xxxviii

3. Materials and methods

3.1. Reference culture and growth conditions

V. anguillarum NB10 kindly provided by Dr. Sahul Hameed (Abdul Hakeem College,

India) was maintained at -80 ºC in nutrient broth containing 30% glycerol. The culture was

activated by inoculating in 5 ml of sterile trypticase soya broth 1% salt (TSBS) and incubated

overnight at 28 oC. A loopful was subcultured into thiosulphate citrate bile salt sucrose agar

(TCBS) supplemented with 1% NaCl and the plates incubated at 28 oC for 48 h. Isolated

colonies on TCBS agar were subcultured on trypticase soy agar (TSA) supplemented with 1%

NaCl and maintained in slants for further work. Escherichia. coli (QIAGEN EZ) and E. coli

SG13009 competent cells were grown in Luria Bertani (LB) medium supplemented with

ampicillin (100 mg l-1) and kanamycin (25 mg l-1) incubated at 37 oC.

TSBS broth

The Tryptic Soya broth prepared by dissolving the dehydrated medium according to the

manufacturer’s (Hi Media, Mumbai, India) instructions in distilled water and supplementing

with 1% NaCl (TSBS). 10 ml portions were dispensed in clean tubes. The sterilization was

carried out by autoclaving at 121 ºC for 15 min.

TCBS

The TCBS medium was prepared by adding the dehydrated powder into sterile distilled

water according to the manufacturer’s (Hi Media, Mumbai, India) instructions and

supplementing with 1% NaCl. The medium was boiled on gentle flame and continuous mixing.

After cooling to 50 ºC, 20 ml portions of the media were poured in sterile plate.

xxxix 3.2. Fish samples

Marine fish (Rastrelliger kanagurta, Epinephalus diacanthus, Cynoglossus sp. and

Muraenesox sp.) exhibiting hemorrhage on their surface were collected from the wild (at

Mangalore landing center, west coast of India). Diseased and moribund fish (Etroplus

suratensis and Latus calcarifers) were collected form estuarine farms and hatchery in Kumta,

Karnataka, India and from wet lab tanks in college of Fisheries, Mangalore, Karnataka, India.

Fish were rinsed with sterile physiological saline to get rid of all the external contaminants.

Representative samples of liver, kidney and hemorrhagic muscles were collected from fish

after dissection; these samples were processed immediately for bacterial culturing.

3.3. Bacterial isolation

Tissues samples were macerated and transferred to TSBS at 30 ºC for 6 h. A loopful of

the enrichment broth was streaked on TCBS agar and plates were incubated at 30 ºC for 48 h.

Yellow colonies were subcultured for purification and further analysis.

3.4. Biochemical testes for V. anguillarum identification

The suspected colonies were processed for series of biochemical tests according to

Myhr et al. (1991) as it is illustrated in Table 1.

3.4.1. Gram staining

a) NaCl solution

The solution was prepared by dissolving 2 g of NaCl in 100 ml of distilled water and

store at room temperature.

Table 1. Typical biochemical reactions for V. anguillarum.

xl

Biochemical tests Typical reaction Gram stain Gram negative Motility test Motile Oxidase + Sensitivity to O/129 Sensitive Oxidation /Fermentation +/+ Arginine decarboxylase test + Lysine decarboxylase test - Ornithine decarboxylase test - Methyl red - Voges-Proskauer + Indole +/- * Growth at 0% salt + Growth at 3% salt + Growth at 5% salt + Growth at 8% salt -

* Majority are positive

b) Crystal Violet Solution

The solution was made through mixing the following ingredients:

Methyl violet 2 g Ethanol (95%, VWR) 20 ml Ammonium oxalate 0.5 g Distilled water 80 ml

The solution was left overnight at room temperature (RT) and filtered through a

Whatman N°1 filter paper.

c) Iodine Solution

The solution was made through mixing the following ingredients:

Iodine 1 g

Potassium Iodine 2 g

Distilled water 300 ml

The solution was left overnight at RT and filtered through a Whatman N°1 filter paper.

xli

d) Safranin Solution

The solution was made through mixing the following ingredients:

Safranin 0.25 g

Ethanol (95%) 10 ml

Distilled water 90 ml

The solution was left overnight at RT and filtered through a Whatman N°1 filter paper.

g) Procedure

The technique used during this study was adapted from Gram (1884). Briefly, part of a

fresh bacterium colony was mixed with one drop of sterile 2% NaCl solution, onto a glass slide

using a sterile metal loop. The slide was left to air dry at room temperature and was then

passed three times though flame to fix the bacteria. A few drops of crystal violet solution were

placed onto the fixed bacteria and left for 1 min. The stain was washed off under running tap

water and replaced with Iodine solution and incubated for 1 min. The slide was rinsed in

acetone, and then under running water. Safranin solution was placed onto the slide and

incubated for 2 min. Finally the slide was rinsed under running tap water and left to air dry at

room temperature. The morphology of the cells was then observed using a microscope at 100x

magnification under oil immersion.

3.4.2. Motility test

Young cultures of bacteria, grown in TSBS were tested for motility by hanging drop

technique using cavity slide.

xlii 3.4.3. Oxidase test

a) Oxidase reagent

b) Oxidase straps

Whatman filter paper No.1 was cut into strips of 2.5 x 1.0 cm, sterilized in hot air oven

at 140oC for 1 h. The strips were later dipped in prepared oxidase reagent, allowed to absorb

and then dried. The strips were stored in dark bottle at 4 ºC.

b) Procedure

Young culture (18 h old) on TSA slants were picked up using a platinum wire loop and

spotted onto moistened oxidase strips. Development of a dark purple color within 10 s was

recorded as positive.

3.4.4. Sensitivity to O/129

a) O/129 disk preparation

O/129 (2,4-diamino-6,7-diisopropyl pteridine) 150 mg

Distilled water 10 ml

O/129 compound was dissolved in water and discs of 6.5 mm diameter each (pre-

sterilized at 140 ºC for 1 h) were loaded with 10 micro liter of the solution, dried and stored at

4 ºC. Each disc contained 150 µg of the pteridine compound.

(N,N,N',N' – tetramethyl p-phenylene diamine dihydrochloride) 1.0 g

Distilled water 100 ml

xliii

b) Procedure

One colony of the bacterium under investigation was mixed in 1 ml of sterile 1% NaCl

solution and vortexed vigorously. 0.1 ml of the solution was spread onto a TSA plates

containing 2% NaCl using a sterilised glass spreader. The plate was left to dry for a few

minutes and discs of 150 μg of 0/129 were placed on center of the plate using flamed forceps.

The plate was incubated overnight at 30 °C and the size of the growth-inhibition zone was

measured. A clearing zone of 9 mm or greater around the disc was considered as a sensitive

result (Bernardet and Grimont, 1989).

3.4.5. Oxidation - Fermentation (O/F) test

Hugh and Leifson’s media prepared by mixing the below ingredients :

Peptone 2.0 g

Yeast extract 5.0 g

Sodium chloride 5.0 g

Glucose 10.0 g

Bromocresol purple 0.016 g

Agar 3.0 g

Distilled water 1000 ml

The pH was set at 7.2 and medium was boiled, dispensed into tubes and sterilized by

autoclaving at 110 ºC for 10 min. The tested culture was stabbed into the butts of two tubes

containing Hugh and Leifson’s O/F medium. One of the tubes was overlaid with sterile liquid

paraffin. Reactions were recorded after 48 h of incubation at 30 ºC as fermentative if both the

tubes turned yellow.

3.4.6. Amino acid decarboxylase test

xliv

a) Basal medium for amino acid decarboxylase test

Peptone 0.5%

Yeast extract 0.3%

Sodium chloride 1.0%

Glucose 0.1%

Bromocresol purple 0.0016%

The pH was set to 7.2. Basal medium was divided into four parts and aminoacid lysine,

ornithine and arginine were added individually to each quarter at a concentration of 0.5, 0.5

and 0.4 % respectively. The last quarter served as control. The media were distributed into

tubes, in 4 ml volumes and sterilized at 110 ºC for 15 min.

b) Procedure

A young broth culture was inoculated to each of the four tubes (control, lysine,

ornithine, arginine) and overlaid with sterile liquid paraffin. The tubes were incubated at 30 ºC

for 3 days and results recorded. A positive reaction was recorded as yellow coloration in the

control tube while the amino acid containing tubes turned yellow and returned to purple.

3.4.7. Methyl red test

The breakdown of glucose to acidic end-product by the bacteria in MR - VP broth

culture was tested after growing bacteria at 30 ºC for 48 to 72 h by adding a few drops of

alcoholic methyl red indicator. Development of a pink to red color was recorded as positive.

3.4.8. Voges - Proskauer test

The production of neutral end products like acetyl methyl carbinol (acetoin) from

glucose by the bacteria was tested by growing the organism in 5.0 ml of MR - VP broth at 30

xlv ºC for 48 to 72 h and adding VP reagents consisting of solution A (0.6 ml) and solution B (0.2

ml). Development of a port wine color was recorded as positive.

3.4.9. Indole test

a) Tryptophan broth

Tryptophan 1.0 %

Sodium chloride 1.0 %

pH was set to 7.1 and distributed in 5 ml volumes into test tubes and autoclaved at

110 ºC for 15 min.

b) Kovac's reagent

p-Dimethyl aminobenzaldehyde (DMAB) 5 g

Amyl alcohol 75 ml

Hydrochloric acid 25 ml

DMAB was dissolved in amyl alcohol and then the concentrated HCl was added slowly.

The solution was stored at 4 C in a dark bottle and used to perform the test whenever required.

c) Procedure

The cultures were grown in tryptophan broth for 24-48 h and then a few drops of

Kovac's reagent were added. Formation of a pink indole ring at the surface of culture was

recorded as a positive reaction.

xlvi 3.4.10. Salt tolerance test

This test was carried out to determine the ability of bacteria to grow at varying

concentrations of salt. Cultures were inoculated to tryptone broth containing 0 %, 3 %, 5 % and

8% sodium chloride and incubated at room temperature for 48 h.

a) Tryptone broth

Tryptone 1.0 %

Yeast extract 0.3 %

pH was set to 7.2. The ingredients were dissolved in distilled water and sodium chloride

was added to give final concentrations as mentioned above.

3.5. Storage of bacteria

3.5.1. Storage in minimal media

T1N1 agar

Tryptone 1 g

NaCl 1 g

Agar 1 g

Distilled water 100 ml

The pH was set to 7. Medium was boiled to dissolve the agar and 10 ml portions were

dispensed in clean tubes. The sterilization carried out by autoclaving at 121 ºC for 15 min.

Bacterial strains were stabbed into the tubes and overlaid with 1 cm of sterile liquid

paraffin.

xlvii

Every 6 months tubes were checked for viability by culturing the bacteria onto TSA and

TSAS plates.

3.5.2. Storage at -70°C in glycerol broth

Bacteria were grown overnight in TSBS and 1ml of the solution was aliquoted into

centrifuge tubes, centrifuged at 5000 rpm for 10 min and resuspended in 1 ml of 30 % glycerol.

The different bacteria were stored at -70 °C until used.

3.6. Preparation of crude lysate from bacterial isolates

Bacterial isolates identified as V. anguillarum by biochemical tests were grown

overnight in LB broth. About 50 µl of the broth culture was diluted in 450 µl sterile TE (10

mM Tris-Cl, pH 8.0; 1 mM EDTA) buffer and heated at 98 oC for 15 min in a hot bath. The

tubes were then quickly cooled on ice. Lysates were immediately stored at -20 oC until PCR

was performed.

Luria Bertani (LB) broth

Luria Bertani broth was prepared according to manufacturer’s instructions. 10 ml

portions were dispensed in clean tubes. The sterilization carried out by autoclaving at 121 ºC

for 15 min.

3.7. Preparation of genomic DNA by (CTAB) method

DNA was extracted by the method of Ausbel et al., (1995). Bacterial isolates were

grown overnight in 5 ml of TSBS (3.3.). 1.5 ml cultures were centrifuged at 6000 rpm for 10

min. Pellets were resuspended in 567 µl TE buffer (10 mM TrisCl, pH 8; 1 mM EDTA), 30 µl

of 10 % SDS and 3 µl of 20 mg\mL proteinase K and incubated at 37 ºC for 1hr in water bath.

xlviii Then 100 µl of 5 M NaCl and 80 µl N-Cetyl N, N, N-trimethylammonium bromide

(CTAB\Nacl) solution was added and incubated at 65 ºC for10 min. Later an equal volume of

24:1 chloroform isoamyl alcohol was added, mixed and centrifuged for 5 min at 10,000 rpm.

The supernatant was transferred into a new tube and equal volume of 24:1:25 phenol

chloroform isoamyl alcohol was mixed and centrifuged at10000 rpm for 5 min. The

supernatant was gently mixed with 0.6 volume of isopropyl alcohol. DNA was precipitated by

centrifugation at 10000 rpm for 5 min and the supernatant was discarded. DNA pellets were

washed with 1ml of 70 % alcohol and centrifuged at 10,000 rpm for 5 min. DNA pellets were

then dried in vacuum drier and dissolved in 100 µl of TE buffer. DNA was stored at -20 ºC

after evaluation of purity and concentration.

3.8. DNA concentration and purity

The concentration and purity of DNA was determined by nanoDrop 1000. Also the

same was checked by electrophoresis using 0.8 % agarose gel.

3.9. PCR reaction

The PCR reaction mixture consisted of 5 l of 10X buffer (100 mM HCl pH 8.3) 20

mM MgCl2, 500 mM KCl, 1% gelatin), 200 M concentrations each of deoxyribonucleotide

triphosphates (dATP, dTTP, dGTP and dCTP), 0.5 l of each primer, template genomic DNA,

150-200 ng and 1.5 units of Taq polymerase. The primer sequences are given in Table 2, 3 and

4. PCR was run in a programmable thermocycler having an initial delay at 95 °C for 10 min

and final delay at 72 °C for 10min followed by 30 cycles of denaturation at 95 °C for 1min,

annealing at 55 to 57 °C for 1min followed by extension at 72 °C for 1 min. PCR amplified

product was resolved in a 1.5% agarose gel by electrophoresis and analyzed using gel

documentation system.

xlix 3.9.1. Detection of PCR by agarose gel electrophoresis

10 μl of PCR product were mixed with 3 μl of sample loading buffer. The product was

resolved on 2 % agarose gel, at constant 120 V in 1X Tris-acetate-EDTA (TAE) buffer stained

with ethidium bromide 0.5 μgml-1. The results were documented using gel documenting

system.

3.9.2. Preparation of 1.5% agarose gel

1.5 g of agarose was added to 100 ml of 1X TAE buffer and dissolved by boiling.

Cooled to 50 oC, then ethidium bromide was added to a final concentration 0.5 g ml-1.

TAE buffer

Tris base 242 g

Glacial acetic acid 57.1 g

0.5 M EDTA 100 ml

The solution has made up to final volume of 1000 ml by distilled water.

Sample loading buffer

Bromophenol blue 0.25 g

Sucrose 40 g

Distilled water 100 ml

Table 2. Primers used for amplification DNA for cloning with illustration of name and

source of the gene

l

Primer Gene and organism Primer sequence Accession number

VaAMI-B F amiB V. anguillarum ACAT CATCCATTTGTTAC ABD85291

VaAMI-B R amiB V. anguillarum CCTTATCACTATCCAAATTG ABD85291

Table 3. Primers used for DNA amplification of cloning with illustration of name and

source of the gene.

TabTable 4. Primers used for DNA amplification of cloning in expression vector with

illustration of name and source of the gene

Primer Gene and organism Primer sequence Accession number

VaOMP-U F1 ompU of V. anguillarum GGTGAGCTATACAACCAAGAC FJ573227

Primer Gene and organism Primer sequence Accession number

VaOMP-U F ompU of V. anguillarum ATGAACAAAACTCTGATTGCT AY605929

VaOMP-U R1 ompU of V. anguillarum TTA GAA GTCGTAACGTAGACC AY605929

VaOMP-K F ompK of V harveyi ATGCGTAAATCACTTTTAGCT GU318333

VaOMP-K R1 ompK of V harveyi TTAGAACTTGTAAGTTACTGC GU318333

VaOMP-V F4 ompV of V. cholerae ATGAAAAAGATCGCACTATT D86078

VaOMP-V R3 ompV of V. cholerae TTAAAAGTGGTAAGCGACG D86078

li VaOMP-U R1 ompU of V. anguillarum TTA GAAGTCGTAACGTAGACC AY605929

VaOMP-K F1 ompK of V. anguillarum GCAGATTACTCTGACGGCGAT FJ705222

VaOMP-K R1 ompK of V. harveyi TTAGAACTTGTAAGTTACTGC GU318333

VaOMP-V F3 ompV of V. anguillarum GCCCAAACGTACATTCGTAA GU723694

VaOMP-V R3 ompV of V. cholerae TTAAAAGTGGTAAGCGACG D86078

Table 5. Primers used in Real time PCR

Primers Sequences Amplified gene F-k502: GGCTTCCAAATTTCAACCAA ompK partial sequence+ R-k699: TTTAAGGCCGTAGCCAACAG ompK partial sequence

F-rpoA CGTAGCTGAAGGCAAAGATGA alpha subunit of RNA polymerase++

R-rpoA AGCTGGAACATAACCACGA alpha subunit of RNA polymerase

+ Target gene, ++ Housekeeping gene

3.9.3. Purification of PCR products

The PCR products were purified to get rid of contaminants like Taq DNA polymerase,

primer dimers and unused dNTPs, which may interfere with subsequent process. The PCR

purification was carried out by QIAquick PCR purification kit. 120 μl of the PCR product were

mixed with 5 volume of PB buffer and transferred to QIAquick spin column. The column was

centrifuged at 10000 rpm for 1min and the flow through was discarded. The column was

washed two times with 750 μl of PE buffer and the flow through was discarded after

centrifugation at 10000 rpm for 1 min. The column was dried by spinning for 2 min at 10000

rpm. The DNA was eluted by adding 30 μl of elution buffer to the column and centrifuged for

1 min at 10000 rpm.

3.10. Cloning

lii 3.10.1. Ligation with cloning vector

QIAGEN PCR cloning kit was used for cloning ompU, ompK and ompV genes. PCR

was done by using the cloning primers (Table 3). Ligation reaction was carried out by using

fresh purified PCR product (6.9.3) and following the instructions of manufacturing company as

detailed below:

pDrive Cloning Vector (50 ng/μl) 1 μl

PCR product 1 μl

Ligation Master Mix (2x) 5 μl

Distilled water 4 μl

The mixture was incubated at 16 ºC for 2 h. and stored at -20 ºC.

3.10.2. Transformation

100 μl QIAGEN EZ competent cells was thawed of on ice for 10 min. 5 μl of ligation-

reaction mixture was added to the competent cell, mixed gently and incubated on ice for 5 min.

the cell were subjected to heat shock at 42 ºC for 1 min followed by 2 min incubation on ice.

250 μl SOC medium preheated to room temperature was added and incubated for 1 h. in 37 ºC

with vigorous shaking. 100 μl and 50 μl portions of the transformation mixture was spread

onto LB agar plates containing 100 μg ml-1 ampicillin and incubated at 37 °C for 18 h. LB

media were prepared using dehydrated medium (Hi Media, Mumbai) and sterilized by

autoclaving at 121 ºC for 15 min. After cooling to 50 ºC, antibiotics were added and 20 ml

portions of the media poured in sterile plate.

3.10.3. Screening for the desired clone

Transformants were randomly selected and screened for the presence of insert by PCR

using gene-specific primers (Table. 3). Crude lysates from transformants were prepared as

described earlier (3.6). Briefly, each of the selected colonies were inoculated to 5 ml of LB

liii broth containing antibiotics (100 μg ml-1 ampicillin) and incubated overnight at 37 ºC. To 50 µl

of the culture, 450 µl of TE buffer was added, cells were lysed at 98 ºC for 15 min and snap

cooled on ice. 2 µl of supernatant was used as template for PCR.

3.11. Sequencing

The ompU, ompK and ompV genes were cloned into pDrive cloning vector and sent for

sequencing (Bangalore genei, Bangalore, India) and confirmation of cloned genes.

3.12. Bioinformatics analysis

3.12.1. Primer designing

Primers were designed using Primer 3 software (http://biotools.umassmed.edu/bioapps

/primer3 www.cgi). The target DNA sequences were loaded into the program and the resulting

optimum primers couples were chosen as were given in table 2, 3, 4 and 5.

3.12.2. Signal peptide Identification

Signal peptides were predicated by SignalP server

(http://www.cbs.dtu.dk/services/SignalP/). The protein sequences were loaded into the

program and the predicted signal peptides located. The codons that encode for the signal

peptides were eliminated during the synthesis of the forward primers used for amplification

reactions of expression cloning (table 4).

3.12.3. Outer membrane protein sequence similarity

Deduced amino acid sequence similarity of OmpU, OmpK and OmpV of V.

anguillarum with that of other closely related bacterial outer membrane proteins was analyzed

using BLAST (http://www.ncbi.nlm. nih.gov/BLAST). Multiple sequence alignment was

performed using CLUSTAL (Corpet, 1988).

liv

3.12.4. Outer membrane protein secondary structure prediction

Prediction of transmembrane segments and topology server (PRED-TMBB)

(http://bioinformatics.biol.uoa.gr/PRED-TMBB) was used for predicting the transmembrane

strands and the topology of OmpU, OmpK and OmpV. The proteins sequences without the

signal peptides were loaded into the program and the resulting structures were documented for

further analysis.

3.12.5. 3 D structure of the recombinant protein

SWISS-MODEL server (http://swissmodel.expasy.org/) was used for generate

preliminary three-dimensional models of the target structure based on the alignments proposed

by all servers. The protein sequences (OmpU, OmpK and OmpV) were uploaded into the

program and the results were documented for further analysis.

3.12.6. Prediction of antigenic determinants

European molecular biology open software suite (http://bips.u-strasbg.fr/EMBOSS/)

was chosen to predict the antigenic site in the OmpU, OmpK and OmpV. Minimum length of

antigenic region was set to be 6 amino acids while minimum score of the antigenic site was set

to 1. The FASTA format of the amino acid sequences of OmpU, OmpK and OmpV were

loaded in the server after deletion of signal peptide sequences. The resulting antigenic sites

were marked on the initial proteins sequences together with the external loop peptides based on

the result of secondary structure. BCPREDS server

(http://ailab.cs.iastate.edu/bcpreds/index.html) was adopted for B-cell epitopes prediction.

Protein sequences of OmpU, OmpK and OmpV were loaded in the server after deletion of

signal peptide sequences. Minimum epitope length chosen to be ≤ eight 85 % specificity. The

lv epitopes that score ≤ 0.95 were considered. The B-cell epitope sequences were marked on the

initial proteins sequences.

3.12.7. Phylogenetic tree construction

Phylogenetic tree were constructed using the MEGA4 program and inferred based on

the UPGMA method (Tamura et al., 2007). Nucleotide sequence of ompU from V.

anguillarum, V. cholerae (ZP 01983620), V. vulnificus (AEE98101.1), V. mimicus (ZP

06039969.1), V. metschikovii (ZP055880742.1), V. alginolyticus (ACR228855.1)

and V. harveyi (ADR 22855.1) were downloaded from the GenBank and uploaded into suitable

alignment program and the results were analyzed by MEGA4 program and the constructed

phylogenetic tree was recorded. Similarly the sequence of V. anguillarum ompK and those of

V. cholerae (ZP 01951173.1), V. vulnificus (NP 7606911.1), V. mimicus (ZP 05715986.1), V.

alginolyticus (ZP 06180292.1) and V. harveyi (ADB 92036.1) were retrieved from the

GenBank and uploaded into suitable alignment program and the result was uploaded and

analyzed by MEGA4 program and the constructed phylogenetic tree was recorded. Finally the

sequence of V. anguillarum ompV with those of V. cholerae (NP 230962.1), V. crorallilyticus

(NP 7606911.1), V. mimicus (ZP 05722371.1), V. alginolyticus (ZP 01259420.1) and V.

parahaemolyticus (ZP 05887673.1) were retrieved from the GenBank and uploaded into

suitable alignment program and the result was uploaded and analyzed by MEGA4 program and

the constructed phylogenetic tree was recorded

3.13. Cloning for expression

3.13.1. Ligation with expression vector

lvi

The QIAexpressionist kit was used for cloning ompU, ompK and ompV genes. PCR was

done by using the expression primers (Table 4). Ligation reaction carried out by using fresh

purified PCR product (6.9.3.) and following the instruction of manufacturing company as

detailed below:

pQE-30 UA (50 ng/μl) 1 μl

PCR product 1 μl

Ligation Master Mix (2X) 5 μl

Distilled water 4 μl

The mixture was incubated at 16 ºC for 2 h. and stored at -20 ºC.

3.13.2. Transformation

100 μl QIAGEN SG13009 competent cells were thawed of on ice for 10 min. 5 μl of

ligation-reaction mixture was added to the competent cell, mixed gently and incubated on ice

for 5 min. The cells were subjected to heat shock at 42 ºC for 1 min followed by 2 min

incubation on ice. 250 μl SOC medium preheated to room temperature was added and

incubated for 1 h. in 37 ºC with vigorous shaking. 100 μl and 50 μl portions of the

transformation mixture was spread onto LB agar plates containing 100 μl ml-1 ampicillin and

kanamycin 25 μl ml-1 and incubated at 37°C for 18 h. onto LB agar plates

3.11.3. Screening for the desired clone

Transformants were randomly selected and screened for the presence of insert by PCR

using gene-specific primers (Table 4). Crude lysates from transformants were prepared as

described earlier (3.6.). Briefly, each of the selected colonies were inoculated to 3ml of LB

broth containing antibiotics (100 μl ml-1 ampicillin and 25 μl ml-1 kanamycin) and incubated

overnight at 37 ºC. To 50 µl of the culture, 450 µl of TE buffer was added, cells were lysed at

98 ºC for 15 min and snap cooled on ice. 2 µl of supernatant was used as template for PCR.

lvii

3.13.4. Checking for the orientation of the insert

Transformants with the desired insert were examined for being constructed in a correct

orientation, by PCR amplification by using the forward primer of the desired gene and the

reverse primer pQUE30 (GGTCATTACTGGAGTCTTG).

3.14. Recombinant protein expression

3.14.1. Protein expression

To check the expression, ompU, ompK and ompV positive clones with correct

orientation were inoculated in to 5 ml of LB medium containing antibiotics (100 μg ml-1

ampicillin and 25 μg ml--1 kanamycin) and incubated overnight at 37 ºC with constant

agitation at 150 rpm. From the overnight grown cultures, 0.5 ml of broth was inoculated into

10 ml of LB broth (100 μg ml--1 ampicillin and 25 μg ml--1 kanamycin) incubated at 37 ºC with

constant shaking till it reached an OD600 of 0.6. The cultures were induced 1mM IPTG and

further incubated for 4 h with the same conditions. Uninduced recombinant clone and E. coli

SG13009 cells were used as controls. From each sample 1.5 ml of culture was centrifuged at

6000 rpm for 10 min and the supernatant was discarded. The pellet was resuspended in 50 µl

distilled water and 50 µl of 2X sample buffer by continuous vortexing and lysed at 98 ºC for 15

min in a dry bath. Then samples were loaded onto the discontinuous polyacrylamide gel.

Isopropylthio- β-D-galactoside (IPTG, 1 M)

Stock solution was prepared by dissolving 2.3 g of IPTG in 10 ml of distilled water,

filter sterilized and aliquots were stored at -20 ºC.

3.14.2. SDS-polyacrylamide gel electrophoresis

lviii

Recombinant proteins were analysed by the method of Laemmli (1970) using SDS-

PAGE with minor modifications. The various buffers and reagents used are as follows:

A) Acrylamide-bisacrylamide mixture

Acrylamide 30 g

Bisacrylamide (N, N’-methylene bisacrylamide) 0.8 g

Distilled water 80 ml

The volume was made up to 100 ml and stored at 4 ºC.

B) Separating gel buffer (1.5 M Tris-Cl, pH-8.8)

Tris base 181.7 g

Distilled water 800 ml

pH was adjusted using concentrated HCl. Then final volume was made up to 1000 ml

with distilled water and stored at 4 ºC.

C) Stacking gel buffer (1 M Tris-HCl, pH-6.8)

Tris base 121.1 g

Distilled water 800 ml

pH was adjusted using concentrated HCl. Then final volume was made up to 1000 ml

with distilled water and stored at 4 ºC.

D) 10 % sodium dodecyl sulphate (SDS) solution

10 g of SDS was dissolved in 100 ml of distilled water and stored at room temperature.

E) 10% ammonium persulfate solution (APS)

1 g of APS was dissolved in 10ml of the distilled water and stored at 4 ºC temperature.

APS decomposes slowly and hence solution was stored not more than a week.

lix

F) N,N,N’,N’-tetramethylethylenediamine (TEMED)

Electrophoresis grade TEMED stored at 4 oC was used.

G) Electrode buffer (10X)

Tris base 3.02 g

Glycine 18.8 g

Distilled water 800 ml

SDS 10 % 100 ml

Final volume was made up to 1 liter with distilled water and stored at room

temperature.

H) SDS gel loading buffer (2X)

Tris-Cl (pH 6.8) 100 Mm

SDS 1 g

Glycerol 5.75 ml

bromophenol blue (0.1 %) 0.5 ml

pH was adjusted to 6.8 with HCl and the volume made up to 50 ml with distilled water.

This was stored at room temperature. 200 mM β-mercaptoethanol was added to buffer from 14

M stock mercaptoethanol before use.

I) Staining solution

Coomassie brilliant blue R250 2.5 g

Methanol 450 ml

acetic acid 100 ml

lx

Solution was mixed, filtered and volume was made up to 1000 ml with distilled water.

Solution was stored at room temperature.

J) Destaining solution

Methanol 300 ml

Acetic acid 100 ml

Solution was mixed, made up to 1000 ml by distilled and stored at room temperature.

K) Standard protein molecular weight marker

A medium-range protein molecular weight marker (PMW-M) was used for

determination of molecular weights of desired protein. The molecular weight protein

standards included were phosphorylase b (97,000 Da), bovine serum albumin (66,000

Da), ovalbumin (43,000 Da), carbonic anhydrase (29,000 Da), soyabean trypsin

inhibitor (20,100 Da) and lysozyme (14,300 Da).

3.14.3. Preparation of SDS-PAGE apparatus (Sambrook et al., 1989)

Proteins were separated on 15 % resolving gel and 5 % stacking gels. Glass plates were

rinsed in absolute alcohol and cleaned using tissue paper. Spacers (1 mm) were placed on both

the sides between two plates in such a way that any bubbles could not move through that and

seated in stand and checked by water. Resolving gel mixture (Table 6) was prepared in a small

beaker with a magnetic stirrer by mixing the components for a desired concentration of

acrylamide according to the following chart (Harlow and Lane, 1998). The resolving gel was

prepared and poured up to 3\4th portion. Isobutanol was used for layering the resolving gel to

avoid the contact with oxygen and kept for solidification. After solidification, 5% stacking gel

was prepared (Table 7) (Sambrook et al., 1989). Stacking gel was poured and 1 mm comb was

lxi inserted into the staking gel and was allowed to solidify. Comb was removed and the solidified

gel with plates was fixed in gel running apparatus. Gel running tank was filled with 1X

electrode buffer and prepared samples were loaded into wells. Samples were resolved by

applying constant current of 25 mA for 2 h. After electrophoresis, the gel was transferred to a

clean container and stained overnight at room temperature with shaking. After staining, the gel

was immersed in destaining solution until a clear background was obtained. Photographs of the

gels were documented.

Table 6. Preparation of resolving gel for SDS-PAGE (15 %)

Table 7. Preparation of 5 % stacking gel for SDS-PAGE

Component Total volume 3 ml

H20 2.1

Acrylamide Mix (30 %) 0.5

Tris (1.0 M, pH-6.8) 0.38

SDS10 % 0.03

APS10 % 0.03

TEMED 0.003

3.14.4. Purification of recombinant proteins

Recombinant proteins were produced in large scale by inoculating the recombinant E.

coli in 200 ml of LB broth. The cultures of the recombinant E. coli were grown and

Solution component Component Volumes (ml)

Total volume 5.0

Deionised water 1.2

acrylamide mix (30 %) 2.5

Tris-HCl (1.5 M ,pH 8.8) 1.3

SDS 10 % (w/v) 0.05

APS 10 % (w/v) 0.05

TEMED 0.002

lxii expressions were induced by IPTG for 4 h. The DNA inserts were expressed with 6 histidine

residues as an N-terminal fusion protein. The metal binding domain in the fusion protein

allows simple one step purification using immobilized metal affinity chromatography. The

following steps were used for purification of the recombinant proteins by nickel-nitrilotriacetic

acid (Ni-NTA) affinity chromatography.

Cells were harvested by centrifugation at 6000 rpm for 10 min. Pellets were

resuspended in lysis buffer (pH 8.0) and stirred using magnetic beads for 1 h at room

temperature, followed by sonication on ice at 20-30 W with six 10 s bursts. The lysates were

centrifuged at 10000 × g for 10 min at room temperature to pellet the cellular debris. 1 ml of

50% of Ni-NTA agarose slurry was mixed with the supernatant and stirred gently on magnetic

stirrer for 1 h at 4 ºC. The lysate-Ni-NTA mixtures were loaded into polypropylene columns

and the agarose slurry was allowed to settle. Each column was washed twice with 4 ml wash

buffer (pH 6.3). The proteins were then eluted with 4ml of elution buffer (pH 4.5), dialyzed

against 10 mM Tris, pH 8.0, 0.1% Triton X-100 overnight at 4 ºC to remove guanidine

hydrochloride and purity of these proteins were analyzed on 15 % SDS-PAGE. The protein

concentration was measured by Nanodrop Spectrophotometer.

Lysis buffer (pH 8.0)

NaH2PO4 100 mM

Tris-Cl 10 mM

Guanidine hydrochloride 6 M

pH was adjusted to 8.0 using NaOH

Wash buffer (pH 6.3)

NaH2PO4 100 mM

Tris-Cl 10 mM

lxiii

Guanidine hydrochloride 6 M

pH was adjusted to 6.3 using NaOH

Elution buffer (pH 4.5)

NaH2PO4 100 mM

Tris-Cl 10 mM

Guanidine hydrochloride 6 M

pH was adjusted to 4.5 using NaOH.

3.15. Generation of polyclonal antibodies

Rabbits were immunized with 0.5 µg g-1 of purified recombinant proteins (OmpU,

OmpK or OmpV) for 5 times at 14-day intervals. The first dose was administered with

Freund’s complete adjuvant while subsequent doses were given with Freund’s incomplete

adjuvant. Rabbits were bled by cardiac puncture, 5 days after the last dose which was given

without adjuvant (booster dose). Blood were left 2 h at room temperature followed by

centrifugation at 70000 rpm for 10 min. Sera were separated from blood and stored at -20 ºC in

aliquots.

3.15.1. Titration of polyclonal antibodies

Titres of polyclonal antibodies were estimated by plate-ELISA (Engvall and Perlman's,

1971). Polystyrene ELISA plates were coated separately with 4 µg ml-1 of antigen (purified

OmpU, OmpK or OmpV recombinant proteins) in carbonate - bicarbonate buffer and

incubated at 4 ºC overnight. The excess antigen was aspirated and the plates were rinsed gently

with phosphate buffer saline (PBS). Non-specific sites were blocked by 2 % bovine serum

albumin (BSA) in PBS and further incubated overnight at 37 ºC for 3 h. The plates were

rinsed gently with PBS, and incubated for 1 h at 37 ºC with serially diluted polyclonal

antibodies in PBS. Wells containing PBS and serum from unimmunized rabbit served as

lxiv negative controls. The plates were washed twice with phosphate buffered saline tween-20

(PBST) followed by twice PBS. Plates were incubated with 100 µl/well of

horse-raddish-peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulins for 50 min at 37

ºC. After three washings with PBST and three washing steps with PBS, portions of 100 µl of

freshly prepared solution of tetramethyl benzidine hydrogen peroxide (TMB/H2O2) were added

into the wells. Incubation was carried out for 2 to 5 min at room temperature in dark and the

reaction was stopped by adding 50 µl of 5 N sulphuric acid. Enzyme activity was read at 450

nm in ELISA reader.

a) Carbohydrate-bicarbonate (coating) buffer (0.05 M, pH 9.5)

Na2CO3 16.0 mM

NaHCO3 36.9 mM

b) Phosphate buffered saline (PBS)

NaCl 137 mM

KCl 2.7 mM

Na2HPO4 10 mM

KH2PO4 2.0 mM

c) Phosphate buffered saline tween-20 (PBST)

PBS 100 ml

Tween-20 0.5 ml

a) Tetramethyl benzidine hydrogen peroxide (20X TMB/H2O2)

TMB/H2O2 was diluted 20 times in distilled water just before use.

3.15.2. Characterization of polyclonal antibodies by Western blotting

lxv

Reactivity of OmpU, OmpK or OmpV polyclonal antibodies was determined using non-

recombinant E. coli SG13009 cells, uninduced recombinant E. coli, induced recombinant E.

coli and both recombinant proteins. Western blotting was carried out as per the procedure of

Towbin et al. (1979). Visualization of band was achieved by incubation with horseradish

peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulins (Sigma, USA), followed by

development using Diaminobenzidine- hydrogen peroxide (DAB-H2O2). The following

materials were involved:

a) Nitrocellulose membrane

Nitrocellulose (NC) membrane (Pall Life Sciences, USA) was used as per the

manufacturer’s instructions.

b) Transfer buffer

Glycine 39 mM

Tris base 48 mM

SDS 0.037 %

20 % methanol was added to this solution just prior to use.

c) Blocking solution

3% (w/v) BSA (HiMedia, Mumbai) was used as a blocking solution.

d) Enzyme labeled secondary antibody

Goat anti-rabbit immunoglobulin conjugated with HRP (Bangalore Genei, Bangalore)

was used at a dilution of 1:1000 in PBS.

lxvi

e) Substrate

DAB (3-3’-diaminobenzidine tetrahydrochloride) and H2O2 (Bangalore Genei,

Bangalore) was used as a substrate.

Procedure

The immunoblotting procedure was carried out as follows:

1) Resolving the samples by SDS-PAGE

2) Transfer of separated polypeptides to a nitrocellulose membrane

3) Blocking of non-specific binding sites on the membrane

4) Addition of antibody

5) Detection

1) Resolving the samples by SDS-PAGE

The antigens were separated on a 15 % SDS polyacrylamide gel (3.14.2)

2) Transfer electrophoresis

Transfer of proteins from the polyacrylamide gel to nitrocellulose membrane was

carried out using the semidry transfer unit. Electrode plate of the semiphor unit was rinsed with

distilled water. 2 sheets of absorbent paper and one sheet of nitrocellulose membrane was cut

to the size of the gel used for electrotransfer. The transfer stack was prepared by placing a pre-

cut mylar mask (2 mm smaller than the gel from each side) on the anode in the base centering

the opening. One sheet of absorbent paper soaked in transfer buffer was placed at the centre of

the opening. Nitrocellulose membrane soaked in deionised water was placed on the absorbent

papers. The polyacrylamide gel slightly wetted in deionised water was placed carefully at one

attempt on the membrane surface. The remaining absorbent paper soaked in transfer buffer was

placed on the top of the gel completing the stack. As each layer was added, care was taken in

lxvii removing air pockets by rolling a clean test tube over them. Electrophoresis was performed

with constant voltage of 45 V for 1 h at maximum current. After electrotransfer, the

nitrocellulose membrane was taken out and rinsed with distilled water. The lane containing

molecular weight marker was cut and stained.

3) Blocking

The nitrocellulose membrane was rinsed several times with PBS. The membrane was

soaked in blocking solution at 4 °C overnight.

4) Addition of antibody

The blot was removed from blocking solution and rinsed with PBS. Then the membrane

was incubated with polyclonal antibodies to specific recombinant proteins for 1 h at 37 °C on a

rotor shaker. The blot was washed three times with PBST and three times with PBS at 5 min

intervals. After washing, the membrane was incubated with the HRP- conjugated secondary

antibody for 1 h at 37 °C.

5) Detection

The blots were washed three times with PBST and three times with PBS for 5 min each.

The reaction was developed by adding DAB and H2O2. The excess development of color was

stopped with distilled water. The result was documented by scanning the nitrocellulose paper.

3.16. Fish vaccination

3.16.1. Fish samples

lxviii

Hundred healthy non-vaccinated Labeo rohita (rohu) were obtained from a fish farm

(Mangalore, India) and transported to the wet lab in oxygenated bags. The 300 weighted fish

were housed in 9 circular tanks (1.5 m diameter and 1.5 m water depth) independent from the

main recirculation system, with uniform oxygenation system. The temperature was maintained

at approximately 25 °C. The fish were left to acclimatize for 2 weeks and fed on commercial

carp sinking pellets at 1 % of their body weight per day. The fish were anesthetized with

tricaine methanesulfonate (80 μg ml-1) before any handling.

3.16.2. Vaccine preparations

3.16.2.1. Recombinant protein vaccines

The purified recombinant protein OmpU, OmpK and OmpV solutions (3.14.5) were

mixed with freund’s incomplete adjuvant in the ratio (1:2), boosting preparation of the

recombinant protein vaccines carried out through mixing the PBS with the recombinant protein

solutions in the ratio of 1:1.

3.16.2.2. Heat killed vaccine

Young culture of V. anguillarum was inoculated to TSBS media (3.3) and incubated at

25 ºC for 24 h. Bacteria were pelleted by centrifugation at 6000 rpm for 10 min and washed

twice with PBS (3.15.1). The pellet was resuspended in one tenth volume of the original

culture using PBS and kept for 3 h in water bath at 70 ºC with gentle shaking. To confirm heat

killing effect, 1 ml of suspension was inoculated in 5ml of TSBS and incubated for overnight

at 25 ºC. The total protein level present in heat killed suspension was estimated using

Nanodrop Spectrophotometer. The heat killed bacterial solution was mixed with freund’s

lxix incomplete adjuvant in the ratio (1:2) for vaccination whereas the boosting dose was prepared

only with PBS in ratio of 1:1.

3.16.3. Lethal dose 50 (LD50) estimation

Five groups of 6 unvaccinated fish in each group were placed in 5 tanks (1 m diameter,

0.6 m height). The fish were injected intraperitoneally with V. anguillarum bacterial dose

(1x108, 3x108, 1x109, 3x109 and normal saline as control). The injected fish were monitored for

five days post injection and mortalities were recorded for each tank.

3.16.4. Vaccination schedule

Five groups of fish were vaccinated by intraperitoneal injection. Fish were injected with

heat killed bacteria, OmpU, OmpK and OmpV at 2 time point, 1 day and 15 days. The time

periods and the dosages are illustrated in table 8.

Table 8. Fish vaccination and challenging schedule

Periods Groups Day 1 Day 15 (Booster dose)

Positive control Heat killed bacteria (protein

concentration300 μg) + FIA

Heat killed bacteria (protein

concentration300 μg)+ PBS

Negative control PBS+ FIA PBS

OmpU 300 μg OMPU+ FIA 300 μg OMPU

OmpK 300 μg OMPK+ FIA 300 μg OMPK

OMPV 300 μg OMPV+ FIA 300 μg OMPV

lxx 3.16.5. Challenge study

The vaccinated fish were challenged after 45 days from the first vaccination injection.

The challenge was carried out by intraperitoneal injection of 5X lethal dose 50 of pathogenic

V. anguillarum. The fish were monitored for a week after the challenge and the mortality in

each group were recorded.

3.16.6. Protection efficiency

The protection efficiency of each vaccine was estimated by calculating the relative

percentage of survival (RPS) of each group according to the bellow equation.

RPS= 1 -

3.16.7. Serum collection

Blood was rapidly collected from the caudal vein using a 2 ml syringe and dispensed

into 15 ml collection tubes. To avoid clotting of blood inside the syringes, before blood

collection they were rinsed with anticoagulant solution (0.1% Na-citrate). Blood was collected

at 3 different time points; sample 1 was collected 10 days after vaccination, sample 2 and 3

were collected 5 and 15 days respectively after boosting. The blood was allowed to clot at

room temperature for 2 h and then serum was collected after centrifugation at 6000 rpm for 10

min. The serum stored at -20°C.

3.16.8. Serum inhibitory assay

An overnight culture of V. anguillarum was adjusted to 104 CFU ml-1 in PBS. 10 μl of

the bacterial suspension was transferred to a macrophage tube, and 190 μl of the undiluted fish

Percentage of mortality of vaccinated fish X 100

Percentage of mortality of control fish

lxxi serum was added to the bacterial inoculate. Serum collected from PBS injected fish was used

as control. The solution was mixed thoroughly and placed at 25 ºC for 24 h. After incubation a

10-fold serial dilution of serum containing bacteria was prepared for each mixture and 100 μl

aliquot of each dilution was plated onto TSAS plates and incubated at 25 ºC for 24 h. Bacterial

colonies were counted and the values were expressed as log10 CFU ml-1. Reduction in

bacterial count was obtained by subtracting the logarithm of the bacterial count of each sample

with the mean logarithm bacterial count of the control group.

3.17. Real time PCR study for the ompK gene function

3.17.1. Effect of growth conditions

The experiment was carried out in 100 ml TSB after inoculating it with 1 ml overnight

culture followed by incubation at 28 °C. To determine the effect of culture conditions on

expression of ompK, samples were drawn at different time intervals; 5 h (kept as control), 10 h,

20 h and 30 h. To study the effect of NaCl, bacteria were grown in TSB supplemented with

following NaCl concentrations; 1% (chosen as control), 2 %, 3 % and 4 %. To study the effect

of bile salts, the cultures were grown in media containing 0.1 %, 0.2 %, and 0.4 % bile salts,

and also grown in media free of bile salt (taken as control). The effect of O positive human

blood (procured from blood bank) was determined by using 1 %, 2 % and 4 % of fresh blood;

culture grown in media without blood was taken as control. The effect of iron chelating agent

2, 2’-bipyridine was studied by growing the bacteria with or without 20 m M-1 2, 2’-bipyridine.

Effect of a combination of 1% blood with 20 m mol-1 and 100 m M-1 of 2, 2’-bipyridine was

also included in the study.

3.17.2. RNA extraction

RNA extraction and purification was carried out using the RNeasy Protect Bacteria

Mini kit (QIAGENE, USA) Protocol was followed as described in manual. Briefly,

lxxii 1. Bacterial cells were collected by centrifugation of 1 ml of the bacterial cultures at 6000

rpm for 10 min.

2. 150 µl of lysozyme (1 mg ml-1) was added to each bacterial pellet and incubated at room

temperature for 10 min. During incubation each 2 min time interval pellet was

homogenized by vortexing.

3. 350 µl of buffer RLT (containing 10 µl ml-1 B- mercaptoethanol) was added and the

mixture vortexed to disrupt it as much as possible.

4. 250 µl of 99% ethanol was added to each tube containing homogenized cells and the

contents mixed well by pipetting and transferred onto RNeasy mini column.

5. The column was centrifuged at 10,000 rpm for 30 sec. The flow through was discarded.

6. 700 µl of Buffer RW1 was added to the column and centrifuged at 10000 rpm for 30 sec

and the flow through was discarded.

7. The column was transferred into new sterilized 2 ml collection tubes and 500 µl of buffer

RPE was added to the column, and centrifuged at 10,000 rpm for 30 sec and the flow

through was discarded. This step was repeated followed by centrifugation at 10000 rpm

for 2 min.

8. The RNeasy column was transferred into a new 1.5 ml RNA free microfuge tube and 50 µl

of RNase free water was added directly onto the column and centrifuged at 11,000 rpm for

1 min.

3.17.3. Degradation DNA contaminant from RNA

Degradation DNA carried out with DNase I according to manufacturer’s guidelines to

get rid of any remaining DNA.

Master Mix was prepared with 1 µl of DNase (1 U), 1 µl of RNase inhibitor (40 U µl-1)

and 5 µl of 10X reaction buffer. 43 µl of template RNA was mixed with this master mix and

incubated at 37 °C for 30 min. The reaction was stopped by incubating with 1 µl EDTA

lxxiii (25mM) at 65 °C for 10 min. The complete degradation of DNA was confirmed by PCR using

the DNAse treated RNA.

3.17.4. cDNA synthesis of gene of interest

Reverse transcription was carried out according to the protocol of Fermentas Life

Sciences (Fermentas International Inc., Canada). Briefly, the RNA was reverse transcribed to

cDNA from 2 μg of RNA using 2 μl of reverse primer (100 ng μl-1) and 0.5 μl of RevertAid H

minus (Fermentas International Inc., Canada) at 42 °C for 1 h. The reaction mixture was

incubated at 42 °C for 60 min. cDNA of ompK was tested by PCR using primers F-k502, and

R-k699 and cDNA of the internal standard gene (rpoA subunit) was tested by PCR using

primers F-rpoA and R-rpoA. cDNA samples were stored at -20 °C for further use.

Real time PCR primers

Specific primers for ompK and rpoA genes were designed using primer3 design

software (table 5). Primers were resuspended in steriled Milli-Q water to a concentration of

100 pmol µl-1. 2.5 pmol µl-1 primers were used as working concentration.

Internal standard selection for real-time PCR

An appropriate gene for use as an internal standard and normalisation of data must be

selected. For this experiment rpoA gene of V. harveryi has used as an internal standard

(Defoirdt et al., 2007). To monitor rpoA gene expression, its specific primers were designed

(table 5).

lxxiv 3.17.5. Primer optimization

Separate mastmix were prepared for different concentration of primers (100 nM, 200

nM and 300 nM). 25 µl mastermix was prepared for each reaction (Table 9) and added to each

well of 96 well real-time PCR plate. Then the plate was sealed and centrifuged at 2000 rpm for

5 min. The thermal cycling conditions were set up for the 7300 fast real time PCR system

(Applied Biosystems, USA) as described, initial activation at 50 oC for 2 min, initial

denaturation at 95 oC for 10 min followed by 45 cycles of denaturation at 95 oC for 15 s,

primer annealing at 60 oC for 45 s and elongation at 72 oC for 30 s.

Table 9. Mastermix of real-time PCR with different concentration of primers

Mastermix preparation for each gene (for one sample) Ingredients

100 nM primer 200 nM primer 300 nM primer

SYBR green 12.5 µl 12.5 µl 12.5 µl

Forward primer 1 µl 2 µl 3 µl

Reverse primer 1 µl 2 µl 3 µl

SYBR green 12.5 µl 12.5 µl 12.5 µl

Forward primer 1 µl 2 µl 3 µl

3.17.6. Amplification efficiency validation

Validation of the real-time PCR was done by amplifying of serial dilutions of cDNA

synthesized from 1µg of RNA isolated from bacterial samples to arrive at the relative

quantification using the 2-ΔΔct formula. Serial dilutions of cDNA were subjected to real-time

PCR using gene specific primers. ΔCT was calculated (average CT value of target - average CT

value of house keeping gene) for the different dilutions and plotted against the cDNA

concentration. The slope of the graph was near 0 for all the target genes confirming that the

lxxv amplification efficiencies of the primers used in the study were equal thus enabling us to use

the relative quantification using the 2-ΔΔct formula.

3.17.7. Amplification by real-time PCR

The appropriate primer concentration for all genes was determined for subsequent real-

time PCR. Dissociation curve analysis was performed for each gene to check for the

amplification of untargeted fragments. The mix contained 12.5 µl of 2 x SYBR green master

mixes, appropriate volumes of forward and reverse primers and 5 µl of template cDNA.

Volume of each reaction mixture was adjusted to 25 µl by adding sterile RNase free water. The

reaction was performed in a 7300 fast real-time PCR system with initial activation at 50 oC for

2 min, initial denaturation at 95 oC for 10 min followed by 45 cycles of denaturation at 95oC

for 15 s, primer annealing at 60oC for 45 s and elongation at 72 oC for 30 s. Data acquisition

was by 7300 SDS software (v 1.3.1) at the end of each elongation step.

3.17.8. Data analysis

Analysis of relative gene expression was performed using the 2-ΔΔct method according to

Livak and Schmittgen, (2001) after validation of the method. Briefly, the threshold cycle (CT)

indicates the fractional cycle number at which the amount of amplified target reaches a fixed

threshold. By this it was proven that the amplification efficiency of reference and the target is

almost equal, fulfilling the requirement for applying the 2-ΔΔct method. Expression of the genes

was relatived to a calibrator which was chosen for each condition in this study.

ΔΔct = (CTTarget - CT rpoA) time x - (CTTarget -CTrpoA) control. Data acquisition was performed

by end of each elongation step. The data obtained from the real time PCR were statistically

analyzed by independent sample t test. Significant level was chosen to be ≥ 0.05.