal regions 11q (18%), 17p (7%) and
13q14 (55%). The molecular consequences of
trisomy 12 are unknown, but probably related to an
elevated gene dosage of a proto-oncogene.
Del(11)(q22-q23) comprise ataxia teleangectasia
(ATM) gene, a gene related to genomic instability
and DNA-repair and associated with a
predisposition to lymphoid malignancies. The
inability to repair DNA-damage due to ATM-
deficiency contributes to CLL pathogenesis,
allowing accumulation of additional genetic
mutations during cellular proliferation. A similar
pathogenetic mechanism occurs in CLL with
del(17p13) that include the TP53 tumor suppressor
gene. The del(13q14) mono- or bi-allelic involves
two microRNAs, miR-15a and miR16-1, that can
be two potential candidate tumor suppressor genes,
even though their targets are still unknown (Klein
and Dalla-Favera, 2010; Zenz et al., 2010).
Oncogenesis
In CLL, elevated expression of CD38 is associated
with several adverse prognostic factors such as
advanced disease stage, higher incidence of
lymphadenopathy, high-risk cytogenetics, shorter
lymphocytes doubling time (LDT), shorter time to
initiation of first treatment (TFT) and poorer
response to therapy. Besides being a prognostic
marker, CD38 is a key element in the pathogenesis
of CLL, as a component of a molecular network
delivering growth and survival signals to CLL cells
(Deaglio et al., 2005). CD38 performs as a receptor
on leukemic cells following the binding to its ligand
CD31 and the signals are mediated by Zap70,
another negative prognosticator for the disease and
a limiting factor for the activation of the CD38-
mediated pathway (Deaglio et al., 2003; Deaglio et
al., 2007). CD38 can work in association with
chemokines and their receptors, mainly
CXCL12/CXCR4, influencing the migratory
responses and contributing to the recirculation of
neoplastic cells from blood to lymphoid organs
(Vaisitti et al., 2010) and with specific adhesion
molecules, belonging to the integrin family
(Zucchetto et al., 2009; Zucchetto et al., 2012). An
important role in the oncogenesis of CLL is likely
by the CD38 SNP (see above) that has been
recently described as an independent risk factor for
![Page 14: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/14.jpg)
CD38 (CD38 molecule) Deaglio S, Vaisitti T
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 448
Richter syndrome (RS) transformation. The
frequency of the G allele is significantly higher in a
subset of CLL patients characterized by clinical and
molecular markers of poor prognosis, with the
highest allele frequency scored by patients with RS
(Aydin, 2008). The same G allele was
independently reported as a susceptibility factor for
CLL development in a Polish population
(Jamroziak et al., 2009). The presence of the rare G
allele is not correlated to a higher expression of
CD38 by CLL cells, but is responsible for the
ability to modulate CD38 expression in response to
environmental signals.
Multiple myeloma (MM)
Disease
Multiple myeloma is a malignancy of the immune
system characterized by accumulation of plasma
cells in the bone marrow (BM), by a high
concentration of monoclonal Ig in serum or urine
and lytic bone lesions arising from osteolytic
activity of plasma cell-activated osteoclasts. The
proliferation of plasma cells in MM may interfere
with the normal production of blood cells, resulting
in leukopenia, anemia and thrombocytopenia. The
aberrant antibodies that are produced lead to
impaired humoral immunity and patients have a
high prevalence of infection. It is diagnosed with
blood tests, microscopic examination of the bone
marrow (bone marrow biopsy) and radiographs of
commonly involved bones.
Prognosis
MM is characterized by neoplastic proliferation of
plasma cells involving more than 10% of the BM.
Increasing evidence suggests that the BM
microenvironment of tumor cells plays a pivotal
role in the pathogenesis of myeloma. MM is a
heterogenous disease, with survival ranging from 1
year to more than 10 years. The 5-year relative
survival rate is around 40%. Survival is higher in
younger people. The tumor burden (based on C-
reactive protein CRP and beta-2-microglobulin
β2m) and the proliferation rate are the two key
indicators for the prognosis in patients with MM
(Palumbo and Anderson, 2011).
Cytogenetics
MM is characterized by very complex cytogenetic
and molecular genetic aberrations. The
chromosome number is usually either hyperdiploid
with multiple trisomies or hypodiploid with one of
several types of immunoglobulin heavy chain (Ig)
translocations. The chromosome status and Ig
rearrangements are two genetic criteria to stratify
patients into a specific prognostic group. The
malignant cells of MM are the most mature cells of
the B lineage. B cell maturation is associated with a
programmed rearrangement of DNA sequence in
the process encoding the structure of mature
immunoglobulins. Indeed, MM is characterized by
over-production of monoclonal immunoglobulin G
(IgG), IgA and/or light chains. Rearrangements
involving the switch regions of immunoglobulin
heavy chain (IgH) gene at the 14q32 with various
partner genes (t(4;14), t(14;16), t(11;14)) represent
the most common structural abnormalities in MM.
Several chromosomal aberrations are acquired
during disease progression, involving MYC
rearrangements, chromosome 13 (del(13q)), 17
(del(17p)) and 1p deletions. These chromosomal
abnormalities are associated to specific oncogenes,
such as c-myc that develop early in the course of
plasma cell tumors, while changes in other
oncogenes such as N-ras and K-ras are more often
found in MM after BM relapse. Abnormalities are
also described for tumor suppressor genes such as
TP53, associated with spread to other organs.
(Sawyer, 2011).
Oncogenesis
CD38 is predominantly expressed by BM precursor
cells and terminally differentiated plasma cells.
MM cells show moderate to high expression levels
of CD38. The need for improved MM therapy has
stimulated the development of monoclonal
antibodies (mAbs) targeting either MM cells or
cells of the BM microenvironment. CD38 is one of
the candidates: recently, a human anti-CD38
(HuMax-CD38 or Daratunumab) antibody was
generated and preclinical studies indicated that it is
highly effective in killing primary CD38+CD138
+
patients MM cells and a range of MM/lymphoid
cell lines by both Antibody-dependent cellular
cytotoxicity (ADCC) and complement-dependent
cytotoxicity (CDC). Moreover, in a SCID mouse
animal model, this antibody inhibited CD38+ tumor
cell growth (Stevenson et al., 2006; de Weers et al.,
2011; Tai and Anderson, 2011). Another fully
human anti-CD38 mAb (MorphoSysAG) was
reported to efficiently trigger ADCC against CD38+
MM cell lines and patients MM cells in vitro as
well as in vivo in a xenograft mouse model
(Stevenson et al., 2006).
Acute myeloid leukemia (AML)
Disease
Acute myelogenous leukemia (AML) is a cancer of
the myeloid lineage, characterized by the rapid
growth of abnormal white blood cells that
accumulate in the bone marrow and interfere with
the production of normal blood cells (maturational
arrest of bone marrow cells in the earliest stages of
development due to the activation of abnormal
genes through chromosomal translocations and
other genetic abnormalities).
Prognosis
AML has several subtypes: 5-year survival rates
vary from 15% to 70% and relapse rates vary from
33 to 78% depending on subtype. The French-
American-British (FAB) classification system
divides AML into 8 subtypes, M0 through M7,
based on the type of cell from which the leukemia
![Page 15: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/15.jpg)
CD38 (CD38 molecule) Deaglio S, Vaisitti T
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 449
developed and its degree of maturation
(morphology of the neoplastic cells and cytogenetic
analysis to characterize chromosomal
abnormalities). The M3 subtype, also known as
acute promyelocytic leukemia (APL), is caused by
an arrest of leukocyte differentiation at the
promyelocyte stage. Various clinical regimens
combining anthracyclines, retinoic acid (RA), that
induces APL differentiation, and arsenic trioxide,
that triggers apoptosis and differentiation, results in
a remission of 80-90% of patients (de Thé and
Chen, 2010; Kamimura et al., 2011).
Cytogenetics
Cytogenetics is the single most important
prognostic factor in AML. About 50% of AML
patients have a normal cytogenetics; certain
cytogenetic abnormalities are associated with good
outcomes (t(15;17) in acute promyelocytic
leukemia), while other cytogenetic abnormalities
are associated with a poor prognosis and a high risk
of relapse after treatment. APL is characterized by a
reciprocal translocation, t(15;17), that results in a
fusion oncogene, PML (promyelocytic leukemia)-
RARα (retinoic acid receptor α) with a consequent
block of the normal myeloid differentiation
program and increased self-renewal of leukemic
progenitors cells.
Oncogenesis
Retinoic acid (RA), the vitamin A derivative plays
a critical role during the differentiation of myeloid
progenitors towards the neutrophil lineage. This
role is primarily mediated by binding of RA to
RARalpha (RARα, a nuclear receptor that
modulates the expression of multiple downstream
targets via retinoic acid response elements.
Biochemical evidence suggests RARα performs
two opposing functions, one as a repressor of gene
expression in the absence of ligand, the second as a
transcriptional activator in the presence of ligand,
each controlled by multimeric complexes of
transcription corepressors and coactivators. The
fusion gene product PML-RARα causes the
chimeric receptor to bind more tightly to the
nuclear corepressor factor. Therefore, the gene
cannot be activated with physiologic doses of
retinoic acid. RA induces the differentiation of
leukemic cells into mature granulocytes and
complete remissions in a majority of patients with
APL. Although well tolerated, this therapeutic
regimen may be associated with a toxic side effect
known as retinoic acid syndrome (RAS),
characterized by fever, dyspnea, pulmonary edema
and infiltrates. The increased production of
inflammatory cytokines (IFN-γ and IL-1β) by
myeloid cells and an aberrant interaction between
maturating granulocytes and host tissues contribute
to RAS pathogenesis. Normal granulocytes do not
express CD38, while RA-treated APL/AML cells
express high amounts of this molecule (Drach et al.,
1994; Mehta and Cheema, 1999). The aberrant
expression of CD38 on leukemic cells enhances
their propensity to interact with CD31, expressed
by lung endothelial cells, resulting in a local
production of inflammatory cytokines, apoptosis of
endothelial cells and development of RAS (Gao et
al., 2007).
To be noted
Note
The human CD38 gene contains a well defined bi-
allelic polymorphism that can be identified by the
restriction endonuclease PvuII (PvuII site:
CAGCTG). The polymorphic site is located at the
5' end of the first intron of the CD38 gene and
marks a C→G variation at position 184. The gene
frequencies in the healthy population are 0,78 and
0,22 for the C and G allele respectively (CC 61%,
GC 33% and GG 6%). The analysis of this
polymorphism in a large cohort of CLL patients
indicate that the G allele is significantly associated
with molecular markers of unfavourable prognosis
and represents a significant risk factor for RS
transformation (Aydin et al., 2008). The correlation
between this polymorphism and genetic
susceptibility has been studied also for other
diseases, including Systemic Lupus Erythematosus
(SLE), where the CC genotype causes susceptibility
and the CG genotype confers protection for discoid
rash development (Gonzales-Escribano et al.,
2004). Recently, a role for CD38 in mediating
oxytocin (OT) release in the brain has been
described (Jin et al., 2007). Mice deficient in CD38
lack short term social memory, a defect that has
been associated to the autism spectrum disorders
(ASD) in humans. Several polymorphism across
CD38 gene (rs6449197, rs3796863 and rs1800561)
are associated with ASD (Lerer et al., 2010;
Munesue et al., 2010) and a correlation between
CD38 expression and measure of social function in
ASD observed (Riebold et al., 2011). Indeed, a
reduced expression of CD38 in lymphoblast from
ASD patients compared to parental lymphoblastoid
cell lines has been reported. Lower CD38
expression and consequently lower level of
activation of its enzymatic functions in ASD can be
linked to a dysfunction in OT transmission in this
disorder (Higashida et al., 2007; Salmina et al.,
2010; Higashida et al., 2010).
References Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood. 1975 Aug;46(2):219-34
Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, Vaugier G, Potron G, Colona P, Oberling F, Thomas M, Tchernia G, Jacquillat C, Boivin P, Lesty C, Duault MT, Monconduit M, Belabbes S, Gremy F. A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer. 1981 Jul 1;48(1):198-206
![Page 16: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/16.jpg)
CD38 (CD38 molecule) Deaglio S, Vaisitti T
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 450
Drach J, McQueen T, Engel H, Andreeff M, Robertson KA, Collins SJ, Malavasi F, Mehta K. Retinoic acid-induced expression of CD38 antigen in myeloid cells is mediated through retinoic acid receptor-alpha. Cancer Res. 1994 Apr 1;54(7):1746-52
Di Noto R, Lo Pardo C, Schiavone EM, Ferrara F, Manzo C, Vacca C, Del Vecchio L. All-trans retinoic acid (ATRA) and the regulation of adhesion molecules in acute myeloid leukemia. Leuk Lymphoma. 1996 Apr;21(3-4):201-9
Umar S, Malavasi F, Mehta K. Post-translational modification of CD38 protein into a high molecular weight form alters its catalytic properties. J Biol Chem. 1996 Jul 5;271(27):15922-7
Ferrero E, Malavasi F. Human CD38, a leukocyte receptor and ectoenzyme, is a member of a novel eukaryotic gene family of nicotinamide adenine dinucleotide+-converting enzymes: extensive structural homology with the genes for murine bone marrow stromal cell antigen 1 and aplysian ADP-ribosyl cyclase. J Immunol. 1997 Oct 15;159(8):3858-65
Nata K, Takamura T, Karasawa T, Kumagai T, Hashioka W, Tohgo A, Yonekura H, Takasawa S, Nakamura S, Okamoto H. Human gene encoding CD38 (ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase): organization, nucleotide sequence and alternative splicing. Gene. 1997 Feb 28;186(2):285-92
Deaglio S, Morra M, Mallone R, Ausiello CM, Prager E, Garbarino G, Dianzani U, Stockinger H, Malavasi F. Human CD38 (ADP-ribosyl cyclase) is a counter-receptor of CD31, an Ig superfamily member. J Immunol. 1998 Jan 1;160(1):395-402
Mallone R, Ferrua S, Morra M, Zocchi E, Mehta K, Notarangelo LD, Malavasi F. Characterization of a CD38-like 78-kilodalton soluble protein released from B cell lines derived from patients with X-linked agammaglobulinemia. J Clin Invest. 1998 Jun 15;101(12):2821-30
Ferrero E, Malavasi F. The metamorphosis of a molecule: from soluble enzyme to the leukocyte receptor CD38. J Leukoc Biol. 1999 Feb;65(2):151-61
Ferrero E, Saccucci F, Malavasi F. The human CD38 gene: polymorphism, CpG island, and linkage to the CD157 (BST-1) gene. Immunogenetics. 1999 Jul;49(7-8):597-604
Mehta K, Cheema S. Retinoid-mediated signaling pathways in CD38 antigen expression in myeloid leukemia cells. Leuk Lymphoma. 1999 Feb;32(5-6):441-9
Munshi C, Aarhus R, Graeff R, Walseth TF, Levitt D, Lee HC. Identification of the enzymatic active site of CD38 by site-directed mutagenesis. J Biol Chem. 2000 Jul 14;275(28):21566-71
Chiorazzi N, Ferrarini M. B cell chronic lymphocytic leukemia: lessons learned from studies of the B cell antigen receptor. Annu Rev Immunol. 2003;21:841-94
Deaglio S, Capobianco A, Bergui L, Dürig J, Morabito F, Dührsen U, Malavasi F. CD38 is a signaling molecule in B-cell chronic lymphocytic leukemia cells. Blood. 2003 Sep 15;102(6):2146-55
González-Escribano MF, Aguilar F, Torres B, Sánchez-Román J, Núñez-Roldán A. CD38 polymorphisms in Spanish patients with systemic lupus erythematosus. Hum Immunol. 2004 Jun;65(6):660-4
Deaglio S, Vaisitti T, Bergui L, Bonello L, Horenstein AL, Tamagnone L, Boumsell L, Malavasi F. CD38 and CD100 lead a network of surface receptors relaying positive signals for B-CLL growth and survival. Blood. 2005 Apr 15;105(8):3042-50
Guse AH. Second messenger function and the structure-activity relationship of cyclic adenosine diphosphoribose (cADPR). FEBS J. 2005 Sep;272(18):4590-7
Liu Q, Kriksunov IA, Graeff R, Munshi C, Lee HC, Hao Q. Crystal structure of human CD38 extracellular domain. Structure. 2005 Sep;13(9):1331-9
Lee HC. Structure and enzymatic functions of human CD38. Mol Med. 2006 Nov-Dec;12(11-12):317-23
Stevenson GT. CD38 as a therapeutic target. Mol Med. 2006 Nov-Dec;12(11-12):345-6
Deaglio S, Vaisitti T, Aydin S, Bergui L, D'Arena G, Bonello L, Omedé P, Scatolini M, Jaksic O, Chiorino G, Efremov D, Malavasi F. CD38 and ZAP-70 are functionally linked and mark CLL cells with high migratory potential. Blood. 2007 Dec 1;110(12):4012-21
Dores GM, Anderson WF, Curtis RE, Landgren O, Ostroumova E, Bluhm EC, Rabkin CS, Devesa SS, Linet MS. Chronic lymphocytic leukaemia and small lymphocytic lymphoma: overview of the descriptive epidemiology. Br J Haematol. 2007 Dec;139(5):809-19
Gao Y, Camacho LH, Mehta K. Retinoic acid-induced CD38 antigen promotes leukemia cells attachment and interferon-gamma/interleukin-1beta-dependent apoptosis of endothelial cells: implications in the etiology of retinoic acid syndrome. Leuk Res. 2007 Apr;31(4):455-63
Higashida H, Salmina AB, Olovyannikova RY, Hashii M, Yokoyama S, Koizumi K, Jin D, Liu HX, Lopatina O, Amina S, Islam MS, Huang JJ, Noda M. Cyclic ADP-ribose as a universal calcium signal molecule in the nervous system. Neurochem Int. 2007 Jul-Sep;51(2-4):192-9
Jin D, Liu HX, Hirai H, Torashima T, Nagai T, Lopatina O, Shnayder NA, Yamada K, Noda M, Seike T, Fujita K, Takasawa S, Yokoyama S, Koizumi K, Shiraishi Y, Tanaka S, Hashii M, Yoshihara T, Higashida K, Islam MS, Yamada N, Hayashi K, Noguchi N, Kato I, Okamoto H, Matsushima A, Salmina A, Munesue T, Shimizu N, Mochida S, Asano M, Higashida H. CD38 is critical for social behaviour by regulating oxytocin secretion. Nature. 2007 Mar 1;446(7131):41-5
Aydin S, Rossi D, Bergui L, D'Arena G, Ferrero E, Bonello L, Omedé P, Novero D, Morabito F, Carbone A, Gaidano G, Malavasi F, Deaglio S. CD38 gene polymorphism and chronic lymphocytic leukemia: a role in transformation to Richter syndrome? Blood. 2008 Jun 15;111(12):5646-53
Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ. Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood. 2008 Jun 15;111(12):5446-56
Malavasi F, Deaglio S, Funaro A, Ferrero E, Horenstein AL, Ortolan E, Vaisitti T, Aydin S. Evolution and function of the ADP ribosyl cyclase/CD38 gene family in physiology and pathology. Physiol Rev. 2008 Jul;88(3):841-86
Jamroziak K, Szemraj Z, Grzybowska-Izydorczyk O, Szemraj J, Bieniasz M, Cebula B, Giannopoulos K, Balcerczak E, Jesionek-Kupnicka D, Kowal M, Kostyra A, Calbecka M, Wawrzyniak E, Mirowski M, Kordek R, Robak T. CD38 gene polymorphisms contribute to genetic susceptibility to B-cell chronic lymphocytic leukemia: evidence from two case-control studies in Polish Caucasians. Cancer Epidemiol Biomarkers Prev. 2009 Mar;18(3):945-53
Zucchetto A, Benedetti D, Tripodo C, Bomben R, Dal Bo M, Marconi D, Bossi F, Lorenzon D, Degan M, Rossi FM,
![Page 17: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/17.jpg)
CD38 (CD38 molecule) Deaglio S, Vaisitti T
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 451
Rossi D, Bulian P, Franco V, Del Poeta G, Deaglio S, Gaidano G, Tedesco F, Malavasi F, Gattei V. CD38/CD31, the CCL3 and CCL4 chemokines, and CD49d/vascular cell adhesion molecule-1 are interchained by sequential events sustaining chronic lymphocytic leukemia cell survival. Cancer Res. 2009 May 1;69(9):4001-9
de Thé H, Chen Z. Acute promyelocytic leukaemia: novel insights into the mechanisms of cure. Nat Rev Cancer. 2010 Nov;10(11):775-83
Klein U, Dalla-Favera R. New insights into the pathogenesis of chronic lymphocytic leukemia. Semin Cancer Biol. 2010 Dec;20(6):377-83
Lerer E, Levi S, Israel S, Yaari M, Nemanov L, Mankuta D, Nurit Y, Ebstein RP. Low CD38 expression in lymphoblastoid cells and haplotypes are both associated with autism in a family-based study. Autism Res. 2010 Dec;3(6):293-302
Munesue T, Yokoyama S, Nakamura K, Anitha A, Yamada K, Hayashi K, Asaka T, Liu HX, Jin D, Koizumi K, Islam MS, Huang JJ, Ma WJ, Kim UH, Kim SJ, Park K, Kim D, Kikuchi M, Ono Y, Nakatani H, Suda S, Miyachi T, Hirai H, Salmina A, Pichugina YA, Soumarokov AA, Takei N, Mori N, Tsujii M, Sugiyama T, Yagi K, Yamagishi M, Sasaki T, Yamasue H, Kato N, Hashimoto R, Taniike M, Hayashi Y, Hamada J, Suzuki S, Ooi A, Noda M, Kamiyama Y, Kido MA, Lopatina O, Hashii M, Amina S, Malavasi F, Huang EJ, Zhang J, Shimizu N, Yoshikawa T, Matsushima A, Minabe Y, Higashida H. Two genetic variants of CD38 in subjects with autism spectrum disorder and controls. Neurosci Res. 2010 Jun;67(2):181-91
Salmina AB, Lopatina O, Ekimova MV, Mikhutkina SV, Higashida H. CD38/cyclic ADP-ribose system: a new player for oxytocin secretion and regulation of social behaviour. J Neuroendocrinol. 2010 May;22(5):380-92
Vaisitti T, Aydin S, Rossi D, Cottino F, Bergui L, D'Arena G, Bonello L, Horenstein AL, Brennan P, Pepper C, Gaidano G, Malavasi F, Deaglio S. CD38 increases CXCL12-mediated signals and homing of chronic lymphocytic leukemia cells. Leukemia. 2010 May;24(5):958-69
Zenz T, Mertens D, Küppers R, Döhner H, Stilgenbauer S. From pathogenesis to treatment of chronic lymphocytic leukaemia. Nat Rev Cancer. 2010 Jan;10(1):37-50
Cramer P, Hallek M. Prognostic factors in chronic lymphocytic leukemia-what do we need to know? Nat Rev Clin Oncol. 2011 Jan;8(1):38-47
de Weers M, Tai YT, van der Veer MS, Bakker JM, Vink T, Jacobs DC, Oomen LA, Peipp M, Valerius T, Slootstra JW, Mutis T, Bleeker WK, Anderson KC, Lokhorst HM, van de Winkel JG, Parren PW. Daratumumab, a novel therapeutic human CD38 monoclonal antibody, induces killing of multiple myeloma and other hematological tumors. J Immunol. 2011 Feb 1;186(3):1840-8
Kamimura T, Miyamoto T, Harada M, Akashi K. Advances in therapies for acute promyelocytic leukemia. Cancer Sci. 2011 Nov;102(11):1929-37
Malavasi F, Deaglio S, Damle R, Cutrona G, Ferrarini M, Chiorazzi N. CD38 and chronic lymphocytic leukemia: a decade later. Blood. 2011 Sep 29;118(13):3470-8
Palumbo A, Anderson K. Multiple myeloma. N Engl J Med. 2011 Mar 17;364(11):1046-60
Riebold M, Mankuta D, Lerer E, Israel S, Zhong S, Nemanov L, Monakhov MV, Levi S, Yirmiya N, Yaari M, Malavasi F, Ebstein RP. All-trans retinoic acid upregulates reduced CD38 transcription in lymphoblastoid cell lines from Autism spectrum disorder. Mol Med. 2011;17(7-8):799-806
Saborit-Villarroya I, Vaisitti T, Rossi D, D'Arena G, Gaidano G, Malavasi F, Deaglio S. E2A is a transcriptional regulator of CD38 expression in chronic lymphocytic leukemia. Leukemia. 2011 Mar;25(3):479-88
Sawyer JR. The prognostic significance of cytogenetics and molecular profiling in multiple myeloma. Cancer Genet. 2011 Jan;204(1):3-12
Tai YT, Anderson KC. Antibody-based therapies in multiple myeloma. Bone Marrow Res. 2011;2011:924058
Zucchetto A, Vaisitti T, Benedetti D, Tissino E, Bertagnolo V, Rossi D, Bomben R, Dal Bo M, Del Principe MI, Gorgone A, Pozzato G, Gaidano G, Del Poeta G, Malavasi F, Deaglio S, Gattei V. The CD49d/CD29 complex is physically and functionally associated with CD38 in B-cell chronic lymphocytic leukemia cells. Leukemia. 2012 Jun;26(6):1301-12
This article should be referenced as such:
Deaglio S, Vaisitti T. CD38 (CD38 molecule). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):445-451.
![Page 18: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/18.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 452
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1) Edward J Kelly, Vladimir Yarov-Yarovoy, Allan E Rettie
Department of Pharmaceutics, University of Washington, Seattle, USA (EJK), Department of
Physiology and Membrane Biology, Department of Biochemistry and Molecular Medicine, School of
Medicine, University of California, Davis, USA (VYY), Department of Medicinal Chemistry,
University of Washington, Seattle, USA (AER)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/CYP4B1ID40253ch1p33.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CYP4B1ID40253ch1p33.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: CYPIVB1, P-450HP
HGNC (Hugo): CYP4B1
Location: 1p33
DNA/RNA
Description
The CYP4B1 gene has 12 exons resulting in an
open reading frame of 1533 bp (isoform 1). The
CYP4B1 locus is depicted in figure 1 (NCBI).
Transcription
Two major transcripts are known to derive from
alternative splicing (NM_000779.3,
NM_001099772.1). Isoform 1 encodes a 511 amino
acid protein, while isoform 2 encodes a 512 amino
acid protein with a Ser206 insertion.
It should be noted that this is a complicated locus
with many other possibilities for alternative
splicing.
Pseudogene
No pseudogene is known for CYP4B1.
Figure 1. Localization of the CYP4B1 locus to chromosome 1p33 and sites (exons 5, 8 and 9) of polymorphic variants that describe the 7 allelic variants of CYP4B1 (see table 1 for details).
![Page 19: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/19.jpg)
CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1)
Kelly EJ, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 453
Protein
Note
CYP4B1 belongs to the mammalian CYP4 enzyme
family that also includes CYP4A, 4F and the
recently discovered CYP 4V, 4X and 4Z sub-
families (Rettie and Kelly, 2008). P450 enzymes
usually function as monooxygenases in that they
incorporate one atom of molecular oxygen into their
substrates and reduce the other to water.
CYP4 enzymes typically catalyze fatty acid ω-
hydroxylase reactions.
Description
Structurally, P450 enzymes all share a similar fold
featuring a β-sheet rich N-terminus and an α-helix
rich C-terminus.
The hydrophobic N-terminus of eukaryotic P450s
functions as membrane anchor, whereas the C-
terminal region houses the cysteinyl heme (iron
protoporphyrin IX) cofactor that binds and activates
molecular oxygen.
Many CYP4 enzymes, including CYP4B1, possess
a unique post-translational modification at the heme
active center, wherein a conserved glutamate
residue in the core I-helix forms a covalent, ester
linkage at the C-5 methyl group of the heme
(Henne et al., 2001).
The function of the unusual modification has not
been established, although it may serve to rigidify
the enzyme's active site and modulate the substrate
selectivity of CYP4B1.
The CYP4B1 enzyme is highly conserved across
species - see figure 2 below that also highlights the
position of the cysteinyl ligand and the I-helix
glutamate.
Expression
CYP4B1 mRNA and/or protein are found typically
at the highest levels in lung and airway tissue.
Liver levels of the enzyme are usually much lower,
but inducible by phenobarbital.
Expression of the enzyme in mouse kidney is
regulated by androgens. CYP4B1 is highly
expressed in several cancer types, including colon,
adrenal gland, lung and gastric cancers.
Localisation
CYP4B1 is located in the ER membrane, although
one report suggests that the rat enzyme may be a
secreted protein in respiratory mucosa (Genter et
al., 2006).
![Page 20: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/20.jpg)
CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1)
Kelly EJ, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 454
Figure 2. Multiple sequence alignment of vertebrate CYP4B proteins. The covalently heme-linked glutamate residue is indicated in bold italics and the heme-coordinating cysteinyl ligand depicted in bold underline. The Pro>Ser substitution at position 427 in
human CYP4B1 is depicted in italics. Alignments determined using the ClustalW2 multiple sequence alignment program available online at EMBL-EBI.
![Page 21: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/21.jpg)
CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1)
Kelly EJ, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 455
Mutations
Note
Seven alleles (CYP4B1*1-*7) are listed at
http://www.cypalleles.ki.se/cyp4b1.htm and
summarized in table 1 below. The CYP4B1*1 allele
is described by a composition of the major alleles
shown in table 1. CYP4B1*2 contains the
haplotype of the 294 frameshift along with M331I,
R340C and R375C. CYP4B1*7 is the same
haplotype minus the R375C variant. CYP4B1*3/4/5
are described by the R173W, S322G and M331I
polymorphisms, respectively. CYP4B1*6 is
R173W in combination with V345I.
Nucleotide
Change,
cDNA
position
Protein
Coding
Sequence
Change
Heterozygosity1
517C>T R173W 0.28
881_882ΔAT 294
frameshift
(STOP)
0.34
964A>G S322G 0.02
993G>A M331I 0.40
1018C>T R340C 0.22
1033G>A V345I ND
1123C>T R375C 0.26
Table 1. CYP4B1 polymorphic variants including nucleotide changes and effect on protein coding sequences.
1 The
values for heterozygosity of the minor alleles are taken from NCBI. ND: not determined.
Recent exome sequencing has revealed
considerable additional polymorphism (>75 total
SNPs) in the human CYP4B1 gene (search at
Exome Variant Server).
Implicated in
Various cancers
Note
CYP4B1 mRNA and/or protein are highly
expressed in some cancer types. In particular
Imaoka et al. demonstrated increased CYP4B1 in
bladder tumor tissue at both the mRNA and protein
level (Imaoka et al., 2000). This finding is also
consistent with rodent studies demonstrating
localization of CYP4B1 in mouse and rat bladder
tissue (Imaoka et al., 1997; Imaoka et al., 2001).
However, Czerwinski et al. observed down
regulation of CYP4B1 mRNA in lung tumors
relative to normal lung (Czerwinski et al., 1994).
With breast cancer, there does not appear to be any
difference in expression of CYP4B1 when
comparing tumor tissue with surrounding healthy
tissue, but these studies did not use disease-free
subjects as a comparator (Iscan et al., 2001).
Relatively high expression of constitutive CYP4B1
mRNA has been found in human urothelial cells
(Roos et al., 2006). Peripheral blood mononuclear
cell CYP4B1 mRNA expression correlated with
human liver expression and therefore has been
suggested as a surrogate marker for hepatic
bioactivation of environmental pro-toxins
(Furukawa et al., 2004). An increased risk of
bladder cancer (OR of 1.03-2.95) has been reported
in Japanese patients carrying the CYP4B1*2 allele
(Sasaki et al., 2008). One potential explanation
could be that CYP4B1 is known to play a role in
aromatic amine bioactivation (Windmill et al.,
1997) and these compounds are known bladder
carcinogens and present in cooked meats (Jägerstad
and Skog, 2005) and cigarette smoke (Smith et al.,
1997), among other sources. However, no
association was found between lung cancer risk and
CYP4B1*1-*7 polymorphisms in Japanese (Tamaki
et al., 2011).
Angiogenesis
Note
Studies conducted in a rabbit model of corneal
wound healing have implicated that CYP4B1 may
play a role in production of inflammatory
eicosanoids and corneal neovascularization
(Mastyugin et al., 2001).
These observations are corroborated by findings in
mice, whereby heme oxygenase-I induction
attenuates corneal inflammation and is associated
with a lack of CYP4B1 induction (and eicosanoid
production) (Patil et al., 2008).
Conversely, retinoic acid (RA) has been shown to
increase CYP4B1 gene expression in ocular organ
cultures, resulting in increased metabolism of
arachidonic acid to 12-HETE and 12-HETrE
(Ashkar et al., 2004). These effects were shown to
be mediated, at least in part, by transcriptional
regulation of the rabbit CYP4B1 promoter, which
contains several RAR/RXR binding motifs (Ashkar
et al., 2004). While RA is typically associated with
corneal wound healing, the induction of CYP4B1
by RA suggests it may also have a pro-
inflammatory role in wound healing. This is
supported by the observation that systemic
treatment with 13-cis-retinoic acid (Accutane™) for
cystic acne is associated with conjunctivitis, eyelid
inflammation and keratitis, along with other ocular
effects (Lebowitz and Berson, 1988).
Further evidence that CYP4B1 is important in
ocular inflammation, eicosanoid production and
neovascularization is shown in a study by Seta et
al., using in vivo siRNA targeting of CYP4B1 in a
rabbit model of corneal wound healing.
It was found that down-regulation of CYP4B1
inhibited production of 12- HETrE and VEGF in
addition to decreasing neovascularization (Seta et
al., 2007).
![Page 22: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/22.jpg)
CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1)
Kelly EJ, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 456
Colitis
Note
Several recent studies have implicated a potential
role for CYP4B1 in inflammatory bowel disease
(IBD). In a mouse model of dextran sodium sulfate
(DSS)-induced colitis, Ye et al. found that caffeic
acid treatment decreased disease severity and this
was associated with increased expression of
Cyp4b1 in affected tissues (Ye et al., 2009). In a
subsequent study looking at the role of caffeic acid
bioavailability in this model, they found that mice
treated with DSS alone had lower colonic Cyp4b1
expression when compared to DSS plus caffeic acid
treated mice (Ye et al., 2011). In a different mouse
model of IBD, Liu et al. also found evidence that
Cyp4b1 gene expression is altered in this disease
state (Liu et al., 2009). It was found that IBD
induced by infection with Helicobacter bilis
resulted in changes in mucosal gene expression
patterns. Using microarray analysis, it was found
that H. bilis infection resulted in decreased
expression of Cyp4b1. These authors also examined
mice with IBD induced by DSS and, akin to Liu et
al., found decreased expression of Cyp4b1 in
diseased tissue. These findings suggest an anti-
inflammatory role for CYP4B1 in IBD, but these
preclinical studies must be weighed against what is
known about gastrointestinal expression of
CYP4B1 and human IBD. While rodents and
rabbits and other species are known to expression
CYP4B1 in the gut, there are species-specific
differences, with humans expressing little CYP4B1
in this tissue (McKinnon et al., 1994). Whether the
CYP4B1 gene plays any role in IBD is unclear,
particularly in light of the functionality of the
Pro427Ser human protein (Zheng et al., 1998).
Finally, in considering risk of developing IBD, a
genome wide association study by The Wellcome
Trust examining 2000 cases of Crohn's with 3000
controls, found no significant association between
CYP4B1 genetic variants and disease incidence
(Wellcome Trust Case Control Consortium, 2007).
References Lebowitz MA, Berson DS. Ocular effects of oral retinoids. J Am Acad Dermatol. 1988 Jul;19(1 Pt 2):209-11
Czerwinski M, McLemore TL, Gelboin HV, Gonzalez FJ. Quantification of CYP2B7, CYP4B1, and CYPOR messenger RNAs in normal human lung and lung tumors. Cancer Res. 1994 Feb 15;54(4):1085-91
McKinnon RA, Burgess WM, Gonzalez FJ, Gasser R, McManus ME. Species-specific expression of CYP4B1 in rabbit and human gastrointestinal tissues. Pharmacogenetics. 1994 Oct;4(5):260-70
Imaoka S, Yoneda Y, Matsuda T, Degawa M, Fukushima S, Funae Y. Mutagenic activation of urinary bladder carcinogens by CYP4B1 and the presence of CYP4B1 in bladder mucosa. Biochem Pharmacol. 1997 Sep 15;54(6):677-83
Smith CJ, Livingston SD, Doolittle DJ. An international literature survey of "IARC Group I carcinogens" reported in
mainstream cigarette smoke. Food Chem Toxicol. 1997 Oct-Nov;35(10-11):1107-30
Windmill KF, McKinnon RA, Zhu X, Gaedigk A, Grant DM, McManus ME. The role of xenobiotic metabolizing enzymes in arylamine toxicity and carcinogenesis: functional and localization studies. Mutat Res. 1997 May 12;376(1-2):153-60
Rainov NG, Dobberstein KU, Sena-Esteves M, Herrlinger U, Kramm CM, Philpot RM, Hilton J, Chiocca EA, Breakefield XO. New prodrug activation gene therapy for cancer using cytochrome P450 4B1 and 2-aminoanthracene/4-ipomeanol. Hum Gene Ther. 1998 Jun 10;9(9):1261-73
Zheng YM, Fisher MB, Yokotani N, Fujii-Kuriyama Y, Rettie AE. Identification of a meander region proline residue critical for heme binding to cytochrome P450: implications for the catalytic function of human CYP4B1. Biochemistry. 1998 Sep 15;37(37):12847-51
Imaoka S, Yoneda Y, Sugimoto T, Hiroi T, Yamamoto K, Nakatani T, Funae Y. CYP4B1 is a possible risk factor for bladder cancer in humans. Biochem Biophys Res Commun. 2000 Nov 2;277(3):776-80
Henne KR, Kunze KL, Zheng YM, Christmas P, Soberman RJ, Rettie AE. Covalent linkage of prosthetic heme to CYP4 family P450 enzymes. Biochemistry. 2001 Oct 30;40(43):12925-31
Imaoka S, Yoneda Y, Sugimoto T, Ikemoto S, Hiroi T, Yamamoto K, Nakatani T, Funae Y. Androgen regulation of CYP4B1 responsible for mutagenic activation of bladder carcinogens in the rat bladder: detection of CYP4B1 mRNA by competitive reverse transcription-polymerase chain reaction. Cancer Lett. 2001 May 26;166(2):119-23
Iscan M, Klaavuniemi T, Coban T, Kapucuoglu N, Pelkonen O, Raunio H. The expression of cytochrome P450 enzymes in human breast tumours and normal breast tissue. Breast Cancer Res Treat. 2001 Nov;70(1):47-54
Mastyugin V, Mosaed S, Bonazzi A, Dunn MW, Schwartzman ML. Corneal epithelial VEGF and cytochrome P450 4B1 expression in a rabbit model of closed eye contact lens wear. Curr Eye Res. 2001 Jul;23(1):1-10
Ashkar S, Mesentsev A, Zhang WX, Mastyugin V, Dunn MW, Laniado-Schwartzman M. Retinoic acid induces corneal epithelial CYP4B1 gene expression and stimulates the synthesis of inflammatory 12-hydroxyeicosanoids. J Ocul Pharmacol Ther. 2004 Feb;20(1):65-74
Furukawa M, Nishimura M, Ogino D, Chiba R, Ikai I, Ueda N, Naito S, Kuribayashi S, Moustafa MA, Uchida T, Sawada H, Kamataki T, Funae Y, Fukumoto M. Cytochrome p450 gene expression levels in peripheral blood mononuclear cells in comparison with the liver. Cancer Sci. 2004 Jun;95(6):520-9
Jägerstad M, Skog K. Genotoxicity of heat-processed foods. Mutat Res. 2005 Jul 1;574(1-2):156-72
Genter MB, Yost GS, Rettie AE. Localization of CYP4B1 in the rat nasal cavity and analysis of CYPs as secreted proteins. J Biochem Mol Toxicol. 2006;20(3):139-41
Roos PH, Belik R, Föllmann W, Degen GH, Knopf HJ, Bolt HM, Golka K. Expression of cytochrome P450 enzymes CYP1A1, CYP1B1, CYP2E1 and CYP4B1 in cultured transitional cells from specimens of the human urinary tract and from urinary sediments. Arch Toxicol. 2006 Jan;80(1):45-52
Sansen S, Yano JK, Reynald RL, Schoch GA, Griffin KJ, Stout CD, Johnson EF. Adaptations for the oxidation of
![Page 23: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/23.jpg)
CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1)
Kelly EJ, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 457
polycyclic aromatic hydrocarbons exhibited by the structure of human P450 1A2. J Biol Chem. 2007 May 11;282(19):14348-55
Seta F, Patil K, Bellner L, Mezentsev A, Kemp R, Dunn MW, Schwartzman ML. Inhibition of VEGF expression and corneal neovascularization by siRNA targeting cytochrome P450 4B1. Prostaglandins Other Lipid Mediat. 2007 Nov;84(3-4):116-27
. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. 2007 Jun 7;447(7145):661-78
Patil K, Bellner L, Cullaro G, Gotlinger KH, Dunn MW, Schwartzman ML. Heme oxygenase-1 induction attenuates corneal inflammation and accelerates wound healing after epithelial injury. Invest Ophthalmol Vis Sci. 2008 Aug;49(8):3379-86
Rettie A E, Kelly EJ.. The CYP4 Family Issues in Toxicology. Cytochome P450: Role in the metabolism and toxicity of drugs and other xenobiotics; Ioannides C. Ed, Royal Society of Chemistry, London, 2008.
Sasaki T, Horikawa M, Orikasa K, Sato M, Arai Y, Mitachi Y, Mizugaki M, Ishikawa M, Hiratsuka M.. Possible relationship between the risk of Japanese bladder cancer cases and the CYP4B1 genotype. Jpn J Clin Oncol. 2008 Sep;38(9):634-40. Epub 2008 Aug 19.
Liu Z, Henderson AL, Nettleton D, Wilson-Welder JH, Hostetter JM, Ramer-Tait A, Jergens AE, Wannemuehler
MJ.. Mucosal gene expression profiles following the colonization of immunocompetent defined-flora C3H mice with Helicobacter bilis: a prelude to typhlocolitis. Microbes Infect. 2009 Mar;11(3):374-83. Epub 2009 Jan 14.
Ye Z, Liu Z, Henderson A, Lee K, Hostetter J, Wannemuehler M, Hendrich S.. Increased CYP4B1 mRNA is associated with the inhibition of dextran sulfate sodium-induced colitis by caffeic acid in mice. Exp Biol Med (Maywood). 2009 Jun;234(6):605-16. Epub 2009 Mar 23.
Tamaki Y, Arai T, Sugimura H, Sasaki T, Honda M, Muroi Y, Matsubara Y, Kanno S, Ishikawa M, Hirasawa N, Hiratsuka M.. Association between cancer risk and drug-metabolizing enzyme gene (CYP2A6, CYP2A13, CYP4B1, SULT1A1, GSTM1, and GSTT1) polymorphisms in cases of lung cancer in Japan. Drug Metab Pharmacokinet. 2011;26(5):516-22. Epub 2011 Jul 26.
Ye Z, Hong CO, Lee K, Hostetter J, Wannemuehler M, Hendrich S.. Plasma caffeic acid is associated with statistical clustering of the anticolitic efficacy of caffeic acid in dextran sulfate sodium-treated mice. J Nutr. 2011 Nov;141(11):1989-95. Epub 2011 Sep 14.
This article should be referenced as such:
Kelly EJ, Yarov-Yarovoy V, Rettie AE. CYP4B1 (cytochrome P450, family 4, subfamily B, polypeptide 1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):452-457.
![Page 24: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/24.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 458
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Chon-Hwa Tsai-Morris, Maria L Dufau
Section on Molecular Endocrinology, Program in Developmental Endocrinology and Genetics,
NICHD, National Institutes of Health, Bethesda, MD 20892-4510, USA (CHTM, MLD)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/DDX25ID46826ch11q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI DDX25ID46826ch11q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: GRTH
HGNC (Hugo): DDX25
Location: 11q24.2
Note
Gonadotropin Regulated Testicular RNA Helicase
(GRTH), a member of the Glu-Asp-Ala-Glu
(DEAD)-box protein family, is a testis-specific
gonadotropin/androgen-regulated RNA Helicase.
DNA/RNA
Description
Human GRTH gene contains 12 exons and all but
one of its conserved helicase motifs are contained
within single exon (Tsai-Morris et al., 2004). Motif
ARG-D resides in exon 10/11.
Transcription
The GRTH gene belongs to the TATA-less/non-
initiator class (Tsai-Morris et al., 2004). A single
transcript of 1,6 Kb is expressed in the testis (Tang
et al., 1999). Gonadotropin-induced androgen
increases cause autocrine stimulation of GRTH
gene transcription in Leydig cells through a non-
classical half-site element residing at -827/-822 5'
from the initiation codon (Tang et al., 1999; Tsai-
Morris et al., 2010; Villar et al., 2012). The
induction of the GRTH gene expression in germ
cells (meiotic spermatocytes, round and elongated
spermatids) presumbably results from paracrine
actions of androgen through cognate receptors in
Sertoli cells (adjacent to germinal cells).
Pseudogene
One related pseudo DDX25 (LOC100421309) was
found in chromosome 5.
Genomic organization of the Human GRTH gene. Exons presented by boxes. The positions of the translation initiation ATG and termination TGA codon are indicated. Conserved domains of DEAD-box family of the RNA helicase are presented above its
respective exon.
![Page 25: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/25.jpg)
DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Tsai-Morris CH, Dufau ML
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 459
Protein
Description
GRTH contains three ATG in frame codons with
the potential for generation of multiple protein
species (61/56, 48/43 and 33 kDa) (Sheng et al.,
2003). The 61/56 kDa proteins are the major
species observed in the human testis (Tang et al.,
1999; Tsai-Morris et al., 2007).
GRTH 56- and 61-kDa species are present in
nucleus and cytoplasm (Sheng et al., 2006),
respectively.
Based on the mouse model, the 56 kDa nuclear
species interacts with CRM1 and participates in
mRNA transport in the human testis and the
phosphorylated 61 kDa species associates with
mRNAs at polysomal sites and also within the
Chromatoid Body of round spermatids.
Expression
GRTH (484 aa) is highly expressed in the testis:
somatic (Leydig cells) and germinal (meiotic
spermatocytes, round spermatids and elongated
spermatids) cells (Sheng et al., 2003; Tsai-Morris,
et al., 2004).
GRTH is genetically close to DBP5/DDX19b (63%
overall aa homology) involved in mRNA export
(Schmitt et al., 1999).
Localisation
GRTH is localized in the nucleus and at
cytoplasmic sites in polyribosomes and the
Chromatoid Body (CB) of round spermatids (Tsai-
Morris et al., 2004; Sheng et al., 2006; Sato et al.,
2010; Tsai-Morris et al., 2012).
Model of GRTH action in male germ cells during development (derived from mouse studies). 56 kDa GRTH species enters the nucleus (1), where it binds messages and associates with CRM1 (2) as mRNP complex to export messages through nuclear pores via the CRM1 pathway to the cytoplasm (3a) and to the chromatoid body (CB), either directly (via nuclear pores
adjacent to or associated with the CB) (3b) or indirectly via the cytoplasmic route (4b). It is phosphorylated at cytoplasmic sites, and participates in translation at polyribosomes (4a). In the CB, messages are potentially regulated via si/mi/pi RNA pathway (5a
and b). Stored messages are subsequently translated in polyribosomes (4a and 6) at specific times during spermatogenesis.
![Page 26: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/26.jpg)
DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Tsai-Morris CH, Dufau ML
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 460
GRTH is essential for spermatid development and completion of spermatogenesis (derived from studies of GRTH-/-
mouse model). Top panel: Diagram of spermatogenic progression. Representative germ cells during spermatogenesis are
shown in the diagram above. Cells expressing GRTH are boxed in red. The regulation of gene expression during the developmental process is governed in a precise temporal sequence. Lower panel: I. GRTH dependent expression of proteins. II.
Schematic germ-cell development. Unlike the wild type (WT) showing progression to mature sperm, germ cells of GRTH knockout mice fail to elongate at step 8 of round spermatids (RS).
Function
GRTH is a multifunctional protein essential for
completion of spermatogenesis as a post-
transcriptional regulator of relevant genes during
germ cells development (Tsai-Morris et al., 2004;
Sheng et al., 2006; Dufau and Tsai-Morris, 2007;
Tsai-Morris et al., 2010). It contains ATPase
activity (ATP/Mg dependent), and is a bi-
directional RNA helicase. As a translational
regulator it participates in the in vitro and in vivo
translation of RNA templates. GRTH is a shuttling
protein that exports germ cell specific RNA as
mRNP particles from nucleus to cytoplasm via the
CRM1-dependent pathway. A specific set of
testicular gene transcripts, including those of
chromatin-remodeling proteins (Tp1 and Tp2, Prm1
and PRM2), cytoskeletal structural proteins
(Fsc1/Odf1) and tACE are associated with GRTH
protein. GRTH also selectively binds mRNAs of
pro-apoptotic and anti-apoptotic genes, the death
receptor and proteins involved in the NF-kB
pathways to mediate anti-apoptotic regulation
(Gutti et al., 2008). GRTH is required to maintain
the structural integrity of the chromatoid body
(storage/processing organelle of mRNAs that
contains members of the small miRNA RISC-
complex) during spermatogenesis (Sato et al.,
2010). GRTH also participates in the regulation of
microRNA biogenesis in germ cells (Dai et al.,
2011) and associates with polyribosome for
translational initiation of target genes. In Leydig
cells, GRTH prevents overstimulation of
gonadotropin-induced androgen pathway by
promoting degradation of StAR protein (Fukushima
et al., 2011).
Implicated in
Azoospermia
Note
A missense mutation (R242H) in exon 8 identified
in 5% of an infertile Japanese patient population
with non-obstructive azoospermia (NOA) abrogated
the generation of the 61 kDa phosphorylated-GRTH
species (Tsai-Morris et al., 2007; Tsai-Morris et al.,
2008). A silent mutation located in exon 10
(C1194T, nt) identified in Chinese patients with
idiopathic azoospermia was proposed to increase
the risk of impaired spermatogenesis (Zhoucun et
al., 2006). This could result from its location in the
binding motif of splicing factor 2 through affecting
pre-RNA splicing of the GRTH gene and ultimately
its expression. However, such mutation was not
observed in the infertile Japanese patients with non-
obstructive azoospermia (Tsai-Morris et al., 2008),
which indicated segregration of the mutation to the
Chinese population.
References Schmitt C, von Kobbe C, Bachi A, Panté N, Rodrigues JP, Boscheron C, Rigaut G, Wilm M, Séraphin B, Carmo-Fonseca M, Izaurralde E. Dbp5, a DEAD-box protein
![Page 27: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/27.jpg)
DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25) Tsai-Morris CH, Dufau ML
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 461
required for mRNA export, is recruited to the cytoplasmic fibrils of nuclear pore complex via a conserved interaction with CAN/Nup159p. EMBO J. 1999 Aug 2;18(15):4332-47
Tang PZ, Tsai-Morris CH, Dufau ML. A novel gonadotropin-regulated testicular RNA helicase. A new member of the dead-box family. J Biol Chem. 1999 Dec 31;274(53):37932-40
Dufau ML, Tsai-Morris C, Tang P, Khanum A. Regulation of steroidogenic enzymes and a novel testicular RNA helicase. J Steroid Biochem Mol Biol. 2001 Jan-Mar;76(1-5):187-97
Sheng Y, Tsai-Morris CH, Dufau ML. Cell-specific and hormone-regulated expression of gonadotropin-regulated testicular RNA helicase gene (GRTH/Ddx25) resulting from alternative utilization of translation initiation codons in the rat testis. J Biol Chem. 2003 Jul 25;278(30):27796-803
Tsai-Morris CH, Lei S, Jiang Q, Sheng Y, Dufau ML. Genomic organization and transcriptional analysis of gonadotropin-regulated testicular RNA helicase--GRTH/DDX25 gene. Gene. 2004 Apr 28;331:83-94
Tsai-Morris CH, Sheng Y, Lee E, Lei KJ, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is essential for spermatid development and completion of spermatogenesis. Proc Natl Acad Sci U S A. 2004 Apr 27;101(17):6373-8
A Z, Zhang S, Yang Y, Ma Y, Lin L, Zhang W. Single nucleotide polymorphisms of the gonadotrophin-regulated testicular helicase (GRTH) gene may be associated with the human spermatogenesis impairment. Hum Reprod. 2006 Mar;21(3):755-9
Sheng Y, Tsai-Morris CH, Gutti R, Maeda Y, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is a transport protein involved in gene-specific mRNA export and protein translation during spermatogenesis. J Biol Chem. 2006 Nov 17;281(46):35048-56
Dufau ML, Tsai-Morris CH. Gonadotropin-regulated testicular helicase (GRTH/DDX25): an essential regulator of spermatogenesis. Trends Endocrinol Metab. 2007 Oct;18(8):314-20
Tsai-Morris CH, Koh E, Sheng Y, Maeda Y, Gutti R, Namiki M, Dufau ML. Polymorphism of the GRTH/DDX25 gene in normal and infertile Japanese men: a missense mutation associated with loss of GRTH phosphorylation. Mol Hum Reprod. 2007 Dec;13(12):887-92
Gutti RK, Tsai-Morris CH, Dufau ML. Gonadotropin-regulated testicular helicase (DDX25), an essential regulator of spermatogenesis, prevents testicular germ cell apoptosis. J Biol Chem. 2008 Jun 20;283(25):17055-64
Tsai-Morris CH, Koh E, Dufau ML. Differences in gonadotropin-regulated testicular helicase (GRTH/DDX25) single nucleotide polymorphism between Japanese and Chinese populations. Hum Reprod. 2008 Nov;23(11):2611-3
Sato H, Tsai-Morris CH, Dufau ML. Relevance of gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) in the structural integrity of the chromatoid body during spermatogenesis. Biochim Biophys Acta. 2010 May;1803(5):534-43
Tsai-Morris CH, Sheng Y, Gutti R, Li J, Pickel J, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) gene: cell-specific expression and transcriptional regulation by androgen in transgenic mouse testis. J Cell Biochem. 2010 Apr 15;109(6):1142-7
Tsai-Morris CH, Sheng Y, Gutti RK, Tang PZ, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25): a multifunctional protein essential for spermatogenesis. J Androl. 2010 Jan-Feb;31(1):45-52
Dai L, Tsai-Morris CH, Sato H, Villar J, Kang JH, Zhang J, Dufau ML. Testis-specific miRNA-469 up-regulated in gonadotropin-regulated testicular RNA helicase (GRTH/DDX25)-null mice silences transition protein 2 and protamine 2 messages at sites within coding region: implications of its role in germ cell development. J Biol Chem. 2011 Dec 30;286(52):44306-18
Dufau ML, Sato H, Gutti R, Tsai-Morris CH. Gonadotropin-regulated testicular helicase (GRTH/DDX25): a master post-transcriptional regulator of spermatogenesis. Adv Exp Med Biol. 2011;707:23-9
Fukushima M, Villar J, Tsai-Morris CH, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25), a negative regulator of luteinizing/chorionic gonadotropin hormone-induced steroidogenesis in Leydig cells: central role of steroidogenic acute regulatory protein (StAR). J Biol Chem. 2011 Aug 26;286(34):29932-40
Tsai-Morris CH, Sato H, Gutti R, Dufau ML. Role of gonadotropin regulated testicular RNA helicase (GRTH/Ddx25) on polysomal associated mRNAs in mouse testis. PLoS One. 2012;7(3):e32470
Villar J, Tsai-Morris CH, Dai L, Dufau ML. Androgen-induced activation of gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) transcription: essential role of a nonclassical androgen response element half-site. Mol Cell Biol. 2012 Apr;32(8):1566-80
This article should be referenced as such:
Tsai-Morris CH, Dufau ML. DDX25 (DEAD (Asp-Glu-Ala-Asp) box helicase 25). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):458-461.
![Page 28: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/28.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 462
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
EPHB6 (EPH receptor B6) Lokesh Bhushan, Raj P Kandpal
Department of Basic Medical Sciences, Western University of Health Sciences, Pomona, CA 91766,
USA (LB, RPK)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/EPHB6ID40471ch7q34.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI EPHB6ID40471ch7q34.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: HEP, MGC129910, MGC129911
HGNC (Hugo): EPHB6
Location: 7q34
DNA/RNA
Note
EphB6 is located on chromosome 7q33-q35.
Description
Size: 16056 bases.
Orientation: plus strand.
Transcription
EphB6 mRNA size is 4044 bp.
Pseudogene
Not reported.
The chromosomal location of EPHB6 is indicated at interval q33-q35. Adapted from GeneCards.
Schematic representation of various domains in EphB6 protein.
![Page 29: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/29.jpg)
EPHB6 (EPH receptor B6) Bhushan L, Kandpal RP
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 463
Protein
Note
The crystal structure of EphB6 has not yet been
determined. However, based on amino acid
sequence and domain arrangement it is classified as
a type I transmembrane protein.
It has a highly conserved N-terminal domain in the
extracellular region that is involved in ligand
recognition and binding (Labrador et al., 1997). The
N-terminal domain is followed by a cysteine rich
region and two fibronectin type-III repeats. These
repeats are involved in mediating protein-protein
interactions and receptor dimerization (Lackmann
et al., 1998).
The intracellular region contains a juxtamembrane
domain, a conserved kinase domain, a sterile α-
motif (SAM) domain and a PSD95/Dlg/ZO1 (PDZ)
domain (Kalo and Pasquale, 1999).
Description
Eph (erythropoietin producing hepatocellular
carcinoma) receptors belong to a family of receptor
tyrosine kinases, which are activated by binding to
ephrin ligands.
These receptors are involved in a diverse array of
signal transduction processes in humans.
Such diversity of signaling and the resulting
functional output is partly attributed to differential
expression and interactions among these receptors.
Based on sequence homology and affinity for
ephrin ligands, Eph receptors are classified into A
and B groups. EphB6 is a kinase-deficient receptor
(Gurniak and Berg, 1996) that has been shown to
interact with two kinase-active receptors, namely,
EphB2 and EphA2 (Fox and Kandpal, 2011).
Ephrin B2 has been reported as a ligand for this
receptor (Munthe et al., 2000).
The loss of EphB6 expression in breast carcinoma
cell lines has been correlated to their invasiveness
(Fox and Kandpal, 2004; Fox and Kandpal, 2006),
and its role as a tumor suppressor has also been
reported (Fox and Kandpal, 2009; Yu et al., 2010).
Expression
Eph receptors are expressed in a wide variety of
tissues and cells (Andres et al., 1994; Fox et al.,
1995; Ciossek et al., 1995; Lickliter et al., 1996;
Muñoz et al., 2002). In addition to other tissues and
cells, EphB6 receptor expression has been shown in
breast, prostate, thymus, mature T-cells and
leukemia cells (Shimoyama et al., 2000; Luo et al.,
2001; Luo et al., 2002; Fox and Kandpal, 2004; Fox
et al., 2006). EphB6 deficient mice develop
normally and do not display any abnormality in
their general appearance (Shimoyama et al., 2002).
Localisation
Cellular. EphB6 is a transmembrane protein.
Function
A variety of Eph receptors and their ligands are
involved in regulating cell pattern formation during
organogenesis (Xu and Wilkinson, 1997; Flanagan
and Vanderhaeghen, 1998; Holmberg et al., 2000;
Leighton et al., 2001; Kullander et al., 2001; Gerlai,
2001). EphB6 has been shown to facilitate T-cell
activation (Luo et al., 2002). Metastasis/invasion
suppressor role of EphB6 in non-small cell lung
carcinoma and breast carcinoma (Müller-Tidow et
al., 2005; Fox and Kandpal, 2009) suggests its
involvement in cell adhesion and migration.
Homology
Amino acid homology between EphB6 and other
EphB family members varies between 47% and
60%. Mouse and human homologs of EphB6 share
greater than 90% amino acid identity (Gurniak and
Berg, 1996; Matsuoka et al., 1997). The kinase
domain in EphB6 is mutated.
Implicated in
Non-small cell lung cancer
Note
Altered levels and loss of EphB6 expression have
been found in non-small cell lung carcinoma (Tang
et al., 1999a; Müller-Tidow et al., 2005; Yu et al.,
2010).
Breast cancer
Note
EphB6 silencing has been observed in breast
carcinoma cell lines and some tumors (Fox and
Kandpal, 2004; Fox and Kandpal, 2006; Fox and
Kandpal, 2009; Truitt et al., 2010). Molecular
profiling of breast carcinoma cells with or without
EphB6 expression has revealed significant changes
in proteins as well as miRNAs (Kandpal, 2010;
Bhushan and Kandpal, 2011). However, elevated
levels of EphB6 have also been reported in breast
tumor specimens (Brantley-Sieders et al., 2011).
Melanoma
Note
The progression of melanoma to metastasis has
been correlated to progressive decrease of EphB6
expression (Hafner et al., 2003).
Neuroblastoma
Note
The levels of EphB6 have been characterized as
prognostic indicators in neuroblastoma (Tang et al.,
1999b; Tang et al., 2000).
Leukemia and T-cell development
Note
EphB6 expression has been implicated in T-cell
development, and altered levels of this protein have
![Page 30: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/30.jpg)
EPHB6 (EPH receptor B6) Bhushan L, Kandpal RP
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 464
been observed in leukemia and lymphoma cells
(Shimoyama et al., 2000).
Colorectal and colon cancer
Note
In familial colorectal cancer EphB6 gene shows two
missense mutations in germline. These two
mutations include change of alanine to proline at
position 321 (A321P) and glycine to valine
(G914V) at position 914 (Gylfe et al., 2010).
Deletions of EphB6 gene locus have also been
reported in colon cancer (Ashktorab et al., 2010).
References Andres AC, Reid HH, Zürcher G, Blaschke RJ, Albrecht D, Ziemiecki A. Expression of two novel eph-related receptor protein tyrosine kinases in mammary gland development and carcinogenesis. Oncogene. 1994 May;9(5):1461-7
Ciossek T, Lerch MM, Ullrich A. Cloning, characterization, and differential expression of MDK2 and MDK5, two novel receptor tyrosine kinases of the eck/eph family. Oncogene. 1995 Nov 16;11(10):2085-95
Fox GM, Holst PL, Chute HT, Lindberg RA, Janssen AM, Basu R, Welcher AA. cDNA cloning and tissue distribution of five human EPH-like receptor protein-tyrosine kinases. Oncogene. 1995 Mar 2;10(5):897-905
Gurniak CB, Berg LJ. A new member of the Eph family of receptors that lacks protein tyrosine kinase activity. Oncogene. 1996 Aug 15;13(4):777-86
Lickliter JD, Smith FM, Olsson JE, Mackwell KL, Boyd AW. Embryonic stem cells express multiple Eph-subfamily receptor tyrosine kinases. Proc Natl Acad Sci U S A. 1996 Jan 9;93(1):145-50
Labrador JP, Brambilla R, Klein R. The N-terminal globular domain of Eph receptors is sufficient for ligand binding and receptor signaling. EMBO J. 1997 Jul 1;16(13):3889-97
Matsuoka H, Iwata N, Ito M, Shimoyama M, Nagata A, Chihara K, Takai S, Matsui T. Expression of a kinase-defective Eph-like receptor in the normal human brain. Biochem Biophys Res Commun. 1997 Jun 27;235(3):487-92
Xu Q, Wilkinson DG. Eph-related receptors and their ligands: mediators of contact dependent cell interactions. J Mol Med (Berl). 1997 Aug;75(8):576-86
Flanagan JG, Vanderhaeghen P. The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 1998;21:309-45
Lackmann M, Oates AC, Dottori M, Smith FM, Do C, Power M, Kravets L, Boyd AW. Distinct subdomains of the EphA3 receptor mediate ligand binding and receptor dimerization. J Biol Chem. 1998 Aug 7;273(32):20228-37
Kalo MS, Pasquale EB. Signal transfer by Eph receptors. Cell Tissue Res. 1999 Oct;298(1):1-9
Tang XX, Brodeur GM, Campling BG, Ikegaki N. Coexpression of transcripts encoding EPHB receptor protein tyrosine kinases and their ephrin-B ligands in human small cell lung carcinoma. Clin Cancer Res. 1999a Feb;5(2):455-60
Tang XX, Evans AE, Zhao H, Cnaan A, London W, Cohn SL, Brodeur GM, Ikegaki N. High-level expression of EPHB6, EFNB2, and EFNB3 is associated with low tumor stage and high TrkA expression in human neuroblastomas. Clin Cancer Res. 1999b Jun;5(6):1491-6
Holmberg J, Clarke DL, Frisén J. Regulation of repulsion versus adhesion by different splice forms of an Eph receptor. Nature. 2000 Nov 9;408(6809):203-6
Munthe E, Rian E, Holien T, Rasmussen A, Levy FO, Aasheim H. Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 2000 Jan 21;466(1):169-74
Shimoyama M, Matsuoka H, Tamekane A, Ito M, Iwata N, Inoue R, Chihara K, Furuya A, Hanai N, Matsui T. T-cell-specific expression of kinase-defective Eph-family receptor protein, EphB6 in normal as well as transformed hematopoietic cells. Growth Factors. 2000;18(1):63-78
Tang XX, Zhao H, Robinson ME, Cohen B, Cnaan A, London W, Cohn SL, Cheung NK, Brodeur GM, Evans AE, Ikegaki N. Implications of EPHB6, EFNB2, and EFNB3 expressions in human neuroblastoma. Proc Natl Acad Sci U S A. 2000 Sep 26;97(20):10936-41
Gerlai R. Eph receptors and neural plasticity. Nat Rev Neurosci. 2001 Mar;2(3):205-9
Kullander K, Mather NK, Diella F, Dottori M, Boyd AW, Klein R. Kinase-dependent and kinase-independent functions of EphA4 receptors in major axon tract formation in vivo. Neuron. 2001 Jan;29(1):73-84
Leighton PA, Mitchell KJ, Goodrich LV, Lu X, Pinson K, Scherz P, Skarnes WC, Tessier-Lavigne M. Defining brain wiring patterns and mechanisms through gene trapping in mice. Nature. 2001 Mar 8;410(6825):174-9
Luo H, Wan X, Wu Y, Wu J. Cross-linking of EphB6 resulting in signal transduction and apoptosis in Jurkat cells. J Immunol. 2001 Aug 1;167(3):1362-70
Luo H, Yu G, Wu Y, Wu J. EphB6 crosslinking results in costimulation of T cells. J Clin Invest. 2002 Oct;110(8):1141-50
Muñoz JJ, Alonso-C LM, Sacedón R, Crompton T, Vicente A, Jiménez E, Varas A, Zapata AG. Expression and function of the Eph A receptors and their ligands ephrins A in the rat thymus. J Immunol. 2002 Jul 1;169(1):177-84
Shimoyama M, Matsuoka H, Nagata A, Iwata N, Tamekane A, Okamura A, Gomyo H, Ito M, Jishage K, Kamada N, Suzuki H, Tetsuo Noda T, Matsui T. Developmental expression of EphB6 in the thymus: lessons from EphB6 knockout mice. Biochem Biophys Res Commun. 2002 Oct 18;298(1):87-94
Hafner C, Bataille F, Meyer S, Becker B, Roesch A, Landthaler M, Vogt T. Loss of EphB6 expression in metastatic melanoma. Int J Oncol. 2003 Dec;23(6):1553-9
Fox BP, Kandpal RP. Invasiveness of breast carcinoma cells and transcript profile: Eph receptors and ephrin ligands as molecular markers of potential diagnostic and prognostic application. Biochem Biophys Res Commun. 2004 Jun 11;318(4):882-92
Müller-Tidow C, Diederichs S, Bulk E, Pohle T, Steffen B, Schwäble J, Plewka S, Thomas M, Metzger R, Schneider PM, Brandts CH, Berdel WE, Serve H. Identification of metastasis-associated receptor tyrosine kinases in non-small cell lung cancer. Cancer Res. 2005 Mar 1;65(5):1778-82
Fox BP, Kandpal RP. Transcriptional silencing of EphB6 receptor tyrosine kinase in invasive breast carcinoma cells and detection of methylated promoter by methylation specific PCR. Biochem Biophys Res Commun. 2006 Feb 3;340(1):268-76
Fox BP, Tabone CJ, Kandpal RP. Potential clinical relevance of Eph receptors and ephrin ligands expressed in prostate carcinoma cell lines. Biochem Biophys Res Commun. 2006 Apr 21;342(4):1263-72
![Page 31: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/31.jpg)
EPHB6 (EPH receptor B6) Bhushan L, Kandpal RP
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 465
Fox BP, Kandpal RP. EphB6 receptor significantly alters invasiveness and other phenotypic characteristics of human breast carcinoma cells. Oncogene. 2009 Apr 9;28(14):1706-13
Ashktorab H, Schäffer AA, Daremipouran M, Smoot DT, Lee E, Brim H. Distinct genetic alterations in colorectal cancer. PLoS One. 2010 Jan 26;5(1):e8879
Gylfe AE, Sirkiä J, Ahlsten M, Järvinen H, Mecklin JP, Karhu A, Aaltonen LA. Somatic mutations and germline sequence variants in patients with familial colorectal cancer. Int J Cancer. 2010 Dec 15;127(12):2974-80
Kandpal RP. Tyrosine kinase-deficient EphB6 receptor-dependent alterations in proteomic profiles of invasive breast carcinoma cells as determined by difference gel electrophoresis. Cancer Genomics Proteomics. 2010 Sep-Oct;7(5):253-60
Truitt L, Freywald T, DeCoteau J, Sharfe N, Freywald A. The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 2010 Feb 1;70(3):1141-53
Yu J, Bulk E, Ji P, Hascher A, Tang M, Metzger R, Marra A, Serve H, Berdel WE, Wiewroth R, Koschmieder S,
Müller-Tidow C. The EPHB6 receptor tyrosine kinase is a metastasis suppressor that is frequently silenced by promoter DNA hypermethylation in non-small cell lung cancer. Clin Cancer Res. 2010 Apr 15;16(8):2275-83
Bhushan L, Kandpal RP. EphB6 receptor modulates micro RNA profile of breast carcinoma cells. PLoS One. 2011;6(7):e22484
Brantley-Sieders DM, Jiang A, Sarma K, Badu-Nkansah A, Walter DL, Shyr Y, Chen J. Eph/ephrin profiling in human breast cancer reveals significant associations between expression level and clinical outcome. PLoS One. 2011;6(9):e24426
Fox BP, Kandpal RP. A paradigm shift in EPH receptor interaction: biological relevance of EPHB6 interaction with EPHA2 and EPHB2 in breast carcinoma cell lines. Cancer Genomics Proteomics. 2011 Jul-Aug;8(4):185-93
This article should be referenced as such:
Bhushan L, Kandpal RP. EPHB6 (EPH receptor B6). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):462-465.
![Page 32: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/32.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 466
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
FOXF1 (forkhead box F1) Pang-Kuo Lo
Department of Biological Sciences, University of South Carolina, Columbia, South Carolina 29208,
USA (PKL)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/FOXF1ID40628ch16q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI FOXF1ID40628ch16q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: ACDMPV, FKHL5, FREAC1
HGNC (Hugo): FOXF1
Location: 16q24.1
Local order:
According to the NCBI Map Viewer, genes
flanking FOXF1 in centromere to telomere
direction on 16q24 are:
- LOC401864 (chloride intracellular channel 1
pseudogene);
- FLJ34515 (uncharacterized LOC400550);
- FOXF1 (forkhead box F1);
- RPL7AP63 (ribosomal protein L7a pseudogene
63);
- MTHFSD (methenyltetrahydrofolate synthetase
domain containing);
- FLJ30679 (uncharacterized protein FLJ30679);
- FOXC2 (forkhead box C2, mesenchyme forkhead
1);
- FOXL1 (forkhead box L1).
Note
This gene encodes a transcription factor of the
forkhead family which is characterized by a unique
forkhead DNA-binding domain. The function of
this gene is implicated in regulation of embryonic
development and organ morphogenesis.
The cellular role of this gene has been found to
regulate cell cycle progression and epithelial-to-
mesenchymal transition (EMT).
Dysregulation of FOXF1 gene expression has been
linked to various cancers and genomic deletions or
mutations at this gene locus have been discovered
to be associated with congenital abnormalities.
The role of FOXF1 in cancer has been proposed to
act as either an oncogene or a tumor suppressor
gene depending on cell types and disease stages.
DNA/RNA
Description
The FOXF1 gene is composed of two exons with
sizes of 1022 and 1540 bp, respectively.
Transcription
The FOXF1 gene expresses 2,58 kb mRNA with
the 1140 bp open reading frame.
The pink boxes indicate the open reading frame and the sky blue boxes indicate the untranslated mRNA region.
![Page 33: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/33.jpg)
FOXF1 (forkhead box F1) Lo PK
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 467
Protein
Description
Human FOXF1 is a 379 amino acid protein
functioning as a transcription factor. The FOXF1
protein contains a forkhead domain (or called
winged helix, 48-125 amino acids) engaged in
binding to B-DNA (Kim et al., 2005). According to
the information from the NCBI reference sequence
NP_001442 for the FOXF1 protein, amino acids 84,
85, 94, 97, 98 and 118 are involved in interaction
with nucleotides of DNA. In addition to the
forkhead DNA-binding domain, the C-terminal of
FOXF1 possesses characteristics of the
transcriptional activation domain (Mahlapuu et al.,
1998). However, its region has not yet been
convincingly defined. The studies have shown that
FOXF1 transcripitionally modulates expression of
tissue-specific genes (e.g. lung, intestine) (Hellqvist
et al., 1996; Mahlapuu et al., 1998; Costa et al.,
2001; Ormestad et al., 2006; Madison et al., 2009).
Expression
According to published literature, the FOXF1
transcription factor has been identified to be highly
expressed in the normal human prostate transition
zone and benign prostate hyperplasia (BPH), but
decreasingly expressed in prostate cancer (Watson
et al., 2004; van der Heul-Nieuwenhuijsen et al.,
2009). FOXF1 is expressed in normal breast ductal
epithelial cells and basal-like breast cancer cells,
but is silenced in luminal breast cancer cells mainly
through the epigenetic mechanism (Lo et al., 2010;
Nilsson et al., 2010). FOXF1 expression is detected
in cancer-associated fibroblasts of human lung
cancer and its expression is associated with
activation of hedgehog signaling (Saito et al.,
2010). Upregulation of FOXF1 expression is also
found in PTCH1-associated rhabdomyosarcoma
(Wendling et al., 2008).
Localisation
Localized in the nucleus.
Function
The biological roles of forkhead box protein F1
were mostly studied in murine genetic models and
are linked to regulate embryogenesis and
organogenesis (Mahlapuu et al., 2001a; Costa et al.,
2001; Kalinichenko et al., 2001; Mahlapuu et al.,
2001b; Kalinichenko et al., 2002; Lim et al., 2002;
Ormestad et al., 2006; Astorga and Carlsson, 2007;
Yu et al., 2010). However, the functional roles of
the human FOXF1 protein are still largely
unknown. Some of published studies indicate that
FOXF1 participates in regulation of the following
normal and abnormal cellular processes:
The role of FOXF1 in an Epithelial-to-
Mesenchymal Transition (EMT): FOXF1 has
been found to be a direct repressed target of nuclear
factor 1-C2 (NF1-C2) whose expression is lost
during mammary tumor progression and is almost
absent from lymph node metastases (Nilsson et al.,
2010). FOXF1 is preferentially expressed in breast
cancer cell lines with a mesenchymal phenotype
and its ectopic overexpression in mammary
epithelial cells induces mesenchymal traits,
increased invasiveness in vitro and enhanced
xenograft tumorigenesis in vivo (Nilsson et al.,
2010). Hence FOXF1 is proposed to promote
invasion and metastasis.
The oncogenic role of FOXF1 in lung cancer-
associated fibroblasts: FOXF1 is found to be
expressed in cancer-associated fibroblasts of human
lung cancer and associated with activation of
hedgehog signaling (Saito et al., 2010). Gain- and
loss-of-function studies of FOXF1 in fibroblasts
show that FOXF1 is implicated in regulating the
contractility of fibroblasts and abilities of
fibroblasts to produce hepatocyte growth factor as
well as fibroblast growth factor-2 and to stimulate
migration of lung cancer epithelial cells (Saito et
al., 2010). The expression status of FOXF1 in
fibroblasts positively correlates with the ability of
fibroblasts to enhance xenograft tumor growth
(Saito et al., 2010). These findings suggest that
hedgehog-dependent FOXF1 is a clinically relevant
factor to grant oncogenic abilities to cancer-
associated fibroblasts for propelling development of
lung cancer.
The role of FOXF1 in regulation of cell cycle
progression: FOXF1 has been identified as a target
of epigenetic inactivation in breast cancer (Lo et al.,
2010). Ectopic reexpression of FOXF1 in FOXF1-
negative breast cancer cells induces cell growth
arrest by inhibition of the CDK2-RB-E2F cascade
(Lo et al., 2010). FOXF1 knockdown studies of
FOXF1-expressing breast cancer epithelial cells
revealed that FOXF1 is indispensable for
maintaining the stringency of DNA replication and
genomic stability by negatively modulating
expression of E2F target genes which are involved
in promoting the progression of S and G2 phases
(Lo et al., 2010; Lo et al., 2012). These lines of
evidence suggest that FOXF1 is an epigenetically
silenced tumor suppressor gene in breast cancer,
which is essential for maintaining genomic stability
by regulating the stringency of DNA replication.
Homology
- Pan troglodytes (chimpanzee), FOXF1
(XP_523449.2, 535 aa), 99% identity;
- Canis lupus (dog), FOXF1 (XP_546792.2, 354
aa), 95% identity;
- Bos taurus (cattle), FOXF1 (XP_603148.3, 382
aa), 96% identity;
- Mus musculus (mouse), Foxf1a (NP_034556.1,
353 aa), 94% identity;
- Gallus gallus (chicken), FOXF1 (XP_414186.2,
368 aa), 91% identity;
![Page 34: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/34.jpg)
FOXF1 (forkhead box F1) Lo PK
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 468
- Danio rerio (zebrafish), Foxf1 (NP_001073655.1,
380 aa), 81% identity.
Mutations
Note
Four different heterozygous mutations (frameshift,
nonsense, and non-stop) have been identified in the
FOXF1 gene in unrelated patients with sporadic
ACD/MPV (alveolar capillary dysplasia with
misalignment of pulmonary veins) and MCA
(multiple congenital anomalies) (Stankiewicz et al.,
2009). The point mutations identified in the FOXF1
gene are associated with bowel malrotation, annular
pancreas, duodenal stenosis, congenital short
bowel, small omphalocele and Meckel's
diverticulum (Stankiewicz et al., 2009).
Implicated in
Breast cancer
Oncogenesis
Loss or downregulation of FOXF1 expression is
found to be associated with FOXF1 promoter
hypermethylation in breast cancer cell lines and in
breast invasive ductal carcinomas (Lo et al., 2010).
According to analysis of 117 invasive ductal
carcinoma (IDC) cases, FOXF1 promoter was
hypermethylated in 37,6% of examined IDC cases,
which was associated with high tumor grade (Lo et
al., 2010). The gain- and loss-of-function studies of
FOXF1 in breast cancer cells indicate that FOXF1
plays an imperative role in maintaining the
stringency of DNA replication for sustaining
genomic stability (Lo et al., 2010; Lo et al., 2012).
These clinical correlation and cellular functional
studies suggest that FOXF1 is a potential tumor
suppressor gene which is epigenetically silenced in
breast cancer.
Lung cancer
Oncogenesis
Immunohistochemical (IHC) staining of FOXF1 is
found to be positive in nuclei of lung cancer-
associated fibroblasts (CAFs) (Saito et al., 2010).
The frequency of positivity of FOXF1 IHC staining
in CAFs is 110 (44,5%) out of 247 cases examined
(Saito et al., 2010). The IHC studies exhibited
stronger FOXF1 staining in the stromal cells
adjacent to lung tumor cells compared with those
further apart from the tumor cells. FOXF1
expression in CAFs is not significantly associated
with any particular histologic subtypes of lung
cancer and also does not correlate with survival in
the overall population. However, lung cancer
patients from the female population or from the
large cell lung cancer population show positive
correlation between FOXF1 expression in CAFs
and predicted poor prognosis (Saito et al., 2010).
These IHC studies, in combination with in vitro
functional studies of FOXF1 in fibroblasts (Saito et
al., 2010), suggest that FOXF1 plays an oncogenic
role in CAF-stimulated lung tumorigenesis.
Prostate cancer
Oncogenesis
FOXF1 expression is lost or downregulated in
prostate cancer compared with normal prostate
tissue (Watson et al., 2004; van der Heul-
Nieuwenhuijsen et al., 2009). This suggests that
FOXF1 is a putative tumor suppressor gene in
prostate cancer.
Nevoid basal cell carcinoma syndrome
Disease
Patients with nevoid basal cell carcinoma syndrome
(NBCCS) carry germline mutation in the tumor
suppressor gene Patched 1 (PTCH1) and are
predisposed to develop basal cell carcinoma (BCC),
medulloblastoma (MB) and rhabdomyosarcoma
(RMS).
Oncogenesis
FOXF1 expression is found to be aberrantly
upregulated in NBCCS-associated tumors
compared with the respective non-neoplastic tissue
(Wendling et al., 2008). Overexpression of FOXF1
is accompanied by increased levels of the hedgehog
target Gli1 as well as the putative FOXF1 targets
Bmi1 and Notch2 in NBCCS-associated tumors
(Wendling et al., 2008). These findings suggest a
key role for FOXF1 in hedgehog-associated
tumorigenesis.
Idiopathic interstitial pneumonias
Disease
The idiopathic interstitial pneumonias (IIP)
represent a set of diffuse parenchymal lung
disorders and are sub-classified into usual
interstitial pneumonitis (UIP), nonspecific
interstitial pneumonitis (NSIP) and the fibrotic
variant of NSIP (NSIP-F).
Examination of surgical and autopsy specimens
from 13 patients with either UIP or NSIP-F has
revealed that all of UIP cases exhibited a pattern of
strong SHH (a hedgehog ligand) expression with
weak FOXF1 expression and NSIP-F cases
displayed a complementary expression of SHH and
FOXF1 (Coon et al., 2006). These studies suggest
that morphogenetic genes (e.g. FOXF1) may
participate differentially in the pathogenesis of UIP
and NSIP-F.
Alveolar capillary dysplasia with misalignment of pulmonary veins
Disease
Alveolar capillary dysplasia with misalignment of
pulmonary veins (ACD/MPV) is a rare, neonatally
lethal developmental disorder of the lung with
defining histologic abnormalities typically
![Page 35: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/35.jpg)
FOXF1 (forkhead box F1) Lo PK
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 469
associated with multiple congenital anomalies
(MCA). Infants with ACD/MPV develop
respiratory distress and severe pulmonary
hypertension within the first two days of life.
ACD/MPV-affected infants mostly can not survive
within the first month of life due to no sustained
response to supportive measures and respiratory
failure. More than 80% of infants with ACD/MPV
have additional malformations occurring in the
cardiac, gastrointestinal, and genitourinary systems.
Intestinal malrotation is the most commonly
observed of these anomalies, and hypoplastic left
heart together with hypoplasia or coarctation of the
aortic arch are the most common associated
cardiovascular abnormalities. Of almost 200
reported ACD/MPV cases, approximately 10%
have a familial association. Four distinct
heterozygous mutations (frameshift, nonsense, and
no-stop) were identified in the FOXF1 gene in
unrelated 18 patients with sporadic ACD/MPV and
MCA (Stankiewicz et al., 2009), suggesting that an
impairment in the FOXF1 function might lead to
these observed developmental disorders.
References Hellqvist M, Mahlapuu M, Samuelsson L, Enerbäck S, Carlsson P. Differential activation of lung-specific genes by two forkhead proteins, FREAC-1 and FREAC-2. J Biol Chem. 1996 Feb 23;271(8):4482-90
Mahlapuu M, Pelto-Huikko M, Aitola M, Enerbäck S, Carlsson P. FREAC-1 contains a cell-type-specific transcriptional activation domain and is expressed in epithelial-mesenchymal interfaces. Dev Biol. 1998 Oct 15;202(2):183-95
Costa RH, Kalinichenko VV, Lim L. Transcription factors in mouse lung development and function. Am J Physiol Lung Cell Mol Physiol. 2001 May;280(5):L823-38
Kalinichenko VV, Lim L, Stolz DB, Shin B, et al.. Defects in pulmonary vasculature and perinatal lung hemorrhage in mice heterozygous null for the Forkhead Box f1 transcription factor. Dev Biol. 2001 Jul 15;235(2):489-506
Mahlapuu M, Enerbäck S, Carlsson P. Haploinsufficiency of the forkhead gene Foxf1, a target for sonic hedgehog signaling, causes lung and foregut malformations. Development. 2001a Jun;128(12):2397-406
Mahlapuu M, Ormestad M, Enerbäck S, Carlsson P. The forkhead transcription factor Foxf1 is required for differentiation of extra-embryonic and lateral plate mesoderm. Development. 2001b Jan;128(2):155-66
Kalinichenko VV, Zhou Y, Bhattacharyya D, Kim W, Shin B, Bambal K, Costa RH. Haploinsufficiency of the mouse Forkhead Box f1 gene causes defects in gall bladder development. J Biol Chem. 2002 Apr 5;277(14):12369-74
Lim L, Kalinichenko VV, Whitsett JA, Costa RH. Fusion of lung lobes and vessels in mouse embryos heterozygous for the forkhead box f1 targeted allele. Am J Physiol Lung Cell Mol Physiol. 2002 May;282(5):L1012-22
Watson JE, Doggett NA, Albertson DG, et al.. Integration of high-resolution array comparative genomic hybridization analysis of chromosome 16q with expression array data refines common regions of loss at 16q23-qter and
identifies underlying candidate tumor suppressor genes in prostate cancer. Oncogene. 2004 Apr 22;23(19):3487-94
Kim IM, Zhou Y, Ramakrishna S, Hughes DE, Solway J, Costa RH, Kalinichenko VV. Functional characterization of evolutionarily conserved DNA regions in forkhead box f1 gene locus. J Biol Chem. 2005 Nov 11;280(45):37908-16
Coon DR, Roberts DJ, Loscertales M, Kradin R. Differential epithelial expression of SHH and FOXF1 in usual and nonspecific interstitial pneumonia. Exp Mol Pathol. 2006 Apr;80(2):119-23
Ormestad M, Astorga J, Landgren H, Wang T, Johansson BR, Miura N, Carlsson P. Foxf1 and Foxf2 control murine gut development by limiting mesenchymal Wnt signaling and promoting extracellular matrix production. Development. 2006 Mar;133(5):833-43
Astorga J, Carlsson P. Hedgehog induction of murine vasculogenesis is mediated by Foxf1 and Bmp4. Development. 2007 Oct;134(20):3753-61
Wendling DS, Lück C, von Schweinitz D, Kappler R. Characteristic overexpression of the forkhead box transcription factor Foxf1 in Patched-associated tumors. Int J Mol Med. 2008 Dec;22(6):787-92
Madison BB, McKenna LB, Dolson D, Epstein DJ, Kaestner KH. FoxF1 and FoxL1 link hedgehog signaling and the control of epithelial proliferation in the developing stomach and intestine. J Biol Chem. 2009 Feb 27;284(9):5936-44
Stankiewicz P, Sen P, Bhatt SS, Storer M, Xia Z, et al.. Genomic and genic deletions of the FOX gene cluster on 16q24.1 and inactivating mutations of FOXF1 cause alveolar capillary dysplasia and other malformations. Am J Hum Genet. 2009 Jun;84(6):780-91
van der Heul-Nieuwenhuijsen L, Dits NF, Jenster G. Gene expression of forkhead transcription factors in the normal and diseased human prostate. BJU Int. 2009 Jun;103(11):1574-80
Lo PK, Lee JS, Liang X, Han L, Mori T, Fackler MJ, Sadik H, Argani P, Pandita TK, Sukumar S. Epigenetic inactivation of the potential tumor suppressor gene FOXF1 in breast cancer. Cancer Res. 2010 Jul 15;70(14):6047-58
Nilsson J, Helou K, Kovács A, Bendahl PO, Bjursell G, Fernö M, Carlsson P, Kannius-Janson M. Nuclear Janus-activated kinase 2/nuclear factor 1-C2 suppresses tumorigenesis and epithelial-to-mesenchymal transition by repressing Forkhead box F1. Cancer Res. 2010 Mar 1;70(5):2020-9
Saito RA, Micke P, Paulsson J, Augsten M, Peña C, Jönsson P, Botling J, Edlund K, Johansson L, Carlsson P, Jirström K, Miyazono K, Ostman A. Forkhead box F1 regulates tumor-promoting properties of cancer-associated fibroblasts in lung cancer. Cancer Res. 2010 Apr 1;70(7):2644-54
Yu S, Shao L, Kilbride H, Zwick DL. Haploinsufficiencies of FOXF1 and FOXC2 genes associated with lethal alveolar capillary dysplasia and congenital heart disease. Am J Med Genet A. 2010 May;152A(5):1257-62
Lo PK, Lee JS, Sukumar S. The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function. Cell Signal. 2012 Jan;24(1):316-24
This article should be referenced as such:
Lo PK. FOXF1 (forkhead box F1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):466-469.
![Page 36: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/36.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 470
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
FXYD3 (FXYD domain containing ion transport regulator 3) Hiroto Yamamoto, Shinji Asano
Department of Molecular Physiology, College of Pharmaceutical Sciences, Ritsumeikan University,
Kusatsu, Shiga 525-8577, Japan (HY, SA)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/FXYD3ID43704ch19q13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI FXYD3ID43704ch19q13.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: MAT8, PLML
HGNC (Hugo): FXYD3
Location: 19q13.12
Local order: Centromere, SCN1B, HPN, FXYD3,
LGI4, FXYD1, FXYD7, FXYD5, Telomere.
Note
FXYD3 is a member of the FXYD family proteins,
which regulate Na+,K+-ATPase activity to
precisely adjust the physiological ion balance of the
tissue.
DNA/RNA
Note
Morrison and Leder (1994) originally found that
FXYD3 mRNA was overexpressed in murine breast
cancer induced by neu or ras oncogenes, but not by
c-myc or int-2.
FXYD3 has two splicing variants (FXYD3a and
FXYD3b). FXYD3a and 3b are short and long
isoforms of FXYD3, respectively.
Description
DNA contains 8494 bp composed of 9 (FXYD3a)
or 8 (FXYD3b) exons.
Transcription
The FXYD3a mRNA has an in-frame deletion of 78
nucleotides in the coding sequence compared to the
FXYD3b mRNA.
FXYD3a mRNA is a major transcript product
expressed in normal tissues as well as in breast,
colon, stomach and pancreas cancer cells.
Transcription of FXYD3 mRNA was down-
regulated by TGF-b signaling in human mammary
epithelial cells (Yamamoto et al., 2011).
Pseudogene
No pseudogenes reported.
Red boxes represent shared exons between FXYD3a and FXYD3b, and a white box represents an exon specific for FXYD3b
![Page 37: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/37.jpg)
FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 471
Amino acid alignments of human FXYD3a and 3b proteins. An underline represents the FXYD (Phe-Xaa-Tyr-Asp) motif. A box represents the transmembrane segment. FXYD3b protein has 26 more amino acids in the cytoplasmic domain compared to
FXYD3a protein. .
Protein
Description
FXYD3 is a member of the "FXYD" family
proteins, which consist of seven members of small
proteins and share a signature sequence of four
amino acids "FXYD" located in the ectodomain
close to the transmembrane segment.
Human FXYD3 protein contains a hydrophobic
domain at the N terminus encoding a cleavable
signal peptide, and adopts a type I topology.
On the other hand, mouse FXYD3 may have two
transmembrane domains because of the lack of
cleavable signal peptide.
Expression
Mammary gland, lung, stomach, pancreas and
intestine.
Localisation
Plasma membrane and intracellular membrane
compartment.
Function
FXYD family proteins perform fine tuning of ion
transport by associating with and modulating the
pump activity of Na+,K+-ATPase molecules and
modifying the activity of ion channels (Geering,
2006).
FXYD3a slightly decreased the apparent affinity
both for intracellular Na+ (up to 40%) and
extracellular K+ (15 to 40%) of Na+,K+-ATPase
whereas FXYD3b slightly increased the apparent
affinity for intracellular Na+ (about 15%) and
decreased the apparent affinity for extracellular K+
(up to 50%).
Both FXYD3 isoforms induced a
hyperpolarization-activated chloride current in
Xenopus oocytes (Bibert et al., 2006). Two cysteine
residues at cytoplasmic domain of FXYD3 were
glutathionylated by oxidative stress.
As a result, glutathionylation of Na+,K+-ATPase
beta1 subunit by oxidative stress was prevented and
the pump activity of Na+,K+-ATPase was
maintained (Bibert et al., 2011). FXYD3 is
responsible for cancer cell proliferation.
Suppression of FXYD3 expression caused a
significant decrease in cellular proliferation of
breast, prostate and pancreatic cancer cell lines.
In colon cancer cell line Caco-2, silencing of
FXYD3 mRNA with shRNA specific for FXYD3
increased the apoptosis rate and inhibited the
differentiation to enterocyte-like phenotype (Bibert
et al., 2009).
Homology
FXYD family proteins have invariant amino acids
in a signature sequence of FXYD motif and two
conserved glycines and a serine residue (Sweadner
and Rael, 2000).
In mammals, this family contains seven members
including FXYD1 (phospholemman), FXYD2 (the
gamma-subunit of Na+,K+-ATPase), FXYD3 (Mat-
8), FXYD4 (corticosteroid hormone-induced
factor), FXYD5 (dysadherin), FXYD6
(phosphohippolin) and FXYD7. FXYD family
proteins are expressed in specific tissues to regulate
Na+,K+-ATPase activity, and precisely adjust the
physiological ion balance of the tissues.
Mutations
Somatic
Okudela et al. (2009) showed that somatic mutation
(D19H) occurred only in a lung cancer cell line,
H2087.
This mutation is very rare in lung cancer cell lines
and primary lung cancers.
Exogenous expression of wild-type FXYD3, but
not the mutant (FXYD3/D19H), enhanced the
cortical actin density in a lung cancer cell line,
H1299.
FXYD3/D19H distorted the outline of nuclear
envelope in H1299 cells, suggesting that loss of
FXYD3 function attenuates the integrity of the
nuclear envelope and the cytoskeleton.
![Page 38: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/38.jpg)
FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 472
Implicated in
Breast cancer
Note
Down-regulation of FXYD3 mRNA via siRNA for
FXYD3 decreased the proliferation of MCF-7
breast cancer cells.
Disease
Yamamoto et al. (2009) reported that FXYD3
protein was overexpressed in human breast cancer
specimens; invasive ductal carcinomas and intra-
ductal carcinomas compared with surrounding
normal mammary glands. On the other hand,
FXYD3 expression was low in benign lesion
specimens; mastopathy, fibroadenoma and
phyllodes tumors. Distribution pattern of FXYD3
expression was divided into two groups. In one
group, expression was observed mainly in the
cytoplasm. In the other group, expression was
observed both in the cytoplasm and at the cell
surface.
Pancreas cancer
Note
Down-regulation of FXYD3 mRNA by stable
antisense transfection decreased the proliferation of
T3M4 pancreatic cancer cells.
Disease
Kayed et al. (2006) reported that FXYD3 was
overexpressed in pancreatic cancer, and contributed
to its proliferative activity and malignancy. There
was no significant difference in FXYD3 mRNA
expression levels between chronic pancreatitis and
normal pancreatic tissues whereas FXYD3 mRNA
levels were 3.9-fold increased in pancreatic ductal
adenocarcinoma cells compared to normal ductal
cells. FXYD3 protein expression was almost absent
in normal pancreatic tissues. In contrast, chronic
pancreatitis and pancreatic ductal adenocarcinoma
tissues showed up-regulation of FXYD3 protein
which was expressed in cytoplasm and plasma
membrane. Pancreas cancer cells that had
metastasized to the liver and regional lymph nodes
also exhibited strong expression of FXYD3 protein.
Urothelial carcinoma
Disease
Zhang et al. (2011) reported FXYD3 mRNA as a
promising prognosis marker of renal and bladder
urothelial carcinoma (UC). Microarray gene
expression data showed that FXYD3 mRNA was
increased in UC whereas it was not observed in
normal kidney tissues and other type of tumors
including papillary, oncocytoma, chromophobe,
and clear cell renal carcinoma. FXYD3 protein was
expressed in about 90% of UC from renal pelvis,
and 63% of UC from bladder, however, it was not
expressed in normal kidney and bladder stromal
tissues.
Prognosis
Martin-Aguilera et al. (2008) reported that a
combination of FXYD3 and KRT20 (a member of
the keratin family) genes yielded a 100% sensitivity
and specificity differentiating lymph nodes with
bladder UC dissemination from controls. However,
there was no significantly worse survival of patients
presenting qRT-PCR positive compared to negative
lymph nodes after a median follow-up of 35
months.
Lung cancer
Disease
Okudela et al. (2009) reported that FXYD3 mRNA
and protein levels were down-regulated in some
lung cancer cell lines. Epigenetic modifications
such as DNA methylation and histone acethylation
seem to affect FXYD3 expression. In normal lung
epithelial cells, FXYD3 protein was extensively
expressed on the basolateral membrane of bronchial
epithelial cells, and in cytoplasm where it was
concentrated at the perinuclear site of alveolar
epithelial cells. In lung cancer, particularly in
poorly differentiated cancers, FXYD3 expression
was low or faint. Down-regulation of FXYD3 was
more prominent in large cell carcinomas and small
cell carcinomas than in adenocarcinomas. FXYD3
expression was decreased significantly as the
histological grade of squamous cell carcinoma
progressed from well to poorly differentiated.
Prostate cancer
Note
Grzmil et al. (2004) reported that FXYD3 (MAT-8)
plays an important role in cellular growth of
prostate carcinomas. In prostate tumors (6 out of
11), FXYD3 mRNA expression was increased (> 2
times) up to 35-fold compared to normal tissues.
FXYD3 mRNA was also expressed in prostate
cancer cell lines, PC3, DU-145 and LNCaP.
Silencing of FXYD3 mRNA via siRNA specific for
FXYD3 led to significant decrease in proliferation
of PC3 and LNCaP.
Colon cancer
Disease
Kayed et al. (2006) showed that FXYD3 mRNA
expression was decreased in colon cancers (n=40)
compared to normal colon tissues (n=27). Widegren
et al. (2009) reported that FXYD3 seems to be
involved in the development of the relatively earlier
stages of colorectal cancers. FXYD3 protein
expression was significantly higher in primary
tumor compared to adjacent normal mucosa in the
matched cases, while there was no significant
difference in the expression between primary tumor
and metastasis in the lymph nodes. FXYD3 protein
expression was positively related to the expression
of Ras, P53, Legumain and proliferative cell
nuclear antigen. Although FXYD3 expression in
![Page 39: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/39.jpg)
FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 473
Dukes stage A-C tumors was higher than that in
stage D tumors, there was no relationship between
FXYD3 expression and survival in the whole group
of the patients.
Prognosis
Loftas et al. (2009) reported that in rectal cancers,
FXYD3 expression was a prognosis factor
independent of tumor stage and differentiation in
patients receiving preoperative radiotherapy: strong
expression was associated with an unfavorable
prognosis. In the primary tumors, FXYD3
expression was increased compared with normal
mucosa. There were less tumor necrosis and a
higher rate of developing distant metastasis after
radiotherapy in tumors with high FXYD3
expression.
Gastric cancer
Disease
Zhu et al. (2010) reported that up-regulation of
FXYD3 protein expression seems to be involved in
tumorigenesis and invasion of gastric
adenocarcinoma. FXYD3 protein was present in the
cytoplasm of normal gastric epithelial cells as well
as gastric cancer cells. The rate of FXYD3 strong
expression was significantly higher in cancer (51%
of 51) than in normal mucosa (10% of 29). FXYD3
was expressed strongly in ulcerative/infiltrating
types of cancers compared to polypoid/fungating
ones. However, FXYD3 expression was not
correlated with patient's gender, age, tumor size,
lymph node status and histological grade.
Glioma
Disease
Wang et al. (2009) reported that FXYD3 expression
seems to be involved in glioma development. The
frequency of strong FXYD3 expression was higher
in the primary tumors compared to normal brain
tissues. FXYD3 expression was significantly more
increased in females than males, and in multiple
site gliomas than single sites. There was no
difference of FXYD3 expression regarding age,
tumor location, size, histological type, and tumor
grade.
References Morrison BW, Leder P. neu and ras initiate murine mammary tumors that share genetic markers generally absent in c-myc and int-2-initiated tumors. Oncogene. 1994 Dec;9(12):3417-26
Morrison BW, Moorman JR, Kowdley GC, Kobayashi YM, Jones LR, Leder P. Mat-8, a novel phospholemman-like protein expressed in human breast tumors, induces a chloride conductance in Xenopus oocytes. J Biol Chem. 1995 Feb 3;270(5):2176-82
Sweadner KJ, Rael E. The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression. Genomics. 2000 Aug 15;68(1):41-56
Grzmil M, Voigt S, Thelen P, Hemmerlein B, Helmke K, Burfeind P. Up-regulated expression of the MAT-8 gene in prostate cancer and its siRNA-mediated inhibition of expression induces a decrease in proliferation of human prostate carcinoma cells. Int J Oncol. 2004 Jan;24(1):97-105
Crambert G, Li C, Claeys D, Geering K. FXYD3 (Mat-8), a new regulator of Na,K-ATPase. Mol Biol Cell. 2005 May;16(5):2363-71
Bibert S, Roy S, Schaer D, Felley-Bosco E, Geering K. Structural and functional properties of two human FXYD3 (Mat-8) isoforms. J Biol Chem. 2006 Dec 22;281(51):39142-51
Geering K. FXYD proteins: new regulators of Na-K-ATPase. Am J Physiol Renal Physiol. 2006 Feb;290(2):F241-50
Kayed H, Kleeff J, Kolb A, Ketterer K, Keleg S, Felix K, Giese T, Penzel R, Zentgraf H, Büchler MW, Korc M, Friess H. FXYD3 is overexpressed in pancreatic ductal adenocarcinoma and influences pancreatic cancer cell growth. Int J Cancer. 2006 Jan 1;118(1):43-54
Marín-Aguilera M, Mengual L, Burset M, Oliver A, Ars E, Ribal MJ, Colomer D, Mellado B, Villavicencio H, Algaba F, Alcaraz A. Molecular lymph node staging in bladder urothelial carcinoma: impact on survival. Eur Urol. 2008 Dec;54(6):1363-72
Bibert S, Aebischer D, Desgranges F, Roy S, Schaer D, Kharoubi-Hess S, Horisberger JD, Geering K. A link between FXYD3 (Mat-8)-mediated Na,K-ATPase regulation and differentiation of Caco-2 intestinal epithelial cells. Mol Biol Cell. 2009 Feb;20(4):1132-40
Loftås P, Onnesjö S, Widegren E, Adell G, Kayed H, Kleeff J, Zentgraf H, Sun XF. Expression of FXYD-3 is an independent prognostic factor in rectal cancer patients with preoperative radiotherapy. Int J Radiat Oncol Biol Phys. 2009 Sep 1;75(1):137-42
Okudela K, Yazawa T, Ishii J, Woo T, Mitsui H, Bunai T, Sakaeda M, Shimoyamada H, Sato H, Tajiri M, Ogawa N, Masuda M, Sugimura H, Kitamura H. Down-regulation of FXYD3 expression in human lung cancers: its mechanism and potential role in carcinogenesis. Am J Pathol. 2009 Dec;175(6):2646-56
Wang MW, Gu P, Zhang ZY, Zhu ZL, Geng Y, Kayed H, Zentgraf H, Sun XF. FXYD3 expression in gliomas and its clinicopathological significance. Oncol Res. 2009;18(4):133-9
Widegren E, Onnesjö S, Arbman G, Kayed H, Zentgraf H, Kleeff J, Zhang H, Sun XF. Expression of FXYD3 protein in relation to biological and clinicopathological variables in colorectal cancers. Chemotherapy. 2009;55(6):407-13
Yamamoto H, Okumura K, Toshima S, Mukaisho K, Sugihara H, Hattori T, Kato M, Asano S. FXYD3 protein involved in tumor cell proliferation is overproduced in human breast cancer tissues. Biol Pharm Bull. 2009 Jul;32(7):1148-54
Zhu ZL, Zhao ZR, Zhang Y, Yang YH, Wang ZM, Cui DS, Wang MW, Kleeff J, Kayed H, Yan BY, Sun XF. Expression and significance of FXYD-3 protein in gastric adenocarcinoma. Dis Markers. 2010;28(2):63-9
Bibert S, Liu CC, Figtree GA, Garcia A, Hamilton EJ, Marassi FM, Sweadner KJ, Cornelius F, Geering K, Rasmussen HH. FXYD proteins reverse inhibition of the Na+-K+ pump mediated by glutathionylation of its beta1 subunit. J Biol Chem. 2011 May 27;286(21):18562-72
Yamamoto H, Mukaisho K, Sugihara H, Hattori T, Asano S. Down-regulation of FXYD3 is induced by transforming
![Page 40: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/40.jpg)
FXYD3 (FXYD domain containing ion transport regulator 3) Yamamoto H, Asano S
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 474
growth factor-β signaling via ZEB1/δEF1 in human mammary epithelial cells. Biol Pharm Bull. 2011 Mar;34(3):324-9
Zhang Z, Pang ST, Kasper KA, Luan C, Wondergem B, Lin F, Chuang CK, Teh BT, Yang XJ. FXYD3: A Promising Biomarker for Urothelial Carcinoma. Biomark Insights. 2011 Feb 15;6:17-26
This article should be referenced as such:
Yamamoto H, Asano S. FXYD3 (FXYD domain containing ion transport regulator 3). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):470-474.
![Page 41: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/41.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 475
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
MCAM (melanoma cell adhesion molecule) Guang-Jer Wu
Department of Microbiology and Immunology, Emory University School of Medicine, 1510, Clifton
Rd NE, Atlanta, GA 30322, USA; Department of Bioscience Technology, Chung Yuan Christian
University, 200 Chung Pei Rd, 32023 Taiwan, Republic of China (GJW)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/MCAMID41314ch11q23.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MCAMID41314ch11q23.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: CD146, METCAM, MUC18,
Gicerin
HGNC (Hugo): MCAM
Location: 11q23.3
DNA/RNA
Description
Human METCAM (huMETCAM), a CAM in the
immunoglobulin-like gene superfamily, is an
integral membrane glycoprotein. Alternative names
for METCAM are MUC18 (Lehmann et al., 1987),
CD146 (Anfosso et al., 2001), MCAM (Xie et al.,
1997), MelCAM (Shih et al., 1994a), A32 (Shih et
al., 1994b), and S-endo 1 (Bardin et al., 1996).
To avoid confusion with mucins and to reflect its
biological functions, we have renamed MUC18 as
METCAM (metastasis CAM), which means an
immunoglobulin-like CAM that affects or regulates
metastasis, (Wu, 2005). METCAM/MUC18 gene is
located on human chromosome 11q23.3.
Transcription
The major transcript of the gene in most human
epithelial cancer cell lines is about 3,3 kb (Wu et
al., 2001a).
A distinct short form resulting from alternative
splicing of the gene of gicerin, the chicken homolog
of METCAM, has been found (Taira et al., 1995).
Though the expression of a short form of
METCAM has been briefly mentioned in human
melanoma cells (Lehmann et al., 1987), its function
is not known since it is expressed at a much lower
level than the major
form in various cancer cell lines (Wu, unpublished
observation). Interestingly, a truncated form with a
deletion in some portion of the cytoplasmic domain
has been found in a prostate cancer specimen
X9479, a cell line derived from specimens of
nasopharyngeal carcinomas and other cancers (Wu,
unpublished observations).
Further systematic search for the function of this
minor form should be carried out.
Pseudogene
METCAM/MUC18 may not have a pseudogene.
Protein
Note
Human METCAM/MUC18 cDNA encodes 646
amino acids, about 115-150 kDa protein.
Description
The huMETCAM has 646 amino acids that include
a N-terminal extra-cellular domain of 558 amino
acids, which has 28 amino acids characteristics of a
signal peptide sequence at its N-terminus, a
transmembrane domain of 24 amino acids (amino
acids 559-583), and a cytoplasmic domain of 64
amino acids at the C-terminus. HuMETCAM has
eight putative N-glycosylation sites (Asn-X-
Ser/Thr), of which six are conserved, and are
heavily glycosylated and sialylated resulting in an
apparent molecular weight of 113000-150000.The
extra-cellular domain of the protein comprises five
immunoglobulin-like domains (V-V-C2-C2-C2)
(Lehmann et al., 1987; Wu et al., 2001a; Wu, 2005)
and an X domain (Wu et al., 2001a; Wu, 2005).
![Page 42: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/42.jpg)
MCAM (melanoma cell adhesion molecule) Wu GJ
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 476
HuMETCAM protein structure. SP stands for signal peptide sequence, V1, V2, C2, C2', C2'' for five Ig-like domains (each held by a disulfide bond) and X for one domain (without any disulfide bond) in the extracellular region, and TM for transmembrane domain. P stands for five potential phosphorylation sites (one for PKA, three for PKC, and one for CK2) in the cytoplasmic tail. The six conserved N-glycosylation sites are shown as wiggled lines in the extracellular domains of V1, between C2' and C2'',
C2'', and X.
The cytoplasmic tail contains peptide sequences
that will potentially be phosphorylated by protein
kinase A (PKA), protein kinase C (PKC), and
casein kinase 2 (CK 2) (Lehmann et al., 1987; Wu
et al., 2001a; Wu, 2005). My lab has also cloned
and sequenced the mouse METCAM
(moMETCAM) cDNA, which contains 648 amino
acids with a 76,2% identity with huMETCAM,
suggesting that moMETCAM is likely to have
biochemical properties and biological functions
similar to the human counter part (Yang et al.,
2001; Wu, 2005).
The structure of the huMETCAM protein is
depicted in figure above, suggesting that
METCAM, similar to most CAMs, plays an active
role in mediating cell-cell and cell-extracellular
interactions, crosstalk with many intracellular
signaling pathways, and modulating the social
behaviors of cells (Cavallaro and Christofori, 2004;
Wu, 2005). Recent work supports an emerging
novel function of METCAM in tumor angiogenesis
and perhaps it plays an important role in the
metastasis of tumor cells (Wu, 2010; Wu, 2012).
Expression
HuMETCAM is expressed in a limited number of
normal tissues, such as hair follicular cells, smooth
muscle cells, endothelial cells, cerebellum, normal
mammary epithelial cells, basal cells of the lung,
activated T cells, intermediate trophoblast (Shih,
1999), and normal nasopharyngeal epithelial cells
(Lin et al., 2012).
Localisation
HuMETCAM is a cytoplasmic membrane protein.
Most of the protein is located on the cell membrane
in normal tissues. However, increasing presence of
the protein in the cytoplasm appears to be related to
the higher pathological grades and malignant
cancers of prostate and breast, and melanoma and
nasopharyngeal carcinoma (Wu et al., 2001b).
Function
Similar to other cell adhesion molecules (CAMs),
METCAM/MUC18 does not merely act as a
molecular glue to hold together homotypic cells in a
specific tissue or to facilitate interactions of
heterotypic cells; It also actively governs the social
behaviors of cells by affecting the adhesion status
of cells and modulating cell signaling (Cavallaro
and Christofori, 2004).
It controls cell motility and invasiveness by
mediating the remodeling of cytoskeleton
(Cavallaro and Christofori, 2004).
It also actively mediates the cell-to-cell and cell-to-
extracellular matrix interactions to allow cells to
constantly respond to physiological fluctuations and
to alter/remodel the surrounding microenvironment
for survival (Chambers et al., 2002).
It does so by crosstalk with cellular surface growth
factor receptors, which interact with growth factors
that may be secreted from stromal cells or released
from circulation and embedded in the extracellular
matrix (Chambers et al., 2002; Cavallaro and
Christofori, 2004).
Thus an altered expression of METCAM/MUC18
affects the motility and invasiveness of many
epithelial tumor cells in vitro and metastasis in vivo
(Chambers et al., 2002; Cavallaro and Christofori,
2004; Wu, 2005). METCAM/MUC18 may also
play an important role in the favorable soil that
provides a proper microenvironment at a suitable
period to awaken the dormant metastatic tumor
cells to enter into an aggressive growth phase.
Evidence have been documented that aberrant
expression of huMETCAM/MUC18 actually affects
the motility and invasiveness of many tumor cells
in vitro and metastasis in vivo.
Thus HuMETCAM/MUC18 plays an important
role in promoting the malignant progression of
many cancer types (Cavallaro and Christofori,
2004; Wu, 2005).
![Page 43: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/43.jpg)
MCAM (melanoma cell adhesion molecule) Wu GJ
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 477
Homology
Human METCAM/MUC18 protein shares high
homology with the mouse METCAM/MUC18 (Wu
et al., 2001a; Yang et al., 2001) and other Ig-like
CAMs, especially the NCAMs (Lehmann et al.,
1987).
Mutations
Note
Several point mutations have been found in
huMETCAM/MUC18 protein from human cancers
(Wu et al., 2001a).
Implicated in
Various cancers
Note
The protein is overly expressed in most (67%)
malignant melanoma cells (Lehmann et al., 1987),
and in most (more than 80%) pre-malignant
prostate epithelial cells (PIN), high-grade prostatic
carcinoma cells, and metastatic lesions (Wu et al.,
2001b; Wu, 2004). HuMETCAM is also expressed
in other cancers, such as gestational trophoblastic
tumors, leiomyosarcoma, angiosarcoma,
haemangioma, Kaposi's sarcoma, schwannoma,
some lung squamous and small cell carcinomas,
some breast cancer, some neuroblastoma (Shih,
1999), and also nasopharyngeal carcinoma (Lin et
al., 2012) and ovarian cancer (Wu et al., 2012).
Breast cancer
Note
Over-expression of huMETCAM has been shown
to promote tumorigenesis of four breast cancer cell
lines in athymic nude mice and perhaps the
malignant progression of breast cancer cells (Zeng
et al., 2011; Zeng et al., 2012).
Prognosis
Over-expression of huMETCAM/MUC18 has been
implicated in a poor prognosis of breast cancer.
Prostate cancer
Note
Over-expression of huMETCAM has been shown
to promote tumorigenesis and metastasis of human
prostate cancer LNCaP cells in athymic nude mice
(Wu et al., 2001a; Wu et al., 2001b; Wu, 2004; Wu
et al., 2004; Wu et al., 2011).
Disease
Human prostate cancer (Wu et al., 2001a; Wu et al.,
2001b; Wu, 2004; Wu et al., 2004; Wu et al., 2011)
and the TRAMP models (Wu et al., 2005).
Prognosis
Over-expression of huMETCAM/MUC18 has been
implicated in a poor prognosis of prostate cancer
(Wu et al., 2001a; Wu et al., 2001b, Wu, 2004).
Oncogenesis
METCAM/MUC18 promotes the oncogenesis of
human prostate cancer cells (Wu et al., 2001a; Wu
et al., 2001b; Wu, 2004; Wu et al., 2004; Wu et al.,
2011).
Melanoma
Note
Over-expression of huMETCAM has been shown
to promote metastasis, but not the tumorigenesis, of
human melanoma (Xie et al., 1997; Schlagbauer-
Wadl et al., 1999) and mouse melanoma cells
(Yang et al., 2001; Wu et al., 2008) in
immunodeficent nude mice.
Prognosis
Over-expression of huMETCAM/MUC18 has been
implicated in a poor prognosis of melanoma
(Lehmann et al., 1987; Shih, 1999).
Oncogenesis
METCAM does not appear to promote the
oncogenesis of human and most melanoma cells
(Wu et al., 2008).
References Lehmann JM, Riethmüller G, Johnson JP. MUC18, a marker of tumor progression in human melanoma, shows sequence similarity to the neural cell adhesion molecules of the immunoglobulin superfamily. Proc Natl Acad Sci U S A. 1989 Dec;86(24):9891-5
Shih IM, Elder DE, Hsu MY, Herlyn M. Regulation of Mel-CAM/MUC18 expression on melanocytes of different stages of tumor progression by normal keratinocytes. Am J Pathol. 1994a Oct;145(4):837-45
Shih IM, Elder DE, Speicher D, Johnson JP, Herlyn M. Isolation and functional characterization of the A32 melanoma-associated antigen. Cancer Res. 1994b May 1;54(9):2514-20
Taira E, Nagino T, Taniura H, Takaha N, Kim CH, Kuo CH, Li BS, Higuchi H, Miki N. Expression and functional analysis of a novel isoform of gicerin, an immunoglobulin superfamily cell adhesion molecule. J Biol Chem. 1995 Dec 1;270(48):28681-7
Bardin N, George F, Mutin M, Brisson C, Horschowski N, Francés V, Lesaule G, Sampol J. S-Endo 1, a pan-endothelial monoclonal antibody recognizing a novel human endothelial antigen. Tissue Antigens. 1996 Nov;48(5):531-9
Xie S, Luca M, Huang S, Gutman M, Reich R, Johnson JP, Bar-Eli M. Expression of MCAM/MUC18 by human melanoma cells leads to increased tumor growth and metastasis. Cancer Res. 1997 Jun 1;57(11):2295-303
Schlagbauer-Wadl H, Jansen B, Müller M, Polterauer P, Wolff K, Eichler HG, Pehamberger H, Konak E, Johnson JP. Influence of MUC18/MCAM/CD146 expression on human melanoma growth and metastasis in SCID mice. Int J Cancer. 1999 Jun 11;81(6):951-5
Shih IM. The role of CD146 (Mel-CAM) in biology and pathology. J Pathol. 1999 Sep;189(1):4-11
Anfosso F, Bardin N, Vivier E, Sabatier F, Sampol J, Dignat-George F. Outside-in signaling pathway linked to CD146 engagement in human endothelial cells. J Biol Chem. 2001 Jan 12;276(2):1564-9
![Page 44: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/44.jpg)
MCAM (melanoma cell adhesion molecule) Wu GJ
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 478
Wu GJ, Wu MW, Wang SW, Liu Z, Qu P, Peng Q, Yang H, Varma VA, Sun QC, Petros JA, Lim SD, Amin MB. Isolation and characterization of the major form of human MUC18 cDNA gene and correlation of MUC18 over-expression in prostate cancer cell lines and tissues with malignant progression. Gene. 2001a Nov 14;279(1):17-31
Wu GJ, Varma VA, Wu MW, Wang SW, Qu P, Yang H, Petros JA, Lim SD, Amin MB. Expression of a human cell adhesion molecule, MUC18, in prostate cancer cell lines and tissues. Prostate. 2001b Sep 15;48(4):305-15
Yang H, Wang S, Liu Z, Wu MH, McAlpine B, Ansel J, Armstrong C, Wu G. Isolation and characterization of mouse MUC18 cDNA gene, and correlation of MUC18 expression in mouse melanoma cell lines with metastatic ability. Gene. 2001 Mar 7;265(1-2):133-45
Chambers AF, Groom AC, MacDonald IC. Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer. 2002 Aug;2(8):563-72
Cavallaro U, Christofori G. Cell adhesion and signalling by cadherins and Ig-CAMs in cancer. Nat Rev Cancer. 2004 Feb;4(2):118-32
Wu GJ.. The role of MUC18 in prostate carcinoma. Immunohistochemistry and in situ hybridization of human carcinoma. Vol 1. Molecular pathology, lung carcinoma, breast carcinoma, and prostate carcinoma. Hayat, M.A. (Ed.), Elsevier Science/Academic Press. 2004; Chapter 7:347-358.
Wu GJ, Peng Q, Fu P, Wang SW, Chiang CF, Dillehay DL, Wu MW.. Ectopical expression of human MUC18 increases metastasis of human prostate cancer cells. Gene. 2004 Mar 3;327(2):201-13.
Wu GJ.. METCAM/MUC18 expression and cancer metastasis. Current Genomics. 2005; 6:333-349. (REVIEW)
Wu GJ, Fu P, Chiang CF, Huss WJ, Greenberg NM, Wu MW.. Increased expression of MUC18 correlates with the metastatic progression of mouse prostate adenocarcinoma in the TRAMP model. J Urol. 2005 May;173(5):1778-83.
Wu GJ, Fu P, Wang SW, Wu MW.. Enforced expression of MCAM/MUC18 increases in vitro motility and invasiveness and in vivo metastasis of two mouse melanoma K1735 sublines in a syngeneic mouse model. Mol Cancer Res. 2008 Nov;6(11):1666-77.
Wu GJ.. METCAM/MUC18, a cell adhesion molecule, plays positive or negative roles in the progression of different cancers. Current topics in Genetics 2010; 4:79-93. (REVIEW)
Wu GJ, Wu MW, Wang C, Liu Y.. Enforced expression of METCAM/MUC18 increases tumorigenesis of human prostate cancer LNCaP cells in nude mice. J Urol. 2011 Apr;185(4):1504-12. Epub 2011 Feb 19.
Zeng GF, Cai SX, Wu GJ.. Up-regulation of METCAM/MUC18 promotes motility, invasion, and tumorigenesis of human breast cancer cells. BMC Cancer. 2011 Mar 30;11:113.
Lin JC, Chiang CF, Wang SW, Wang WY, Kwan PC, Wu GJ.. Decreased expression of METCAM/MUC18 correlates with the appearance of, but its increased expression with metastasis of nasopharyngeal carcinoma. 2012, (submitted).
Wu GJ.. Dual roles of METCAM in the progression of different cancers. J Oncology 2012; in press. (REVIEW)
Wu GJ, Son ES, Dickerson EB, McDonald JF, Cohen C, Sanjay L, Wu MWH.. METCAM/MUC18 over-expression in human ovarian cancer tissues and metastatic lesions is associated with clinical progression. 2012, (submitted).
Zeng G, Cai S, Liu Y, Wu GJ.. METCAM/MUC18 augments migration, invasion, and tumorigenicity of human breast cancer SK-BR-3 cells. Gene. 2012 Jan 15;492(1):229-38. Epub 2011 Oct 26.
This article should be referenced as such:
Wu GJ. MCAM (melanoma cell adhesion molecule). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):475-478.
![Page 45: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/45.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 479
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
MIR100 (microRNA 100) Katia Ramos Moreira Leite
Laboratory of Medical Research, Urology Department, LIM55, University of Sao Paulo Medical
School, Brazil (KRML)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR100ID51447ch11q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR100ID51447ch11q24.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: hsa-mir-100, MIRN100, miR-100
HGNC (Hugo): MIR100
Location: 11q24.1
Local order
- microRNA 125b-1
- BH3-like motif containing, cell death inducer
- microRNA let-7a-2
- microRNA 100 - Glutamate-ammonia ligase (glutamine synthetase)
pseudogene 3
- Ubiquitin associated and SH3 domain containing
B
Note
Human chromosome 11 (HSA11), is one of the
most gene- and disease-rich chromosomes in
humans with a gene density of 11,6 genes per
megabase, including 1524 protein-coding, and 69
microRNAs. It represents approximately 4,4% of
the human genome. There are hundreds of disorders
currently attributed to the chromosome, including
cancer susceptibility loci.
miR-100 is part of the family miR-99, that
comprehends:
hsa-miR-100
(AACCCGUAGAUCCGAACUUGUG)
hsa-miR-99a
(AACCCGUAGAUCCGAUCUUGUG)
hsa-miR-99b
(CACCCGUAGAACCGACCUUGCG).
Their predicted targets are:
SMARCD1, SMARCA5, mTOR, PPFIA3 (Sun et
al., 2011; Nagaraja et al., 2010), PLK1 (Petrelli et
al., 2012; Peng et al., 2012; Feng et al., 2011; Ugras
et al., 2011; Li et al., 2011; Shi et al., 2010),
CTDSPL (RBSP3) (Zeng et al., 2012), β-tubulin
(Lobert et al., 2011), ATM (Ng et al., 2010),
PPP3CA (Sylvius et al., 2011), FGFR3 (Cato et al.,
2009).
![Page 46: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/46.jpg)
MIR100 (microRNA 100) Leite KRM
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 480
DNA/RNA
RNA - stem-loop.
Description
DNA sequence: hsa-mir-100 MI0000102.
CCUGUUGCCACAAACCCGUAGAUCCGAAC
UUGUGGUAUUAGUCCGCACAAGCUUGUAU
CUAUAGGUAUGUGUCUGUUAGG.
Transcription
Mature sequence: 13 - aacccguagauccgaacuugug -
34.
Protein
Note
microRNAs are not translated into amino acids.
Mutations
Note
Gene mutations have not been described.
Implicated in
Prostate cancer
Disease
miR-100 is down-regulated during the prostate
cancer progression, from high grade prostate
intraepithelial neoplasia through metastasis (Leite et
al., 2011a; Leite et al., 2011b). The same result was
posteriorly confirmed by Sun D et al. (2011) that
found miR-100 down-expressed in C4-2B, an
advanced prostate cancer cell line in comparison
with LNCaP an androgen-dependent prostate cancer
cell line. Porkka KP et al. have previously related
down-expression of miR-100 with hormone-
refractory tumors (Porkka et al., 2007).
Prognosis
Contradictorily, lower levels of miR-100 was
related to lower rates of biochemical recurrence in
patients with localized adenocarcinoma treated with
radical prostatectomy in a mean follow up of 58,8
months (Leite et al., 2011c).
Hepatocellular carcinoma
Disease
miR-100 is involved with HCC carcinogenesis
being down-regulated early, since the pre-
neoplastic lesions. A paralleled increase in polo like
![Page 47: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/47.jpg)
MIR100 (microRNA 100) Leite KRM
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 481
kinase 1 (PLK1) suggests this gene as a target of
this miR-100 (Petrelli et al., 2012).
Ovarian cancer
Disease
In a microarray study of 74 ovarian cancer tissue
and cell lines miR-100 was shown to be down-
regulated in cancer specimens against normal tissue
together with miR-199a, miR-140, miR-145, and
miR-125b1 (Iorio et al., 2007).
Prognosis
miR-100 is significantly down-expressed in
epithelial ovarian cancer and related to FIGO stage,
lymph node metastasis, higher CA125 serum levels
and shorter overall survival (Peng et al., 2012).
Experimental studies with clear cell type ovarian
cancer, an aggressive variant of the tumor showed
that over-expression of miR-100 enhanced
sensitivity to the rapamycin analog RAD001
(everolimus), confirming the key relationship
between mir-100 and the mTOR pathway (Nagaraja
et al., 2010).
Lung cancer
Note
Drug resistance - miR-100 was shown to be down-
regulated in docetaxel-resistant SPC-A1/DTX cells
compared with parenteral SPC-A1 cells.
The ectopic miR-100 re-sensitized tumor cells to
docetaxel by suppression of cell proliferation,
G2/M arrest and induction to apoptosis.
Similar effect was identified knocking down PLK1,
reinforcing this mRNA as a miR-100 target (Feng
et al., 2011).
Leukemia
Disease
In acute myeloid leukemia (AML) miR-100 was
found to promote cell proliferation of
promyelocytic blasts and arrest the differentiation
to granulocyte/monocyte lineages. RBSP3, a
phosphatase-like tumor suppressor, important in
cell differentiation is a target of miR-100. miR-100
regulates G1/S transition and blocks the terminal
differentiation of cells targeting RBSP3 which in
turn modulates pRB/E2F1 (Zeng et al., 2012).
Prognosis
Differently in acute lymphoblastic leukemia (ALL)
miR-100 is down-regulated when compared to
normal samples.
Also the down-expression is related to higher count
of white blood cells and hyperdiploid karyotypes.
Increase in miR-100 expression is related to
t(12;21), biological feature associated to better
outcome (de Oliveira et al., 2012).
On the other hand miR-100 over-expression has
been related to vincristine and daunorubicin
resistance (Schotte et al., 2011).
Thyroid cancer
Prognosis
miRNA profile was used to differentiate benign and
malignant thyroid tumors in specimens obtained by
fine-needle aspiration biopsy. Diagnostic accuracy
of differentially expressed genes was determined by
analyzing receiver operating characteristics (ROC).
miR-100 was overexpressed in malignant follicular
neoplasia and in Hurthle cell carcinomas (Vriens et
al., 2011).
Pancreatic cancer
Disease
miR-100 was shown to be over-expressed in
chronic pancreatitis when compared with normal
pancreas and also over-expressed in pancreatic
cancer versus pancreatitis (Bloomston et al., 2007).
Breast cancer
Note
Drug resistance - Taxanes bind to β subunit of the
tubulin heterodimer and reduce microtubule
dynamics leading to cell cycle arrest in G2/M. miR-
100 is involved in the regulation of the expression
of β-tubulin class II and V, and a down-expression
of miR-100 is related to increase in the expression
of these isoforms of β-tubulin conferring MCF7
breast cancer cell line resistance to paclitaxel
(Lobert et al., 2011).
Disease
miR-100 has been described as down-regulated in
breast cancer, including male breast cancer (Fassan
et al., 2011).
Bladder cancer
Disease
Down-regulation of miR-100 has been described in
urothelial carcinomas, having as a main target the
mRNA of FGFR3. FGFR3 mutation is
characteristics of low-grade, non-invasive urothelial
carcinoma, and another possible pathway for
bladder cancer development would be the loss of
regulation of FGFR3 by down-expression of miR-
100 (Dip et al., 2012 in press; Song et al., 2010;
Catto et al., 2009).
Head and neck squamous cell carcinoma
Note
Drug resistance - Down-regulation of miR-100
together with miR-130a and miR-197 was related to
resistance of UMSCC-1 and SQ20B cell lines to
cisplatin, 5-fluorouracil, paclitaxel, methotrexate,
and doxorubicin (Dai et al., 2010).
Glioma
Note
Radio resistance - Higher expression of miR-100
![Page 48: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/48.jpg)
MIR100 (microRNA 100) Leite KRM
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 482
confers radio-sensitivy to M059J and M059K
human malignant glioma cells, targeting ATM (Ng
et al., 2010).
Uterine cervix squamous carcinoma
Disease
The miR-100 expression was shown to be
significantly and gradually reduced from low-grade
CIN, high-grade CIN to cervical cancer tissues. It
was also reduced in HPV positive cervical cancer
cell lines. miR-100 down-expression influenced cell
proliferation, cycle and apoptosis, and the probable
mechanism is the loss of control of PLK1 protein
(Li et al., 2011).
Laminin A/C - related muscular dystrophy
Note
Physiopathology - miR-100, toghether with miR-
192, and miR-335 participate in muscle
differentiation and proliferation and are probably
involved in the development of the disease. miR-
100 expression induces up-regulation of myogenin
and α-actin and down-regulates Ki-67 a protein
related to proliferation. Sylvius et al. (2011) show
that miR-100 is involved with muscle
differentiation by targeting PPP3CA the calcineurin
gene. Calcineurin is a component of the calcium-
dependent signaling pathways and has been shown
to be involved in the regulation of skeletal muscle
differentiation, hypertrophy, and fiber-type
specification.
Psoriasis
Note
Physiopathology - mir-100 has been described as
down-regulated in psoriasis skin. It is probably
involved in the disease by repressing mTOR and
inhibiting angiogenesis. In this context, miR-100
has been called as a anti-angiomiR (Calin et al.,
2011).
References Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, Liu CG, Bhatt D, Taccioli C, Croce CM. MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA. 2007 May 2;297(17):1901-8
Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P, Taccioli C, Volinia S, Liu CG, Alder H, Calin GA, Ménard S, Croce CM. MicroRNA signatures in human ovarian cancer. Cancer Res. 2007 Sep 15;67(18):8699-707
Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, Visakorpi T. MicroRNA expression profiling in prostate cancer. Cancer Res. 2007 Jul 1;67(13):6130-5
Catto JW, Miah S, Owen HC, Bryant H, Myers K, Dudziec E, Larré S, Milo M, Rehman I, Rosario DJ, Di Martino E, Knowles MA, Meuth M, Harris AL, Hamdy FC. Distinct microRNA alterations characterize high- and low-grade bladder cancer. Cancer Res. 2009 Nov 1;69(21):8472-81
Fassan M, Baffa R, Palazzo JP, Lloyd J, Crosariol M, Liu CG, Volinia S, Alder H, Rugge M, Croce CM, Rosenberg A. MicroRNA expression profiling of male breast cancer. Breast Cancer Res. 2009;11(4):R58
Dai Y, Xie CH, Neis JP, Fan CY, Vural E, Spring PM.. MicroRNA expression profiles of head and neck squamous cell carcinoma with docetaxel-induced multidrug resistance. Head Neck. 2010 Nov 29. [Epub ahead of print]
Nagaraja AK, Creighton CJ, Yu Z, Zhu H, Gunaratne PH, Reid JG, Olokpa E, Itamochi H, Ueno NT, Hawkins SM, Anderson ML, Matzuk MM.. A link between mir-100 and FRAP1/mTOR in clear cell ovarian cancer. Mol Endocrinol. 2010 Feb;24(2):447-63. Epub 2010 Jan 15.
Ng WL, Yan D, Zhang X, Mo YY, Wang Y.. Over-expression of miR-100 is responsible for the low-expression of ATM in the human glioma cell line: M059J. DNA Repair (Amst). 2010 Nov 10;9(11):1170-5.
Shi W, Alajez NM, Bastianutto C, Hui AB, Mocanu JD, Ito E, Busson P, Lo KW, Ng R, Waldron J, O'Sullivan B, Liu FF.. Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer. Int J Cancer. 2010 May 1;126(9):2036-48.
Song T, Xia W, Shao N, Zhang X, Wang C, Wu Y, Dong J, Cai W, Li H.. Differential miRNA expression profiles in bladder urothelial carcinomas. Asian Pac J Cancer Prev. 2010;11(4):905-11.
Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM.. Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome. Hum Mol Genet. 2011 Oct 15;20(20):4025-40. Epub 2011 Aug 1.
Leite KR, Sousa-Canavez JM, Reis ST, Tomiyama AH, Camara-Lopes LH, Sanudo A, Antunes AA, Srougi M.. Change in expression of miR-let7c, miR-100, and miR-218 from high grade localized prostate cancer to metastasis. Urol Oncol. 2011a May-Jun;29(3):265-9. Epub 2009 Apr 16.
Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sanudo A, Camara-Lopes LH, Srougi M.. MicroRNA expression profiles in the progression of prostate cancer-from high-grade prostate intraepithelial neoplasia to metastasis. Urol Oncol. 2011b Aug 29. [Epub ahead of print]
Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sanudo A, Dall'Oglio MF, Camara-Lopes LH, Srougi M.. MicroRNA-100 expression is independently related to biochemical recurrence of prostate cancer. J Urol. 2011c Mar;185(3):1118-22. Epub 2011 Jan 21.
Li BH, Zhou JS, Ye F, Cheng XD, Zhou CY, Lu WG, Xie X.. Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein. Eur J Cancer. 2011 Sep;47(14):2166-74. Epub 2011 Jun 1.
Lobert S, Jefferson B, Morris K.. Regulation of beta-tubulin isotypes by micro-RNA 100 in MCF7 breast cancer cells. Cytoskeleton (Hoboken). 2011 Jun;68(6):355-62. doi: 10.1002/cm.20517. Epub 2011 Jun 14.
Schotte D, De Menezes RX, Moqadam FA, Khankahdani LM, Lange-Turenhout E, Chen C, Pieters R, Den Boer ML.. MicroRNA characterize genetic diversity and drug resistance in pediatric acute lymphoblastic leukemia. Haematologica. 2011 May;96(5):703-11. Epub 2011 Jan 17.
Sun D, Lee YS, Malhotra A, Kim HK, Matecic M, Evans C, Jensen RV, Moskaluk CA, Dutta A.. miR-99 family of MicroRNAs suppresses the expression of prostate-specific
![Page 49: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/49.jpg)
MIR100 (microRNA 100) Leite KRM
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 483
antigen and prostate cancer cell proliferation. Cancer Res. 2011 Feb 15;71(4):1313-24. Epub 2011 Jan 6.
Sylvius N, Bonne G, Straatman K, Reddy T, Gant TW, Shackleton S.. MicroRNA expression profiling in patients with lamin A/C-associated muscular dystrophy. FASEB J. 2011 Nov;25(11):3966-78. Epub 2011 Aug 12.
Ugras S, Brill E, Jacobsen A, Hafner M, Socci ND, Decarolis PL, Khanin R, O'Connor R, Mihailovic A, Taylor BS, Sheridan R, Gimble JM, Viale A, Crago A, Antonescu CR, Sander C, Tuschl T, Singer S.. Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma. Cancer Res. 2011 Sep 1;71(17):5659-69. Epub 2011 Jun 21.
Vriens MR, Weng J, Suh I, Huynh N, Guerrero MA, Shen WT, Duh QY, Clark OH, Kebebew E.. MicroRNA expression profiling is a potential diagnostic tool for thyroid cancer. Cancer. 2011 Oct 17. doi: 10.1002/cncr.26587. [Epub ahead of print]
de Oliveira JC, Scrideli CA, Brassesco MS, Morales AG, Pezuk JA, Queiroz Rde P, Yunes JA, Brandalise SR, Tone LG.. Differential miRNA expression in childhood acute lymphoblastic leukemia and association with clinical and biological features. Leuk Res. 2012 Mar;36(3):293-8. Epub 2011 Nov 17.
Dip N, Reis ST, Timozczuk LS, Abe DK, Dall'Oglio M, Srougi M, Leite K.. Under-expression of miR-100 may be a new Carcinogenic pathway for low-grade pTa Bladder Urothelial Carcinomas. J Mole Biomark Diag. 2012 in press.
Feng B, Wang R, Chen LB.. MiR-100 resensitizes docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1. Cancer Lett. 2012 Apr 28;317(2):184-91. Epub 2011 Nov 25.
Peng DX, Luo M, Qiu LW, He YL, Wang XF.. Prognostic implications of microRNA-100 and its functional roles in human epithelial ovarian cancer. Oncol Rep. 2012 Apr;27(4):1238-44. doi: 10.3892/or.2012.1625. Epub 2012 Jan 11.
Petrelli A, Perra A, Schernhuber K, Cargnelutti M, Salvi A, Migliore C, Ghiso E, Benetti A, Barlati S, Ledda-Columbano GM, Portolani N, De Petro G, Columbano A, Giordano S.. Sequential analysis of multistage hepatocarcinogenesis reveals that miR-100 and PLK1 dysregulation is an early event maintained along tumor progression. Oncogene. 2012 Jan 16. doi: 10.1038/onc.2011.631. [Epub ahead of print]
Zheng YS, Zhang H, Zhang XJ, Feng DD, Luo XQ, Zeng CW, Lin KY, Zhou H, Qu LH, Zhang P, Chen YQ.. MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia. Oncogene. 2012 Jan 5;31(1):80-92. doi: 10.1038/onc.2011.208. Epub 2011 Jun 6.
This article should be referenced as such:
Leite KRM. MIR100 (microRNA 100). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):479-483.
![Page 50: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/50.jpg)
Gene Section Short Communication
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 484
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
MIR145 (microRNA 145) Mohit Sachdeva, Yin Yuan Mo
Department of Radiation Oncology, Duke University Medical center, Durham, North Carolina-27710,
USA (MS), Department of Medical Microbiology, Immunology and Cell Biology, Southern Illinois
University School of Medicine, Springfield, IL 62794, USA (YYM)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR145ID50927ch5q32.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR145ID50927ch5q32.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity Other names: MIRN145, miR-145, miRNA145
HGNC (Hugo): MIR145
Location: 5q32
DNA/RNA Description
miR-145 is located on chromosome 5 (5q32-33)
within a 4.09 kb region (miRBase).
The pri-microRNA structure of miR-145 has not
been identified, yet it is suggested that it co-
transcribed with miR-143.
This gene has been implicated as both tumor and
metastasis suppressor in multiple tumor types
(Sachdeva and Mo, 2010a).
Transcription miR-145 is transcribed by RNA pol-II into pri-
miRNA sequence, which is first processed to pre-
miRNA (~88 bp long) involving RNA cutting and
exporting, and finally to mature miR-145. miR-145
is a p53-regulated gene.
Several reports suggest that miR-145 can be
induced transcriptionally by p53 in response to
stress such as serum starvation or anticancer drugs
(Sachdeva et al., 2009; Spizzo et al., 2010).
Interestingly, another report showed a novel
mechanism of posttranscriptional regulation of
miR-145 that occurs via p53-mediated RNA
processing (Suzuki et al., 2009).
Recently, a study demonstrates that activated Ras
can suppress miR-143/145 cluster through Ras-
responsive element-binding protein (RREB1),
which represses the miR-143/145 promoter (Kent et
al., 2010).
Pseudogene
There is no pseudogene reported for this gene.
Figure 1: A) Genomic localization of miR-145 gene on chromosome 5q32. B) Stem-loop structure of miR-145 (Red: mature miR-145 sequence).
![Page 51: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/51.jpg)
MIR145 (microRNA 145) Sachdeva M, Mo YY
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 485
Protein
Note
Non-coding RNA.
Mutations
Note
No mutations have been found in mature miR-145
sequence; however, a study suggests that OVCAR8
(ovary) and NCI-H727 (lung) cells harbor
mutations in pri-miR-145, i.e., C-133A/pri-
microRNA/homozygous and G-5R (G/A)/pri-
microRNA/heterozygous, respectively. Yet, these
mutations do not have any effect on microRNA
processing (Diederichs and Haber, 2006).
Implicated in
Cancer
Note
Downregulation of miR-145 has been found in
cancers of many tissue types including colon,
breast, prostate, pancreas, etc. (Sachdeva et al.,
2009; Bandres et al., 2006; Michael et al., 2003).
For example, in situ hybridization detected
accumulation of miR-145 in normal colon epithelia
with no signal from adenocarcinomas cells. Loss of
miR-145 in various tumors suggests its role as a
tumor suppressor. In fact, miR-145 has been well
documented as a tumor suppressor gene in multiple
tumor types because of its anti-proliferative and
pro-apoptotic effects. It is shown that miR-145 can
negatively regulate multiple oncogenes such as
MYC, Kras, IRS-1, ERK5, etc. involved in cell
proliferation and survival (Sachdeva et al., 2009;
Kent et al., 2010; Shi et al., 2007; Ibrahim et al.,
2011).
Metastasis
Note
Several reports suggest that miR-145 is a
suppressor of metastasis. For example, mir-145
negatively regulates MUC1 and suppresses
invasion and metastasis of the breast cancer cells
(Sachdeva and Mo, 2010b). Similar findings in
prostate cancer and in gliomas have further
confirmed the role of miR-145 as a metastasis
suppressor by targeting genes including FASCN1
and SOX2, respectively (Fang et al., 2011;
Watahiki et al., 2011; Leite et al., 2011).
Stem cells and differentiation
Note
A study has shown that miR-145 is induced during
differentiation, and it directly silences the stem cell
self renewal and pluripotency program by
suppressing multiple pluripotent genes such as
OCT4, SOX2 and KLF4 (Xu et al., 2009).
Vascular smooth muscle cells
Note
The role of miR-145 in differentiation of vascular
smooth muscle cell (VSMC) has been recently
investigated. A report demonstrated that miR-145 is
the most enriched microRNA in arteries and its
expression is significantly downregulated in
vascular walls with neointimal lesions (Chen et al.,
2004). Similarly, another group, using transgenic
mouse model with miR-145 promoter fused to β-
galactosidase gene, found that miR-145 is cardiac-
specific and smooth-muscle specific microRNA
regulated by serum response factor, myocardin and
Nkx2-5 (NK2 transcription factor related, locus 5)
(Cordes et al., 2009). Further evidence from the
miR-43/miR-145 KO rats suggests that this
microRNA cluster is expressed mostly in the SMC
compartment in vessels and SMC-containing
organs and their loss induces an incomplete
differentiation of VSMCs (Elia et al., 2009).
5q syndrome
Note
A comprehensive study using clinical samples
combined with mouse models have found that
deletion of chromosome 5q correlates with loss of
two miRNAs that are abundant in hematopoietic
stem/progenitor cells (HSPCs), miR-145 and miR-
146a. In addition, they observed that miR-145 is
highly expressed in primitive lin- (mouse) and
CD34+ (human) bone marrow cells than committed
cells and stable knockdown of miR-145 in these
cells in mouse marrow results in 5-q syndrome
(Starczynowski et al., 2010). Similar work from
another group in patients with del (5q) have
decreased expression of miR-145 and increased
expression of Fli-1 (Kumar et al., 2011). They
found that miR-145 functions through repression of
Fli-1, a megakaryocyte and erythroid regulatory
transcription factor and thus, cells lacking miR-145
have impaired megakaryocyte and erythroid
differentiation.
References Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res. 2003 Oct;1(12):882-91
Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004 Jan 2;303(5654):83-6
Bandrés E, Cubedo E, Agirre X, Malumbres R, Zárate R, Ramirez N, Abajo A, Navarro A, Moreno I, Monzó M, García-Foncillas J. Identification by Real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues. Mol Cancer. 2006 Jul 19;5:29
Diederichs S, Haber DA. Sequence variations of microRNAs in human cancer: alterations in predicted
![Page 52: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/52.jpg)
MIR145 (microRNA 145) Sachdeva M, Mo YY
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 486
secondary structure do not affect processing. Cancer Res. 2006 Jun 15;66(12):6097-104
Shi B, Sepp-Lorenzino L, Prisco M, Linsley P, deAngelis T, Baserga R. Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90
Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, Lee TH, Miano JM, Ivey KN, Srivastava D. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. Nature. 2009 Aug 6;460(7256):705-10
Elia L, Quintavalle M, Zhang J, Contu R, Cossu L, Latronico MV, Peterson KL, Indolfi C, Catalucci D, Chen J, Courtneidge SA, Condorelli G. The knockout of miR-143 and -145 alters smooth muscle cell maintenance and vascular homeostasis in mice: correlates with human disease. Cell Death Differ. 2009 Dec;16(12):1590-8
Sachdeva M, Zhu S, Wu F, Wu H, Walia V, Kumar S, Elble R, Watabe K, Mo YY. p53 represses c-Myc through induction of the tumor suppressor miR-145. Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3207-12
Suzuki HI, Yamagata K, Sugimoto K, Iwamoto T, Kato S, Miyazono K. Modulation of microRNA processing by p53. Nature. 2009 Jul 23;460(7254):529-33
Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58
Kent OA, Chivukula RR, Mullendore M, Wentzel EA, Feldmann G, Lee KH, Liu S, Leach SD, Maitra A, Mendell JT. Repression of the miR-143/145 cluster by oncogenic Ras initiates a tumor-promoting feed-forward pathway. Genes Dev. 2010 Dec 15;24(24):2754-9
Sachdeva M, Mo YY. miR-145-mediated suppression of cell growth, invasion and metastasis. Am J Transl Res. 2010a Mar 25;2(2):170-80
Sachdeva M, Mo YY. MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer Res. 2010b Jan 1;70(1):378-87
Spizzo R, Nicoloso MS, Lupini L, Lu Y, Fogarty J, Rossi S, Zagatti B, Fabbri M, Veronese A, Liu X, Davuluri R, Croce CM, Mills G, Negrini M, Calin GA. miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cells. Cell Death Differ. 2010 Feb;17(2):246-54
Starczynowski DT, Kuchenbauer F, Argiropoulos B, Sung S, Morin R, Muranyi A, Hirst M, Hogge D, Marra M, Wells RA, Buckstein R, Lam W, Humphries RK, Karsan A. Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. Nat Med. 2010 Jan;16(1):49-58
Fang X, Yoon JG, Li L, Yu W, Shao J, Hua D, Zheng S, Hood L, Goodlett DR, Foltz G, Lin B. The SOX2 response program in glioblastoma multiforme: an integrated ChIP-seq, expression microarray, and microRNA analysis. BMC Genomics. 2011 Jan 6;12:11
Ibrahim AF, Weirauch U, Thomas M, Grünweller A, Hartmann RK, Aigner A. MicroRNA replacement therapy for miR-145 and miR-33a is efficacious in a model of colon carcinoma. Cancer Res. 2011 Aug 1;71(15):5214-24
Kumar MS, Narla A, Nonami A, Mullally A, Dimitrova N, Ball B, McAuley JR, Poveromo L, Kutok JL, Galili N, Raza A, Attar E, Gilliland DG, Jacks T, Ebert BL. Coordinate loss of a microRNA and protein-coding gene cooperate in the pathogenesis of 5q- syndrome. Blood. 2011 Oct 27;118(17):4666-73
Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sañudo A, Camara-Lopes LH, Srougi M. MicroRNA expression profiles in the progression of prostate cancer-from high-grade prostate intraepithelial neoplasia to metastasis. Urol Oncol. 2011 Aug 29;
Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y. MicroRNAs associated with metastatic prostate cancer. PLoS One. 2011;6(9):e24950
This article should be referenced as such:
Sachdeva M, Mo YY. MIR145 (microRNA 145). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):484-486.
![Page 53: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/53.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 487
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)) Tiangang Zhuang, Mayumi Higashi, Venkatadri Kolla, Garrett M Brodeur
Children's Hospital of Philadelphia, Oncology Research, CTRB Rm 3018, 3501 Civic Center Blvd,
Philadelphia, PA 19104, USA (TZ, MH, VK, GMB)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/NMYC112.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI NMYC112.txt This article is an update of : Huret JL. MYCN (myc myelocytomatosis viral related oncogene, neuroblastoma derived). Atlas Genet Cytogenet Oncol Haematol 1998;2(2) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names: bHLHe37, N-myc, MODED, ODED
HGNC (Hugo): MYCN
Location: 2p24.3
Local order: Centromeric to DDX1.
DNA/RNA
Description
3 exons.
Fluorescence in-situ hybridization of MYCN probe to metaphase and interphase nuclei of a primary neuroblastoma with MYCN amplification (Courtesy Garrett M. Brodeur, Children's Hospital of Philadelphia).
![Page 54: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/54.jpg)
MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian))
Zhuang T, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 488
MYCN (2p24). Fluorescence in-situ hybridization of MYCN probe to metaphase spread (Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics).
Protein
Description
464 amino acids; contains a phosphorylation site,
an acidic domain, an HLH motif, and a leucine
zipper in C-term; forms heterodimers with MAX
and binds to an E-box DNA recognition sequence.
The consensus sequence for the E-box element is
CANNTG, with a palindromic canonical sequence
of CACGTG.
Expression
MYCN is expressed in brain, eye, heart, kidney,
lung, muscle, ovary, placenta and thymus.
It is also expressed highly in several tumors:
glioma, lung tumor, primitive neuroectodermal
tumor, retinoblastoma (EST Profile).
Localisation
Nuclear.
Function
Probable transcription factor; possible role during
tissue differentiation.
Homology
With members of the myc family of helix-loop-
helix transcription factors.
Mutations
Somatic
Amplification, either in extrachromosomal double
minutes (DMs) or in homogeneously staining
regions within chromosomes (there is amplification
when, for example, 10 to 1000 copies of a gene are
present in a cell); found amplified in a variety of
human tumors, in particular in neuroblastoma and
also in retinoblastoma, small cell lung carcinoma,
astrocytoma; level of amplification related to the
tumor progression; transgenic mice that
overexpress MYCN in neuroectodermal cells
develop neuroblastoma.
Implicated in
Neuroblastoma
Note
Neuroblastoma karyotypes frequently reveal the
cytogenetic hallmarks of gene amplification,
namely DMs or HSRs. Schwab (Schwab et al.,
1983) and Kohl (Kohl et al., 1983) originally
identified the MYC-related oncogene MYCN as the
target of this amplification event.
MYCN is located on the distal short arm of
chromosome 2 (2p24), but in cells with MYCN
amplification, the extra copies reside within these
DMs or HSRs (Schwab et al., 1984).
Additional genes may be coamplified with MYCN
in a subset of cases (DDX1, NAG, ALK), but
MYCN is the only gene that is consistently
amplified from this locus. The magnitude of
MYCN amplification varies, but it averages 100-
200 copies per cell (range 5-500+ copies).The
overall prevalence of MYCN amplification is 18-
20%. Amplification of MYCN is associated with
advanced stages of disease, unfavorable biological
features, and a poor outcome (Brodeur et al., 1984;
Seeger et al., 1985), but it is also associated with
poor outcome in otherwise favorable patient groups
(such as infants, and patients with lower stages of
disease), underscoring its biological importance
(Seeger et al., 1985; Look et al., 1991; Tonini et al.,
1997; Katzenstein et al., 1998; Bagatell et al., 2005;
George et al., 2005; Schneiderman et al., 2008).
Therefore, the status of the MYCN gene is
routinely determined from neuroblastoma samples
obtained at diagnosis to assist in therapy planning
(Look et al., 1991; Schwab et al., 2004).
![Page 55: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/55.jpg)
MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian))
Zhuang T, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 489
Indeed, because of the dramatic degree of MYCN
amplification and consequent overexpression in a
subset of aggressive neuroblastomas, it should be
an attractive therapeutic target (Pession and Tonelli,
2005; Bell et al., 2010).
Weiss and colleagues (Weiss et al., 1997) created a
transgenic mouse model of neuroblastoma, with
MYCN expression driven in adrenergic cells by the
tyrosine hydroxylase promoter (TH-MYCN
mouse). Genomic changes in neuroblastomas
arising in TH-MYCN mice closely parallel the
genomic changes found characteristically in human
tumors (Hackett et al., 2003). Thus, the TH-MYCN
mouse model appears to be a tractable model to
study neuroblastoma development, progression and
therapy (Chessler and Weiss, 2011).
Medulloblastoma
Note
MYCN amplification is less common in
medulloblastoma, a neural brain tumor of
childhood, but it is also associated with a worse
clinical outcome (Pfister et al., 2009). However,
recent evidence suggests that MYCN
overexpression is much more common in
medulloblastomas, compared to normal cerebellum
(Swartling et al., 2010), and it may drive the
initiation or progression of medulloblastomas
independent of the sonic hedgehog (SHH) pathway.
Indeed, MYCN amplification is found in both
SHH-driven and non-SHH-driven
medulloblastomas, but each subtype is associated
with other genetic features, suggesting they
represent genetically distinct subtypes with
different prognoses (Korshunov et al., 2011).
Rhabdomyosarcoma (RMS)
Note
MYCN amplification also occurs in a subset of
RMS, the most common pediatric soft tissue
sarcoma, although it tends to be at a lower level (4-
20 fold) than is found in neuroblastomas.
Amplification is found predominantly in the
alveolar subsest of RMS, and it is rarely found in
the more common form, called embryonal RMS
(Driman et al., 1994). However, MYCN expression
is found in the vast majority of RMS tumors,
regardless of histology, at least in primary tumors
(Toffolatti et al., 2002). For this reason,
Morgenstern and Anderson have suggested that it
would be an attractive therapeutic target for this
disease (Morgenstern and Anderson, 2006).
Wilms tumor
Note
Wilms tumor may occasionally show amplification
of the MYCN protooncogene (Schaub et al., 2007).
MYCN amplification is consistently associated
with overexpression, at least at the mRNA level.
Initially, MYCN amplification was associated
almost exclusively with the unfavorable, anaplastic
subset of Wilms tumors. However, Williams and
colleagues (Williams et al., 2011) found focal gain
of MYCN in a substantial number of both
anaplastic and favorable histologies in a survey of
over 400 tumors, suggesting that other genomic
changes may account for differences in clinical
behavior.
Other tumors (retinoblastoma, small cell lung cancer, glioblastoma multiforme)
Note
About 3-5% of primary retinoblastomas have
MYCN amplification, whereas it is much more
common (27%) in established retinoblastoma cell
lines (Bowles et al., 2007; Kim et al., 2008).
MYCN is amplified in 15-25% of small cell lung
cancers, and it may be more common in tumors at
relapse (Johnson et al., 1987; Johnson et al., 1992).
MYCN amplification rarely occurs in other lung
cancer histologies (Yokota et al., 1988). MYCN
amplification occurs in a substantial number of
glioblastoma multiformes (Hui et al., 2001;
Hodgson et al., 2008), but it is rarely found in lower
grade gliomas and astrocytomas.
References Kohl NE, Kanda N, Schreck RR, Bruns G, Latt SA, Gilbert F, Alt FW. Transposition and amplification of oncogene-related sequences in human neuroblastomas. Cell. 1983 Dec;35(2 Pt 1):359-67
Schwab M, Alitalo K, Klempnauer KH, Varmus HE, Bishop JM, Gilbert F, Brodeur G, Goldstein M, Trent J. Amplified DNA with limited homology to myc cellular oncogene is shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature. 1983 Sep 15-21;305(5931):245-8
Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science. 1984 Jun 8;224(4653):1121-4
Seeger RC, Brodeur GM, Sather H, Dalton A, Siegel SE, Wong KY, Hammond D. Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med. 1985 Oct 31;313(18):1111-6
Johnson BE, Ihde DC, Makuch RW, Gazdar AF, Carney DN, Oie H, Russell E, Nau MM, Minna JD. myc family oncogene amplification in tumor cell lines established from small cell lung cancer patients and its relationship to clinical status and course. J Clin Invest. 1987 Jun;79(6):1629-34
Yokota J, Wada M, Yoshida T, Noguchi M, Terasaki T, Shimosato Y, Sugimura T, Terada M. Heterogeneity of lung cancer cells with respect to the amplification and rearrangement of myc family oncogenes. Oncogene. 1988 Jun;2(6):607-11
Look AT, Hayes FA, Shuster JJ, Douglass EC, Castleberry RP, Bowman LC, Smith EI, Brodeur GM. Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol. 1991 Apr;9(4):581-91
![Page 56: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/56.jpg)
MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian))
Zhuang T, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 490
Johnson BE, Brennan JF, Ihde DC, Gazdar AF. myc family DNA amplification in tumors and tumor cell lines from patients with small-cell lung cancer. J Natl Cancer Inst Monogr. 1992;(13):39-43
Driman D, Thorner PS, Greenberg ML, Chilton-MacNeill S, Squire J. MYCN gene amplification in rhabdomyosarcoma. Cancer. 1994 Apr 15;73(8):2231-7
Tonini GP, Boni L, Pession A, Rogers D, Iolascon A, Basso G, Cordero di Montezemolo L, Casale F, Pession A, Perri P, Mazzocco K, Scaruffi P, Lo Cunsolo C, Marchese N, Milanaccio C, Conte M, Bruzzi P, De Bernardi B. MYCN oncogene amplification in neuroblastoma is associated with worse prognosis, except in stage 4s: the Italian experience with 295 children. J Clin Oncol. 1997 Jan;15(1):85-93
Weiss WA, Aldape K, Mohapatra G, Feuerstein BG, Bishop JM. Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J. 1997 Jun 2;16(11):2985-95
Katzenstein HM, Bowman LC, Brodeur GM, Thorner PS, Joshi VV, Smith EI, Look AT, Rowe ST, Nash MB, Holbrook T, Alvarado C, Rao PV, Castleberry RP, Cohn SL. Prognostic significance of age, MYCN oncogene amplification, tumor cell ploidy, and histology in 110 infants with stage D(S) neuroblastoma: the pediatric oncology group experience--a pediatric oncology group study. J Clin Oncol. 1998 Jun;16(6):2007-17
Hui AB, Lo KW, Yin XL, Poon WS, Ng HK. Detection of multiple gene amplifications in glioblastoma multiforme using array-based comparative genomic hybridization. Lab Invest. 2001 May;81(5):717-23
Toffolatti L, Frascella E, Ninfo V, Gambini C, Forni M, Carli M, Rosolen A. MYCN expression in human rhabdomyosarcoma cell lines and tumour samples. J Pathol. 2002 Apr;196(4):450-8
Hackett CS, Hodgson JG, Law ME, Fridlyand J, Osoegawa K, de Jong PJ, Nowak NJ, Pinkel D, Albertson DG, Jain A, Jenkins R, Gray JW, Weiss WA. Genome-wide array CGH analysis of murine neuroblastoma reveals distinct genomic aberrations which parallel those in human tumors. Cancer Res. 2003 Sep 1;63(17):5266-73
Schwab M. MYCN in neuronal tumours. Cancer Lett. 2004 Feb 20;204(2):179-87
Bagatell R, Rumcheva P, London WB, Cohn SL, Look AT, Brodeur GM, Frantz C, Joshi V, Thorner P, Rao PV, Castleberry R, Bowman LC. Outcomes of children with intermediate-risk neuroblastoma after treatment stratified by MYCN status and tumor cell ploidy. J Clin Oncol. 2005 Dec 1;23(34):8819-27
George RE, London WB, Cohn SL, Maris JM, Kretschmar C, Diller L, Brodeur GM, Castleberry RP, Look AT. Hyperdiploidy plus nonamplified MYCN confers a favorable prognosis in children 12 to 18 months old with disseminated neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol. 2005 Sep 20;23(27):6466-73
Pession A, Tonelli R. The MYCN oncogene as a specific and selective drug target for peripheral and central nervous system tumors. Curr Cancer Drug Targets. 2005 Jun;5(4):273-83
Morgenstern DA, Anderson J. MYCN deregulation as a potential target for novel therapies in rhabdomyosarcoma. Expert Rev Anticancer Ther. 2006 Feb;6(2):217-24
Bowles E, Corson TW, Bayani J, Squire JA, Wong N, Lai PB, Gallie BL. Profiling genomic copy number changes in
retinoblastoma beyond loss of RB1. Genes Chromosomes Cancer. 2007 Feb;46(2):118-29
Schaub R, Burger A, Bausch D, Niggli FK, Schäfer BW, Betts DR. Array comparative genomic hybridization reveals unbalanced gain of the MYCN region in Wilms tumors. Cancer Genet Cytogenet. 2007 Jan 1;172(1):61-5
Kim JH, Choi JM, Yu YS, Kim DH, Kim JH, Kim KW. N-myc amplification was rarely detected by fluorescence in situ hybridization in retinoblastoma. Hum Pathol. 2008 Aug;39(8):1172-5
Schneiderman J, London WB, Brodeur GM, Castleberry RP, Look AT, Cohn SL. Clinical significance of MYCN amplification and ploidy in favorable-stage neuroblastoma: a report from the Children's Oncology Group. J Clin Oncol. 2008 Feb 20;26(6):913-8
Hodgson JG, Yeh RF, Ray A, Wang NJ, Smirnov I, Yu M, Hariono S, Silber J, Feiler HS, Gray JW, Spellman PT, Vandenberg SR, Berger MS, James CD. Comparative analyses of gene copy number and mRNA expression in glioblastoma multiforme tumors and xenografts. Neuro Oncol. 2009 Oct;11(5):477-87
Pfister S, Remke M, Benner A, Mendrzyk F, Toedt G, Felsberg J, Wittmann A, Devens F, Gerber NU, Joos S, Kulozik A, Reifenberger G, Rutkowski S, Wiestler OD, Radlwimmer B, Scheurlen W, Lichter P, Korshunov A. Outcome prediction in pediatric medulloblastoma based on DNA copy-number aberrations of chromosomes 6q and 17q and the MYC and MYCN loci. J Clin Oncol. 2009 Apr 1;27(10):1627-36
Bell E, Chen L, Liu T, Marshall GM, Lunec J, Tweddle DA. MYCN oncoprotein targets and their therapeutic potential. Cancer Lett. 2010 Jul 28;293(2):144-57
Swartling FJ, Grimmer MR, Hackett CS, Northcott PA, Fan QW, Goldenberg DD, Lau J, Masic S, Nguyen K, Yakovenko S, Zhe XN, Gilmer HC, Collins R, Nagaoka M, Phillips JJ, Jenkins RB, Tihan T, Vandenberg SR, James CD, Tanaka K, Taylor MD, Weiss WA, Chesler L. Pleiotropic role for MYCN in medulloblastoma. Genes Dev. 2010 May 15;24(10):1059-72
Chesler L, Weiss WA. Genetically engineered murine models--contribution to our understanding of the genetics, molecular pathology and therapeutic targeting of neuroblastoma. Semin Cancer Biol. 2011 Oct;21(4):245-55
Williams RD, Al-Saadi R, Natrajan R, Mackay A, Chagtai T, Little S, Hing SN, Fenwick K, Ashworth A, Grundy P, Anderson JR, Dome JS, Perlman EJ, Jones C, Pritchard-Jones K. Molecular profiling reveals frequent gain of MYCN and anaplasia-specific loss of 4q and 14q in Wilms tumor. Genes Chromosomes Cancer. 2011 Dec;50(12):982-95
Korshunov A, Remke M, Kool M, Hielscher T, Northcott PA, Williamson D, Pfaff E, Witt H, Jones DT, Ryzhova M, Cho YJ, Wittmann A, Benner A, Weiss WA, von Deimling A, Scheurlen W, Kulozik AE, Clifford SC, Peter Collins V, Westermann F, Taylor MD, Lichter P, Pfister SM. Biological and clinical heterogeneity of MYCN-amplified medulloblastoma. Acta Neuropathol. 2012 Apr;123(4):515-27
This article should be referenced as such:
Zhuang T, Higashi M, Kolla V, Brodeur GM. MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):487-490.
![Page 57: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/57.jpg)
Gene Section Review
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 491
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
PTBP1 (polypyrimidine tract binding protein 1) Laura Fontana
Department of Medicine, Surgery and Dentistry, Medical Genetics, Universita degli Studi di Milano,
Italy (LF)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/PTBP1ID46504ch19p13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI PTBP1ID46504ch19p13.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity Other names: HNRNP-I, HNRNPI, HNRPI, PTB,
PTB-1, PTB-T, PTB2, PTB3, PTB4, pPTB
HGNC (Hugo): PTBP1
Location: 19p13.3
DNA/RNA
Description
The PTBP1 locus spans 14936 bases on the short
arm of chromosome 19 and is composed of 14
exons.
Transcription
PTBP1 results from skipping of exon 9 (3203 bp
mRNA and 531 amino acid protein). Three
additional isoforms are generated by alternative
splicing: PTBP2 (3260 bp mRNA and 550 amino
acid protein) and PTBP4 (3281 mRNA protein and
557 amino acid protein) derive from exon 9
inclusion using two alternative 3' splice sites, while
PTB-T has been reported to result from alternative
splicing of exons 2-10 (Sawicka et al., 2004).
Pseudogene
PTBP1P (polypyrimidine tract binding protein 1
pseudogene), chromosome location 14q23.3, starts
at 65745938 and ends at 65748375 bp from pter
(according to hg19-Feb_2009).
Protein
Description
57 kDa protein belonging to the heterogeneous
nuclear ribonucleoprotein family (hnRNP). PTBP1
has four RNA recognition motifs (RRMs) and a
conserved N-terminal domain that harbors both
nuclear localisation and export signals (NLS and
NES).
Through the RRMs, PTBP1 binds to the transcript
at multiple sites within large pyrimidine tracts
leading to conformational changes suitable for
functional mRNA processing (Sawicka et al.,
2004).
Shematic representation of PTB mRNA alternative splicing. Alternative splicing of PTB mRNA, as described below, originates four isoforms. Green boxes represent exons and thin black lines represent introns (not to scale).
![Page 58: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/58.jpg)
PTBP1 (polypyrimidine tract binding protein 1) Fontana L
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 492
Schematic representation of PTBP1 protein structure. Each RNA recognition motif (RRM) has different binding affinity for pyrimidine-rich sequences on mRNA. The N-terminal domain encloses partially overlapping nuclear localisation (NLS) and export
signals (NES). Blue boxes representing RRMs are not drawn to scale.
Expression
PTBP1 is ubiquitously expressed in human tissues
emerging as a pleiotropic splicing regulator. PTBP1
expression levels have been associated with
myoblast and neural precursor differentiation
through specific modulation of the splicing pattern
(Clower et al., 2010). In the brain, in particular, the
switch from PTBP1 to nPTB expression drives the
differentiation towards the neuronal lineage:
PTBP1 is expressed in neural precursors and glial
cells, while post-mitotic neurons express only
nPTB (Boutz et al., 2007). Recently a strong
PTBP1 expression has been found in embryonic
stem cells, particularly those in the brain cortex and
subventricular zone, where PTBP1 appears
essential for cell division after implantation
(Shibayama et al., 2009; Suckale et al., 2011).
Localisation
PTBP1 shuttles between the nucleus and the
cytoplasm. Cytoplasmic localisation is mainly
achieved by PKA-mediated phosphorylation of a
specific serine residue (Ser-16) within the nuclear
localisation signal. Cytoplasmic accumulation of
PTB occurs during cell stress (Sawicka et al.,
2008). PTBP1 has also been identified as a key
component in maintaining the integrity of the
perinucleolar compartment, a sub-nuclear structure
predominantly found in transformed cells (Wang et
al., 2003).
Function
PTB was originally identified as a regulator of
alternative splicing (Garcia-Blanco et al., 1989) but
other roles in mRNA processing have been
described (Sawicka et al., 2008).
Alternative splicing regulation: PTBP1
commonly acts as repressor of alternative splicing
favouring skipping of alternative exons. Different
models of PTBP1 activity have been proposed
(Spellman and Smith, 2006): 1) binding
competition with the splicing factor U2AF65 at the
3' splice site of alternative exons; 2) polymerization
of PTBP1 molecules on the alternative exon
masking splicing enhancer sequences; and 3)
looping out of alternative exon by PTBP1 binding
of flanking intronic sequences. Targets of PTBP1-
mediated repression of exon inclusion comprise α-
tropomiosin, α-actinin, GABAAγ2 (gamma-
aminobutyric acid Aγ2), c-src and FGFR2
(fibroblast growth factor receptor 2) (Li et al., 2007;
Spellman et al., 2005). Recent evidences indicate
that PTBP1 may also favour exon inclusion
depending on the position of its binding sites
relative to the target exon. Upon binding to the
upstream intron and/or within the exon, PTBP1
represses exon inclusion, while by binding to the
downstream intron, it activates exon inclusion. The
PTBP1 position-dependent activity relies on the
splice site features: in particular included exons
show weaker 5' splice sites, whereas skipped exons
have longer polypyrimidine tracts (Llorian et al.,
2010).
PTBP1 pre-mRNA undergoes PTBP1-mediated
alternative splicing too, as part of an autoregulatory
feedback loop: high levels of PTBP1 induce
skipping of exon 11 and hence mRNA degradation
via the nonsense-mediated mRNA decay (Spellman
et al., 2005).
3'-end processing: PTBP1 both promotes and
inhibits the mRNA 3'-end cleavage required for
polyadenylation. PTBP1 may prevent mRNA
polyadenylation through competition with the
cleavage stimulating factor (CstF), or stimulate
polyadenylation by binding to pyrimidine-rich
upstream elements (USEs).
mRNA transport: evidences for a role of PTBP1
in mRNA transport come from experiments in
Xenopus, where the PTBP1 homologue (VgRBP60)
is involved in the localisation of the Vg1 mRNA. In
vertebrates PKA-activated PTBP1 is involved in α-
actin mRNA localisation at neurite terminals.
mRNA stability: PTBP1 increases the stability of
specific transcript by binding to the untranslated
regions of mRNA and consequently competing with
factors involved in mRNA degradation. Transcripts
with PTB-mediated increased stability include
those of insulin, VEGF (vascular endothelial
growth factor), CD154 (cluster of differentiation
154) and iNOS (inducible nitric oxide synthase).
Viral translation and replication: PTBP1 acts as
an ITAF (IRES -internal ribosomal entry site- trans-
acting factor) for mRNA translation of virus
belonging to the Picornaviridae family and lacking
cap structure. PTBP1 seems to have a role as a viral
RNA chaperone that stabilizes or alters IRES
![Page 59: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/59.jpg)
PTBP1 (polypyrimidine tract binding protein 1) Fontana L
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 493
structure to direct ribosomes to the correct start
codon.
IRES-mediated translation: PTBP1 favours cap-
independent translation of few cellular RNAs under
cell stress, apoptosis or infection through ribosome
recruitment to IRES. In this case, PTBP1
cytoplasmic relocalisation is required.
Homology
PTBP1 shares 70-80% homology with two other
proteins: nPTB (neural PTB), expressed in adult
brain, muscle and testis, and ROD1 (regulator of
differentiation 1) only expressed in hematopoietic
cells. PTB also regulates alternative splicing of its
homologues, in particular the nonsense-mediated
decay of nPTB transcripts and the non-productive
splicing of ROD1 (Sawicka et al., 2008).
Mutations
Somatic
Three synonymous mutations have been reported in
cancer samples: c.510C>T (p.A170A) in kidney
carcinoma (Dalgliesh et al., 2010), c.1416C>T
(p.F472F) in melanoma (Wei et al., 2011) and
c.501G>A (p.S167S) in squamous cell carcinoma
of the mouth (Stransky et al., 2011). Moreover five
missense mutations have been identified in other
cancer samples: c.932C>T (p.A311V) in ovarian
carcinoma (Cancer Genome Atlas Research
Network, 2011), c.413C>T (p.T138I) in skin
squamous cell carcinoma (Durinck et al., 2011),
c.212C>T (p.T71M), c.666C>G (p.F222L) and
c.928G>A (p.G310R) in squamous cell carcinomas
of the mouth and larynx (Durinck et al., 2011;
Stransky et al., 2011).
Implicated in
Glioma
Note
PTBP1 is aberrantly overexpressed in glioma with
expression levels correlated with glial cell
transformation. The increased expression of PTBP1
contributes to gliomagenesis by deregulating the
alternative splicing of genes involved in cell
proliferation and migration (McCutcheon et al.,
2004; Cheung et al., 2006; Cheung et al., 2009).
FGFR-1 (fibroblast growth factor receptor-1):
PTBP1 overexpression increases FGFR-1 α-exon
skipping and hence the synthesis of a receptor with
higher affinity for fibroblast growth factor,
favouring transformed cell growth (Jin et al., 2000).
PKM (pyruvate kinase): PTBP1 overexpression
leads to the re-expression of the embryonic
pyruvate kinase isoform, PKM2, in transformed
glial cells. The switch from PKM1, normally
expressed in terminally differentiated cells, to
PKM2 is achieved through the PTBP1-mediated
inclusion in the PKM mRNA of exon 10, instead of
exon 9. In transformed cells PKM2 promotes
aerobic glycolysis and proliferation. Recently c-
Myc overexpression has been demonstrated to
upregulate PTBP1 transcription in transformed glial
cells (David et al., 2010).
USP5 (ubiquitin specific peptidase 5): PTBP1
overexpression in GBM forces the expression of
USP5 isoform 2, a protein involved in
ubiquitination. USP5 isoform 2 has a low activity
and favours cell growth and migration (Izaguirre et
al., 2011).
Ovarian tumour
Note
PTBP1 is overexpressed in the majority of
epithelial ovarian tumours and deregulates cell
proliferation, anchorage-dependent growth and
invasiveness. PTBP1 targets in ovarian transformed
cells have not yet been identified (He et al., 2007).
Alzheimer's disease (AD)
Note
Recent evidences delineate PTBP1 as a regulator of
the amyloid precursor protein (APP) in neurons. In
particular, PTBP1 altered expression in neuronal
cells, likely mediated by miR-124, enhances the
expression of APP isoforms including exon 7
and/or 8. These isoforms have been found enriched
in AD patients and associated with β-amyloid
production (Smith et al., 2011).
References García-Blanco MA, Jamison SF, Sharp PA. Identification and purification of a 62,000-dalton protein that binds specifically to the polypyrimidine tract of introns. Genes Dev. 1989 Dec;3(12A):1874-86
Jin W, McCutcheon IE, Fuller GN, Huang ES, Cote GJ. Fibroblast growth factor receptor-1 alpha-exon exclusion and polypyrimidine tract-binding protein in glioblastoma multiforme tumors. Cancer Res. 2000 Mar 1;60(5):1221-4
Wang C, Politz JC, Pederson T, Huang S. RNA polymerase III transcripts and the PTB protein are essential for the integrity of the perinucleolar compartment. Mol Biol Cell. 2003 Jun;14(6):2425-35
McCutcheon IE, Hentschel SJ, Fuller GN, Jin W, Cote GJ. Expression of the splicing regulator polypyrimidine tract-binding protein in normal and neoplastic brain. Neuro Oncol. 2004 Jan;6(1):9-14
Spellman R, Rideau A, Matlin A, Gooding C, Robinson F, McGlincy N, Grellscheid SN, Southby J, Wollerton M, Smith CW. Regulation of alternative splicing by PTB and associated factors. Biochem Soc Trans. 2005 Jun;33(Pt 3):457-60
Cheung HC, Corley LJ, Fuller GN, McCutcheon IE, Cote GJ. Polypyrimidine tract binding protein and Notch1 are independently re-expressed in glioma. Mod Pathol. 2006 Aug;19(8):1034-41
Spellman R, Smith CW. Novel modes of splicing repression by PTB. Trends Biochem Sci. 2006 Feb;31(2):73-6
Boutz PL, Stoilov P, Li Q, Lin CH, Chawla G, Ostrow K, Shiue L, Ares M Jr, Black DL. A post-transcriptional
![Page 60: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/60.jpg)
PTBP1 (polypyrimidine tract binding protein 1) Fontana L
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 494
regulatory switch in polypyrimidine tract-binding proteins reprograms alternative splicing in developing neurons. Genes Dev. 2007 Jul 1;21(13):1636-52
He X, Pool M, Darcy KM, Lim SB, Auersperg N, Coon JS, Beck WT. Knockdown of polypyrimidine tract-binding protein suppresses ovarian tumor cell growth and invasiveness in vitro. Oncogene. 2007 Jul 26;26(34):4961-8
Li Q, Lee JA, Black DL. Neuronal regulation of alternative pre-mRNA splicing. Nat Rev Neurosci. 2007 Nov;8(11):819-31
Sawicka K, Bushell M, Spriggs KA, Willis AE. Polypyrimidine-tract-binding protein: a multifunctional RNA-binding protein. Biochem Soc Trans. 2008 Aug;36(Pt 4):641-7
Cheung HC, Hai T, Zhu W, Baggerly KA, Tsavachidis S, Krahe R, Cote GJ. Splicing factors PTBP1 and PTBP2 promote proliferation and migration of glioma cell lines. Brain. 2009 Aug;132(Pt 8):2277-88
Shibayama M, Ohno S, Osaka T, Sakamoto R, Tokunaga A, Nakatake Y, Sato M, Yoshida N. Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation. FEBS J. 2009 Nov;276(22):6658-68
Clower CV, Chatterjee D, Wang Z, Cantley LC, Vander Heiden MG, Krainer AR. The alternative splicing repressors hnRNP A1/A2 and PTB influence pyruvate kinase isoform expression and cell metabolism. Proc Natl Acad Sci U S A. 2010 Feb 2;107(5):1894-9
David CJ, Chen M, Assanah M, Canoll P, Manley JL. HnRNP proteins controlled by c-Myc deregulate pyruvate kinase mRNA splicing in cancer. Nature. 2010 Jan 21;463(7279):364-8
Llorian M, Schwartz S, Clark TA, Hollander D, Tan LY, Spellman R, Gordon A, Schweitzer AC, de la Grange P, Ast G, Smith CW. Position-dependent alternative splicing activity revealed by global profiling of alternative splicing events regulated by PTB. Nat Struct Mol Biol. 2010 Sep;17(9):1114-23
. Integrated genomic analyses of ovarian carcinoma. Nature. 2011 Jun 29;474(7353):609-15
Durinck S, Ho C, Wang NJ, Liao W, Jakkula LR, Collisson EA, Pons J, Chan SW, Lam ET, Chu C, Park K, Hong SW, Hur JS, Huh N, Neuhaus IM, Yu SS, Grekin RC, Mauro TM, Cleaver JE, Kwok PY, Leboit PE, Getz G, Cibulskis K, Aster JC, Huang H, Purdom E, Li J, Bolund L, Arron ST, Gray JW, Spellman PT, Cho RJ. Temporal Dissection of Tumorigenesis in Primary Cancers. Cancer Discov. 2011 Jul;1(2):137-143
Izaguirre DI, Zhu W, Hai T, Cheung HC, Krahe R, Cote GJ. PTBP1-dependent regulation of USP5 alternative RNA splicing plays a role in glioblastoma tumorigenesis. Mol Carcinog. 2011 Oct 4;
Smith P, Al Hashimi A, Girard J, Delay C, Hébert SS. In vivo regulation of amyloid precursor protein neuronal splicing by microRNAs. J Neurochem. 2011 Jan;116(2):240-7
Stransky N, Egloff AM, Tward AD, Kostic AD, Cibulskis K, Sivachenko A, Kryukov GV, Lawrence MS, Sougnez C, McKenna A, Shefler E, Ramos AH, Stojanov P, Carter SL, Voet D, Cortés ML, Auclair D, Berger MF, Saksena G, Guiducci C, Onofrio RC, Parkin M, Romkes M, Weissfeld JL, Seethala RR, Wang L, Rangel-Escareño C, Fernandez-Lopez JC, Hidalgo-Miranda A, Melendez-Zajgla J, Winckler W, Ardlie K, Gabriel SB, Meyerson M, Lander ES, Getz G, Golub TR, Garraway LA, Grandis JR. The mutational landscape of head and neck squamous cell carcinoma. Science. 2011 Aug 26;333(6046):1157-60
Suckale J, Wendling O, Masjkur J, Jäger M, Münster C, Anastassiadis K, Stewart AF, Solimena M. PTBP1 is required for embryonic development before gastrulation. PLoS One. 2011 Feb 17;6(2):e16992
This article should be referenced as such:
Fontana L. PTBP1 (polypyrimidine tract binding protein 1). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):491-494.
![Page 61: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/61.jpg)
Gene Section Short Communication
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 495
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
SOCS3 (suppressor of cytokine signaling 3) Zoran Culig
Experimental Urology, Department of Urology, Innsbruck Medical University, Anichstrasse 35, A-
6020 Innsbruck, Austria (ZC)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Genes/SOCS3ID44124ch17q25.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI SOCS3ID44124ch17q25.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity Other names: ATOD4, CIS3, Cish3, MGC71791,
SOCS-3, SSI-3, SSI3
HGNC (Hugo): SOCS3
Location: 17q25.3
DNA/RNA
Description
Size: 3300 bases.
Transcription
2 introns.
Transcription generates 3 different mRNAs, 2
spliced variants and 1 unspliced form.
Protein
Description
225 amino acids, 24770 Da.
Expression
Widely expressed in normal and tumor tissues.
Expression in tumors is variable due to its different
functions.
Localisation
Cytoplasm.
Function
SOCS is a negative regulator of cytokines that
signal through the JAK/STAT pathway. It binds to
tyrosine kinase receptors such as gp130 subunit of
receptors.
It interacts with cytokine receptors or JAK kinases
and interaction with growth factor receptors
(insulin-like growth factor-I, insulin, fibroblast
growth factor). It inhibits JAK2 kinase activity.
Part of the ubiquitin-protein ligase complex which
contains elongin, RNF7, and CUL5.
Binding to leptin.
Tumor promoting or tumor suppressive functions.
Antagonizing cAMP-antiproliferative effects.
SOCS3 suppresses erythropoietin in fetal liver and
IL-6 signaling in vivo.
Mutations
Note
Mutations not detected.
KIR = kinase inhibitory region.
![Page 62: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/62.jpg)
SOCS3 (suppressor of cytokine signaling 3) Culig Z
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 496
Implicated in Lung cancer
Note
SOCS-3 acts as a tumor suppressor and is
frequently lost in the disease. Its transient
transfection in lung cancer cell lines leads to a
decrease in proliferation.
Liver cancer
Note
SOCS-3 is silenced by methylation. SOCS-3 is a
tumor suppressor in this malignancy. It is
implicated in regulation of migration of cancer
cells. SOCS-3 deletion enhances JAK/STAT and
FAK signaling.
Barret's adenocarcinoma
Note
SOCS-3 is methylated. It is considered as a tumor
suppressor.
Glioblastoma multiforme
Note
SOCS-3 expression is lost through promoter
methylation.
Head and neck squamous cell cancer
Note
SOCS-3 is frequently down-regulated as a result of
promoter methylation. It causes a growth inhibition.
Hematological malignancies
Note
SOCS-3 inhibits megakaryocytic growth,
overexpression of SOCS-3 is associated with a
decreased survival of patients with follicular
lymphoma.
Melanoma
Note
SOCS-3 is a tumor promoter in melanoma and is
constitutively expressed in several cell lines.
Prostate cancer
Note
SOCS-3 stimulates proliferation and inhibits
apoptosis in prostate cancer cells which do not
express the androgen receptor.
It may also antagonize the effects of fibroblasts
growth factor and mitogen-activated protein
kinases.
In androgen-sensitive prostate cancer cells, SOCS-3
is induced by androgen and may inhibit androgen-
stimulated proliferation and secretion.
Diabetes
Note
SOCS-3 may antagonize function of insulin-like
growth factors.
Various cancers
Prognosis
Loss of protein expression and promoter
hypermethylation occur in lung, liver cancer, head
and neck squamous cell cancer. Overexpression
occurs in melanoma and prostate cancer.
References Brender C, Nielsen M, Kaltoft K, Mikkelsen G, Zhang Q, Wasik M, Billestrup N, Odum N. STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma. Blood. 2001 Feb 15;97(4):1056-62
He B, You L, Uematsu K, Zang K, Xu Z, Lee AY, Costello JF, McCormick F, Jablons DM. SOCS-3 is frequently silenced by hypermethylation and suppresses cell growth in human lung cancer. Proc Natl Acad Sci U S A. 2003 Nov 25;100(24):14133-8
Niwa Y, Kanda H, Shikauchi Y, Saiura A, Matsubara K, Kitagawa T, Yamamoto J, Kubo T, Yoshikawa H. Methylation silencing of SOCS-3 promotes cell growth and migration by enhancing JAK/STAT and FAK signalings in human hepatocellular carcinoma. Oncogene. 2005 Sep 22;24(42):6406-17
Weber A, Hengge UR, Bardenheuer W, Tischoff I, Sommerer F, Markwarth A, Dietz A, Wittekind C, Tannapfel A. SOCS-3 is frequently methylated in head and neck squamous cell carcinoma and its precursor lesions and causes growth inhibition. Oncogene. 2005 Oct 6;24(44):6699-708
Bellezza I, Neuwirt H, Nemes C, Cavarretta IT, Puhr M, Steiner H, Minelli A, Bartsch G, Offner F, Hobisch A, Doppler W, Culig Z. Suppressor of cytokine signaling-3 antagonizes cAMP effects on proliferation and apoptosis and is expressed in human prostate cancer. Am J Pathol. 2006 Dec;169(6):2199-208
Komyod W, Böhm M, Metze D, Heinrich PC, Behrmann I. Constitutive suppressor of cytokine signaling 3 expression confers a growth advantage to a human melanoma cell line. Mol Cancer Res. 2007 Mar;5(3):271-81
O'Connor JC, Sherry CL, Guest CB, Freund GG. Type 2 diabetes impairs insulin receptor substrate-2-mediated phosphatidylinositol 3-kinase activity in primary macrophages to induce a state of cytokine resistance to IL-4 in association with overexpression of suppressor of cytokine signaling-3. J Immunol. 2007 Jun 1;178(11):6886-93
Capello D, Deambrogi C, Rossi D, Lischetti T, Piranda D, Cerri M, Spina V, Rasi S, Gaidano G, Lunghi M. Epigenetic inactivation of suppressors of cytokine signalling in Philadelphia-negative chronic myeloproliferative disorders. Br J Haematol. 2008 May;141(4):504-11
Martini M, Pallini R, Luongo G, Cenci T, Lucantoni C, Larocca LM. Prognostic relevance of SOCS3 hypermethylation in patients with glioblastoma multiforme. Int J Cancer. 2008 Dec 15;123(12):2955-60
Puhr M, Santer FR, Neuwirt H, Susani M, Nemeth JA, Hobisch A, Kenner L, Culig Z. Down-regulation of suppressor of cytokine signaling-3 causes prostate cancer cell death through activation of the extrinsic and intrinsic apoptosis pathways. Cancer Res. 2009 Sep 15;69(18):7375-84
This article should be referenced as such:
Culig Z. SOCS3 (suppressor of cytokine signaling 3). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):495-496.
![Page 63: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/63.jpg)
Leukaemia Section Short Communication
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 497
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
i(17q) solely in myeloid malignancies Vladimir Lj Lazarevic
Department of Hematology, Skane University Hospital, Lund University, 22185, Lund, Sweden
(VLjL)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Anomalies/i17qID1038.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI i17qID1038.txt This article is an update of : Bilhou-Nabera C. i(17q) in myeloid malignancies. Atlas Genet Cytogenet Oncol Haematol 2000;4(1) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Note
An isochromosome 17 results in a loss of the short
arm (17p) and duplication of the long arm (17q)
leading to a single copy of 17p and three copies of
17q.
An i(17q), usually observed in a complex
karyotype, has been reported in solid tumors and in
various types of hematological diseases: acute
myeloid leukemias and chronic myeloid leukemias,
myelodysplastic syndromes and myeloproliferative
neoplasms, acute lymphoid leukemias and chronic
lymphoid leukemias, and Hodgkin and non-
Hodgkin lymphomas.
In chronic myeloid leukemia, i(17q) is a frequent
and well known secondary anomaly, either solely in
10% of cases, or with other additional anomalies ,
in at least another 10% of cases, in particular with
+8.
It is believed that i(17q) as a sole abnormality is a
distinctive clinicopathological entity with a high
risk to a leukemic progression; a subset may present
as de novo AML. These neoplasms have distinctive
morphologic features, including multilineage
dysplasia and concurrent myeloproliferative
features. Isochromosome 17q usually occurs at time
of blast transformation and heralds an aggressive
clinical course. In the 2008 World Health
Organization (WHO) classification system, myeloid
neoplasms with isochromosome 17q are only
briefly mentioned within the MDS/MPN category.
Clinics and pathology
Disease
Myeloproliferative neoplasm/myelodysplastic
syndrome (MPN/MDS)
Phenotype/cell stem origin
Previous studies on isolated i(17q) have suggested
this aberration was associated with chronic myeloid
abnormalities with a high rate of progression to
AML; a new clinico-pathological entity in which
i(17q) is the sole abnormality has been reported in a
mixed myeloproliferative disorder /
myelodysplastic syndrome with an aggressive
course.
Etiology
i(17q) as sole cytogenetic aberration represents only
1% of cases in myeloid malignancies.
Clinics
Isolated isochromosome 17q cases can be divided
into 2 distinct subgroups based on the presentation:
de novo AML and MDS/MPN.
All de novo AML fit into the WHO classification of
AML with myelodysplasia-related changes (with
the exception of 1 mixed phenotype acute
leukemia), and showed features of both
myelodysplasia (pseudo-Pelger-Huet-like
neutrophils, micromegakaryocytes) and
myeloproliferation (splenomegaly, hypercellularity,
reticulin fibrosis, osteosclerosis).
![Page 64: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/64.jpg)
i(17q) solely in myeloid malignancies Lazarevic VLj
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 498
i(17q) G- banding (left) - Courtesy Jean-Luc Lai (top) and Diane H. Norback, Eric B. Johnson, and Sara Morrison-Delap, UW Cytogenetic Services (middle and bottom); and R- banding (right) - top: Editor, bottom: Courtesy Jacques Boyer
Cytology
A severe hyposegmentation of neutrophil nuclei
(pseudo-Pelger Huet neutrophils (PHH)) and a
prominence of the monocyte/macrophage lineage
has been noted; other studies have identified an
association between hyposegmented neutrophils
and loss of 17p (called 17p- syndrome), always
included in complex karyotypes; the i(17q)
appeared to be a part of the malignant clone as
demonstrated in cases available for a FISH
analysis: all myeloid cell lines observed contained
the abnormal i(17q), whereas none of the
lymphocytes were affected. Morphologically, all
showed myelodysplastic and myeloproliferative
features, including pseudo-Pelger-Huet-like
neutrophils, micromegakaryocytic hyperplasia,
hypercellularity, fibrosis, and osteosclerosis.
Pathology
We recommend that for cases with morphologic
features suggestive of isochromosome 17q, such as
pseudo-Pelger-Huet-like neutrophils or
micromegakaryocytes, a complete workup with
ancillary studies should be performed to explore
features of both myelodysplasia and
myeloproliferation to better classify the disease
process, including stains for reticulum and collagen,
immunostains using CD61 to reveal
micromegakaryocytes, CD34 and CD117 to
quantify the blasts on the core biopsy, iron stain to
assess storage iron and ring sideroblasts, butyrate
esterase stain to quantify monocytes, and
myeloperoxidase stain to determine percentage and
lineage of the blasts, as well as flow cytometry
immunophenotyping of the blasts, cytogenetic
analysis for the detection of isochromosome 17q,
and mutational studies of common molecular
markers seen in myeloid neoplasms.
Review of the peripheral blood smear and clinical
records with special attention to the presence of
splenomegaly may also be helpful.
Evolution
Mutational analyses showed rare mutations in
NRAS (3 of 10), FLT3 (2 of 16), and JAK2 (1 of
18), and no mutations in NPM1 (0 of 15), KIT (0 of
4), and CEBPA (0 of 4).
Mutations of JAK2, FLT3, RAS, NPM1, KIT, and
CEBPA are rare and appear to not play a critical
role in the pathogenesis of isochromosome 17q
leukemia.
Prognosis
Log-rank test, and univariate and multivariate Cox
proportional hazards regression analyses to evaluate
prognostic values of patients' characteristics,
including age >65 years, sex, leukocytosis, anemia,
thrombocytopenia, absolute monocytosis, elevated
lactate dehydrogenase, elevated β2-microglobulin,
splenomegaly, megakaryocytic hyperplasia,
dysgranulocytes, dyserythrocytes,
dysmegakaryocytes, increased blasts, bone
thickness, cytogenetic evidence of clonal evolution,
mutations of JAK2 V617F, FLT3, or NRAS, and
stem cell transplantation. In the univariate analysis,
log-rank test suggested that OS was significantly
associated with stem cell transplantation and
absolute monocytosis.
Patients with stem cell transplantation had a longer
survival (P = 0,042), and absolute monocytosis was
associated with a shorter survival (P = 0,016).
![Page 65: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/65.jpg)
i(17q) solely in myeloid malignancies Lazarevic VLj
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 499
Kaplan-Meier curve of overall survival (OS) of patients with myeloid neoplasms and isolated isochromosome 17q is shown. The median OS of de novo acute myeloid leukemia (AML) and of myelodysplastic/myeloproliferative neoplasm (MDS/MPN) was 14,5
months and 11,0 months, respectively.
Cytogenetics
Cytogenetics molecular
DNA sequencing of exons 2-11 of the TP53 gene,
representing the entire coding region. No mutation
was detected in all 14 cases assessed. None of the
13 cases tested had bcr-abl1 fusion transcripts. It
has been proposed that TP53 deletion/mutation
might be responsible for the unique
clinicopathologic features of myeloid neoplasms
associated with isochromosome 17q. We can
conclude that DNA sequencing showed no mutation
in the involved TP53 allele.
Genes involved and proteins
Note
The underlying molecular defect that produces the
isolated i(17q) is unknown: breakage of the
proximal p arm (17p11.2) with rejoining of both
centromere-containing chromatids and subsequent
inactivation of one centromere; breakpoints could
involve important genetic material whose
disruption could result in oncogene or tumor
suppression gene deregulation.
In understanding the specific i(17q) phenotype, loss
of genes localized on 17p were suggested as p53
(17p13.1); a direct correlation between p53 loss and
PHH neutrophils was found in a series of MDS and
ANLL with 17p- syndrome. However, Fioretos et
al. assessed TP53 mutations in 5 Philadelphia
negative myeloid neoplasms with isolated
isochromosome.
17q by sequencing, and found no mutation in all 5
cases. Similarly, none of the 14 cases assessed in
another series of patients demonstrated TP53
mutation. These results suggest that there is no
association between isochromosome 17q and TP53
mutations, and that another oncogene(s) at 17q
and/or tumor suppressor gene(s) at 17p may play an
important role in the pathogenesis of
isochromosome 17q-associated myeloid neoplasms.
The presence of a moderate apoptotic rate also
suggests that the cytogenetically uninvolved TP53
allele is functional.
References Borgström GH, Vuopio P, de la Chapelle A. Abnormalities of chromosome No. 17 in myeloproliferative disorders. Cancer Genet Cytogenet. 1982 Feb;5(2):123-35
Testa JR, Cohen BC. Dicentric chromosome 17 in patients with leukemia. Cancer Genet Cytogenet. 1986 Sep;23(1):47-52
Becher R, Carbonell F, Bartram CR. Isochromosome 17q in Ph1-negative leukemia: a clinical, cytogenetic, and molecular study. Blood. 1990 Apr 15;75(8):1679-83
Lai JL, Preudhomme C, Zandecki M, Flactif M, Vanrumbeke M, Lepelley P, Wattel E, Fenaux P. Myelodysplastic syndromes and acute myeloid leukemia with 17p deletion. An entity characterized by specific dysgranulopoïesis and a high incidence of P53 mutations. Leukemia. 1995 Mar;9(3):370-81
Fugazza G, Bruzzone R, Puppo L, Sessarego M. Granulocytes with segmented nucleus retain normal chromosomes 17 in Philadelphia chromosome-positive
![Page 66: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/66.jpg)
i(17q) solely in myeloid malignancies Lazarevic VLj
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 500
chronic myeloid leukemia with i(17q) and pseudo-Pelger anomaly. A case report studied with fluorescence in situ hybridization. Cancer Genet Cytogenet. 1996 Sep;90(2):166-70
Jary L, Mossafa H, Fourcade C, Genet P, Pulik M, Flandrin G. The 17p-syndrome: a distinct myelodysplastic syndrome entity? Leuk Lymphoma. 1997 Mar;25(1-2):163-8
Fioretos T, Strömbeck B, Sandberg T, Johansson B, Billström R, Borg A, Nilsson PG, Van Den Berghe H, Hagemeijer A, Mitelman F, Höglund M. Isochromosome 17q in blast crisis of chronic myeloid leukemia and in other hematologic malignancies is the result of clustered breakpoints in 17p11 and is not associated with coding TP53 mutations. Blood. 1999 Jul 1;94(1):225-32
Lazarević V, Djordjević V, Magić Z, Marisavljevic D, Colović M. Refractory anemia with ring sideroblasts associated with i(17q) and mutation of the TP53 gene. Cancer Genet Cytogenet. 2002 Jul 1;136(1):86-9
Kanagal-Shamanna R, Bueso-Ramos CE, Barkoh B, Lu G, Wang S, Garcia-Manero G, Vadhan-Raj S, Hoehn D, Medeiros LJ, Yin CC. Myeloid neoplasms with isolated isochromosome 17q represent a clinicopathologic entity associated with myelodysplastic/myeloproliferative features, a high risk of leukemic transformation, and wild-type TP53. Cancer. 2012 Jun 1;118(11):2879-88
This article should be referenced as such:
Lazarevic VLj. i(17q) solely in myeloid malignancies. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):497-500.
![Page 67: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/67.jpg)
Leukaemia Section Short Communication
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 501
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
inv(11)(q13q23) Adrian Mansini, Claus Meyer, Marta Susana Gallego, Jorge Rossi, Patricia Rubio, Adriana
Medina, Rolf Marschalek, Maria Felice, Cristina Alonso
Dept. Hematology and Oncology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina; Agencia
Nacional de Promocion Cientifica y Tecnologica, MINCyT, Argentina (AM), Inst. Pharm Biology,
Goethe-University, Biocenter/DCAL, Max-von-Laue-Str. 9, D-60438 Frankfurt/Main, Germany
(CM), Dept. Genetics, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (MSG), Dept.
Immunology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (JR), Dept. Hematology and
Oncology, Hosp. Pediatria Garrahan, Buenos Aires, Argentina (PR, AM, MF, CA), Inst. Pharm
Biology, Goethe-University, Biocenter/DCAL, Max-von-Laue-Str. 9, D-60438 Frankfurt/Main,
Germany (RM)
Published in Atlas Database: March 2012
Online updated version : http://AtlasGeneticsOncology.org/Anomalies/inv11q13q23ID1585.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI inv11q13q23ID1585.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Clinics and pathology
Disease
Infant acute lymphoblastic leukemia (ALL)
Epidemiology
Poorly defined, only one case described to date, a 9-
months-old boy with Pro-B ALL (FAB L1) (Alonso
et al., 2010).
Evolution
Patient achieved complete remission on day 33 of
treatment and 5 months since diagnosis presented a
bone marrow relapse.
The patient had no available compatible donor and
he did not receive a second line treatment and
palliative care was administered.
He died due to progressive disease.
Prognosis
Infant-ALL with 11q23 abnormality/MLL gene
rearrangement has been defined as a type of
leukemia with poor prognosis (Pieters et al., 2007).
The patient relapsed at +5 months and died due to
progressive disease.
Genetics
Note
Fusion gene MLL-BTBD18 (Alonso et al., 2010)
was detected by LDI-PCR, as described (Meyer et
al., 2005).
Partial G-banded karyogram for the inv(11)(q13q23), showing both chromosomes 11.
![Page 68: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/68.jpg)
inv(11)(q13q23) Mansini A, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 502
Split-FISH: The hybridization pattern for the chromosome with the MLL-BTBD18 rearrangement is one red/one green signal, while the yellow signal represents the germline MLL allele.
Cytogenetics
Cytogenetics morphological
46,XY,inv(11)(q13q23) as sole abnormality.
Cytogenetics molecular
Split-FISH analysis revealed two signals
corresponding to the 3' and the 5' probes, both on
the long arm of chromosome 11 (Alonso et al.,
2010).
Probes
MLL Dual Color Break Apart Rearrangement
Probe.
Genes involved and proteins
MLL
Location
11q23
DNA/RNA
The Mixed-Lineage Leukemia gene consists of at
least 37 exons, encoding a 3969 amino-acid nuclear
protein with a molecular weight of nearly 431 kDa.
Schematic diagram of the exon/intron structure of the MLL gene (Nilson et al., 1996).
![Page 69: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/69.jpg)
inv(11)(q13q23) Mansini A, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 503
Fusion sequence of the MLL-BTBD18 fusion transcript.
Schematic diagram of the structure of the predicted MLL-BTBD18 fusion protein.
Protein
431 kDa; contains two DNA binding motifs (a AT
hook and Zinc fingers), and a DNA methyl
transferase motif; wide expression; nuclear
localisation; transcriptional regulatory factor.
BTBD18
Location
11q12.1
Protein
712 amino acids; 78 kDa.
Result of the chromosomal anomaly
Hybrid gene
Description
In frame fusion between the truncated MLL exon
10 and the truncated BTBD18 exon 3.
Transcript
MLL-BTBD18.
Detection
RT-PCR (van Dongen et al., 1999; Alonso et al.,
2010).
Fusion protein
Description
Fusion protein of 1989 amino acids containing
1374 codons from the amino-terminal region of
MLL and 614 codons from the carboxy terminal
portion of the BTBD18 protein, plus "fusion codon"
consisting of two nucleotides derived from the
MLL gene sequence and one from BTBD18 gene
sequence. The chimeric protein of 1989 amino
acids retains a major portion of MLL, including
those domains known to be essential for leukemic
transformation: the AT-hooks and the DNA
methyltransferase domain (DNMT). The C-terminal
sequences are derived from the BTBD18 protein, a
new fusion partner. The fusion occurred with in the
BTB/POZdomain of BTBD18 (Alonso et al., 2010).
To be noted
Note
Additional cases are needed to delineate the
epidemiology and prognosis of this entity, even
when MLL abnormalities are associated with poor
prognosis, especially when they are identified in
infant leukemias (Pieters et al., 2007).
References Nilson I, Löchner K, Siegler G, Greil J, Beck JD, Fey GH, Marschalek R. Exon/intron structure of the human ALL-1 (MLL) gene involved in translocations to chromosomal region 11q23 and acute leukaemias. Br J Haematol. 1996 Jun;93(4):966-72
van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F, Parreira A, Gameiro P, Diáz MG, Malec M, Langerak AW, San Miguel JF, Biondi A. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia. 1999 Dec;13(12):1901-28
Meyer C, Schneider B, Reichel M, Angermueller S, Strehl S, Schnittger S, Schoch C, Jansen MW, van Dongen JJ, Pieters R, Haas OA, Dingermann T, Klingebiel T, Marschalek R. Diagnostic tool for the identification of MLL rearrangements including unknown partner genes. Proc Natl Acad Sci U S A. 2005 Jan 11;102(2):449-54
![Page 70: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/70.jpg)
inv(11)(q13q23) Mansini A, et al.
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 504
Stogios PJ, Downs GS, Jauhal JJ, Nandra SK, Privé GG. Sequence and structural analysis of BTB domain proteins. Genome Biol. 2005;6(10):R82
Pieters R, Schrappe M, De Lorenzo P, Hann I, De Rossi G, Felice M, Hovi L, LeBlanc T, Szczepanski T, Ferster A, Janka G, Rubnitz J, Silverman L, Stary J, Campbell M, Li CK, Mann G, Suppiah R, Biondi A, Vora A, Valsecchi MG. A treatment protocol for infants younger than 1 year with acute lymphoblastic leukaemia (Interfant-99): an observational study and a multicentre randomised trial. Lancet. 2007 Jul 21;370(9583):240-50
Alonso CN, Meyer C, Gallego MS, Rossi JG, Mansini AP, Rubio PL, Medina A, Marschalek R, Felice MS. BTBD18: A novel MLL partner gene in an infant with acute lymphoblastic leukemia and inv(11)(q13;q23). Leuk Res. 2010 Nov;34(11):e294-6
This article should be referenced as such:
Mansini A, Meyer C, Gallego MS, Rossi J, Rubio P, Medina A, Marschalek R, Felice M, Alonso C. inv(11)(q13q23). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):501-504.
![Page 71: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/71.jpg)
Leukaemia Section Short Communication
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 505
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
t(2;9)(q37;q34) Purvi M Kakadia, Stefan K Bohlander
Center for Human genetics, Philipps University Marburg, Baldingerstrasse, Marburg, Germany (PMK,
SKB)
Published in Atlas Database: March 2012
Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0209q37q34ID1577.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0209q37q34ID1577.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names
INPP5D/ABL1 fusion
SHIP1/ABL1 fusion
Clinics and pathology
Disease
c-ALL
Epidemiology
Only one case known to date, a 18-year-old female
patient.
Clinics
Immature lymphoid blast population CD19+,
CD10+, with no co-expression of myeloid markers.
Treatment
Treated with Imatinib; a complete remission (CR)
was obtained. Continued CR after bone marrow
transplantation (Follow-up: 15 months).
Cytogenetics
Cytogenetics morphological
Normal karyotype. This translocation would be
hard to detect using conventional cytogenetics.
Figure 1: FISH analysis: (I) Interphase nuclei showing four FISH signals for ABL1 (orange) with a commercial BCR/ABL-DCDF probe. (II) Schematic diagram showing the position of the BAC clones corresponding to the 3' and 5' portions of the SHIP1 and
ABL1 genes, with the color scheme used for the fluorescent labelling of the SHIP1/ABL1 DCDF probes. The BAC clones for SHIP1 were labelled with FITC and those for ABL1 were labelled with Texas Red. (SHIP1 clones: A: RP13-497I2 and B: RP13-916J2; ABL1 BAC clones: C: RP11-57C19 and D: RP11-835J22). (III-V) Interphase FISH demonstrating the presence of three
fusion signals using the SHIP1-ABL1-DCDF probes (III), two SHIP1-ABL1 fusion signals, when SHIP1-ABL1 fusion specific probes were used (IV) and presence of one reciprocal ABL1/SHIP1 fusion using the ABL1-SHIP1 fusion specific FISH probe (V)
in the patient sample. With all three probe combinations one normal copy of each the SHIP1 and ABL1 locus was also confirmed. The probes used for the hybridization are indicated below each image. The fusion signals (yellow) are indicated by
arrows.
![Page 72: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/72.jpg)
t(2;9)(q37;q34) Kakadia PM, Bohlander SK
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 506
Cytogenetics molecular
ABL1 rearrangement observed in interphase cells
but not on metaphase chromosomes by FISH using
commercial BCR-ABL-DCDF probes (Abbott).
FISH using SHIP-ABL-DCDF FISH probes
showed two fusion signals indicating the SHIP1-
ABL1 fusion and one fusion signal for the
reciprocal fusion on interphase cells. The
rearrangement was not observed on the metaphase
chromosomes, possibly because the malignant cells
did not go into mitosis.
Genes involved and proteins
INPP5D
Location
2q37.1
Note
Other names: SHIP, SHIP1, SIP-145, hp51CN.
DNA/RNA
Transcript variant 1: NM_001017915.1; 26 exons,
4928 bp mRNA.
Transcript variant 2: NM_005541.3; 26 exons, 4925
bp mRNA.
There is also an INPP5D transcript variant
described with 29 exons in the Ensembl database
(INPP5D-201 ENST00000359570).
Protein
Proteins: Variant 1 contains 1189 aa and Variant 2
contains 1188 aa.
Domains: An N-terminal SH2 domain, an inositol
phosphatase domain and two C-terminal protein
interaction domains (Figure 3, upper box).
Expression: The expression of SHIP1 is restricted
to hematopoietic cells.
Localization: Cytosol and plasma membrane; the
localization of SHIP1 (cytosol vs. plasma
membrane) is regulated by its SH2 domain which
mediates interaction with tyrosine phosphorylated
receptors.
Function: SHIP1 is a phosphatase, which
hydrolyzes the 5-phosphates from
phosphatidylinositol (3,4,5)-trisphosphate
(Ptdins(3,4,5)P3; PIP3) and inositol-1,3,4,5
tetrakisphosphate (Ins(1,3,4,5)P4; PIP4) (Damen et
al., 1996), thereby negatively regulating the PI3K
(phosphoinositide 3-kinase) pathway.
The PI3K pathway is part of many important
signalling pathways and regulates key cellular
functions such as survival, proliferation, cell
activation and cell migration (Krystal, 2000; Ward
and Cantrell, 2001; Ward, 2006).
SHIP1 regulates these important cellular functions
by controlling PIP3 levels and Ras activity
following cytokine stimulation (Batty et al., 1985;
Damen et al., 1996).
Homology: Belongs to the inositol-1,4,5-
trisphosphate 5-phosphatase family.
Contains an SH2 domain.
ABL1
Location
9q34
Figure 2: Partial sequence of the PCR product showing an in-frame fusion of SHIP1 with ABL1.
![Page 73: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/73.jpg)
t(2;9)(q37;q34) Kakadia PM, Bohlander SK
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 507
Figure 3: The upper two diagrams show the SHIP1 and the ABL1 proteins and the lower diagram depicts the SHIP1/ABL1 fusion protein. The arrows indicate the breakpoints in the individual proteins; numbers indicate amino acid positions. SH2: Src homology-2 domain; SH3: Src homology-3 domain; 5-ptase: Inositol 5-phosphatase domain; INPNY and ENPLY: Target
sequences for the phospho tyrosine binding domains of other proteins; TK: Tyrosine kinase domain; DB: DNA binding domain; AD: Actin-binding domain.
Result of the chromosomal anomaly
Hybrid gene
Transcript
Only SHIP1-ABL1 fusion transcript was detected.
The reciprocal ABL1-SHIP1 fusion transcript was
not detected.
Detection
The SHIP1-ABL1 fusion transcript can be detected
by 5' SHIP1 forward primer (bp 997-1015): 5'-
TTGCTGCACGAGGGTCCTG-3' and 3' ABL1
reverse primer (bp 1474-1454): 5'-
TCTCCAGACTGTTGACTGGCG-3' resulting in
477 bp PCR product.
Fusion protein
Description
The fusion protein leads to the constitutive
activation of the ABL1 tyrosine kinase facilitated
by the homo-di- and homo-heteromerization of the
fusion protein via the dimerization domain within
the N-terminal SHIP1 portion contained in the
fusion protein.
Oncogenesis
Constitutive activation of ABL1 tyrosine kinase
activity and possibly inactivation of the putative
tumor suppressor function of SHIP1.
References Batty IR, Nahorski SR, Irvine RF. Rapid formation of inositol 1,3,4,5-tetrakisphosphate following muscarinic receptor stimulation of rat cerebral cortical slices. Biochem J. 1985 Nov 15;232(1):211-5
Damen JE, Liu L, Rosten P, Humphries RK, Jefferson AB, Majerus PW, Krystal G. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5-phosphatase. Proc Natl Acad Sci U S A. 1996 Feb 20;93(4):1689-93
Krystal G. Lipid phosphatases in the immune system. Semin Immunol. 2000 Aug;12(4):397-403
Ward SG, Cantrell DA. Phosphoinositide 3-kinases in T lymphocyte activation. Curr Opin Immunol. 2001 Jun;13(3):332-8
Ward SG. T lymphocytes on the move: chemokines, PI 3-kinase and beyond. Trends Immunol. 2006 Feb;27(2):80-7
Kakadia PM, Tizazu B, Mellert G, Harbott J, Röttgers S, Quentmeier H, Spiekermann K, Bohlander SK. A novel ABL1 fusion to the SH2 containing inositol phosphatase-1 (SHIP1) in acute lymphoblastic leukemia (ALL). Leukemia. 2011 Oct;25(10):1645-9
This article should be referenced as such:
Kakadia PM, Bohlander SK. t(2;9)(q37;q34). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):505-507.
![Page 74: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/74.jpg)
Solid Tumour Section Short Communication
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 508
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24) Karolin H Nord
Department of Clinical Genetics, University and Regional Laboratories, Skane University Hospital,
Lund University, Lund, Sweden (KHN)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Tumors/t0110p22q24MyoInfFibSID6369.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0110p22q24MyoInfFibSID6369.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Other names
MIFS was originally described as acral MIFS
(Meis-Kindblom and Kindblom, 1998).
Note
MIFS is an intermediate malignant soft tissue tumor
usually located in the subcutaneous tissue of distal
extremities (Kindblom et al., 2002).
Distant metastases are rare but the tumor has a
propensity for multiple local recurrences. An
identical t(1;10)(p22;q24) has been found in MIFS
and hemosiderotic fibrolipomatous tumor (HFLT)
(Hallor et al., 2009; Antonescu et al., 2011). HFLT
is an intermediate malignant tumor of uncertain
differentiation, morphologically distinct from
MIFS.
In similarity with MIFS, HFLT has a predilection
for superficial soft tissue of distal extremities and
present frequent local recurrences.
Despite their usually distinct morphology, there are
tumors with mixed HFLT/MIFS histology (Elco et
al., 2010).
These tumors also show a t(1;10) and suggest that
there are either different morphological variants or
different levels of tumor progression of a sole
biological entity (Antonescu et al., 2011).
Classification
Note
MIFS is an intermediate malignant
fibroblastic/myofibroblastic soft tissue tumor.
Clinics and pathology
Disease
Myxoinflammatory fibroblastic sarcoma (MIFS)
Phenotype / cell stem origin
The origin of the tumor cells is unknown. Their
fibroblastic/myofibroblastic differentiation
indicates that they derive from a mesenchymal
precursor.
Etiology
Unknown.
Epidemiology
MIFS is a rare soft tissue tumor which primarily
affects adults without any gender predilection.
Clinics
MIFS is an intermediate malignant tumor that
usually presents as a slowly-growing, poorly-
delineated mass of the superficial soft tissue of
distal extremities (Kindblom et al., 2002). It is
sometimes associated with pain and decreased
mobility. In many cases the growth has been noted
for a relatively long period of time before
diagnosis. MIFS may be confused with
inflammatory or post-traumatic lesions, benign or
other malignant soft tissue tumors. Local
recurrences are common but distant metastases are
very rare.
Pathology
MIFS show a poorly delineated, multinodular
![Page 75: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/75.jpg)
Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24)
Nord KH
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 509
growth pattern with alternating myxoid and cellular
areas (Kindblom et al., 1998). There is a prominent
inflammatory infiltrate that may obscure the
neoplastic cells and cause misdiagnoses of a
reactive or inflammatory process. Tumor cells,
including large polygonal and bizarre ganglion-like
cells with prominent inclusion-like nucleoli and
variably sized, multivacuolated lipoblast-like cells,
may be scattered singly or form coherent clusters.
Treatment
The treatment for MIFS is surgical excision.
Prognosis
Local recurrences are common and their incidence
may depend on primary surgical treatment; multiple
local recurrences may require eventual amputation
(Kindblom et al., 2002). Distant metastases are,
however, exceedingly rare.
Genetics
Note
MIFS, HFLT and tumors with mixed MIFS/HFLT
histology share the same genetic aberrations;
t(1;10) and amplification of a region in proximal
chromosome arm 3p (Antonescu et al., 2011).
Cytogenetics
Cytogenetics Morphological
The majority of cytogenetically analyzed MIFS
present a t(1;10)(p22;q24), or variants thereof
(Mitelman Database of Chromosome Aberrations in
Cancer 2012).
Ring and/or giant marker chromosomes as well as
aberrations involving chromosome 3 are also
associated with this disease.
Cytogenetics Molecular
Fluorescence in situ hybridization analyses, using
probes flanking the genes TGFBR3 in chromosome
1 and MGEA5 in chromosome 10, can be used as a
diagnostic molecular test for MIFS and HFLT
(Antonescu et al., 2011).
Amplification of material from chromosome arm 3p
can be detected by fluorescence in situ
hybridization analyses and/or array-based genomic
copy number analyses (Hallor et al., 2009).
Partial karyotype with a t(1;10)(p22;q24) and rearrangement of 3p.
Fluorescence in situ hybridization, using probes flanking the TGFBR3 and MGEA5 genes, respectively, can be used to detect the t(1;10)(p22;q24). A normal chromosome 10 show signals from probes located on either side of MGEA5 (labeled in red and
yellow). On the der(10)t(1;10) the proximal probe (yellow) is detected while the more distal probe (red) is deleted.
![Page 76: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/76.jpg)
Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24)
Nord KH
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 510
DNA copy number analysis of a MIFS using array comparative genomic hybridization. A genome-wide copy number profile displays tumor/reference log2 ratios across the genome (top). Individual chromosomes are separated by vertical bars and chromosome 3 is labeled in yellow. The profile shows amplification of material from chromosome 3 and a few additional
aberrations. Enlarged view of chromosome 3 shows two separate amplicons, the more proximal of these contains the VGLL3 gene (bottom).
Genes involved and proteins
Note
The breaks in chromosomes 1 and 10 seem to occur
in, or close to, the genes TGFBR3 and MGEA5,
respectively, and the translocation juxtaposes FGF8
in chromosome 10 with TGFBR3 in chromosome 1
(Hallor et al., 2009).
FGF8 is highly expressed, likely as a result of the
rearrangement, in tumors affected by the
translocation. Ring and giant marker
chromosomes in MIFS contain amplified material
from chromosome 3.
The core amplicon harbors the gene VGLL3, which
is also highly expressed in affected tumors (Hallor
et al., 2009).
This abnormality is, however, not specific for
MIFS/HFLT and have been found in additional
sarcomas as well as other malignancies (Hélias-
Rodzewicz et al., 2010).
VGLL3
Location
3p12
![Page 77: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/77.jpg)
Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24)
Nord KH
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 511
Fluorescence in situ hybridization analyses suggest that TGFBR3 is translocated from chromosome 1 and positioned in opposite direction next to the MGEA5 gene on the der(10)t(1;10) (Hallor et al., 2009).
Note
Amplification and high expression of VGLL3 in
chromosome 3 is found in MIFS and HFLT as well
as other sarcomas.
DNA / RNA
VGLL3 is a protein coding gene located at position
86987119-87040269 in chromosome 3
(http://www.ensembl.org; human assembly
GRCh37). There are three transcript variants of this
gene. The most extensive variant (transcript variant
1) comprises 10400 base pairs and consists of 4
coding exons.
Protein
VGLL3 encodes the protein vestigial like 3
(Drosophila). Translation of VGLL3 transcript
variant 1 results in a 326 amino acid protein. There
is not much known about the function of this
protein. However, it is believed that mammlian
vestigal like proteins could be involved in
regulating members of the TEAD transcription
factor family (Vaudin et al., 1999; Maeda et al.,
2002).
FGF8
Location
10q24
Note
The translocation between chromosomes 1 and 10
juxtaposes FGF8 in chromosome 10 with TGFBR3
in chromosome 1. In tumors affected by the
translocation, FGF8 is highly expressed.
DNA / RNA
FGF8 is a highly conserved gene located at position
103530081-103535827 in chromosome 10
(http://www.ensembl.org; human assembly
GRCh37). There are six transcript variants of this
gene and the alternating splicing results in products
of 4-6 exons, which in turn encode proteins of 204-
244 amino acids. The expression of FGF8 is
controlled by several regulatory sequences located
both upstream and downstream of the gene
(Beermann et al., 2006; Inoue et al., 2006).
Protein
Fibroblast growth factor 8 belongs to the large
family of fibroblast growth factors. Members of this
family are secreted molecules which by activating
their receptors are involved in a variety of
biological processes (Thisse and Thisse et al.,
2005). FGF8 is transcriptionally silent in most
normal adult tissues. However, upregulation of this
gene has been associated with tumor growth and
has been identified in carcinomas of the breast,
prostate, and ovary, as well as in synovial sarcoma
(Tanaka et al., 1998; Ishibe et al., 2005; Mattila et
al., 2007).
Result of the chromosomal anomaly
Hybrid Gene
Note
The t(1;10) juxtaposes FGF8 in chromosome 10
with TGFBR3 in chromosome 1 and the
rearrangement is associated with high expression of
FGF8 (Hallor et al., 2009).
Description
The translocation does not result in a conventional
fusion gene. The functional outcome of the
recurrent aberration seems to be high expression of
the gene FGF8 (Hallor et al., 2009). The consistent
involvement of TGFBR3, but lack of fusion
transcripts, suggest that regulatory sequences in
TGFBR3 are crucial for malignant transformation.
Transcript
Rearrangements of TGFBR3 and MGEA5.
Detection
Fluorescence in situ hybridization analysis using
probes flanking the TGFBR3 and MGEA5 genes
can be applied as a molecular test for detecting
rearrangements of the genes (Antonescu et al.,
2011).
References Meis-Kindblom JM, Kindblom LG. Acral myxoinflammatory fibroblastic sarcoma: a low-grade tumor of the hands and feet. Am J Surg Pathol. 1998 Aug;22(8):911-24
Tanaka A, Furuya A, Yamasaki M, Hanai N, Kuriki K, Kamiakito T, Kobayashi Y, Yoshida H, Koike M, Fukayama M. High frequency of fibroblast growth factor (FGF) 8 expression in clinical prostate cancers and breast tissues, immunohistochemically demonstrated by a newly established neutralizing monoclonal antibody against FGF 8. Cancer Res. 1998 May 15;58(10):2053-6
Vaudin P, Delanoue R, Davidson I, Silber J, Zider A. TONDU (TDU), a novel human protein related to the
![Page 78: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/78.jpg)
Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24)
Nord KH
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 512
product of vestigial (vg) gene of Drosophila melanogaster interacts with vertebrate TEF factors and substitutes for Vg function in wing formation. Development. 1999 Nov;126(21):4807-16
Kindblom LG, Meis-Kindblom JM.. Myxoinflammatory fibroblastic sarcoma. In Fletcher CDM, Unni KK, Mertens F (Eds.). World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Soft Tissue and Bone. Lyon: IARC Press, 2002.
Maeda T, Chapman DL, Stewart AF.. Mammalian vestigial-like 2, a cofactor of TEF-1 and MEF2 transcription factors that promotes skeletal muscle differentiation. J Biol Chem. 2002 Dec 13;277(50):48889-98. Epub 2002 Oct 9.
Ishibe T, Nakayama T, Okamoto T, Aoyama T, Nishijo K, Shibata KR, Shima Y, Nagayama S, Katagiri T, Nakamura Y, Nakamura T, Toguchida J.. Disruption of fibroblast growth factor signal pathway inhibits the growth of synovial sarcomas: potential application of signal inhibitors to molecular target therapy. Clin Cancer Res. 2005 Apr 1;11(7):2702-12.
Thisse B, Thisse C.. Functions and regulations of fibroblast growth factor signaling during embryonic development. Dev Biol. 2005 Nov 15;287(2):390-402. Epub 2005 Oct 10. (REVIEW)
Beermann F, Kaloulis K, Hofmann D, Murisier F, Bucher P, Trumpp A.. Identification of evolutionarily conserved regulatory elements in the mouse Fgf8 locus. Genesis. 2006 Jan;44(1):1-6.
Inoue F, Nagayoshi S, Ota S, Islam ME, Tonou-Fujimori N, Odaira Y, Kawakami K, Yamasu K.. Genomic organization, alternative splicing, and multiple regulatory regions of the zebrafish fgf8 gene. Dev Growth Differ. 2006 Sep;48(7):447-62.
Mattila MM, Harkonen PL.. Role of fibroblast growth factor 8 in growth and progression of hormonal cancer. Cytokine
Growth Factor Rev. 2007 Jun-Aug;18(3-4):257-66. Epub 2007 May 23. (REVIEW)
Hallor KH, Sciot R, Staaf J, Heidenblad M, Rydholm A, Bauer HC, Astrom K, Domanski HA, Meis JM, Kindblom LG, Panagopoulos I, Mandahl N, Mertens F.. Two genetic pathways, t(1;10) and amplification of 3p11-12, in myxoinflammatory fibroblastic sarcoma, haemosiderotic fibrolipomatous tumour, and morphologically similar lesions. J Pathol. 2009 Apr;217(5):716-27.
Elco CP, Marino-Enriquez A, Abraham JA, Dal Cin P, Hornick JL.. Hybrid myxoinflammatory fibroblastic sarcoma/hemosiderotic fibrolipomatous tumor: report of a case providing further evidence for a pathogenetic link. Am J Surg Pathol. 2010 Nov;34(11):1723-7.
Helias-Rodzewicz Z, Perot G, Chibon F, Ferreira C, Lagarde P, Terrier P, Coindre JM, Aurias A.. YAP1 and VGLL3, encoding two cofactors of TEAD transcription factors, are amplified and overexpressed in a subset of soft tissue sarcomas. Genes Chromosomes Cancer. 2010 Dec;49(12):1161-71.
Antonescu CR, Zhang L, Nielsen GP, Rosenberg AE, Dal Cin P, Fletcher CD.. Consistent t(1;10) with rearrangements of TGFBR3 and MGEA5 in both myxoinflammatory fibroblastic sarcoma and hemosiderotic fibrolipomatous tumor. Genes Chromosomes Cancer. 2011 Oct;50(10):757-64. doi: 10.1002/gcc.20897. Epub 2011 Jun 29.
Mitelman F, Johansson B, Mertens F.. Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer. Mitelman F, Johansson B and Mertens F (Eds.), 2012. http://cgap.nci.nih.gov/Chromosomes/Mitelman
This article should be referenced as such:
Nord KH. Myxoinflammatory fibroblastic sarcoma (MIFS) with t(1;10)(p22;q24). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):508-512.
![Page 79: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/79.jpg)
Case Report Section Paper co-edited with the European LeukemiaNet
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 513
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia Helena Podgornik, Peter Cernelc
University medical center Ljubljana, Department of Haematology, Zaloska 7, 1000 Ljubljana,
Slovenia (HP, PC)
Published in Atlas Database: February 2012
Online updated version : http://AtlasGeneticsOncology.org/Reports/t1721q11q22PodgornikID100063.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t1721q11q22PodgornikID100063.txt This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Clinics
Age and sex
87 years old male patient.
Previous history
No preleukemia, no previous malignancy, no inborn
condition of note.
Organomegaly
No hepatomegaly, nosplenomegaly, no enlarged
lymph nodes, no central nervous system
involvement.
Blood
WBC: 30,6 X 109/l
HB: 99 g/dl
Platelets: 71 X 109/l
Blasts: 3%
Bone marrow: 28% (of blasts) (Hypercellular;
28% of blasts; 20% of monocytic lineage,
dispoiesis in megakariocytic lineage and
diserithropoiesis).
Cyto-Pathology Classification
Cytology
Acute myelomonocytic leukemia
Immunophenotype
CD4-
/CD11c+/CD13+/CD14+/CD15+/CD33+/CD34+↓/
CD45+/ CD64+/CD65+/MPO+↓
Rearranged Ig Tcr: -
Pathology: Not done
Electron microscopy: Not done
Diagnosis: Acute myelomonocytic leukemia
Survival
Date of diagnosis: 04-2011
Treatment: Symptomatic (antibiotics)
Complete remission: no
Treatment related death: no
Relapse : no
Status: Death
Last follow up: 04-2011
Survival: 1 month
Karyotype
Sample: Bone marrow
Culture time: 24h
Banding: GTG
Results
46,XY,t(17;21)(q11.2;q22)[19]/46,XY[1]
Other molecular cytogenetics technics
FISH; LSI RUNX1/RUNX1T1, LSI MLL (Abbott);
WC 17, 21 (Kreatech)
Other molecular cytogenetics results
nuc ish(RUNX1T1x2,RUNX1x3)[130/200]; ish
t(17;21)(WCP17+,WCP21+;WCP17+,WCP21+)
Other Molecular Studies
Technics: PCR
Results: FLT3-ITD - negative; NPM1 mutation -
negative.
![Page 80: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/80.jpg)
t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia
Podgornik H, Cernelc P
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 514
Figure 1. Partial Karyograme with a balanced translocation t(17;21)(q11.2;q22).
Figure 2. GTG banded metaphase chromosomes.
Figure 3. FISH on previously GTG banded chromosomes (Fig. 2). WC 17 (aqua) and WC 21 (red) (Kreatech).
![Page 81: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/81.jpg)
t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia
Podgornik H, Cernelc P
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7) 515
Figure 4. Metaphase FISH by LSI AML1(RUNX1)/ETO(RUNX1T1) DNA probe (Abbott) with split signal for RUNX1 (green). On GTG banded metaphase normal 21 with the strong RUNX1 signal and both derivatives with split RUNX1 signals are indicated.
Comments We report the first case of t(17;21)(q11.2;q22) as
the sole anomaly in AML. This rare recurrent
abnormality has been linked to treatment related
leukemia or MDS although it has been also found
in de novo leukemia (Roulston et al., 1998; Nadal
et al., 2008). Our patient had no previous history of
cancer or preleukemia. Cytomorphology of bone
marrow cells was, however consistent with
dysplastic changes typical for s-AML. FISH
analysis with probe specific for RUNX1 has been
done in two previous cases with
t(17;21)(q11.2;q22). While in one patient RUNX1
has been lost (Nadal et al., 2008) our result
corresponds to the case of Roulston et al. (Roulston
et al., 1998) where signals from RUNX1 were split
by the translocation. Due to his age and poor
physical condition our patient was not treated by
intensive chemotherapy and he died within a month
from diagnosis.
References Roulston D, Espinosa R 3rd, Nucifora G, Larson RA, Le Beau MM, Rowley JD. CBFA2(AML1) translocations with novel partner chromosomes in myeloid leukemias: association with prior therapy. Blood. 1998 Oct 15;92(8):2879-85
Kobzev YN, Martinez-Climent J, Lee S, Chen J, Rowley JD. Analysis of translocations that involve the NUP98 gene in patients with 11p15 chromosomal rearrangements. Genes Chromosomes Cancer. 2004 Dec;41(4):339-52
Nadal N, Stephan JL, Cornillon J, Guyotat D, Flandrin P, Campos L. RUNX1 rearrangements in acute myeloblastic leukemia relapsing after hematopoietic stem cell transplantation. Cancer Genet Cytogenet. 2008 Jan 15;180(2):168-9
This article should be referenced as such:
Podgornik H, Cernelc P. t(17;21)(q11.2;q22) as a sole aberration in acute myelomonocytic leukemia. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(7):513-515.
![Page 82: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/82.jpg)
![Page 83: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/83.jpg)
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology
Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas.
Iconography is most welcome: there is no space restriction.
The Atlas publishes "cards", "deep insights", "case reports", and "educational items".
Cards are structured review articles. Detailed instructions for these structured reviews can be found at:
http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes,
http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias,
http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours,
http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases.
According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews"
(between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by
bibliographic databases.
Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length
restriction.
Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in
leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in
at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings,
and 4- with iconography of chromosomes.
It is mandatory to use the specific "Submission form for Case reports":
see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html.
Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French,
German, Italian, and Spanish are welcome.
Subscription: The Atlas is FREE!
Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].
Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to
editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members
must disclose any potential conflict.
Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If
complete anonymity is difficult to achieve, informed consent should be obtained.
Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the
cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may,
nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further
the content of their papers published in the Atlas, provided that the source is cited.
Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general
distribution. All rights are reserved. The information presented is protected under international conventions and under
national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the
Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with
commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as
the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver
convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or
otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions
of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web
site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty,
express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal
liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever
for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose,
and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to
persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein.
See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical
Publication - Updated October 2004": http://www.icmje.org.
http://AtlasGeneticsOncology.org
© ATLAS - ISSN 1768-3262
![Page 84: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/84.jpg)
![Page 85: Volume 16 - Number 7 Volume 1 - Number 1 May - September](https://reader030.vdocuments.mx/reader030/viewer/2022012800/61b5c5028143c3082c26f55f/html5/thumbnails/85.jpg)
INIST-CNRS
OPEN ACCESS JOURNAL
Atlas of Genetics and Cytogenetics in Oncology and Haematology