università degli studi di trieste mc... · università di udine prof. claudio santoro università...

Università degli Studi di Trieste

Graduate School in MOLECULAR BIOMEDICINE

PhD Thesis

Is bilirubin able to affect the cell cycle in Gunn rat brain?

-An in vivo and in vitro study-

María Celeste Robert

XXIV ciclo – Anno Accademico 2011

UNIVERSITA’ DEGLI STUDI DI TRIESTE

DOTTORATO DI RICERCA IN BIOMEDICINA MOLECOLARE

Ciclo XXIV

Is bilirubin able to affect the cell cycle in Gunn rat brain?

-An in vivo and in vitro study-

Settore Scientifico - disciplinare: Biologia Molecolare (Bio/11)

PhD Student:

María Celeste Robert

Doctoral program Coordinator:

Prof. Giannino Del Sal


Thesis Supervisor:

Prof. Claudio Tiribelli


Thesis Tutor:

Dr. Silvia Gazzin

Fondazione Italiana Fegato

Anno accademico 2010/2011

Supervisor:



Tutor:

Dr. Silvia Gazzin


External Supervisor:

Prof. Stefano Gustincich

Scuola Internazionale Superiore di Studi Avanzati- SISSA

Opponent:

Dr. Germana Meroni

CBM s.c.r.l

Thesis Committee:

Prof. Quattrone Alessandro

Università di Trento

Prof. Cordenonsi Michelangelo

Università di Padova

Prof. Pucillo Carlo Ennio Michele

Università di Udine

Prof. Brancolini Claudio


Dr. Benetti Roberta


Prof. Claudio Santoro

Università di Novara

This study was supported by a fellowship from the Italian Ministry of Foreign Affairs (MAE)

in Rome, Italy. In particular, I wish to thank Dr. Paola Ranocchia.

A Mariano, Susana, Gustavo, Constanza y Augusto

Que me ayudaron a recorrer este camino.

vii

CONTENTS

ABSTRACT ...................................................................................................................................... xi

PUBLICATIONS ............................................................................................................................ xiii

ABBREVIATIONS ......................................................................................................................... xiv

1. INTRODUCTION ......................................................................................................................1

1.1 Bilirubin ..............................................................................................................................1

1.1.1 Bilirubin metabolism ...................................................................................................1

1.1.2 Bilirubin Characteristics ...............................................................................................3

1.1.3 The free bilirubin theory ..............................................................................................5

1.2 Disorders of bilirubin metabolism ........................................................................................6

1.2.1 Disorders leading to unconjugated hyperbilirubinemia .................................................6

Neonatal hyperbilirubinemia ...................................................................................................6

Bilirubin encephalopathy .........................................................................................................7

Kernicterus ..............................................................................................................................8

Crigler - Najjar syndrome ........................................................................................................8

Gilbert syndrome .....................................................................................................................9

1.2.2 Disorders leading to conjugated hyperbilirubinemia .....................................................9

Dubin - Johnson syndrome ......................................................................................................9

Rotor syndrome ..................................................................................................................... 10

1.3 Bilirubin neurotoxicity ....................................................................................................... 10

1.4 The Gunn rat ..................................................................................................................... 12

1.5 The cerebellum .................................................................................................................. 15

1.6 The cell cycle .................................................................................................................... 18

1.6.1 Cell cycle regulation .................................................................................................. 19

1.6.2 Cell cycle and apoptosis ............................................................................................. 20

1.7 Cryopreservation ............................................................................................................... 22

2. AIMS OF THE STUDY ............................................................................................................ 25

3 MATERIALS & METHODS .................................................................................................... 27

3.1 Materials, Chemicals and Reagents .................................................................................... 27

3.2 in vivo and in vitro bilirubin effect on cell cycle ................................................................. 28

3.2.1 Animals ..................................................................................................................... 28

CONTENTS

viii

3.2.2 Rat cerebella dissection .............................................................................................. 28

3.2.3 Primary cell cultures .................................................................................................. 29

Primary astrocyte cultures ..................................................................................................... 29

Primary cerebellar granule cultures ........................................................................................ 30

UCB solutions and Bf measurements ..................................................................................... 31

Culture and treatment conditions ........................................................................................... 32

Cell viability after UCB treatment ......................................................................................... 32

3.2.4 Gene expression analysis ........................................................................................... 33

RNA extraction ..................................................................................................................... 33

mRNA Quantification by Real-Time RT-PCR ....................................................................... 33

3.2.5 Protein expression analysis ........................................................................................ 35

Protein extraction .................................................................................................................. 35

Western blot .......................................................................................................................... 35

3.2.6 Cell cycle analysis by FACS ...................................................................................... 38

Cell dispersal and fixation ..................................................................................................... 38

Staining and analysis ............................................................................................................. 39

3.2.7 in vitro analysis of apoptosis/ necrosis by FACS ........................................................ 40

3.3 Neural cells cryopreservation ............................................................................................. 40

3.3.1 Equipment for sample freezing ................................................................................... 40

3.3.2 Primary cerebellar granule cells cultures .................................................................... 42

3.3.3 Cryopreservation........................................................................................................ 42

Freezing conditions ............................................................................................................... 42

Rewarming conditions ........................................................................................................... 44

3.3.4 Viability after rewarming ........................................................................................... 44

3.4 Statistical analysis ............................................................................................................. 45

4 RESULTS ................................................................................................................................. 46

4.1 in vivo bilirubin effect on cell cycle ................................................................................... 46

4.1.1 Gene expression ......................................................................................................... 46

Selection of reference genes .................................................................................................. 46

mRNA expression of cell cycle regulators ............................................................................. 47

4.1.2 Protein expression ...................................................................................................... 48

Protein expression of cell cycle regulators ............................................................................. 48

Parp-1 cleavage analysis ........................................................................................................ 50

CONTENTS

ix

4.1.3 Cell cycle analysis by FACS ...................................................................................... 50

Cell cycle progression during development ............................................................................ 50

Bilirubin effect on cell cycle progression ............................................................................... 51

4.2 in vitro bilirubin effect on cell cycle................................................................................... 53

4.2.1 Bf and UCB solutions ................................................................................................ 53

4.2.2 Cell viability after UCB treatment .............................................................................. 54

Primary astrocytes culture ..................................................................................................... 55

Primary cerebellar granule culture ......................................................................................... 57

4.2.3 Gene expression analysis ........................................................................................... 58



4.2.4 Cell cycle analysis ..................................................................................................... 61



4.2.5 Apoptosis/ necrosis analysis in astrocyte primary culture............................................ 63

4.3 Neural cells cryopreservation ............................................................................................. 65

Proportion of cryoprotective agent ......................................................................................... 65

Freezing and rewarming conditions ....................................................................................... 66

5 DISCUSSION ........................................................................................................................... 69

5.1 Bilirubin effect on cell cycle .............................................................................................. 69

in vivo ................................................................................................................................... 69

in vitro .................................................................................................................................. 72

in vivo- in vitro ..................................................................................................................... 73

5.2 Cryopreservation of primary granule neurons..................................................................... 74

6 CONCLUSION ......................................................................................................................... 75

ACKNOWLEDGEMENTS .............................................................................................................. 77

REFERENCES ................................................................................................................................. 78

xi

ABSTRACT

The hyperbilirubinemic jj Gunn rat is a well established animal model for Crigler-

Najjar type I Syndrome and neonatal jaundice. Similarly to humans, they present

neurological deficits and what is more a marked cerebellar hypoplasia with a prominent

loss and degeneration of Purkinje cells and granule neurons. Since high levels of bilirubin

have been proven to arrest the cell cycle progression, we addressed the question if the

cerebellar hypoplasia observed in the hyperbilirubinemic Gunn rat could be somehow

linked to a cell cycle arrest, and if this cell cycle arrest was affecting selectively primary

cultures of astrocytes and cerebellar granule neurons.

In the in vivo study we report that the high levels of bilirubin present in the cerebellum

of hyperbilirubinemic Gunn rat cause a cell cycle arrest in the late G0/G1 phase,

characterized by a decrease in the protein expression of Cyclin D1, Cyclin A, Cyclin A1

and most importantly Cdk2. Meanwhile an increase in protein expression of total Cyclin

E, due to a rose in the levels of low molecular weight Cyclin E forms (a supposed attempt

to bypass the cell cycle arrest), was in vain.

Furthermore, we observed an increment in the 18 kDa fragment of Cyclin E

(implicated in the amplification of the apoptotic pathway) suggesting us the presence of

an increased apoptosis. Consistent with this speculation, the levels of the cleaved form of

Poly (ADP-ribose) Polymerase (PARP-1) were increased.

In the in vitro study we support the selectivity of bilirubin to damage specific cells as

cerebellar granule neurons. Cerebellar granule cells viability was more affected respect to

astrocytes in the same treatment conditions. The cell cycle was affected by high

concentration of bilirubin only in cerebellar granule cells.

We hypothesised that the characteristic cerebellar hypoplasia of hyperbilirubinemic

Gunn rat may be due to the conjunction between cell cycle arrest and apoptosis, and that

these two processes are intimately connected. Furthermore, only granule neurons cell

cycle was affected.

ABSTRACT

xii

Cryopreservation has been used routinely in prolonged storage of many mammalian

tissues. The cryopreservation of neural cells/ tissue started to be interesting after the

successful transplantation of such tissues, mainly for research. Several studies have been

performed to achieve cryopreservation of granule cells, however, for these cell types

there is no defined protocol for cryopreservation with sufficient success to enable it to be

incorporated into routine clinical practice. As we were thinking to perform cerebellar

granule cells transplantation as a way to treat Gunn rats cerebellar hypoplasia, we started

to set up a protocol for cerebellar granule cells cryopreservation using the slow-freezing

methodology.

Cerebellar granule cells were successfully cryopreserved with a protocol that involves

the use of 10 % of DMSO as cryoprotective agent, a freezing rate of 2.1°C/min, and a fast

(154.4°C/ min) rewarming at 39°C. The cells cryopreserved in this way had a good cell

viability and were kept in culture for 7 days. More experiments have to be made to

standardize this protocol.

xiii

PUBLICATIONS

List of publications

Robert MC, Furlan G, Rosso N, Tiribelli C, and Gazzin S. Alterations in the cell cycle and apoptosis

account for the cerebellar atrophy of hyperbilirubinemic Gunn rat pups. -In preparation-

Gazzin S, Zelenka J, Zdrahalova L, Konickova R, Zabetta CC, Giraudi PJ, Berengeno AL, Raseni A,

Robert MC, Vitek L, Tiribelli C. Bilirubin accumulation and Cyp mRNA expression in selected brain

regions of jaundiced Gunn rat pups. 2012 Pediatric Research, Feb 15 doi: 10.1038/pr.2012.23.

Robert MC, Gazzin S., Tiribelli, C. Bilirubin arrests the cell cycle in the Cerebellum of developing

hyperbilirubinemic Gunn rat. FEBS Journal 2011, 278 (Suppl. 1), 274.

Robert MC, Gazzin S, Berengeno A, Bellarosa C, Tiribelli C. Bilirubin modulates cell cycle in rat

cerebella. Medicina 2010, Vol. 70 (Supl. II), 84.

Berengeno A, Gazzin S, Bellarosa C, Robert MC, Tiribelli C. Does Bilirubin affect the ABCc (Mrp1)

expression in the brain of the Gunn rat?. Pediatric Research Nov. 2010 (Supl. I), 300.

Congress presentations

Gambaro SE, Gazzin S, Robert MC, Tiribelli C. Study on the role of cytochrome P450 in bilirubin-

induced encephalopathy. In abstract of poster for International Symposium on Biology and

Translational Aspects of Neurodegeneration. Venice, Italy. March 12-14, 2012.

Robert MC, Gazzin S, Tiribelli C. Bilirubin arrests the cell cycle in the cerebellum of developing

hyperbilirubinemic Gunn rat. In abstract of poster for 36th FEBS Congress Biochemistry for

Tomorrow’s Medicine, Torino, Italy. June 25-30, 2011.

Robert MC, Gazzin S, Tiribelli C. Cell cycle alterations in hyperbilirubinemic Gunn rat cerebella. In

abstract of poster for 7th Seminar Frontiers in Molecular Biology, Società Italiana di Biofisica e

Biologia Molecolare (SIBBM), Trieste, Italy. May 26-28, 2011.

Robert MC, Gazzin S, Berengeno A, Bellarosa C, Tiribelli C. Bilirubin modulates cell cycle in rat

cerebella. In abstract of poster for LV Reunión Científica Anual de la Sociedad Argentina de

Investigación Clínica (SAIC) Mar del Plata, Argentina. November 17-20, 2010.

xiv

ABBREVIATIONS

List of Abbreviations

Ara-C Cytosine-β-D-arabino-furanoside

Bf Free bilirubin

BME Basal Medium Eagle with Earle’s salts, without L-glutamine

BSA Bovine Serum Albumin

CB Conjugated bilirubin

CGC Cerebellar Granule Cell

Cll Cerebella

CNS Crigler- Najjar syndrome

Ct Cycle Threshold

div Days in vitro

DMEM Dulbecco’s Modified Eagle Medium

DMSO Dimethyl sulfoxide

FACS Fluorescence activated cell sorter

FBS Foetal bovine serum

FL Full length

FSC Forward-scattered light

jj Homozygous hyperbilirubinemic Gunn rats

JJ Homozygous normobilirubinemic Gunn rats

LMW Low molecular weight forms

LN2 Liquid nitrogen

MTT 3(4,5-dimethiltiazolil-2)-2,5 diphenil tetrazolium

P Post-natal age in days

Pi Propidium iodide

RT Room Temperature

SSC Side-scattered light

UCB Unconjugated bilirubin

UGT1A1 Uridine diphosphoglucuronate glucuronosyltransferase

1

1. INTRODUCTION

1.1 Bilirubin

1.1.1 Bilirubin metabolism

Bilirubin is produced as end product of the degradation of the protoporphyrin portion

of the heme group present in haemoglobin, myoglobin, and some enzymes. This

breakdown generates 250 to 400 mg/day of bilirubin in humans (LONDON et al., 1950).

More than 80 % of the bilirubin produced in human body derives from heme catabolism

liberated from senescent red cells, 15-20 % from the turnover of myoglobin, cytochromes

and other hemoproteins, and less than 3 % from destruction of immature red blood cells

in the bone marrow (LONDON et al., 1950; Ostrow et al., 1962).

The physiological degradation of heme group is mediated by the microsomal heme

oxygenase enzyme, which is particularly abundant in spleen and liver, principal site of

red cell breakdown. This enzyme directs the stereospecific cleavage of the α-methene

bridge of heme group to form the linear tetrapyrrole, biliverdin, carbon monoxide, and

iron (Tenhunen et al., 1968). This reaction is energy requiring, as the reduced form of

nicotinamide-adenine dinucleotide phosphate (NADPH) and molecular oxygen (O2) are

metabolized by cytochrome cP450 reductase to the oxidized form NADP (Yoshida and

Kikuchi, 1978; Wilks and Ortiz de Montellano, 1993). Once synthesized biliverdin is

converted to bilirubin (UnConjugated Bilirubin, UCB) by the cytosolic enzyme biliverdin

reductase, in the presence of NADPH (Figure 1).

As soon as bilirubin is released in the blood, and due to its lipophilicity, it must bind a

carrier molecule to be transported to the liver, where it will be modified for its subsequent

excretion. This function is accomplished by albumin that posses two binding sites for

bilirubin. Almost all the bilirubin (99.9 %) present in plasma binds tightly but reversibly

to serum albumin (Wennberg et al., 1979; Weisiger et al., 2001; Ahlfors, 2001).

INTRODUCTION

2

Figure 1: Bilirubin metabolism. Bilirubin derives from heme metabolism by heme oxygenase and biliverdin reductase.

When bilirubin-albumin complex reaches the liver, bilirubin is rapidly transferred

from plasma into the liver. At the sinusoidal surface of the hepatocyte, bilirubin

dissociates from albumin and is internalized, through mechanism not fully elucidated. It

has been proposed that bilirubin is able to diffuse through cellular membranes (Zucker et

al., 1999). There is also evidence that the hepatic uptake is saturable and occurs against a

concentration gradient, supporting the idea of a protein-mediated transport mechanism

(Cui et al., 2001). Within the aqueous environment of the hepatocyte, bilirubin is again

bound to another group of carrier proteins, mainly to glutathione- S- transferases class

alpha (ligandins) (Zucker et al., 1995). The binding to these enzymes, increases the net

uptake of bilirubin by reducing efflux from the cell.

In the endoplasmic reticulum, a specific form of uridine diphosphoglucuronate

glucuronosyltransferase (UGT1A1) catalyzes the transfer of either one or two molecules

of glucuronic acid to bilirubin, yielding mono and diglucuronides, collectively known as

conjugated bilirubin (CB) (Hauser et al., 1984; Bosma et al., 1994). This conversion is

critical since renders bilirubin water soluble and unable to diffuse across membranes.

INTRODUCTION

3

Finally, the conjugated bilirubin is excreted across the bile canaliculus by the membrane

transporter multidrug resistance protein 2 (MRP2 or ABCC2) (Kamisako et al., 1999) in

the intestinal lumen (Figure 2). Bilirubin passes through the small intestine without

significant absorption. In the colon, the glucuronide residues are released by bacterial

hydrolases, and bilirubin degraded to a large family of reduction- oxidation products,

collectively known as urobilinoids, which are mostly excreted by faeces. The conversion

of bilirubin conjugates to urobilinoids is an important natural detoxification mechanism

because it blocks the intestinal absorption of bilirubin known as enterohepatic circulation

(Poland and Odell, 1971; Lester and Schmid, 1963). Only a small proportion of

unconjugated bilirubin is reabsorbed by the intestine, returned to the liver and secreted

again to the bile.

Figure 2: Hepatic metabolism of bilirubin. (1) bilirubin is transported bound to albumin. (2) Bilirubin is dissociated from

albumin and enters hepatocytes by facilitated diffusion. (3) Binding to glutathione-S-transferases (GSts). (4) Bilirubin is

converted to mono- and diglucuronide by the action of UGT1A1. (5) Bilirubin glucuronides are actively transported into bile

by ATP dependent pump ABCC2 (MRP2). (Adapted from Roy Chowdhury et al., 2001).

1.1.2 Bilirubin Characteristics

Unconjugated bilirubin is a nearly symmetrical tetrapyrrole, consisting of two rigid,

planar dipyrrole units, joined by a methylene (-CH2-) bridge at carbon 10. The structure

thus resembles a two bladed propellor, in which the blades could theoretically be joined

INTRODUCTION

4

at different angles and each blade could rotate its bond to the methylene bridge, reviewed

by Ostrow (Ostrow et al., 1994). In the preferred “ridge-tile” conformation, the two

dipyrrinones are synperiplanar as in a partially opened book, and the angle (ϴ) between

the two planes is about 95°.

The rigid biplanar structure of bilirubin IXα, the most naturally occurring isomer

(Figure 3), with its internal hydrogen bonds, was first demonstrated in the crystalline

state by X-ray diffraction (Bonnett et al., 1978), is also the preferred conformation in

solution of UCB in water, alcohols, and chloroform.

Figure 3: The structure of bilirubin IXα-Z,Z, diacid (H2B), which consist of two slightly asymmetrical, rigid, planar

dipyrrinone chromophores, connected by a central methylene bridge. (Adapted from Pu et al. Tetrahedron 47: 6163-6170).

At physiological pH values in plasma (7.40), tissues (7.60) and bile (6.00 to 8.00)

there is a significant ionization of the –COOH groups of the natural IXα isomer of UCB

(Hahm et al., 1992), so in addition to the diacid (H2B), a proportion of UCB is present as

monoanion (HB-) and dianion (B

2-) as shown in Figure 4. The pK’a values of the –COOH

groups on the two carboxymethyl (propionyl) side chains determine the proportion of the

free UCB species at any given pH. At pH 7.40 (e.g. plasma) the preponderant form of

INTRODUCTION

5

UCB is H2B (83 %), HB- represent the 15 % and B

2- less than 1.5 % of total UCB (Hahm

et al., 1992).

1.1.3 The free bilirubin theory

In blood, the total amount of bilirubin is formed by three principal forms: albumin-

bound unconjugated bilirubin (UCB-A), conjugated bilirubin (CB) and unbound

unconjugated bilirubin (free bilirubin, Bf). The Bf represents less than 0.1 % of the

pigment found in blood (Ahlfors, 2001; Weisiger et al., 2001).

Figure 4: Proportions of unbound species of unconjugated bilirubin at pH 6.00 to 8.00, derived from partitions of UCB from

chloroform into buffered NaCl at ionic strength 0.15. (Adapted from Hahm et al., J. Lipid Res. 33: 1123-1137).

In 1959 Odell (Odell, 1959) proposed for the first time that only non-albumin-bound

bilirubin (free bilirubin, Bf) is available for transport into brain and recommended that

the measurement of Bf level would be better than total bilirubin in predicting risk for

kernicterus. However it took additional 15 years before Wennberg reports a successful

method to assess Bf in serum (Jacobsen and Wennberg, 1974). This proposal has been

successfully popularized as the “free bilirubin theory” (Wennberg, 2000; Calligaris et al.,

2007).

INTRODUCTION

6

The proportion of free UCB depends on the presence of albumin and its binding

affinity constants. If the quantity of bilirubin does not exceed the albumin binding

capacity (bilirubin/ albumin ratio is lower than 1) the maximal amount of UCB circulates

in blood bound to human serum albumin (HSA), being 435 μM (25 mg/dL) the highest

quantity of UCB transported bound to HSA (Brito, 2006). On the contrary, if the

bilirubin/ albumin ratio is more than 1, the albumin binding capacity for UCB is

exceeded and the amount of Bf sharply rises (Diamond and Schmid, 1966). In these

conditions, the Bf, which is mainly in the non-ionised (diacid, H2B) form at physiological

pH, can passively diffuse across membranes and enters into tissues (Gourley, 1997;

Zucker et al., 1999).

1.2 Disorders of bilirubin metabolism

Hepatic transport of bilirubin, as described previously, involves four distinct but

related stages: uptake from circulation, intracellular binding or storage, conjugation and

biliary excretion. In pathological situations, abnormalities in the bilirubin metabolic

pathway may cause hyperbilirubinemia. In severe inheritable disorders, the transfer of

bilirubin from blood to bile is disrupted at a specific stage, depending on which stage

abnormality occurs, hyperbilirubinemia of unconjugated or conjugated type will be

produced (Strassburg, 2010; Roy-Chowdhury, 2001).

1.2.1 Disorders leading to unconjugated hyperbilirubinemia

Neonatal hyperbilirubinemia

During the foetal development, the maternal placenta is responsible for cleaning the

bilirubin from the foetal circulation. Upon birth, this placental protection is suddenly lost,

and bilirubin clearance is totally accomplished by the infants. Just at that moment a sharp

increase in the production of unconjugated bilirubin occurs.

INTRODUCTION

7

The daily production of bilirubin is of 6-8 mg/kg in healthy term infants and 3-4

mg/kg in adults. This increase is principally due to: the shorter red blood cells life span of

newborns (70-90 vs. 120 days in adults), the immaturity of the hepatic bilirubin

conjugation (Rubaltelli, 1993). In addition, the absence of the intestinal flora in the

newborn infant lead to more non-metabolized UCB available for intestinal absorption,

increasing the enterohepatic circulation of UCB (Vitek et al., 2000). Therefore, a

significant retention of UCB occurs in almost all healthy term neonates (Gourley, 1997;

Blanckaert et al., 1976; Dennery et al., 2001).

Almost 60% of neonates become clinically jaundiced in the first week of life, with

elevated serum bilirubin levels (UCB between 5 mg/dL and 7 mg/dL) (Maisels, 2000),

that returned to normal over the next 1-2 weeks without treatment (Ostrow et al., 2003a).

This condition is known as “physiologic jaundice”.

However, neonatal physiological jaundice may be aggravated by various combinations

of: (1) augmented bilirubin production (e.g. due to haemolysis) (Stevenson et al., 2001);

(2) increased enterohepatic circulation (Gartner, 2001); and (3) hereditary defects,

prematurity, or abnormally delayed maturation of the hepatic conjugation mechanism for

UCB (Ostrow et al., 2003a; Kaplan et al., 1997). The high serum UCB levels observed in

this case, favours the entry of UCB into the central nervous system, and may cause

neurotoxicity, bilirubin encephalopathy and kernicterus.

Bilirubin encephalopathy

Bilirubin encephalopathy or BIND (Bilirubin Induced Neuronal Dysfunction) is

usually a reversible condition, particularly at the early stages, characterized by hypotonia/

hypertonia, lethargy, poor suckling, and abnormal brainstem auditory evoke potentials

(BSAEP) (Ostrow, 1987; Connolly and Volpe, 1990). This condition is caused by

moderated levels of hyperbilirubinemia (200- 300 μM; 11.7 mg/dL) (Ostrow, 1987).

Phototherapy is the preferred treatment in such cases, converts UCB to photo isomers that

can be excreted in bile and urine without conjugation. Cases not responding to

phototherapy underwent exchange transfusion (Hansen et al., 2009).

INTRODUCTION

8

Kernicterus

The term “Kernicterus” originally referred to a pathologic diagnosis typified by

staining of the brainstem nuclei and cerebellum with bilirubin in infants or children who

had manifested signs of acute or chronic bilirubin encephalopathy. The serum UCB

levels may exceed the 20 mg/dL, resulting in permanent neurological sequelae and even

death. The symptoms are: cerebral palsy and spasticity, deafness or diminished hearing,

impairment of upward gaze, and dental emamel dysplasia. Corresponding to lesions in

the globus pallidus, subthalamic nucleus, auditory and oculomotor brainstem nuclei,

respectively, with the cerebellum and hippocampus also affected (Kaplan and

Hammerman, 2005b; Ostrow, 1987; Shapiro, 2010).

Crigler - Najjar syndrome

The Crigler – Najjar syndrome (CNS) was first described in 1952 (Crigler and

NAJJAR, 1952), is a rare genetic disorder (one in 1x106 newborns) characterized by

severe non-haemolytic unconjugated hyperbilirubinemia. This syndrome is caused by a

deficiency of the UGT1A1. Different mutations in the UGT gene have been identified.

Patients affected by this disease have been classified in two groups: Crigler – Najjar type

I (CNIS) and type II (CNIIS) depending on the remaining UGT1A1 activity and the

response to phenobarbital administration.

Crigler – Najjar type I is the most severe type, characterized by the absence of

UGT1A1 and no response to phenobarbital treatment. Serum bilirubin levels typically

range from 15 to over 50 mg/dL and, if untreated with exchange transfusions and daily

phototherapy, may result in kernicterus with permanent neurological damage or death.

Currently, liver transplantation is the only definitive treatment (Van Der Veere et al.,

1996; Sampietro and Iolascon, 1999). Mutations in type I syndrome are mainly missense

mutations, nonsense mutations, mutations leading to a premature stop codon, frame shift

and splice sites, all leading to no enzyme-protein, truncated enzyme or inactive full length

enzyme (Kaplan and Hammerman, 2005a).

INTRODUCTION

9

In Crigler – Najjar type II the UGT1A1 activity is decreased and treatment with

phenobarbital reduce the serum bilirubin levels by stimulation of the UGT1A1 gene

(Arias et al., 1968), rendering this condition less severe. Due to the presence of UGT1A1

residual activity the bilirubin levels found in serum are lower (10- 20 mg/dL) than those

found in CNIS (Sampietro and Iolascon, 1999). The missense mutations found in this

cases result in partial enzyme activity (Kaplan and Hammerman, 2005a).

Gilbert syndrome

This syndrome is characterized by mild hyperbilirubinemia without evidence of

hemolysis or liver disease. It is a common, benign condition and 3-10 % of general

population is estimated to have it. Mild icterus is the only abnormal physical finding and

even this is lacking in the majority of cases. The serum bilirubin concentration in this

patients are usually less than 5 mg/dL (Sampietro and Iolascon, 1999). The most common

genetic polymorphism encountered in patients of Gilbert’s syndrome is that of an

additional TA insertion in the TATAA box of the UGT1A1 promoter, although not all

individuals homozygous for the promoter mutation manifest clinical signs of this

condition (Bosma et al., 1995; Strassburg, 2010).

1.2.2 Disorders leading to conjugated hyperbilirubinemia

Dubin - Johnson syndrome

Dubin- Johnson syndrome is a benign rare disease characterized by a chronic,

predominantly conjugated non-haemolytic hyperbilirubinemia and black pigmentation of

the liver, without other abnormalities of clinic-chemical test for liver dysfunction

(DUBIN, 1958; Shani et al., 1970). Hyperbilirubinemia reaches 50-100 μM/L but levels

exceeding 400 μM are possible (Strassburg, 2010). This syndrome is due to a nonsense

mutation of the coding region of the gene for MRP2 (ABCC2), the canalicular membrane

transporter that normally extrudes a vast number of metabolites into bile, including

INTRODUCTION

10

conjugated bilirubin. Bilirubin glucuronides reflux into blood creating a typical pattern of

conjugated hyperbilirubinemia, and are excrete by the kidneys causing bilirubinuria.

Rotor syndrome

The Rotor syndrome is a benign disease and has a strikingly similar presentation to

Dubin- Johnson syndrome. It is characterized by accumulation of conjugated bilirubin in

presence of normal liver function test, but without the liver pigmentation. It is suggest

that the underlying mechanism impaired is the hepatocellular storage of conjugated

bilirubin, which results in hyperbilirubinemia by leakage into the plasma (Berthelot and

Dhumeaux, 1978). The mode of inheritance is autosomal recessive but the association to

a specific gene has not been reported (Strassburg, 2010).

1.3 Bilirubin neurotoxicity

The reoccurrence of bilirubin encephalopathy and its occasional appearance at plasma

bilirubin levels below therapeutic guidelines (Maisels and Newman, 1998) have revived

the interest in understanding the molecular mechanism of UCB induced neurotoxicity.

Even though it is well established that only the unbound fraction of UCB in plasma

(free bilirubin, Bf) is responsible of bilirubin neurotoxicity (Calligaris et al., 2007;

Wennberg, 2000; Ahlfors and Wennberg, 2004), neither the underlying cellular and

molecular mechanism nor the selective pattern of bilirubin damage in the brain are well

understood. Since there is not a great agreement regarding which might act as a

mechanistic focal point and which be the most clinically relevant. Furthermore, most

published in vitro studies of neurotoxicity of UCB have been performed at total UCB

levels vastly higher than those seen in jaundice neonates or hyperbilirubinemic Gunn rats

(Ostrow et al., 2003b).

Bilirubin neurotoxicity is selective, certain areas of the brain and certain cell types

within these regions are more affected than others. The classic anatomic changes

observed in brain of children with extreme bilirubin encephalopathy or kernicterus

INTRODUCTION

11

consist of yellow discoloration and degenerative changes more marked in the basal

ganglia, hippocampus, cerebellum and cochlear nuclei. This pattern of involvement is

remarkably similar across term, preterm, previously well, or septic neonates, the rarely

reported adult with kernicterus, or those seen in experimental animal models as the Gunn

rat with bilirubin encephalopathy induced by displacing agents (Aono et al., 1989; Daood

and Watchko, 2006; Ostrow, 1987). The reason for the selective affinity of bilirubin for

those brain sites is uncertain; some possible explanations are: differences in lipid

composition in these areas (Cashore, 1990); accumulation and clearance of UCB (Gazzin

et al., 2012); in the metabolic rate and/ or requirements of these tissues as compared with

the rest of the brain (Ostrow, 1987; McCandless and Abel, 1980).

It has been shown that among the cells forming these tissues (neurons, astrocytes,

oligodendrocytes, and microglia), nerve cells (particularly granular cells and Purkinje

cells) are the main target for UCB cytotoxicity. In fact, several effects of UCB toxicity to

neurons have been reported either in brain sections (Danbolt et al., 1993; Hansen et al.,

1988b; Sawasaki et al., 1976), cultured cell lines (Ngai et al., 2000; Notter and Kendig,

1986), or isolated nerve terminals (Hansen et al., 1988a; Vazquez et al., 1988). Although

neurons (Notter and Kendig, 1986) have been suggested as more susceptible than

astrocytes, more recent reports describe compromised astrocyte function following UCB

interaction (Silva et al., 1999; Silva et al., 2002; Amit and Brenner, 1993).

It has been suggested that the neuronal injury caused by bilirubin is initiated at level of

plasmatic, mitochondrial (Schutta et al., 1970; Rodrigues et al., 2000), and/ or

endoplasmic (Calligaris et al., 2009) compartment with consequent alterations of

membrane permeability and function (Rodrigues et al., 2002b; Brito et al., 2004),

possibly triggering excitotoxicity (Grojean et al., 2000; McDonald et al., 1998),

mitochondrial energy failure, and increased intracellular calcium levels (Brito et al.,

2004), that finally lead to activation of apoptotic or necrotic pathways (Watchko, 2006;

Silva et al., 2001; Falcao et al., 2007; Vaz et al., 2010).

Additionally, it has been shown that bilirubin impairs DNA and protein synthesis

(Yamada et al., 1977; Schiff et al., 1985; Kashiwamata et al., 1980), cell proliferation

(Sukhotnik et al., 2009), receptor functionality (Hoffman et al., 1996), and

neurotransmitter uptake and release (Ochoa et al., 1993; Silva et al., 1999).

INTRODUCTION

12

More recently, it has been shown in vivo that high concentrations of bilirubin in Gunn

rats blood clearly suppress the development of vascular neointimal hyperplasia after

ballon injury (Ollinger et al., 2005; Ollinger et al., 2007b) and that treatment of tumors

with bilirubin inhibits its growth (Ollinger et al., 2007a; Rao et al., 2006). It was also

demonstrated in vitro that treatment of primary cultures and tumoral cell lines with

bilirubin/ biliverdin caused the arrest of the cell cycle progression in the late G1 phase, by

a decrease of Cyclin D, E, A as well as Cdk2 protein amount in treated cells (Rao et al.,

2006; Ollinger et al., 2005; Ollinger et al., 2007b; Ollinger et al., 2007a). New evidences

also indicates that cell cycle regulating proteins are involved in apoptotic process in post-

mitotic neurons (Herrup and Busser, 1995; Wen et al., 2005).

1.4 The Gunn rat

In 1934 a new mutant strain of Wistar rats, with non-hemolytic unconjugated

hyperbilirubinemia, was discovered by Gunn (Gunn, 1938) (Figure 5). From that moment

on, the Gunn rat has been used as animal model of Crigler- Najjar type I syndrome and

neonatal jaundice, as like in humans they manifest a congenital inherited deficiency of

hepatic UDP-glucuronosyl-transferase, and similar neuropathological lesions (Schutta

and Johnson, 1967; Chowdhury et al., 1993).

In Gunn rat, the UGT1A1 deficiency is due to the deletion of a single base pairs

(guanosine) in the common region exon 4, which results in a stop codon that remove the

115C- terminal amino acids of the protein. This truncated protein is unstable and rapidly

degraded (Chowdhury et al., 1991; Chowdhury et al., 1993; Iyanagi et al., 1989).

INTRODUCTION

13

Figure 5: Photograph of Gunn rats at 9-days after birth (P9), the yellow discoloration of the skin is clearly visible in jj

hyperbilirubinemic animals while JJ normal rats appear white.

In hyperbilirubinemic (jj) rat, the level of bilirubin in serum show a pronounced

increase (13.60- 14.60 mg/dL) from birth to age P17, declining to a persistent

hyperbilirubinemia (4.90 mg/dL) throughout their life, as shown in Figure 6 (Gazzin et al.,

2011; Zarattini et al., 2011).

Figure 6: Plasma bilirubin in jj and JJ Gunn rat. (Adapted from Gazzin et al., 2011. PLoS ONE 6:1; and Zarattini et al.,

Experimental models).

INTRODUCTION

14

Morphologically, the brain is affected almost selectively in jj rat. The brain

hippocampus, virtually all basal ganglia, and most brain stem nuclei are damaged in

affected rats, with a distribution similar to that seen in humans (Schutta and Johnson,

1967). In contrast to human kernicterus, cerebellar hypoplasia is a prominent feature of

bilirubin damage in Gunn rat (Schutta and Johnson, 1967; Sawasaki et al., 1976; Conlee

and Shapiro, 1997). Also a significant reduction on the cerebellar weight was found in jj

rats respect to the normal’s heterozygous (Jj) and homozygous (JJ) littermates (Gazzin et

al., 2011; Zarattini et al., 2011) (Figure 7). Cerebellar damage by bilirubin is most severe

in the anterior lobe (Sawasaki et al., 1976) where most serious and early changes are

observed in Purkinje cells (Schutta and Johnson, 1967; Takagishi and Yamamura, 1989).

There is a decreased area of the molecular layer and diminished cell number in the

granule layer, while an hypertrophy of astrocytes is found (Chowdhury et al., 1993;

Mikoshiba et al., 1980; O'Callaghan and Miller, 1985; Sawasaki et al., 1976).

Figure 7: Cerebellar weight in jj and JJ Gunn rat. A. Representative photograph of JJ and jj Gunn brain, where the cerebellar

hypoplasia is observable. B. The cerebellar growth expressed as g/ animal. Statistical significance ** p <.0.01, *** p < 0.001.

(Adapted from Gazzin et al., 2011. PLoS ONE 6:1).

It has been suggested a developmental dependence of cerebellar hypoplasia by

bilirubin in Gunn rat (Sawasaki et al., 1976; Conlee and Shapiro, 1997). It is known that

the rat cerebellum develops by post-natal neurogenesis (Altman and Das, 1966), and that

INTRODUCTION

15

cerebellar hypoplasia in jj rat begins largely after 8 post-natal days (Conlee and Shapiro,

1997), consistent with the critical period for bilirubin- induced cerebellar hypoplasia

identified at 6-10 days after birth (Keino and Kashiwamata, 1989; Sawasaki et al., 1976;

Takagishi and Yamamura, 1987; Rice and Barone S Jr, 2000).

1.5 The cerebellum

The central nervous system consists of the brain and spinal cord, while the peripheral

system consists of all the neural (nerve) tracts that lie outside these central tissues and

connect the rest of the body. The brain weights about 1500 g and constitutes about 2 % of

total body weight. It consists of three major divisions: 1) the massive paired hemispheres

of the cerebrum; 2) the brainstem, consisting of the thalamus, hypothalamus, epithalamus,

subthalamus, midbrain, pons, and medulla oblongata, and 3) the cerebellum (Figure 8).

Due to the complexity of the whole brain structure that define each region, we only focus

our attention on the anatomical and functional description of the area considered as target

for our study, the cerebellum.

Figure 8: Sagital diagram of the rat brain. (Adapted from The Gene Expression Nervous System Atlas –GENSAT- Project,

NINDS Contracts N01NS02331 & HHSN271200723701C to The Rockefeller University, New York, NY).

INTRODUCTION

16

The cerebellum functions as a kind of computer, providing a quick and clear response

to sensory signals. It plays no role in sensory perception, but it exerts profound influences

upon equilibrium, muscle tone, and the coordination of voluntary motor function

(HERNDON, 1964; ITO, 2006; Nieuwenhuys et al., 2008).

The gross anatomy of the cerebellum is characterized by transverse fissures of

different depths, which subdivide the cerebellum into lobes, lobules and folia (leaflets).

The cerebellum consists of a large mass of white matter, the medulla of the cerebellum,

over which is disposed a greatly folded layer of gray matter, the cerebellar cortex. The

cortex has a very complex structure, being made up of many different kinds of neurons,

but it appears to be composed of only three layers. A monolayer formed by the perikarya

of the large Purkinje cells separates the superficial, cell-poor molecular layer from the

deep layer of granule cells (Nieuwenhuys et al., 2008; Craigie, 1925). The molecular

layer consists primarily of the stellate and basket cells as well as dendrites of the Purkinje

cells and the parallel fibres (axons of the granule cells), while the granular layer contains

the densely packed somata of granule cells together with the somata of Golgi cells.

Figure 9: Perpendicular organization of the dendritic trees of the Purkinje cells and axons of the granule cells, also known as

the parallel fibres. (Adapted from Nieuwenhuys R., Voogd J., Van Huijizen C.-2008. The human central Nervous System. 4th

Edition).

INTRODUCTION

17

Purkinje cells are large neurons with very elaborated and characteristic dendritic

arbors which extend into the molecular layer and are oriented perpendicularly to parallel

fibres (Figure 9). Purkinje cells axons extend out through to granular layer to the white

matter and then project to targets in the cerebellar and vestibular nuclei. They are of

particular functional interest since their axons provide the sole output from the cortex.

These large cells are inhibitory and use gamma- aminobutiric acid (GABA) as their

neurotransmitter (ITO et al., 1964).

Granule cells are very small and the most prevalent neuronal subclass within the

cerebellum. Granule cells emit four or five thin dendrites that terminate in digit-like

protrusions, the axons ascend toward the molecular layer, where they split into two

branches that run parallel to the transverse fissure and, therefore called parallel fibres.

Parallel fibres may reach a length of 10 mm or more and terminate with excitatory

(glutamatergic) synapses on the spiny branchlets of Purkinje cell dendrites and on the

dendrites of cortical interneurons they meet in the way (Nieuwenhuys et al., 2008). They

play an essential role in the coordination of the afferent input to and motor output from

the cerebellum through their excitatory connections with Purkinje neurons (ITO, 2006).

Moreover, cerebellar granule cells are powerful inducers for Purkinje cells differentiation.

Astrocytes are a specific class of glial cells, they are estimated to comprise only the 20 %

of cells in the cerebellum, while neurons represent the 80 % (Herculano-Houzel and Lent,

2005). As the name suggests, are process-bearing stellate or star-shaped cells and have

been classified into protoplasmic and fibrous type based on their morphology and

distribution in the central nervous system. In most instances, protoplasmic astrocytes

predominate in gray matter and fibrous astrocytes are most common in white matter.

Astrocytes are multifunctional cells that are indispensable for neuronal survival and

function. They provide the migratory scaffold for neurons; represent the major source of

extracellular matrix proteins, adhesion molecules and glycogen. They also contributed to

the formation and preservation of a secure blood-brain barrier. Astrocytes control ionic

and osmotic homeostasis, remove neurotransmitters from the synaptic cleft, and produced

a variety of trophic factors. They have important roles in development and plasticity of

the central nervous system by modifying the growth of axons and dendrites, and

INTRODUCTION

18

regulating synapse formation. In addition they contribute to the control of the immune

responses (Montgomery, 1994).

The rat cerebellum development initiates on E12 (E12, embryonic day 12) and

continues beyond the 16-19 post-natal days (P16-P19) (Rice and Barone S Jr, 2000).

Cerebellar development is dominated by the interplay between two germinal epithelia –

the external granular layer, which produces the granule cells, and the ventricular zone of

the fourth ventricle, which produces the Purkinje cells. During post-natal development of

rat cerebellum, in the external granule layer two distinct zones can be clearly identified,

the proliferative and the pre-migratory zone. The post-mitotic cells of the external

granular layer migrate to their final destination in the internal cell layer (Altman, 1972).

The proper development of the nervous system requires apoptosis, which systematically

removes a lot of cells not only in the proliferative zones, but also among the post-mitotic

cells (Blaschke et al., 1998; Blaschke et al., 1996). Apoptosis is a physiological feature of

central nervous system development, and the period of neuronal apoptosis is between P0

and P14 in rat (Cheng et al., 2011), during which animals are more susceptible to suffer

brain damage (Rice and Barone S Jr, 2000).

1.6 The cell cycle

The cell cycle is a ubiquitous, complex process involved in the growth and

proliferation of cells, organism development, regulation of DNA damage repair, tissue

hyperplasia as a response to injury, and diseases such as cancer. The cell cycle involves

numerous regulatory proteins that direct the cell through a specific sequence of events

culminating in mitosis and the production of two daughter cells. Central to this process

are the cyclin-dependent kinases (Cdks) and the cyclin proteins that regulate the cell’s

progression through the stages of the cell cycle referred to as G1, S, G2, and M phases

(Figure 10). The cell cycle can be morphologically subdivided into interphase and stages

of M (mitotic) phase, which include prophase, methaphase, anaphase, and telophase.

Interphase encompasses G1, S, and G2 (Schafer, 1998).

INTRODUCTION

19

The G1 and G2 phases of the cell cycle represented the “gaps” in the cell cycle that

occur between DNA synthesis and mitosis, during which mRNAs and proteins

accumulate continuously. In the first gap, G1 phase, the cell is preparing for DNA

synthesis. S phase cells are synthesizing DNA and therefore have aneuploid DNA content

between 2N and 4N. The G2 phase is the second gap, during which the cell prepares for

mitosis or M phase. In the G0 phase (quiescence) cells are not actively cycling.

1.6.1 Cell cycle regulation

Cyclin- dependent kinases (Cdks) are the key regulator proteins which allow the

transition from one cell cycle phase to another, these serine/ threonine protein kinases are

activated at specific points during the cell cycle (Collins and Garrett, 2005; Vermeulen et

al., 2003). Positive regulation of Cdk activity occurs through association with cyclin and

by phosphorylation of the T-loop threonine by Cdk- activating kinase (Park and Lee,

2003). Cyclins are produced at each of these phases and form a complex with their Cdk

partners. The levels of activating cyclins in different stages of the cell cycle differ,

whereas the Cdk protein levels remain stable (Vermeulen et al., 2003). During the G0 to S

phase transition, cyclins D1, D2, D3 and C get activated. Cyclins D1, D2, and D3 bind to

Cdk4 and Cdk6 where as cyclin C binds to Cdk8. Cyclins D1, D2, D3 are the first cyclins

to be induced as the G0 cells are stimulated to enter the cell cycle. The progression

through G1 is mediated by cyclin D isoforms and Cdk2, -4, and -6. In G1 an important

target of the Cdks is the retinoblastoma protein (pRb), and the G1 cyclin- cdk complexes

phosphorylate pRb on multiples residues (Kato et al., 1993). Once the cyclin- cdk

phosphorylates pRb, pRb releases the transcription factor E2F, freeing it to participate in

transcription of proteins necessary for the progression of the cell cycle (Schafer, 1998).

Cyclin E is associated during G1 to S phase transition and activates Cdk2. Cyclin A gets

activated during the S phase transition and binds to Cdk1 and Cdk2. B type cyclins are

present during G2 exit and mitosis phase and are associated with Cdk1 (Figure 10).

Cdks are also regulated by inhibitory phosphorylation and by inhibitory molecules.

The inhibitory phosphorylation is mediated by the kinase Wee1 and MYT1. Two classes

of Cdk inhibitors also regulates Cdks function, the INK4 group such as p16INK4a

or

INTRODUCTION

20

p15INK4b

and CIP/KIP class such as p21waf1

or p27kip1

(Park and Lee, 2003; Maddika et al.,

2007).

Figure 10: Cell cycle regulation. (Adapted from Herrup and Yang. 2007. Nat. Rev. Neurosci., 8(5); 368-378)

1.6.2 Cell cycle and apoptosis

Each phase of the cell cycle contains checkpoints that allow the arrest of the cell cycle

progression and activation of repair mechanisms (Johnson and Walker, 1999). After

passing these checkpoints cells are irreversible committed to the next phase. DNA

damage and/ or malfunction of other critical organelles or structure (e.g. faulty mitotic

spindle) can activate the cell cycle arrest and even the apoptotic cascade, leading to cell

death (Rowinsky, 2005). The induction of programmed cell death occurs via two major

pathways: the death receptor-dependent (extrinsic) pathway through TNF- family ligands,

or via the mitochondrial (intrinsic) pathway induced by different factors such as UV

radiation, chemotherapeutics, free radicals or DNA damage (Los et al., 1995; Maddika et

al., 2007). The induction of apoptosis leads to cell blebbing, exposure of

phosphatidylserine at the cell surface, reduction of cell size, shrinkage of the cell core,

DNA condensation and the formation of apoptotic bodies (Darzynkiewicz et al., 1997).

INTRODUCTION

21

The cell cycle regulators have been shown to be involved also in the induction of

apoptosis. Cyclin A1, E, D1, and p53, E2F and Rb have a dual role in the regulation of

the cell cycle and apoptosis as reviewed by Maddika (Maddika et al., 2007).

There are two mammalian A-type cyclins, namely Cyclin A1 and A2. Cyclin A1 is

limited to male germ cells and brain (Sweeney et al., 1996; Yang et al., 1997). Cyclin A1

null mice show cell cycle arrest and apoptosis of spermatocytes (Salazar et al., 2005).

Apparently, Bax expression is elevated in Cyclin A1 null mice’s spermatocytes as

compared to the normal mice leading to their apoptotic demise. This clearly shows that

cyclin A1 plays a vital role in the regulation of apoptotic process by inhibiting the

expression of Bax gene. Molecular mechanisms revealed that apoptotic cell death is due

to the cell cycle arrest in G2/M transition phase by downregulation of Cyclin A and

subsequent upregulation of proapoptotic Bcl2 family proteins (Palozza et al., 2002).

Recent investigations revealed that Cyclin E is responsible for induction of apoptosis

in hematopoietic cells (Mazumder et al., 2002). Cyclin E usually exists as a 50-kDa

protein (Full Length, FL). During apoptosis it is cleaved into a 18-kDa fragment (p18-

Cyclin E) by caspases and it can no longer bind to the Cdks. Overexpression of Bcl2

protein downregulated the apoptotic process and at the same time reduced the expression

of p18-Cyclin E (Mazumder et al., 2002). Unexpected evidence indicates that p18-Cyclin

E interacts with the Ku-70, a critical component in the non-homologous end-joining

repair. It is speculated that interaction of cyclin E might inhibit the activity of Ku-70 and

hence augments the apoptotic process by inhibiting the DNA repair mechanism

(Mazumder et al., 2004).

In neuronal cells the cell cycle is linked to neurogenesis (Ohnuma and Harris, 2003),

and also serve to diverse post-mitotic functions that span various developmental stages of

a neuron, including neuronal migration, axonal elongation, axon pruning, dendrite

morphogenesis, and synaptic maturation and plasticity as review by Frank and Tsai

(Frank and Tsai, 2009; Becker and Bonni, 2005). There are also growing evidences that

cell cycle- related molecules appear to play key role in neuron death during normal

development as well as in disease and trauma. Once neuronal cells became a mature

neuron (post-mitotic), the mature neuron will keep this status until the organism dies.

Increasing evidence over the last decade supports the notion that neuronal cell cycle re-

INTRODUCTION

22

entry result in post-mitotic death (Becker and Bonni, 2004; Becker and Bonni, 2005;

Chen and Wang, 2008; Greene et al., 2007; Herrup and Yang, 2007).

1.7 Cryopreservation

Cryopreservation allows the long term storage of cells, which has a number of

applications. Clinically, cells may be stored by a patient for their own use at a later date

or to facilitate donation to other patients. Having stored the cells, they can be distributed,

making it easier to co-ordinate patient care, and avoiding the need to synchronise donor

and recipient. The ability to store cells reduces wastage of cells if they cannot be used

fresh, and allows the pooling of cells from two o more donors where cells from a single

donor are insufficient for a clinical effect. Cell storage is also of great value in scientific

research; allowing archiving of material, repeated experiments from the same tissue

source and, by allowing the stored of samples, facilitates research collaboration.

There are three methods for cells and tissue storage: a- culture at 37°C, is time

consuming and primary cultures of cells and tissue can be maintained for a limited time;

b- cold storage at 4°C has been reported to allow good survival of primary tissue up to a

maximum of 8 days, and c- cryopreservation, (-150 to -196°C) allow virtually indefinite

storage. In this work, we focus our attention only in cryopreservation.

Conventional cryopreservation (slow freezing) has been successful with embryos of

different species and immortalized cell lines. This technique based on achieving a cooling

rate that allows the formation of extracellular ice and a slow cell dehydration has been

successful with cell suspensions, but lethal to tissue and organs, for which the

maintenance of an extracellular architecture is indispensable (Taylor et al., 2004). Some

of the cell damage caused by conventional cryopreservation are summarized in Table 1

(Yannas, 1968). Slow-cooling is achieved using a controlled rate freezing machine, but

simpler devices can be used.

INTRODUCTION

23

Affected cellular system Damage

Whole cell

Formation of intra and extracellular ice, apoptosis, toxicity, imbalance of cellular

calcium levels, generation of free radicals, metabolic failure

Membranes Breaking, loss of substrates, fusion, phase change

Chromosome Loss/ gain

DNA Apoptosis, fusion

Cytoskeleton Breakdown of microtubules

Proteins, enzymes Dehydration, loss of function

Ultrastructure Alterations in mitochondria, vesicles

Table 1: Damages caused by conventional cryopreservation.

During storage at temperatures below -130°C all biological events cease hence no

deterioration of the sample occurs. What is potentially damaging to cells is cooling to,

and warming from, the storage temperature. When cells are cooled to just below 0°C,

there will be no ice formation due to the presence of solutes. As cells are cooled further

( -5 to – 15°C) ice formation begins to occur. The ice is formed preferentially in the

extracellular medium, this creates an osmotic gradient across the cell membrane, resulting

in water being drawn out of the cells, the cell will shrink and cell contents will become

concentrated. The increase in intracellular solutes can reach toxic levels, being the major

factor causing cellular injury with slow-cooling rates (Mazur, 1970).

In order to cryopreserve cells successfully, they must be exposed to cryoprotectans.

The cryoprotective agents are classified in two types: membrane permeating (glycerol,

ethylene glycol, DMSO, propanediol) and no-permeating (sucrose, ficoll, proteins)

(Fuller, 2004). Those belonging to the first group act through any of the following

mechanism: decreasing the solution freezing point, preventing cell damage by increasing

the electrolyte concentration and interacting with the membranes modifications during

cryopreservation process. For classic cryopreservation procedures, the concentration of

permeating cryoprotectans is limited to 1-1.5 M, and so the potential toxicity is low. The

no-permeating cryoprotectans exert its beneficial effect by increasing the concentration of

extracellular solutes, generating an osmotic gradient across the cell membrane. Once the

sample is warmed, the cryoprotectans must be removed from cells. Stepwise removal of

INTRODUCTION

24

cryoprotectans can be used to alleviate osmotic stress, as can the presence of non-

permeating solutes, to help prevent excessive water entry as the concentration of

permeating cryoprotectans is decreased.

Cryopreservation has been used routinely in prolonged storage of many mammalian

tissues such as blood, bone marrow cells, spermatozoa and embryos used clinically. The

cryopreservation of neural cells/ tissue started to be interesting followed the successful

transplantation of such tissues, initially for studies of brain development, formation and

regeneration of neuronal connections, and later for clinical transplantation (Olanow et al.,

1996). The first report of viable frozen-thawed nerve tissue was that of Luyet and

Gonzales (LUYET and GONZALES, 1953). Several studies have been performed to

achieve cryopreservation of nervous tissue, cells (Ichikawa et al., 2007), primary neural

tissue, neural progenitors cells and neural stem cells have been subjected to freezing, as

summarized by Paynter in 2008 (Paynter, 2008). However, for these cells types

cryopreservation has not been applied with sufficient success to enable it to be

incorporated into routine clinical practice.

25

2. AIMS OF THE STUDY

In neonates and in Crigler-Najjar syndrome type I patients, severe unconjugated

bilirubin (UCB) accumulation may cause brain damage and death early in life. The Gunn

rat is the animal model to study these pathologies. The hyperbilirubinemic jj Gunn rat

develops a marked cerebellar hypoplasia with degeneration and loss of Purkinje cells and

granule neurons. Recently it has been shown that high levels of bilirubin cause the arrest

of the cell cycle progression in the late G1 phase by a decrease of all Cyclins (D, E, A) as

well as Cdk2 protein. Until now, the role of cell cycle arrest by bilirubin in cerebellar

hypoplasia has not been investigated.

Bilirubin neurotoxicity was shown to be selective, only certain areas of the brain and

only certain cells types within these regions are more affected than others. Among the

cells forming the cerebellum (neurons, astrocytes, oligodendrocytes, and microglia) nerve

cells, particularly granular cells and Purkinje cells are the main target for UCB

cytotoxicity. The selectivity of bilirubin to arrest the cell cycle differentially in cerebellar

astrocytes and granule neurons has not been investigated.

Bilirubin neurotoxicity was shown to reduce significantly the quantity of cerebellar

granule neurons found in the granular layer. The successful transplantation of neuronal

cells for studies of brain development, formation and regeneration of neuronal

connections, and for clinical transplantation, lead us to hypothesize the possibility of

transplanting cryopreserved granule neurons to the hypoplasic cerebellum of jj Gunn rat

so as to reduce the effect of bilirubin on cerebellar granule cells. Several studies have

been performed to achieve cryopreservation of nervous tissue and cells, but without

sufficient success to enable it to be incorporated into routine clinical practice.

AIMS OF THE STUDY

26

Based on these considerations the aims of this PhD thesis were:

the first aim was to evaluate the cell cycle progression and expression of

the cell cycle regulators (mRNA and protein) in cerebellum of normal (JJ)

and hyperbilirubinemic (jj) Gunn rat.

the second aim was to evaluate the cell cycle progression and expression of

the cell cycle regulators (mRNA) in primary cultures of cerebellar

astrocytes and granule neurons treated with high concentrations of bilirubin.

The effect of bilirubin on the rate of apoptosis in astrocytes primary culture

was also evaluated.

the third aim was to assess the possibility of cryopreserving cerebellar

granule neurons by conventional cryopreservation (slow freezing)

methodology, and to set up the conditions for its cryopreservation. So as to

generate a cryopreserved stock of granule cells for future transplantation in

jj Gunn rat.

27

3 MATERIALS & METHODS

3.1 Materials, Chemicals and Reagents

Dulbecco’s Modified Eagle Medium low glucose (DMEM) and Basal Medium Eagle

with Earle’s salts, without L-glutamine (BME) were obtained from Invitrogen, Life

Technologies Corporation, Grand Island, NY, and L-glutamine from EuroClone, Milano,

Italy.

Foetal Bovine Serum (FBS), gentamycin (50 mg/mL, Solution), fatty acid free bovine

serum albumin fraction V (BSA), trypsin from bovine pancreas, trypsin inhibitor from

glycine max (soybean), deoxyribonuclease I from bovine pancreas, poly-L-lysine

hydrobromide molecular weight 30,000-70,000, cytosine-β-D-arabino-furanoside,

TriReagent, Bicinchoninic Acid protein Assay kit (BCA), β-mercaptoethanol, Triton

X100, PBS (Dulbecco’s Phosphate Buffered Saline), propidium iodide (Pi), ribonuclease

A from bovine pancreas DNAse free, unconjugated bilirubin (UCB), 3(4,5-

dimethiltiazolil-2)-2,5 diphenil tetrazolium (MTT), dimethyl sulfoxide (DMSO),

Coomassie blue solution, Ponceau solution and (S)-(+)-camptothecin were purchased

from Sigma-Aldrich, St. Louis, MO, USA.

The nylon cell strainers of 40, 70 and 100 µm were obtained from BD falconTm

, BD

Biosciences, Bedford, USA, and 6 Well cell culture cluster-Costar 3516 (6-well plate)

was obtained from Corning Inc., Corning, NY, USA.

iScriptTM

cDNA Synthesis Kit, iQ TM

SYBR Green Supermix and Laemmli buffer were

purchased from Bio-Rad Laboratories, Hercules, CA, USA. Cell Lysis buffer was

obtained from Cell Signaling Technology, Inc; Danvers, MA, USA.

All the other reagents and chemicals were of analytical level.

MATERIALS & METHODS

28

3.2 in vivo and in vitro bilirubin effect on cell cycle

3.2.1 Animals

Animals of both sexes were obtained from the animal facility of the Department of

Life Sciences of Trieste University (Trieste, Italy) and from the animal facility of the

Faculty of Biochemical and Pharmaceutical Sciences of National University of Rosario

(Rosario, Argentina). Animal care and procedures were conducted according to the

guidelines approved by the Italian Law (decree 116-92), by the European Communities

Council Directive 86-609-EEC and by the Argentinean National Council for Scientific

Research. All efforts were made to minimize the number of animals used and their

suffering.

Two different rat strains were used in this Thesis. SpdBlueGUNN.j-rats and Wistar

HanTM

(RccHanTM

:WIST) rats, purchased from Harlan Illinois, were used. Both rat

strains were grown in the local animal facility.

For the in vivo study, hyperbilirubinemic (jj) and normobilirubinemic (JJ) Gunn rats at

9 days after birth P9 (Post-natal age, P9), as well as, Wistar rats (P3, P9 and P60) were

used. While for the in vitro study, only P2 and P8 Wistar rats were used.

3.2.2 Rat cerebella dissection

Animals from all post-natal ages were sacrifice by decapitation under isofluorane

anaesthesia, their brains were rapidly excised and placed for the in vivo study in 4°C

Krebs-Ringer buffer (NaCl 135 mM; KCl 4 mM; CaCl2 2.2 mM; MgCl2 1.2 mM;

NaHCO3 6 mM; Hepes 10 mM; D-Glucose 5 mM, pH 7.40) and for the in vitro study at

room temperature (RT) in DMEM or BME culture medium as described below.

Under stereomicroscope vision the cerebella (Cll) was immediately dissected, cleaned

from meninges and 4th ventricle choroid plexus as previously described (Gazzin et al.,

2008). Particularly, in the in vivo study, the Gunn rats cerebella was longitudinally

divided in two parts, one part for mRNA analysis and the second part for protein studies.

MATERIALS & METHODS

29

3.2.3 Primary cell cultures

Primary astrocyte cultures

Primary cultures of astrocytes were obtained pooling the cerebella dissected from 6

Wistar rats pups (P2) as described previously by Booher (Booher and Sensenbrenner,

1972) with minor modifications.

The dissected Cll were collected in RT Dulbecco’s Modified Eagle Medium, low

glucose (DMEM) supplemented with 10 % heat-inactived foetal bovine serum (FBS) and

50 µg/mL gentamycin, and cut into small pieces. Immediately after that, cells were

mechanically dissociated by forcing the tissue through a 70 µm nylon cell strainer (#

352350, BD Biosciences) using a plunger of a 5 mL syringe in a tissue culture dish

containing 5 mL supplemented DMEM. The filter was removed and the cell suspension

was dissociated 20 times through a 5 mL pipette, keeping the pipette vertical with its end

stuck to the bottom of the dish, for avoiding cells aggregates.

The resulting cell suspension was diluted (1:4), and cells were seeded at 1.2 x 105

cells/mL in 6-well plates. The cells were incubated in culture medium containing DMEM

(low glucose), 10 % inactive FBS and 50 µg/mL gentamycin in a culture incubator at

37°C in an atmosphere of 95 % air/ 5 % CO2, with 90 % humidity. The culture medium

was replaced the next day, to remove debris and twice a week thereafter. The purity of

the astrocyte cultures was determined by immunocytochemical staining using the

astrocyte marker glial fibrillary acidic protein (GFAP) vs. Hoechst staining of nuclei.

Experiments were performed on cultures with age between 12 and 16 days in vitro (div)

when they reach 90 % of confluence. Two days before the experiments the culture

medium was changed with Neuron Medium (Basal Medium Eagle: BME, 10 % heat-

inactivated FBS, 2 mM L-glutamine, 25 mM KCl, 10 mM Hepes, 44 mM NaHCO3, 5.6

mM D-glucose, 100 µg/ml gentamycin, pH 7.40) where experiments of astrocytes and

granule neurons were conducted.

MATERIALS & METHODS

30

Primary cerebellar granule cultures

Primary cultures of cerebellar granular cells (CGC) were obtained pooling the

dissected cerebella from six P8 Wistar rats as described previously by Mitchell (Mitchell

et al., 2007; Dutton et al., 1981) with minor modifications.

The dissected Cll were collected at RT in BME medium with 100 µg/mL gentamycin.

The tissue was grossly triturated in 90-mm plastic Petri dish, transferred into a sterile 50

mL tube containing 10 mL of RT Solution 1 (0.03 % MgSO4 and 3 mg/mL BSA in Krebs

buffer: 124 mM NaCl, 5.37 mM KCl, 1.01 mM NaH2PO4.H2O, 2.7 µM Phenol Red, 25

mM Hepes, 14.5 mM D-glucose, pH 7.40) and centrifuged at 200 g for 1 min. After

decanting the supernatant, the tissue pellet was resuspended in 10 mL RT Solution 2

(0.03 % MgSO4, 3 mg/mL BSA and 0.12 mg/mL trypsin in Krebs buffer) and incubated

at 37°C for 15 min with gentle agitation. After incubation, the trypsin was inhibited by

the addition of 10 mL of RT Solution 4 (0.03 % MgSO4, 3 mg/mL BSA, 0.16 mg/mL

trypsin inhibitor, 0.014 mg/mL DNase I in Krebs buffer). The suspension was divided in

two 15 mL tubes and centrifuged at 200 g for 1 min. The supernatant was decanted, and 3

mL of RT Solution 3 (0.07 % MgSO4, 3 mg/mL BSA, 0.52 mg/mL trypsin inhibitor,

0.045 mg/mL DNase I in Krebs buffer) was added to each tube and the tissue pellet was

gently triturated (~17 times) through a sterile fire-polished glass Pasteur pipette. After

allowing standing for 10-15 min at RT the supernatants were transferred to two fresh 15

mL conical tube, leaving ~ 500 µl of supernatant containing mostly cell clumps. More

Solution 3 was added to the tissue pellet and gentle disruption was repeated as described

above. The second collection of isolated cells was combined with the first, and 1.25 mL

of Solution 3 was added to each tube. To reduce the amount of debris, and inhibit DNases,

the isolated cells were centrifuged through RT 4 % BSA gradient-Solution 5 (0.06 %

MgSO4, 0.001 % CaCl2, 3 mg/mL BSA in Krebs buffer). Using a 2 mL pipette 2 mL of

the gradient solution were placed below the two supernatants, this yields a two-step

gradient which was centrifuged at 180 g for 5 min (Cambray-Deakin, 1995). The cell

pellet of the two tubes were put it together and resuspended in 5 mL of Neuron Medium

(BME, 10 % heat-inactivated FBS, 2 mM L-glutamine, 25 mM KCl, 10 mM Hepes, 44

mM NaHCO3, 100 µg/mL gentamycin, pH 7.40).

Cells were counted using a Burker chamber, and cell viability was evaluated by trypan

blue dye exclusion. Briefly, 10 µl of the cell suspension was diluted 1:50 in 0.4 % (w/v)

MATERIALS & METHODS

31

trypan blue solution, living and dead (blue) cells were counted, the % of viable cells was

calculated. The cells were them plated in 5 µg /mL poly-L-lysine pre-coated 6-well plate

at the density of 1.5 x106 cells/well in Neuron Medium. After plating, the cells were

incubated at 37°C in an atmosphere of 95 % air/ 5 % CO2, with 90 % humidity. After 24

h the medium was renewed with the addition of cytosine-β-D-arabino-furanoside (Ara-C,

10 µM), to prevent the growth of non-neuronal cells, and D-glucose (5.6 mM). From that

moment on, the medium was changed twice a week. All experiments were carried out

after 7 days in culture (7 div).

UCB solutions and Bf measurements

The free (unbound) bilirubin (Bf) concentration in each culture medium was evaluated

using a modification of the horseradish peroxidase assay (Ahlfors, 2000) as described by

Roca (Roca et al., 2006).

Unconjugated bilirubin (UCB) was purified as described by Ostrow and Mukerjee

(Ostrow and Mukerjee, 2007), divided into aliquots, and stored at -20°C until used.

Immediately before each cell treatment, an aliquot was dissolved in DMSO (0.3 µl of

DMSO per µg of UCB), and diluted with each culture medium containing 10 % FBS

(25.6 µM BSA). Experiments were performed with two final UCB concentrations of 5

and 25 µM, yielding two free unbound UCB concentrations (Bf): one corresponding to

the physiological serum Bf and the other to the serum Bf calculated from P9

hyperbilirubinemic (jj) Gunn rat.

In order to standardize DMSO-related effect, control cells were incubated with

medium containing DMSO 0.5 % (the quantity of DMSO needed to dissolve the UCB 25

µM). To minimize photo-degradation, all the experiments with UCB were performed

under light protection (dim lighting and vials wrapped in tin foil).

MATERIALS & METHODS

32

Culture and treatment conditions

Astrocytes and CGC primary cultures were grown for 12-16 and 7 div, respectively in

the corresponding medium (DMEM and Neuron Medium). The cultures were monitored

daily to check their progress. At the moment of treatment, cells were washed once with

37°C PBS and then incubated in 4 different conditions:.

Cells alone: complete medium.

Control group: complete medium plus DMSO 0.5 %.

UCB 5 µM: complete medium plus 5µM UCB (yielding a physiological Bf of

20 nM)

UCB 25 µM: complete medium plus 25 µM UCB (yielding a Bf of 140 nM, as

in P9 hyperbilirubinemic Gunn rats)

Cell viability after UCB treatment

The assay used to evaluate cell viability was based on the reduction of 3(4,5-

dimethyltiazolyl-2)-2,5 diphenyl tetrazolium (MTT) to formazan crystals (Mosmann,

1983; Denizot and Lang, 1986).

Primary astrocyte and CGC cultures were grown on 6-well plates and treated with two

final UCB concentrations of 5 and 25 µM for different periods of time (from 10 min up to

24 h). Considering the possibility of performing astrocyte/ CGC co-cultures, astrocytes

were grown in DMEM and two days before treatment the medium was changed to

Neuron Medium without Ara-C. In this case for both astrocytes and CGC, treatment was

made in Neuron Medium without Ara-C.

A MTT stock solution of MTT (5 mg/mL in PBS pH 7.40) was diluted to 0.5 mg/mL

in the corresponding treatment medium (2 mL) immediately before the treatments. The

cells were washed once with PBS and incubated for 1 hour at 37°C. After incubation,

MTT formazan crystals were dissolved by adding 0.5 mL DMSO with gentle shaking.

The absorbance was measured at 570 nm in a LD 400C Luminescence Detector,

Beckman Coulter, Milan Italy. Results were expressed as percentage of control cells, not

exposed to UCB, which was considered as 100 % viability.

MATERIALS & METHODS

33

3.2.4 Gene expression analysis

RNA extraction

For the in vivo study the half part of the cerebellum of P9 JJ and jj Gunn rats dedicated

to gene analysis, was collected directly in TriReagent solution, and total RNA was

isolated according to the manufacture's protocol.

For the in vitro study primary astrocyte and CGC cultures were grown on 6-well plates

and treated for 2 and 24 hours, with 25 µM UCB. Total RNA was isolated by TriReagent

solution according to the manufacture's suggestions.

In both cases total RNA concentration and purity were quantified

spectrophotometrically in a Beckman DU640. For each sample a A260/A280 ratio

between 1.8 and 2.0 was considered as good RNA quality criteria. The RNA integrity

was evaluated by agarose gel electrophoresis and staining with ethidium bromide,

indicating that the RNA preparations were of high integrity. The isolated RNA was

dissolved in RNAse free water and stored at -80°C until analysis.

mRNA Quantification by Real-Time RT-PCR

Expression analysis of house-keeping genes and the target genes were performed by

Real Time RT-PCR technology, using specific primers (see Table 2).

Retrotranscription of total RNA (1 μg) was performed with an iScriptTM

cDNA

Synthesis Kit according to the manufacturer’s instructions. The reaction was run in a

thermal cycler (Gene Amp PCR System 2400, Perkin-Elmer, Boston, MA, USA) at 25°C

for 5 min, 42°C for 45 min, and 85°C for 5 min. The final cDNA was conserved at –20°C

until used.

The primers for the targeted genes Cyclin D1, E1, A, A1 and Cdk2 and the four

possible house-keeping genes (18S, Actin, hypoxanthine-guanine

phosphoribosyltransferase: Hprt1 and glyceraldehydes 3-phosphate dehydrogenase:

Gapdh) were designed using Beacon Designer 4.2 software (PREMIER Biosoft

MATERIALS & METHODS

34

International, Palo Alto, CA, USA). All primer pairs were synthesized by Sigma Genosys

(Cambridgeshire, UK). Primer sequences are reported in Table 1.

Gene Accession Number Forward Reverse Amplicon

(bp)

18S X01117 TAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG 150

Actin NM_031144.2 GGTGTGATGGTGGGTATG CAATGCCGTGTTCAATGG 103

Gapdh NM_017008.3 CTCTCTGCTCCTCCCTGTTC CACCGACCTTCACCATCTTG 87

Hprt1 NM_012583.2 AGACTGAAGAGCTACTGTAATGAC GGCTGTACTGCTTGACCAAG 163

Cyclin D1 NM_171992.4 AGCTGAGGCGTCCCAACC CAACCAGAATACACAAAGCCAACC 173

Cyclin E1 NM_001100821.1 CAGTCAGCCTTGGGATGATGATTC TCCTCCAGACCTCTTCTCTATTGC 185

Cdk2 NM_199501.1 CGGCAGGATTTTAGCAAGGTTGTG CAGGTGAAGAGGGCTTTGGGAAG 192

Cyclin A1 NM_001011949.1 TATCTTCCTTCCTTGGTAG TAATGAATAGCCCGTAAATG 105

Cyclin A NM_053702.3 TAGATGCTGACCCATACC TCCTGTGACTGTGTAGAG 83

Table 2: Primers sequences designed for the mRNA quantification.

The reaction was performed on 25 ng of cDNA, with the corresponding gene-specific

sense and anti-sense primers (250 nM, except 18S and Cyclin A1 primers, were we used

100 nM and 300 nM respectively) with 1x iQ SYBER Green Supermix (Bio-Rad

Laboratories, Hercules, CA, USA) in a final volume of 25 µl for each gene except Cyclin

A1, were we used 50 µl. Reactions were run on an iCycler iQ thermocycler (Bio-Rad

Laboratories, Hercules, CA, USA). The thermal cycler conditions consisted of 3 min at

95°C and 40 cycles each at 95°C for 20 s, 60°C for 20 s, and 72°C for 30 s.

The PCR was performed in 96-well plates; each sample was analysis in triplicate.

Standard curves using a “calibrator” cDNA (chosen among the cDNA samples from

normal JJ Gunn rats) were prepared for each target and house-keeping gene. Melting

curve analysis was performed to asses product specificity. The relative quantification was

MATERIALS & METHODS

35

made using the iCycler iQ Software, version 3.1 (Bio-Rad Laboratories, Hercules, CA,

USA) by the Pfaffl modification of the ΔΔCT equation (CT: cycle number at which the

fluorescence passes the threshold level of detection) (Pfaffl, 2001; Tichopad et al., 2004),

taking into account the efficiencies of the individuals genes. The results were normalized

to the chosen housekeeping genes and the initial amount of the template of each sample

was determined as relative expression vs. one of the sample chosen as reference which is

considered the 1x sample.

3.2.5 Protein expression analysis

Protein extraction

For the in vivo study the half part of the cerebellar tissue of P9 JJ and jj Gunn rats

dedicated to protein analysis, was homogenized in homogenization buffer (0.25 M

Sucrose; 50 mM K2HPO4; 50 mM KH2PO4; 1 mM EDTA; 0.1 mM DTT; pH 7.40) at

4 °C, using a Dounce-type glass homogenizer. The protein homogenate was stored at -

80°C until analysis.

For the in vitro study primary astrocyte and CGC cultures were grown on 6-well plates

as previously described and treated for 2 and 24 hours, with 25 µM UCB. Total cells

extracts were obtained by lysing cells in ice-cold Cell Lysis buffer (Cell Signaling

Technology) for 5 min on ice. The cell lysate was centrifuged at 14.000 g for 10 min at

4°C, and the supernatant was collected and stored at -80°C until analysis.

In both cases total protein content was determined by the Bicinchoninic Acid Protein

Assay (BCA) kit (Smith et al., 1985), following the manufacturer’s protocol (Procedure #

TPRO 562).

Western blot

Proteins homogenates from Cll of P9 JJ and jj Gunn rats (20, 25, 30 or 50 µg,

depending on the analysed protein) were denatured with 10 % β-mercaptoethanol in

MATERIALS & METHODS

36

Laemmli loading buffer (62.5 mM Tris-HCl, pH 6.80; 25 % glycerol, 2 % SDS, 0.01 %

bromophenol blue) by 10 min boiling in water bath and separated by SDS-PAGE on 10

or 12 % polyacrylamide gels. Molecular weight standards (10-205 kDa, #SM1811

Fermentas) were used as marker proteins. After that proteins were electro-transferred

with a wet blotting system (BioRad Laboratories, Hercules, CA, USA) at 100 V for 1 h

onto PVDF membrane (0.2 µm; Whatman Schleicher & Schuell, Dassel, Germany) in

transfer buffer (25 mM Tris-Base; 192 M glycine, 0.1 % SDS; 20 % methanol).

Completeness of transfer was assessed by lack of Coomassie blue coloration of the gels

after blotting and Ponceau staining of PVDF membranes.

Membranes were saturated for 2 h in blocking solution 4 % non fat milk or 4 % BSA

in T-TBS (20 mM Tris-Base; 500 mM NaCl, pH 7.40, 0.2 % Tween 20) and incubated

overnight at 4°C with antibodies anti Cyclin D1, Cylin E, Cyclin A, Cdk2, PARP-1, α-

Tubulin and Actin (Table 3) in the same buffer. After washing, membranes were

incubated for 1h at RT with peroxidase-conjugated anti-rabbit or anti-mouse secondary

antibodies (P0448, 0.04 µg/ml, and P0260, 0.26 µg/ml, Dako, Glostrup, Denmark).

Protein bands were detected by peroxidase reaction according to the manufacturer’s

protocol using a chemiluminescence procedure (Millipore, Billeria, MA, USA) and

visualized on X-ray films (BioMax Light, Kodak Rochester, NY, USA).

The intensity of the autoradiography bands was estimated by densitometry scanning

using NIH Image software (Scion Corporation, Frederick, MD, USA). The protein

relative expression was finally obtained as previously described (Gazzin et al., 2008;

Gazzin et al., 2011). Briefly a standard curve was generated by serial dilution of a

reference sample on each gel and a non-linear regression analysis of the densitometry

analysis was performed by CurveExpert 1.38 Software (Starkville, MS, USA) to obtain

the protein expression that was later normalized for the concomitant actin signal (Figure

11).

MATERIALS & METHODS

37

Protein Blocking

Solution

Concentration

(µg/ml)

Antibody Manufacturer

Cyclin D1 4% BSA 13.5 [DCS-6] ab10540 Abcam, Cambridge, UK

Cyclin E 4% BSA 2.0 [E-4] SC-25303 Santa Cruz Biotechnology, Santa Cruz, CA,

USA

Cyclin E 4% non fat milk 2.0 [M-20] SC-481 Santa Cruz Biotechnology, Santa Cruz, CA,

USA

Cyclin A 4% BSA 0.5 [H-432] SC-751 Santa Cruz Biotechnology, Santa Cruz, CA,

USA

Cdk2 4% non fat milk 0.03 [M2] SC-163 Santa Cruz Biotechnology, Santa Cruz, CA,

USA

Parp-1 5% non fat milk 0.034 #9542 Cell Signaling Technology, Inc; Danvers,

MA, USA

α-Tubulin 4 % non fat milk 0.04 [DM1A]: SC-32293 Santa Cruz Biotechnology, Santa Cruz, CA,

USA

Actin 4% non fat milk 0.1 A2066 Sigma, St. Louis, MO, USA

Table 3: Antibodies and conditions used for Western blot

The analysis of p18-Cyclin E protein expression was performed using the M-20

antibody that recognised the C-terminal portion of Cyclin E. The low protein expression

of the 18 kDa fragment of Cyclin E (p18-Cyclin E) forced us to load up to 50 µg of

protein for the Western blot analysis, precluding the formation of a well defined standard

curve. Therefore, the results of the p18-Cyclin E protein expression were obtained only

by normalization with the actin signal.

MATERIALS & METHODS

38

Figure 11: Representative western blot for Cyclin D1 quantification. A. Photograph of a representative Western blot showing

the standard curve and the evaluated samples. B. Representative non-linear regression curve obtained from the standard curve

by Curve Expert 1.38 Software.

3.2.6 Cell cycle analysis by FACS

Cell dispersal and fixation

For the in vivo study freshly dissected cerebellum from P9 JJ and jj Gunn rats, and P3,

P9 and P60 Wistar rats were collected directly in cold PBS/EDTA (0.1 % w/v EDTA,

PBS pH 7.40) and dispersed as previously described with minor modifications (Heinlein

et al., 2010; Heinlein and Speidel, 2011). Briefly, small pieces (about 3 x 3 x 3 mm) of

the tissue were mechanically dispersed, sequentially using 100 µm and 40 µm nylon cell

strainers (# 352360 and # 352340 respectively, BD Bioscience). The tissue was first

pressed through the 100 µm mesh using a plunger of 5 mL syringe in a tissue culture dish

containing PBS/EDTA. The mesh was then rinsed several times with 4°C cold

A.

B.

MATERIALS & METHODS

39

PBS/EDTA. The resulting cell suspension (5 mL) was filtered through 40 µm cell strainer

and the total volume was adjusted with PBS/EDTA to 15 mL per sample. After

centrifugation (310 g; 4°C; 6 min) and removal of the supernatant, the cell pellet was

suspended in 0.5 mL 4°C cold PBS.

For the in vitro study primary astrocyte and CGC cultures were grown on 6-well

plates as previously described and treated for 2 and 24 hours, with 25 µM UCB. Cells

were harvested with trypsin into a 15 mL tube, keeping media as this helps to inactivate

trypsin. After centrifugation (200 g, 6 min, RT) and removal of the supernatant, the cell

pellet was suspended in 0.5 mL 4°C cold PBS.

In both cases the cells were immediately fixed by adding 5 mL of cold (-20°C) 80 %

ethanol drop-wise under constant gentle vortexing. Samples were incubated for 30 min

on ice and subsequently stored at -20°C until staining.

Staining and analysis

Staining was performed after removal of the fixed cell suspensions from -20°C storage

and stabilization at RT for ≈ 10 min. After centrifugation (310 g; RT; 6 min) pellets were

resuspended in 5 mL PBS/EDTA (RT), incubated for 5 min at RT and pelleted again (310

g; RT; 6 min). Cell sediments were resuspended in 1mL of staining solution PBS with

0.1 % v/v Triton X-100, 20 µg/ml propidium iodide (Pi), and 0.2 mg/ml DNAse free

RNase A; that warrants saturation of all DNA with Pi. Samples were incubated for 30

min at RT and subjected to FACS (fluorescence activated cell sorter) analysis.

Cells were analyzed using the cytometer BD FACSCaliburTM

and CellQuest software

(BD Biosciences, San Jose, CA). Briefly Pi fluorescence excited with a 488 nm argon ion

laser was detected in the FL2 channel (> 600 nm band-pass filter). Doublets and higher

aggregates were excluded by making a gate in the pulse-width versus pulse-area

histogram. Data were collected for 10,000 events per sample.

MATERIALS & METHODS

40

3.2.7 in vitro analysis of apoptosis/ necrosis by FACS

Primary astrocyte cell cultures were grown on 6-well plates and treated for 2 and 24

hours, with 25 µM UCB and with (S)-(+)-camptothecin 6 µM for 4 h, as positive control.

The rate of apoptosis/ necrosis was evaluated with the Annexin V-FITC Kit (Bender

MedSystems GmbH, Vienna, Austria) according to the manufacture's protocol. Briefly,

cells were harvested with trypsin into a 15 mL tube, keeping media as this helps to

inactivate trypsin. After centrifugation (200 g, 5 min, 4°C) and removal of the

supernatant, cells were washed in PBS and centrifuged again (200 g, 5 min, 4°C). The

cell pellet was resuspended in ice-cold Annexin V-binding buffer (10 mM Hepes, 140

mM NaCl, 2.5 mM CaCl2, pH 7.40), Annexin V-FITC and Pi were added and incubated

for 10 min at RT.

Samples were analyzed by generating a dot plot showing Annexin V-FITC (FL1)

versus Pi (FL2), and defining quadrants that divide cell populations according to Annexin

V and Pi positivity. Single-stained cells were included in the experiments to set up

compensation and quadrant markers, i.e. cells stained only with Annexin V-FITC and

cells stained only with Pi. The FL1 (520 nm) and FL2 (610 nm) channels were used to

detect Annexin V-FITC staining and Pi uptake, respectively, on a cytometer BD

FACSCaliburTM

(BD Biosciences, San Jose, CA) equipped with a argon-ion laser at 488

nm. Data were collected for 10,000 cells and analyzed using CellQuest software from BD

Biosciences (San Jose, CA).

3.3 Neural cells cryopreservation

3.3.1 Equipment for sample freezing

The following equipment was used to perform the cryopreservation of neuronal cells

by slow freezing methodology, as its allow the execution of cooling ramps at different

speeds. Consist of a 500 mL Dewar, containing liquid nitrogen (LN2); a 400 mL glass

Beacker with methanol, an electronic Thermometer (Tes 1303, Taiwan) and K-type

thermocouple, different thermic transfer units (in this case copper bars), a magnetic

agitator, a stirring bar Kartell Cat. 788 (7 mm x 35 mm) and a computer, that collected all

MATERIALS & METHODS

41

the data measured by the thermometer and K-type thermocouple. Briefly, the Dewar

containing the liquid nitrogen was connected through the transfer unit to the Beacker,

generating a cold methanol bath, where the cryovials (Nunc, CryotubeTM

Vials)

containing the sample and a control cryovial holding the K-type thermocouple were

immersed for its slow freezing (Figure 12).

Figure 12: Equipment used for slow freezing cryopreservation. A. Description of the components. B. The equipment ready

to be use.

A.

B.

MATERIALS & METHODS

42

3.3.2 Primary cerebellar granule cells cultures

The cerebellar granular cells suspension was obtained as described previously in

section 3.2.3. The cell suspension was divided in two, one part of the cells were plated in

5 µg /mL poly-L-lysine pre-coated 6-well plate at the density of 1.5 x106 cells/well in

Neuron Medium, and the other one was cryopreserved as described below. After 24 h of

plating the cryopreserved CGC, the medium was renewed with the addition of D-glucose

(5.6 mM), but without Ara-C. The next time the medium was changed Ara-C (10 µM)

was added to prevent the growth of non-neuronal cells. From that moment on, the

medium was changed twice a week. The culture was maintained for 7 div, as a control for

a proper isolation process.

3.3.3 Cryopreservation

Freezing conditions

In the first set of experiments the isolated CGC (Figure 13 A), whose viability were

always greater than 95 %, were cryopreserved with different ratios of DMSO as

cryoprotective agent (9, 10, 15, 16.6, 23.1 and 28.6 %) in order to choose the best

proportion of DMSO to produce the best viability after cryopreservation. Briefly, the cell

suspension was centrifuged at 70 g for 5 min, and the cell pellet was resuspended in 1 mL

of Neuron Medium with the corresponding % of DMSO. After a incubation of 15 min in

ice, the cells were centrifuged (70 g for 5 min) and the cell pellet was finally resuspended

in 100 µl of Neuron Medium with DMSO and put it in a cryovial and plunging in LN2.

In the second set of experiments the isolated CGC (Figure 13 B), whose viability were

always greater than 95 %, were cryopreserved in Neuron Medium with 10 % DMSO at

different freezing rates using the slow freezing methodology. The different freezing rates

were achieved using three different cooper transfer units (5/8, 3/8 and 1/4 inch) an

agitation rate of the methanol bath of 780 rpm. The temperature of the sample and the

methanol bath was measured with the thermometer and K-type thermocouple every

minute, the data was directly collected in a computer, and a graph temperature vs. time

was generated. The freezing rate was calculated using the linear part of the curve. Briefly,

MATERIALS & METHODS

43

the isolated cells were centrifuged at 70 g for 5 min, the supernatant was discarded and

the pellet was resuspended in 3 mL of Neuron medium with 10 % DMSO, and the final

suspension was divided in three aliquots of 1 mL each in cryovials. Samples were left for

10 min in a 10°C bath. Finally the cryovials were submerged in the methanol bath and the

temperature was decreased with different freezing rates to -40°C, at that point cryovials

were deposited in the Liquid Nitrogen tank (-196°C) until use.

Figure 13: Representative diagram of freezing and rewarming conditions used in the two set of experimentes. A. First set of

experiments. B. Second set of experiments.

MATERIALS & METHODS

44

Rewarming conditions

In the set of experiments designed to testing the different proportions of the

cryoprotective agent DMSO (9, 10, 15, 16.6, 23.1 and 28.6 %), the cryopreserved

samples were quickly rewarmed in a 37°C bath. The rewarmed cell suspension was

centrifuged 70 g for 2 min. After removing the supernatant, the cells were resuspended in

1 mL of Neuron medium, incubated for 15 min on ice and plated as described above. For

the samples that were cryopreserved with the highest quantity of DMSO (15, 16.6, 23.1

and 28.6 %), the DMSO was removed by dilution. For example, the cells cryopreserved

with 28.6 % DMSO after the rewarming they were centrifuged, the pellet was

resuspended in medium with 14.5 % DMSO and incubated for 15 min in ice. After that,

another centrifugation was perform, the pellet was then resuspended in medium with 7.8 %

DMSO and incubated for 15 min in ice. Finally, cells were centrifuged, the pellet

resuspended in Neuron Medium without DMSO and plated as described above (Figure 13

A).

In the second set of experiments the three aliquots were thawed under different bath

temperature (36 and 39°C) and with RT air using the same equipment. The rewarming

rate was evaluated as described for freezing rate. The cells were thawed, the medium was

diluted with the addition of 1 mL of fresh Neuron medium and centrifuged 70 g for 4 min.

The cell pellet was resuspended in fresh Neuron medium and plated as described above

(Figure 13 B).

In both cases the effectiveness of the cryopreservation and rewarming process were

evaluated from the study of the viability post-rewarming and the capacity for survival in

culture by x days in vitro. The cultures were monitored daily to check their progress.

3.3.4 Viability after rewarming

Immediately after rewarming cells were counted using a Neubauer chamber, and cell

viability was evaluated by trypan blue dye exclusion. Briefly, 10 µl of the cell suspension

was diluted 1:50 in 0.4 % (w/v) trypan blue solution, living and dead (blue) cells were

counted, the % of viable cells was calculated.

MATERIALS & METHODS

45

3.4 Statistical analysis

Unpaired t-test, for the in vivo study, and one-way ANOVA with Dunnett or Tukey-Kramer

post test, for the in vitro study, were performed using InStat 3.06 (GraphPad Software, San Diego,

CA, USA). Differences were considered statistically significant at a p value lower than 0.05. All

results were expressed as mean ± S.D.

46

4 RESULTS

4.1 in vivo bilirubin effect on cell cycle

4.1.1 Gene expression

Selection of reference genes

In order to select the best reference genes for studying the gene expression of the cell

cycle regulators in the cerebellum of hyperbilirubinemic and normal Gunn rat, the most

commonly used reference genes β-Actin, Gapdh, Hprt1 and 18S were measured by real-

time RT-PCR and the variation in the cycle threshold (Ct) was assessed in both genotypes.

The expression stability (M), the average pair wise variation of a particular gene

compared with all other tested reference genes, was evaluated using geNorm and Norm-

Finder software (Vandesompele et al., 2002; Andersen et al., 2004). Lower M values

indicate higher expression stability, with 0.5 being a suggested cut-off for stable genes

(Hellemans et al., 2007) (Table 4). Since the Ct for 18S and Actin was significantly

different (p < 0.05) between the two genotypes (JJ vs. jj), and that the analysis of the

expression stability indicated that the best combination of reference genes was Gapdh

and Hprt1, these two genes were selected as reference genes.

Reference Gene/ Genotype

Cycle Threshold (Ct) geNorm

(M)

Norm-Finder

(M) JJ jj

18S 14.7 ± 1.2 13.5 ± 1.1* 0.132 1.779

Actin 15.7 ± 0.5 15.2 ± 0.3* 0.032 0.278

Gapdh 16.9 ± 0.4 16.8 ± 0.4 0.024 0.036

Hprt1 20.9 ± 0.4 20.8 ± 0.4 0.028 0.040

Table 4: Real-Time RT-PCR of reference genes in normal (JJ) and Hyperbilirubinemic (jj) Gunn rat (N = 9). The Ct values

are Mean ± S.D. Statistical significance * p < 0.05. M: stability value.

RESULTS

47

mRNA expression of cell cycle regulators

The mRNA levels of selected cyclins (D1, E1, A, A1) and cyclin dependent kinases 2

(Cdk2; constitutively expressed) in the cerebellum were quantified by Real Time RT-PCR.

We selected these cyclins and Cdk2 based on previous observations indicating that bilirubin

affects cell cycle (Ollinger et al., 2005; Ollinger et al., 2007b). Hyperbilirubinemic animals (jj)

were compared to age matched (P9) normobilirubinemic controls (JJ) (Figure 14).

In cerebella of hyperbilirubinemic jj rats, the mRNA expression of Cyclin D1 (20 %)

and Cyclin A (15 %) showed a modest downward trend, whereas Cyclin A1 (germinal, which

expression was lower than Cyclin A, as demonstrated by a Ct of 30 vs. 20); Cdk2 expression

was comparable to non-jaundiced JJ controls. On the contrary, the Cyclin E1 mRNA level

was increased by 45 % (p ≤ 0.01) in hyperbilirubinemic jj pups (Figure 14).

Figure 14: mRNA expression of Cyclin D1, E1, A, A1 and Cdk2 in cerebellum of P9 JJ and jj Gunn rats (N = 9). Normal

homozygous JJ and Hyperbilirubinemic homozygous jj Gunn rat. Results were normalized to the two housekeeping genes,

Hprt1 and Gapdh. The values are expressed as mean ± SD. Statistical significance ** p < 0.01.

RESULTS

48

4.1.2 Protein expression

Protein expression of cell cycle regulators

The protein levels of the cell cycle regulators, Cyclin D1, E, A, A1 and Cdk2 were

evaluated by SDS-PAGE Western blot analysis.

As shown in Figure 15 A, the antibodies used recognized band(s) at the expected

molecular weight(s) (36 kDa for D1 and 33 kDa for Cdk2, respectively). In addition to the

expected Cyclin E bands at 50 KDa (full length, FL), the E-4 antibody recognized also the

cleaved forms of Cyclin E ranging from 49 to 34 KDa (low molecular weight forms, LMW);

(Keyomarsi and Pardee, 1993; Harwell et al., 2000; Porter et al., 2001). The M-20 antibody

against Cyclin E recognized also the 18 kDa fragment of Cyclin E (p18-Cyclin E). The anti-

Cyclin A H-432 antibody recognized the two types of Cyclin A proteins expressed (A and A1)

(Yang et al., 1997) and its corresponding variants in rat tissues (Cyclin A1: 47.7 KDa, Cyclin

A: 43.8 KDa and Cyclin A: 29.6 KDa).

Similar to mRNA results, a significant decrease (each p < 0.05) in protein levels of

Cyclin D1 (15 %), and total, as well as “43.8” and “29.6” Cyclin A variants (each about 20 %)

was observed in hyperbilirubinemic vs. control rats (Figure 14 B). Differently from mRNA

results, the protein levels of Cyclin A1and Cdk2 were decreased by about 30 % (p < 0.01) and

25 % (p < 0.001), respectively (Figure 15 B) in hyperbilirubinemic animals.

The level of the total Cyclin E (FL plus LMW) was increased about 19 % (p < 0.05) in

jj animals, in agreement with the increase in mRNA levels. The raised level of Cyclin E was

due entirely to the increased amounts of the LMW cleaved forms of Cyclin E; while the

amount of the FL form (50 kDa) was unchanged (Figure 15 B). Furthermore, the protein

levels of p18-Cyclin E were increased about 67 % (p < <0.05) in jj rats (Figure 15 B).

RESULTS

49

Figure 15: A. Representative Western blot and B. Protein relative expression of Cyclin D1, Cyclin E, p18-Cyclin E, Cyclin

A, A1 and Cdk2 in cerebellum of P9 JJ and jj Gunn rats (N = 9). FL: full length Cyclin E (50 kDa), LWM: low molecular

weight Cyclin E forms (49-34 kDa), Total: FL plus LMW Cyclin E forms. Normal homozygous JJ and

Hyperbilirubinemic homozygous jj Gunn rat. The values are expressed as mean ± SD. Statistical significance * p < 0.05, ** p

<.0.01, *** p < 0.001.

RESULTS

50

Parp-1 cleavage analysis

In order to analyse the presence of an apoptotic processes due to the high levels of

bilirubin present in jj Gunn rat, we evaluated the protein levels of Parp-1 (116 kDa)

and its cleaved form (cleaved Parp-1, cParp-1, 89 kDa) by SDS-PAGE Western blot

analysis. As shown in Figure 16 A, cParp-1 was present both in control (JJ) and

jaundiced (jj) animals. However (Figure 16 B), the level of Parp-1 and cParp-1 was

significantly increased in hyperbilirubinemic jj animals by 38 % and 54 %

respectively (each p < 0.01).

Figure 16: A. Representative Western blot and B. Protein relative expression of PARP-1 and cPARP-1 (cleaved PARP-1) in

cerebellum of P9 JJ and jj Gunn rats (N = 9). Normal homozygous JJ and Hyperbilirubinemic homozygous jj Gunn rat.

The values are expressed as mean ± SD. Statistical significance ** p < 0.01.

4.1.3 Cell cycle analysis by FACS

Cell cycle progression during development

In order to evaluate the cell cycle progression during the post-natal development of

cerebella in healthy animals, the cerebella of P3 (N = 6), P9 (N = 4) and P60 (N = 4)

Wistar rats were analysed by FACS. As shown in Figure 17, a slightly increase in the

proportion of cells in G0/G1 (from 68 % to73 %) and G2/M (from 5 % to 7 %, p< 0.01

RESULTS

51

and p < 0.05) phase were observed in P9 as compared to either P3 and P60 rats. At the

same time, in P9 animals the proportion of cells in S phase was reduced from 27 % to 20 %

(p < 0.05) respect P3 pups. The proportion of cells in G0/G1, S and G2/M phases were

almost identical between P3 and P60 rats.

Figure 17: Cell cycle progression in cerebella of P3, P9 and P60 Wistar rats. P3, P9 and P60 Wistar rat. The values

are expressed as mean ± SD. Statistical significance * p < 0.05, ** p < 0.01.

Bilirubin effect on cell cycle progression

To assess the effect of hyperbilirubinemia on the cell cycle progression in cerebella,

we evaluated the cell cycle profile in P9 normal JJ (N = 7) and hyperbilirubinemic jj (N =

9) Gunn rats by FACS. As shown in Figure 18, in hyperbilirubinemic jj animals the

proportion of cells in G0/G1 phase increased from 66 % to 72 % (p < 0.01), while cells in

S phase decreased from 28 % to 22 % (p < 0.05). The percentage of cells in the latest cell

cycle phase (G2/M) was identical in both genotypes (6 %).

Moreover, thanks to light-scattering properties of a cell, the correlated measurements

of forward-scattered light (FCS, proportional to cell-surface area or size) and side-

RESULTS

52

scattered light (SSC, proportional to cell granularity or internal complexity) allowed us to

differentiate two major subpopulations in the cell suspension obtained from JJ and jj

Gunn rat cerebella. The first population (Subpopulation A) was characterized by smaller

size and less granularity, while in the second population the size and granularity was

higher (Subpopulation B) No difference was observed in the cell cycle profile of

Subpopulation A of JJ and jj rats. On the contrary, an increase of cells in G0/G1 phase in

jj vs. normal rats (from 57 % to 72 %, p < 0.01) was observed in Subpopulation B,

meanwhile the proportion of cells in S (from 33 % to 22 %) and G2/M (from 10 % to 5 %)

phases was significantly decrease in jj animals (Figure 19).

Figure 18: Cell Cycle progression in cerebella of P9 JJ and jj Gunn rats. Normal homozygous JJ and

Hyperbilirubinemic homozygous jj Gunn rat. (N = 7 for JJ and N = 9 for jj). The values are expressed as mean ± SD.

Statistical significance * p < 0.05, ** p < 0.01.

RESULTS

53

Figure 19: Evaluation of the cell cycle profile in the two major subpopulations observed in JJ and jj Gunn rats. A. Forward-

scattered light (FCS) vs. side-scattered light (SSC) Dot Plots. B. Cell cycle profile in Subpopulation A and B from Gunn rat

cerebella. (N = 7 for JJ and N = 9 for jj). The values are expressed as mean. Statistical significance * p < 0.05, ** p < 0.01.

4.2 in vitro bilirubin effect on cell cycle

4.2.1 Bf and UCB solutions

The free (unbound) plasma bilirubin concentration (Bf) was determined in each

culture medium (DMEM and Neuron Medium, Figure 20). Solutions with different molar

ratio UCB/ BSA (25.6 µM, contained in FBS) were generated by addition of purified

unconjugated bilirubin to the cultures mediums (DMEM low glucose plus 10 % FBS and

Neuron Medium low glucose plus 10 % FBS) in order to obtain solutions with variable

doses of Bf to treat the cells.

RESULTS

54

Figure 20: Relationship of Bf to UCB in two albumin-containing cultures mediums. DMEM low glucose with 10% FBS

(25.6 µM BSA) and Neuron Medium with 10% FBS (25.6 µM BSA).

The two final UCB concentrations of 5 and 25 µM used to treat cells in each culture

medium, yielded different free unbound UCB concentration (Bf), being respectively:

DMEM low glucose, 10 % FBS: 27 and 175 nM

Neuron Medium, low glucose, 10 % FBS: 15 and 126 nM

4.2.2 Cell viability after UCB treatment

To verify the effect of UCB on the two primary cell cultures, cells were treated with

the same Bf reported above for 10, 30 min, 1, 2, 4, 8 and 24 hours.

RESULTS

55

Primary astrocytes culture

Figure 21: Representative photograph of astrocyte primary culture at 14 div. Image from a Nikon eclipse Ts100 phase

contrast light microscope.

Astrocyte primary cultures were grown for about 14 div in completed DMEM (Figure

21), and treated as described above. Cell viability was unchanged when cells were treated

with a physiological Bf of 27 nM (UCB 5 µM) in completed DMEM medium for the

different periods of time tested. On the contrary, when the cells were treated with a Bf of

175 nM, UCB decreased astrocyte viability in a time-dependent manner, significant only

after 4 hours of treatment (Figure 22 A).

Since the Bf in the two culture mediums for each final UCB concentration were

different, and considering the possibility of performing astrocyte/CGC co-cultures, we

studied also the viability of astrocyte after the treatment with UCB in Neuron Medium as

described in materials and methods. As shown in Figure 22 B, treatment in Neuron

Medium with the lower Bf (15 nM/ UCB 5 µM) did not cause any change in viability. On

the other hand treatment with a Bf of 126 nM (UCB 25 μM) produced a decrease in cell

viability in a time-dependent manner, being statistically significant only after 8 hours of

treatment.

RESULTS

56

The viability was not affected by the change in the treatment culture medium (DMEM

vs. Neuron Medium), in any UCB concentration and time. Neither was affected by the

only addition of 0.5 % DMSO (bilirubin vehicle) to the culture medium, in any time (data

not shown).

Figure 22: Effect of UCB on astrocytes viability- MTT time course. A. Astrocytes treated in DMEM medium with different

doses of UCB (Bf 27 and 175 nM) for different periods of time. B. Astrocytes treated in Neuron Medium with different doses

of UCB (Bf 15 and 126 nM) for different periods of time. Control cells were grown in its corresponding medium with 0.5 %

DMSO for each time. Results are expressed as mean percentage values (%) ± SD of at least three independent experiments

performed in duplicate. Statistical significance * p < 0.05, ** p < 0.01.

A.

B.

RESULTS

57

Primary cerebellar granule culture

Cerebellar granule cells were grown for 7 div in Neuron Medium. Neurite outgrowth

begins within hours after plating primary CGC, and mature cultures showed a dense

network of processes which can be characterized as axons and dendrites (Burgoyne and

Cambray-Deakin, 1988). Furthermore, CGC in culture form functional synapses (Van

Vliet et al., 1989). As shown in Figure 23 CGC can readily be indentified in cultures by

their small round cell bodies of 8 μm diameter and the presence of one or two neuritis. As

previously described (Balazs et al., 1988), at this time CGC are fully developed and

acquire the morphological, biochemical, and electrophysiological characteristics of

mature neurons, including the synthesis and release of glutamate. Primary cerebellar

granule cells cultures obtained using the protocol described in materials and methods

provides a homogeneous populations of granule neurons (they represent the 90-95 % of

the cells present in culture), with a dense network of axons and dendrites. Other cells

which can be found in minor quantities within the cultures are astrocytes and fibroblast,

these last cells functioning as scaffold necessary to support granule cell growth and

development.

Figure 23: Representative photograph of cerebellar granule cells primary culture at 7 div. Images from a Nikon eclipse

Ts100 phase contrast light microscope. A. 10X and B. 20X. Healthy neurons organized into clumps interconnected by thick

bundles of fibbers.

A. B.

RESULTS

58

The CGC viability was unchanged when cells were treated with a physiological Bf of

15 nM in Neuron Medium for different periods of time. However, when the cells were

treated with a Bf of 126 nM (UCB 25 μM), UCB decreased CGC viability in a time-

dependent manner, being statistically significant after 10 minutes of treatment. At two

hours of treatment the viability, reached the lowest level (~ 56) (Figure 24). The viability

was not affected by the only addition of 0.5 % DMSO (bilirubin vehicle) to the culture

medium, in any time (data not shown).

Figure 24: Effect of UCB on cerebellar granule viability- MTT time course. Cerebellar granule cells treated in Neuron

Medium with different doses of UCB (Bf 15 and 126 nM) for different periods of time. Control cells were grown in its

corresponding medium with 0.5 % DMSO for each time. Results are expressed as mean percentage values (%) ± SD of at

least three independent experiments performed in duplicate. Statistical significance * p < 0.05, ** p < 0.01.

4.2.3 Gene expression analysis

We investigated by Real Time RT-PCR, whether or not a toxic concentration of UCB

(Bf 126 nM) modifies the gene expression of the cell cycle regulators. Based on the

above described results, the intention of treating the two cells types with the same Bf,

more importantly, considering the possibility of performing co-culture, both astrocytes

and CGC primary cultures were treated in Neuron Medium with a Bf of 126 nM for 2 and

24 hours.

RESULTS

59


Astrocytes primary cultures were first grown in completed DMEM medium and 2 days

before treatment the medium was changed by Neuron Medium, where treatment was

performed. As shown in Figure 25 A, at 2 hours of treatment the expression of Cyclin D1

and Cyclin A1 were only slightly affected by UCB treatment, while the expression of

Cyclin E, A and Cdk2 was not modified as compared to cells treated 0.5 % DMSO. No

differences in gene expression were found between cells (kept in Neuron Medium) and

controls (cells treated with 0.5 % DMSO)

After 24 hours of treatment (Figure 25 B), a slight down-regulation on the expression

of Cyclin E, Cdk2 and Cyclin A was observed, whereas the mRNA levels of Cyclin D1

and A1 were increased. The last results are controversial because treatment with 0.5 %

DMSO seems to affect by itself the expression of Cyclin D1 and A1 respect to cells that

were only kept in Neuron Medium. On the contrary no differences were found for Cyclin

E, Cdk2 and Cyclin A gene expression.


Cerebellar granule neurons were grown in Neuron Medium for 7 div, and treated for 2

and 24 hours with a Bf of 126 nM. As shown in Figure 26 A, the expression of Cyclin D1

and Cdk2 was not affected at 2 hours of treatment, while the expression of Cyclin A and

Cyclin E was slightly up-regulated, respect to control group. After 24 hours of treatment

(Figure 26 B), a slight down-regulation on the expression of Cyclin D1 was observed

respect to controls. Whereas, mRNA levels of Cyclin A were slightly increased, and

mRNA levels of Cyclin E and Cdk2 were unchanged. It has to be taken in consideration

that Cyclin D1 and A expression was affected by 2 and 24 hours treatment with 0.5 %

DMSO respect to cells that were only kept in Neuron Medium. Cyclin A1 mRNA

expression was not detectable.

RESULTS

60

Figure 25: Effect of UCB treatment on gene expression of cell cycle regulators. A. Astrocytes treated for 2 hours or B. for 24

hours with a Bf of 126 nM. Cells corresponded to cells with only Neuron Medium; control cells were treated in Neuron

Medium with 0.5 % DMSO. Results are expressed as mean ± SD of at least three independent experiments performed in

duplicate. Statistical significance * p < 0.05, ** p < 0.01, *** p < 0.001.

B.

A.

RESULTS

61

Figure 26: Effect of UCB treatment on gene expression of cell cycle regulators. A. Cerebellar granule neurons treated for 2

hours and B. for 24 hours with a Bf of 126 nM. Cells corresponded to cells with only Neuron Medium; Control cells were

treated with 0.5 % DMSO. Results are expressed as mean ± SD of at least three independent experiments performed in

duplicate. Statistical significance * p < 0.05, ** p < 0.01.

4.2.4 Cell cycle analysis


To assess the specific effect of toxic levels of bilirubin (Bf 126 nM) on cell cycle

progression in astrocytes, the cell cycle profile was evaluated on cells treated for 2 and 24

hours using flow cytometry (FACS). Withdrawal of FBS from the culture medium for 24

hours was used as positive control for cell cycle arrest; five independent experiments

performed in duplicate were made. The astrocyte cell cycle profile was unaffected by a

126 nM Bf in the two treatment times studied (Figure 27).

A.

B.

RESULTS

62

Figure 27: Cell cycle progression in astrocytes primary cultures analyzed by FACS. A. Treated for 2 hours and B. 24 hours

with a Bf of 126 nM. FBS corresponded to cells where FBS was removed for 24 hours. Cells corresponded to cells with only

Neuron Medium; Control cells were treated with 0.5 % DMSO. Results are expressed as mean ± SD of five independent

experiments performed in duplicate. Statistical significance * p < 0.05, ** p < 0.01.


To assess the specific effect of toxic levels of bilirubin (Bf 126 nM) on cell cycle

progression in CGC culture, the cell cycle was evaluated on granule neurons treated for 2

and 24 hours by FACS. Withdrawal of FBS from the culture medium for 24 hours was

used as positive control for cell cycle arrest; five independent experiments performed in

duplicated were made. As shown in Figure 28, when CGC were treated for 2 hours, the

proportion of cells in G0/G1 was significantly increased (from 73 % to 84 %, p < 0.01),

while cells in S phase decreased from 20 % to 11 % (p < 0.01). The percentage of cells in

the latest cell cycle phase (G2/M) was slightly decreased. No difference was found

between cells (kept in medium) and controls (medium with 0.5 % DMSO). No

differences were found on the cell cycle profile after 24 hours of treatment with a 126 nM

Bf.

A. B.

RESULTS

63

Figure 28: Cell cycle progression in CGC primary cultures analyzed by FACS. A. Treated for 2 hours and B. 24 hours with a

Bf of 126 nM. Cells corresponded to cells with only Neuron Medium; Control cells were treated with 0.5 % DMSO. Results

are expressed as mean ± SD of five independent experiments performed in duplicate. Statistical significance ** p < 0.01.

4.2.5 Apoptosis/ necrosis analysis in astrocyte primary culture

To study the possible role of UCB in the induction of apoptosis and/ or necrosis,

astrocytes were grown for 14 div and treated for 2 and 24 hours with a 126 nM Bf, and

evaluated as described in materials and methods by FACS.

As shown in Figure 29, no significant differences were found at any time between

controls and treated astrocytes. Treatment of astrocytes with 0.5 % DMSO (controls) has

not any effect on the apoptotic rate respect to cells that were kept in Neuron Medium.

Only a slight increase in cells at early apoptosis was observed after 24 hours of treatment

with UCB.

A. B.

RESULTS

64

Figure 29: Effect of UCB on apoptosis/ necrosis induction on astrocytes primary cultures analyzed by FACS. Representative

Annexin-V vs. Pi dot plot. The lower left quadrant correspond to normal cells (alive); lower right to cells in early apoptosis;

the upper left to necrotic cells and the upper right to cells in late apoptosis. A. Treated for 2 and B. 24 hours with a Bf of 126

nM. Control cells were treated with 0.5 % DMSO. Results are expressed as mean ± SD of four independent experiments

performed in duplicate. No statistical significance were found.

RESULTS

65

4.3 Neural cells cryopreservation

Proportion of cryoprotective agent

The effect of increasing concentrations of DMSO as cryoprotective agent was

investigated by the evaluation of cell viability (tryphan blue exclusion test) after

rewarming, and according to how many days cells remains viable in culture. The CGC

cultures were monitored daily to check their progress.

As shown in Table 5, the viability after rewarming increased with the quantity of

DMSO added to the medium. However only cells that were cryopreserved with less than

20 % DMSO attached to the plate the day after plating. Furthermore, cryopreserved cells

with 9, 15 and 16.6 % DMSO attached to the plate exhibited a rounded refringent shape

without any kind of branching (axons), and were not able to live more than 48 hours.

Only the cells cryopreserved with 10 % DMSO were able to adhere to the plate, develop

and survive up to 7 div. Based on these results the following cryopreservations were

performed with 10 % DMSO.

% DMSO Viability before freezing % Viability after rewarming %

9.0 98.0 82.8

10.0 96.6 77.3

15.0 94.8 84.0

16.6 98.0 85.7

23.1 97.9 91.9

28.6 97.9 92.9

Table 5: Effect of the quantity of cryoprotective agent (DMSO) added for cryopreservation on cell viability after rewarming.

For 9.0, 16.6, 23.1, and 28.6 % one independent experiment was performed. For 10.0 % and 15.0 % three independent

experiments were performed in triplicate.

RESULTS

66

Freezing and rewarming conditions

The cerebellar granule cells were cryopreserved in Neuron Medium with 10 % DMSO

at different freezing rates. From the temperature vs. time graph (Figure 30 A) the

temperature and the time at which each sample spontaneously freeze was calculated for

each cryopreserved sample (Table 6).

Sample Freezing rate (°C/ min) Spontaneous

freezing time (min) Freezing Temperature (°C)

S1 3.3 12 -14.8

S2 2.1 18 -17.1

S3 1.2 33 -16.7

Table 6: Freezing conditions. Each sample was frozen in triplicate.

RESULTS

67

Figure 30: Representative graph used for evaluation and calculation of A. Freezing rate and B. Rewarming rate.

As described in materials and methods, the 3 aliquots cryopreserved from each sample

(sample S1, S2 and S3) were thawed under different temperature (36, 39°C and RT) and

the rewarming temperature and rate calculated, as shown in Figure 30 B. The viability

after rewarming was evaluated by trypan blue exclusion test, and CGC cultures were

monitored daily to check their progress and survival (days in vitro, div) (Table 7).

RESULTS

68

Sample Rewarming temperature

(°C) Rewarming rate (°C/ min) Viability (%) Div

S1a 36.0 263.0 71.8 3

S1b 39.0 147.8 75.6 3

S1c Air/ RT 94.1 81.8 3

S2a 36.0 133.6 74.1 7

S2b 39.0 154.4 83.6 7

S2c Air/ RT 125.2 76.2 7

S3a 36.0 101.5 75.7 6

S3b 39.0 182.1 68.0 6

S3c Air/ RT 282.0 80.0 6

Table 7: Rewarming conditions, viability and survival of CGC after rewarming. Div: days in vitro.

All the granule neurons that were cryopreserved with 10 % of DMSO, adhered to the

plate and developed axons the day after plating, as fresh cells. The aliquots with lower

survival rate derived from the sample cryopreserved with the highest freezing rate (S1).

The survival of the cells cultures from S2 and S3 samples were almost the same. However,

the highest viability was found in the aliquot S2b, cells cryopreserved at an average speed

and rewarmed in a 39°C bath. The culture obtained from sample S2b showed an

appearance more similar to cultures obtained from fresh cells.

69

5 DISCUSSION

5.1 Bilirubin effect on cell cycle

in vivo

Since its discovery the Gunn rat has been used as animal model of CNIS and neonatal

hyperbilirubinemia (Schutta and Johnson, 1967; Chowdhury et al., 1993). Homozygous

hyperbilirubinemic jj Gunn rats manifest an inherited deficiency of hepatic UDP-

glucuronosyltransferase and are therefore unable to adequately conjugate and excrete bilirubin,

developing a severe hyperbilirubinemia and visible jaundice within 6 h of parturition

(Johnson et al., 1959; Wennberg, 1993).

In hyperbilirubinemic jj animals, cerebellar cell proliferation appears to be affected by

bilirubin (Schutta and Johnson, 1967; Sawasaki et al., 1976). A significantly reduction on

cerebellar weight in jj rats respect to the normal’s heterozygous (Jj) and homozygous (JJ)

littermates (Schutta and Johnson, 1967; Gazzin et al., 2011; Zarattini et al., 2011) have been

demonstrated. This cerebellar hypoplasia is accompanied by prominent loss and degeneration

of Purkinje cells and granule neurons (Mikoshiba et al., 1980; O'Callaghan and Miller, 1985;

Chowdhury et al., 1993). Finally, the loss of cells, both in vivo and in vitro, has been linked to

the bilirubin induced activation of apoptotic or necrotic pathways (Silva et al., 2001;

Rodrigues et al., 2002a; Watchko, 2006; Falcao et al., 2007; Vaz et al., 2010; Rice and

Shapiro, 2005).

Recently alterations of the cell cycle by high concentrations of bilirubin has been

described (Ollinger et al., 2005; Ollinger et al., 2007b; Ollinger et al., 2007a; Rao et al., 2006).

Furthermore, in vitro evidences indicates that cell cycle regulating proteins are involved in

apoptotic process in neurons (Herrup and Busser, 1995; Becker and Bonni, 2004; Wen et al.,

2005).

Those studies suggested a possible link between cell cycle arrest at high concentration

of bilirubin and the well characterized cerebellar hypoplasia in jj Guun rat.

DISCUSSION

70

Our results in whole cerebella dissected from hyperbilirubinemic (jj) Gunn rats, show a

decrease in the protein expression of Cylin D1, Cyclin A, A1, and even more a decrease of the

constitutively expressed Cdk2, these results are in agreement with previous in vitro findings

(Ollinger et al., 2005; Ollinger et al., 2007b), reinforcing the capacity of bilirubin to interfere

with the cell cycle.

Cyclin D1 is the earliest mRNA/protein that has to be synthesized to initiate the cell

cycle, followed by the inactivation of retinoblastoma protein (Rb) and the release of E2F

transcription factor (Sherr and Roberts, 1999; Olashaw and Pledger, 2002). The release of

E2F leads to the synthesis firstly of Cyclin E and later of Cyclin A, which sequentially binds

and activates Cdk2. Therefore, the down regulation of cyclin D1 mRNA observed in jj

animals could implicate that in some way bilirubin is interfering with the arrival of

physiologic growth mitogenic stimulus, leading to a decrease in the rate of the cell cycle

progression.

This assumption is confirmed by the decrease of the protein expression of Cdk2

observed in jj animals, key regulator of the S phase and catalytic subunit of both Cyclin E and

Cyclin A/Cdk2 complexes. Being these two complexes required for entry into and completion

of S phase (Pagano et al., 1992; Resnitzky and Reed, 1995; Lavia and Jansen-Durr, 1999;

Chibazakura et al., 2011). No differences between jj and JJ Cdk2 mRNA levels were

observed, indicating that the reduction plays across post-transcriptional mechanism(s).

In the past, bilirubin has been considered able to impair both protein and DNA synthesis,

and this has been suggested as a possible explanation for the cerebella hypoplasia observed in

hyperbilirubinemic Gunn rats (Yamada et al., 1977; Katoh-Semba and Kashiwamata, 1984).

However, we report a relevant increase in Cyclin E mRNA and protein in jj animals (vs. JJ).

This results, in addition to the significant increase in the protein level of αTubulin observed in

jj animals (p < 0.01; data not shown) are not in line with this theory.

The up-regulation of Cyclin E we observed in vivo, do not correlate with the down-

regulation of Cyclin E reported in literature (Ollinger et al., 2005) and seems not to be in line

with the idea that bilirubin arrests the cell cycle. However, in the hyperbilirubinemic cerebella,

the higher levels of the total Cyclin E protein were basically due to an increase in the amounts

of the LMW isoforms, whereas the protein expression of the FL form was unchanged. The

DISCUSSION

71

LMW isoforms of Cyclin E are generated through cleavage by the elastase class of proteases

from the FL Cyclin E (Harwell et al., 2000; Porter and Keyomarsi, 2000; Porter et al., 2001).

Additionally, when in complex with Cdk2, they are biochemically hyperactive as compared

with FL Cyclin E/CDK2 complex (Porter and Keyomarsi, 2000; Wingate et al., 2003; Harwell

et al., 2004). Moreover, it has been shown that Cyclin E can functionally replace Cyclin D1

deficiency (Geng et al., 1999). Therefore, we hypothesized that the increased expression of

LMW isoforms in jj Gunn rats, could be an attempt to bypass the cell cycle arrest, by an hyper

activation of the remained Cdk2, and the induction of a faster rate of cell cycle progression

and proliferation (Porter and Keyomarsi, 2000; Harwell et al., 2000).

Despite this supposed effort to overcome the arrest of the cell cycle, we still observed a

cell cycle arrest in the late G0/G1 phase in whole cerebella of hyperbilirubinemic pups by

FACS (Figure 18). These in vivo results are in agreement, with those reported in vitro by

other, on different cell cultures exposed to bilirubin (Rao et al., 2006; Ollinger et al., 2005;

Ollinger et al., 2007a). It is important to bear in mind that the cerebellar cells used in this

study are a mixture of all the type of cells found in jj cerebellum, not only those sensitive to

bilirubin toxicity, such as neuronal cells, but also the less sensitive ones, such as glial cells.

These less sensitive cells might partially mask the effect of bilirubin toxicity to a level similar

to that of JJ cerebellar cells, decreasing the difference in cell cycle progression between the

two genotypes. This assumption was confirmed when we evaluated the cell cycle progression

in the two distinguished cells subpopulations (Subpopulation A and B), the cell cycle

progression was not affected in Subpopulation A, while the decrease observed in

Subpopulation B was greater than that observed in the whole suspension; unfortunately we

were unable to characterize the composition of each subpopulation.

Most importantly, in hyperbilirubinemic Gunn rats (vs. controls), the expression of p18-

cyclin E fragment was increased. This fragment, is generated through caspase -mediated

proteolytic cleavage of the C-terminal portion of Cyclin E, leading to the inactivation of

Cyclin E activity and cell cycle function (Mazumder et al., 2002), due to the abrogation of its

binding to Cdk2. In contrast to cell cycle progression, the p18-cyclin E fragment has a critical

role in the amplification of the intrinsic apoptotic pathway, by interacting with Ku70, p18-

Cyclin E release Bax, which participates in the amplification of apoptosis (Mazumder et al.,

2007b; Mazumder et al., 2007a). The caspase mediated apoptotic cell death is accomplished

DISCUSSION

72

through the cleavage of several key proteins required for cellular functioning and survival

(Fischer et al., 2003). One of them is PARP-1, Poly (ADP-ribose) polymerase-1, and the

presence of its cleaved form (cPARP, 85 kDa fragment) is considered to be a hallmark of

apoptosis (Kaufmann et al., 1993; Tewari et al., 1995). Previously it has been demonstrated in

vitro that bilirubin treatment of rat neurons produce cytochrome c release, caspase-3

activation, PARP cleavage and apoptosis (Rodrigues et al., 2002a). The detection of cleaved

PARP in the cerebellum of P9 normal (JJ) hyperbilirubinemic (jj) Gunn rat indicates, as we

expected, the presence of an apoptotic process. The levels of cleaved PARP observed in

normal animals correspond to the physiological cell death (apoptosis) observed during

cerebellar development (Cheng et al., 2011; Oppenheim, 1991). While the increased levels of

PARP and cleaved PARP in hyperbilirubinemic jj Gunn rat (vs. JJ) indicates an enhancement

of the apoptotic process by the high levels of bilirubin present in this animals.

in vitro

Numerous studies have demonstrated the selectivity of the bilirubin toxicity for certain

areas of the brain and for only certain cells types within them. It has been shown that

neurons, particularly granule neurons and Purkinje cells (Schutta and Johnson, 1967;

Takagishi and Yamamura, 1989; Sawasaki et al., 1976), are the main target for bilirubin

toxicity (Danbolt et al., 1993; Hansen et al., 1988b; Sawasaki et al., 1976; Ngai et al.,

2000; Vazquez et al., 1988), recent reports have also described compromised astrocyte

function following UCB interaction (Silva et al., 1999; Silva et al., 2002; Amit and

Brenner, 1993). The cerebellum of hyperbilirubinemic Gunn rat presents degeneration

and loss of Purkinje cells, reduction of the granular layer thickness, and hypertrophy of

astrocytes (Chowdhury et al., 1993; Mikoshiba et al., 1980; O'Callaghan and Miller, 1985;

Sawasaki et al., 1976).

Our results in primary cultures of cerebellar astrocytes and granule cells shown that

cell viability was only affected when bilirubin treatment was performed with a toxic

concentration (about of 140 nM Bf, such as that found in P9 hyperbilirubinemic Gunn

rat), and this effect was time-dependent. Granule neurons were more susceptible than

astrocytes, showing a decrease in cell viability at shorter treatment times than astrocytes.

DISCUSSION

73

These results are in agreement with previous studies performed with higher bilirubin

concentrations in neuronal cells lines or primary cultures (Notter and Kendig, 1986; Ngai

et al., 2000; Rodrigues et al., 2002c; Silva et al., 2002). When we evaluated the rate of

apoptosis in astrocytes after treatment, we did not observe significant difference (as

respect to controls). Our results of bilirubin-induced apoptosis in astrocytes differ from

the previously cited studies; this could be due to that they were made with higher UCB

concentrations and longer treatment periods.

Additionally, when we evaluated the cell cycle progression in the two primary cultures

we observed a different cell response to UCB- induced toxicity. The cell cycle was

arrested only in granule cells after two hours of UCB exposure, while, after 24 hours of

treatment the cell cycle arrest had disappeared. As far as we know, this is the first study

showing that bilirubin affects the cell cycle differently in astrocytes and granular cells.

Also, our result showing that the cell cycle is only arrested in granular cells, further

reinforce the fact that neurons are far more sensitive than astrocytes when exposed to the

same insult (same UCB concentration and treatment time). To study the molecular

mechanism underneath we evaluated the gene expression of the same cell cycle

regulators used in the in vivo study. No conclusive information could be taken from these

results, because the bilirubin vehicle (DMSO) alone affected the gene expression of

Cyclin D1 and A in granule cells at every treatment time. In astrocytes DMSO affect the

gene expression of cylin D1 and A1 only at longer (24) hours of treatment.

in vivo- in vitro

The in vivo cell cycle analysis of the whole pool of cells that constitute the cerebellum

indicates a cell cycle arrest in the cerebellum of hyperbilirubinemic Gunn rats respect to

controls. Moreover, when the two main subpopulations detected were evaluated

independently, a cell cycle arrest was observed in only one of them, Subpopulation B,

while the other one (Subpopulation A) did not differ. When primary cell cultures of

astrocytes and granular neurons, obtained from whole cerebellum, were treated with an

UCB concentration (about 140 nM Bf) similar to that found in hyperbilirubinemic P9

Gunn pups, an arrest of the cell cycle was observed only in granular cell culture. If we put

DISCUSSION

74

together the in vivo and in vitro results, we could speculate that Subpopulation B is

mainly constitute by sensitive granular cells, while Subpopulation A by astrocytes.

Further experiments, using specific cell markers, have to be performed to characterise the

two subpopulations, and confirm our hypothesis.

5.2 Cryopreservation of primary granule neurons

With the beginning of success in neural tissue transplantation the studies of

cryopreservation of neural cells/tissue started to growth. Several studies have been

performed to achieve cryopreservation of nervous tissue, cells, primary neural tissue,

neural progenitors cells and neural stem cells have been subjected to freezing, as

summarized by Paynter in 2008 (Paynter, 2008; Ichikawa et al., 2007). However, for

these cells type cryopreservation has not been applied with sufficient success to enable it

to be incorporated into routine clinical practice.

In our attempts to cryopreserve cerebellar granule cells by the slow- freezing

methodology, we observed that with increasing concentrations of cryoprotective agent

(DMSO) the cell viability after rewarming was higher, however cells were unable to

attach to the plate. The best results were obtained with 10 % DMSO (although the

viability was of 77.3 %), a middle freezing rate of 2.1°C/min and a faster rewarming rate

(154.4°C/min) at 39°C bath. Further experiments must be done to check neuronal

function.

75

6 CONCLUSION

In conclusion, our in vivo data indicate that in jj Gunn rat cerebellum high level of

unconjugated bilirubin causes a cell cycle arrest, the enhancement of apoptosis. This two

processes seem to be active through p18-Cyclin E. Thus the combination of cell cycle

arrest and apoptosis could be the cause of the cerebellar hypoplasia observed in

hyperbilirubinemic jj Gunn rat.

Collectively our in vitro data support the selectivity of bilirubin to damaged specific

cells as cerebellar granule neurons. Cerebellar granule cells were more susceptible to

bilirubin toxicity than astrocytes, and in agreement the cell cycle was only affected in

granule cells. This last result could indicate that the cell cycle arrest observed in vivo may

be caused mainly by granule cells arrest.

Cryopreservation of cerebellar granule cells was successful when 10 % DMSO was

used as cryoprotective agent, the freezing of the sample was made at a middle rate, and

rewarmed at a fast rate.

77

ACKNOWLEDGEMENTS



Dr. Silvia Gazzin

Cristina Bellarosa

Natalia Rosso

Sabrina Corsucci

Caecilia Sukowati

Varenka Barberi

Carlos Coda Zabetta

Devis Pascut

Beatrice Anfuso

Mohamed Qaisiya

Sabrina Gambaro

Paolo Peruzzo

Elena Boscolo

Sandra Leal

Erika Ghersin

Giulia Furlan

Chiara Greco

Pablo Giraudi

Norberto Chavez Tapia

Andrea Berengeno

Centro Binacional (Argentina-Italia) de Investigaciones en

Criobiología Clínica y Aplicada

Dr. Joaquín Rodriguez

Dr. Edgardo Guibert

All members of the center

Animal Facility, Università

di Trieste

Dr. Paola Zarattini

CBM- Consorcio per il Centro di

Biomedicina Molecolare S.c.ar.l.

Andrea Lorenzon

Dr. Francesca Petrera

78

REFERENCES

Reference List

Ahlfors,C.E. (2000). Measurement of plasma unbound unconjugated bilirubin. Anal. Biochem. 279, 130-135.

Ahlfors,C.E. (2001). Bilirubin-albumin binding and free bilirubin. J. Perinatol. 21 Suppl 1, S40-S42.

Ahlfors,C.E. and Wennberg,R.P. (2004). Bilirubin-albumin binding and neonatal jaundice. Semin. Perinatol. 28, 334-339.

Altman,J. (1972). Postnatal development of the cerebellar cortex in the rat. I. The external germinal layer and the transitional molecular layer. J. Comp Neurol. 145, 353-397.

Altman,J. and Das,G.D. (1966). Autoradiographic and histological studies of postnatal neurogenesis. I. A longitudinal investigation of the kinetics, migration and transformation of cells incorporating tritiated thymidine in neonate rats, with special reference to postnatal neurogenesis in some brain regions. J. Comp Neurol. 126, 337-389.

Amit,Y. and Brenner,T. (1993). Age-dependent sensitivity of cultured rat glial cells to bilirubin toxicity. Exp. Neurol. 121, 248-255.

Andersen,C.L., Jensen,J.L., and Orntoft,T.F. (2004). Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245-5250.

Aono,S., Semba,R., Sato,H., and Kashiwamata,S. (1989). Mode of bilirubin deposition in the cerebellum of developing jaundiced Gunn rats. Biol. Neonate 55, 119-123.

Arias,I.M., Gartner,L.M., Cohen,M., Ben-Ezzer,J., and Levi,A.J. (1968). Chronic nonhemolytic unconjugated hyperbilirubinemia with glucuronyl transferase deficiency: evidence for genetic heterogeneity. Trans. Assoc. Am. Physicians 81, 66-75.

Balazs,R., Gallo,V., and Kingsbury,A. (1988). Effect of depolarization on the maturation of cerebellar granule cells in culture. Brain Res. 468, 269-276.

Becker,E.B. and Bonni,A. (2004). Cell cycle regulation of neuronal apoptosis in development and disease. Prog. Neurobiol. 72, 1-25.

Becker,E.B. and Bonni,A. (2005). Beyond proliferation--cell cycle control of neuronal survival and differentiation in the developing mammalian brain. Semin. Cell Dev. Biol. 16, 439-448.

Berthelot,P. and Dhumeaux,D. (1978). New insights into the classification and mechanisms of hereditary, chronic, non-haemolytic hyperbilirubinaemias. Gut 19, 474-480.

REFERENCES

79

Blanckaert,N., Heirwegh,K.P., and Compernolle,F. (1976). Synthesis and separation by thin-layer chromatography of bilirubin-IX isomers. Their identification as tetrapyrroles and dipyrrolic ethyl anthranilate azo derivatives. Biochem. J. 155, 405-417.

Blaschke,A.J., Staley,K., and Chun,J. (1996). Widespread programmed cell death in proliferative and postmitotic regions of the fetal cerebral cortex. Development 122, 1165-1174.

Blaschke,A.J., Weiner,J.A., and Chun,J. (1998). Programmed cell death is a universal feature of embryonic and postnatal neuroproliferative regions throughout the central nervous system. J. Comp Neurol. 396, 39-50.

Bonnett,R., Davies,J.E., Hursthouse,M.B., and Sheldrick,G.M. (1978). The structure of bilirubin. Proc. R. Soc. Lond B Biol. Sci. 202, 249-268.

Booher,J. and Sensenbrenner,M. (1972). Growth and cultivation of dissociated neurons and glial cells from embryonic chick, rat and human brain in flask cultures. Neurobiology 2, 97-105.

Bosma,P.J., Chowdhury,J.R., Bakker,C., Gantla,S., de,B.A., Oostra,B.A., Lindhout,D., Tytgat,G.N., Jansen,P.L., Oude Elferink,R.P., and . (1995). The genetic basis of the reduced expression of bilirubin UDP-glucuronosyltransferase 1 in Gilbert's syndrome. N. Engl. J. Med. 333, 1171-1175.

Bosma,P.J., Seppen,J., Goldhoorn,B., Bakker,C., Oude Elferink,R.P., Chowdhury,J.R., Chowdhury,N.R., and Jansen,P.L. (1994). Bilirubin UDP-glucuronosyltransferase 1 is the only relevant bilirubin glucuronidating isoform in man. J. Biol. Chem. 269, 17960-17964.

Brito, M. A. The human RBC as a model of unconjugated bilirubin binding and toxicity. New Trends in Brain Research , 1-38. 2006. Nova Science Publishers, Inc. Ref Type: Generic

Brito,M.A., Brites,D., and Butterfield,D.A. (2004). A link between hyperbilirubinemia, oxidative stress and injury to neocortical synaptosomes. Brain Res. 1026, 33-43.

Burgoyne,R.D. and Cambray-Deakin,M.A. (1988). The cellular neurobiology of neuronal development: the cerebellar granule cell. Brain Res. 472, 77-101.

Calligaris,R., Bellarosa,C., Foti,R., Roncaglia,P., Giraudi,P., Krmac,H., Tiribelli,C., and Gustincich,S. (2009). A transcriptome analysis identifies molecular effectors of unconjugated bilirubin in human neuroblastoma SH-SY5Y cells. BMC. Genomics 10, 543.

Calligaris,S.D., Bellarosa,C., Giraudi,P., Wennberg,R.P., Ostrow,J.D., and Tiribelli,C. (2007). Cytotoxicity is predicted by unbound and not total bilirubin concentration. Pediatr. Res. 62, 576-580.

Cambray-Deakin, M. A. Cerebellar Granule cells. Cohen, J. and Wilkin, G. P. Neural Cell Culture- A practical approach. 3-13. 1995. New York, Oxford University Press. Ref Type: Generic

Cashore,W.J. (1990). The neurotoxicity of bilirubin. Clin. Perinatol. 17, 437-447.

Chen,B. and Wang,W. (2008). The expression of cyclins in neurons of rats after focal cerebral ischemia. J. Huazhong. Univ Sci. Technolog. Med. Sci. 28, 60-64.

REFERENCES

80

Cheng,X.S., Li,M.S., Du,J., Jiang,Q.Y., Wang,L., Yan,S.Y., Yu,D.M., and Deng,J.B. (2011). Neuronal apoptosis in the developing cerebellum. Anat. Histol. Embryol. 40, 21-27.

Chibazakura,T., Kamachi,K., Ohara,M., Tane,S., Yoshikawa,H., and Roberts,J.M. (2011). Cyclin A promotes S-phase entry via interaction with the replication licensing factor Mcm7. Mol. Cell Biol. 31, 248-255.

Chowdhury,J., Huang,T.J., Kesari,K., Lederstein,M., Arias,I.M., and Roy-Chowdhury,N. (1991). Molecular basis for the lack of bilirubin-specific and 3-methylcholanthrene-inducible UDP-glucuronosyltransferase activities in Gunn rats. The two isoforms are encoded by distinct mRNA species that share an identical single base deletion. J. Biol. Chem. 266, 18294-18298.

Chowdhury,J.R., Kondapalli,R., and Chowdhury,N.R. (1993). Gunn rat: a model for inherited deficiency of bilirubin glucuronidation. Adv. Vet. Sci. Comp Med. 37, 149-173.

Collins,I. and Garrett,M.D. (2005). Targeting the cell division cycle in cancer: CDK and cell cycle checkpoint kinase inhibitors. Curr. Opin. Pharmacol. 5, 366-373.

Conlee,J.W. and Shapiro,S.M. (1997). Development of cerebellar hypoplasia in jaundiced Gunn rats: a quantitative light microscopic analysis. Acta Neuropathol. 93, 450-460.

Connolly,A.M. and Volpe,J.J. (1990). Clinical features of bilirubin encephalopathy. Clin. Perinatol. 17, 371-379.

Craigie, E. H. An introduction to the fine anatomy of the central nervous system. 1925. Philadelphia, P. Blakiston's Son & Co. Ref Type: Generic

Crigler,J.F.J. and NAJJAR,V.A. (1952). Congenital familial nonhemolytic jaundice with kernicterus. Pediatrics 10, 169-180.

Cui,Y., Konig,J., Leier,I., Buchholz,U., and Keppler,D. (2001). Hepatic uptake of bilirubin and its conjugates by the human organic anion transporter SLC21A6. J. Biol. Chem. 276, 9626-9630.

Danbolt,C., Hansen,T.W., Oyasoeter,S., Storm-Mathisen,J., and Bratlid,D. (1993). In vitro binding of [3H]bilirubin to neurons in rat brain sections. Biol. Neonate 63, 35-39.

Daood,M.J. and Watchko,J.F. (2006). Calculated in vivo free bilirubin levels in the central nervous system of Gunn rat pups. Pediatr. Res. 60, 44-49.

Darzynkiewicz,Z., Juan,G., Li,X., Gorczyca,W., Murakami,T., and Traganos,F. (1997). Cytometry in cell necrobiology: analysis of apoptosis and accidental cell death (necrosis). Cytometry 27, 1-20.

Denizot,F. and Lang,R. (1986). Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J. Immunol. Methods 89, 271-277.

Dennery,P.A., Seidman,D.S., and Stevenson,D.K. (2001). Neonatal hyperbilirubinemia. N. Engl. J. Med. 344, 581-590.

REFERENCES

81

Diamond,I. and Schmid,R. (1966). Experimental bilirubin encephalopathy. The mode of entry of bilirubin-14C into the central nervous system. J. Clin. Invest 45, 678-689.

DUBIN,I.N. (1958). Chronic idiopathic jaundice; a review of fifty cases. Am. J. Med. 24, 268-292.

Dutton,G.R., Currie,D.N., and Tear,K. (1981). An improved method for the bulk isolation of viable perikarya from postnatal cerebellum. J. Neurosci. Methods 3, 421-427.

Falcao,A.S., Silva,R.F., Pancadas,S., Fernandes,A., Brito,M.A., and Brites,D. (2007). Apoptosis and impairment of neurite network by short exposure of immature rat cortical neurons to unconjugated bilirubin increase with cell differentiation and are additionally enhanced by an inflammatory stimulus. J. Neurosci. Res. 85, 1229-1239.

Fischer,U., Janicke,R.U., and Schulze-Osthoff,K. (2003). Many cuts to ruin: a comprehensive update of caspase substrates. Cell Death. Differ. 10, 76-100.

Frank,C.L. and Tsai,L.H. (2009). Alternative functions of core cell cycle regulators in neuronal migration, neuronal maturation, and synaptic plasticity. Neuron 62, 312-326.

Fuller,B.J. (2004). Cryoprotectants: the essential antifreezes to protect life in the frozen state. Cryo. Letters. 25, 375-388.

Gartner,L.M. (2001). Breastfeeding and jaundice. J. Perinatol. 21 Suppl 1, S25-S29.

Gazzin,S., Berengeno,A.L., Strazielle,N., Fazzari,F., Raseni,A., Ostrow,J.D., Wennberg,R., Ghersi-Egea,J.F., and Tiribelli,C. (2011). Modulation of Mrp1 (ABCc1) and Pgp (ABCb1) by bilirubin at the blood-CSF and blood-brain barriers in the Gunn rat. PLoS. One. 6, e16165.

Gazzin,S., Strazielle,N., Schmitt,C., Fevre-Montange,M., Ostrow,J.D., Tiribelli,C., and Ghersi-Egea,J.F. (2008). Differential expression of the multidrug resistance-related proteins ABCb1 and ABCc1 between blood-brain interfaces. J Comp Neurol. 510, 497-507.

Gazzin,S., Zelenka,J., Zdrahalova,L., Konickova,R., Zabetta,C.C., Giraudi,P.J., Berengeno,A.L., Raseni,A., Robert,M.C., Vitek,L., and Tiribelli,C. (2012). Bilirubin accumulation and Cyp mRNA expression in selected brain regions of jaundiced Gunn rat pups. Pediatr. Res.

Geng,Y., Whoriskey,W., Park,M.Y., Bronson,R.T., Medema,R.H., Li,T., Weinberg,R.A., and Sicinski,P. (1999). Rescue of cyclin D1 deficiency by knockin cyclin E. Cell 97, 767-777.

Gourley,G.R. (1997). Bilirubin metabolism and kernicterus. Adv. Pediatr. 44, 173-229.

Greene,L.A., Liu,D.X., Troy,C.M., and Biswas,S.C. (2007). Cell cycle molecules define a pathway required for neuron death in development and disease. Biochim. Biophys. Acta 1772, 392-401.

Grojean,S., Koziel,V., Vert,P., and Daval,J.L. (2000). Bilirubin induces apoptosis via activation of NMDA receptors in developing rat brain neurons. Exp. Neurol. 166, 334-341.

Gunn,C.H. (1938). Hereditary acholuric jaundice in a new mutant strain of rats. J. Hered. 29, 137-139.

REFERENCES

82

Hahm,J.S., Ostrow,J.D., Mukerjee,P., and Celic,L. (1992). Ionization and self-association of unconjugated bilirubin, determined by rapid solvent partition from chloroform, with further studies of bilirubin solubility. J. Lipid Res. 33, 1123-1137.

Hansen,T.W., Bratlid,D., and Walaas,S.I. (1988a). Bilirubin decreases phosphorylation of synapsin I, a synaptic vesicle-associated neuronal phosphoprotein, in intact synaptosomes from rat cerebral cortex. Pediatr. Res. 23, 219-223.

Hansen,T.W., Nietsch,L., Norman,E., Bjerre,J.V., Hascoet,J.M., Mreihil,K., and Ebbesen,F. (2009). Reversibility of acute intermediate phase bilirubin encephalopathy. Acta Paediatr. 98, 1689-1694.

Hansen,T.W., Paulsen,O., Gjerstad,L., and Bratlid,D. (1988b). Short-term exposure to bilirubin reduces synaptic activation in rat transverse hippocampal slices. Pediatr. Res. 23, 453-456.

Harwell,R.M., Mull,B.B., Porter,D.C., and Keyomarsi,K. (2004). Activation of cyclin-dependent kinase 2 by full length and low molecular weight forms of cyclin E in breast cancer cells. J. Biol. Chem. 279, 12695-12705.

Harwell,R.M., Porter,D.C., Danes,C., and Keyomarsi,K. (2000). Processing of cyclin E differs between normal and tumor breast cells. Cancer Res. 60, 481-489.

Hauser,S.C., Ziurys,J.C., and Gollan,J.L. (1984). Subcellular distribution and regulation of hepatic bilirubin UDP-glucuronyltransferase. J. Biol. Chem. 259, 4527-4533.

Heinlein,C., Deppert,W., Braithwaite,A.W., and Speidel,D. (2010). A rapid and optimization-free procedure allows the in vivo detection of subtle cell cycle and ploidy alterations in tissues by flow cytometry. Cell Cycle 9, 3584-3590.

Heinlein,C. and Speidel,D. (2011). High-resolution cell cycle and DNA ploidy analysis in tissue samples. Curr. Protoc. Cytom. Chapter 7, Unit.

Hellemans,J., Mortier,G., De,P.A., Speleman,F., and Vandesompele,J. (2007). qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 8, R19.

Herculano-Houzel,S. and Lent,R. (2005). Isotropic fractionator: a simple, rapid method for the quantification of total cell and neuron numbers in the brain. J. Neurosci. 25, 2518-2521.

HERNDON,R.M. (1964). THE FINE STRUCTURE OF THE RAT CEREBELLUM. II. THE STELLATE NEURONS, GRANULE CELLS, AND GLIA. J. Cell Biol. 23, 277-293.

Herrup,K. and Busser,J.C. (1995). The induction of multiple cell cycle events precedes target-related neuronal death. Development 121, 2385-2395.

Herrup,K. and Yang,Y. (2007). Cell cycle regulation in the postmitotic neuron: oxymoron or new biology? Nat. Rev. Neurosci. 8, 368-378.

Hoffman,D.J., Zanelli,S.A., Kubin,J., Mishra,O.P., and Delivoria-Papadopoulos,M. (1996). The in vivo effect of bilirubin on the N-methyl-D-aspartate receptor/ion channel complex in the brains of newborn piglets. Pediatr. Res. 40, 804-808.

REFERENCES

83

Ichikawa,J., Yamada,R.X., Muramatsu,R., Ikegaya,Y., Matsuki,N., and Koyama,R. (2007). Cryopreservation of granule cells from the postnatal rat hippocampus. J. Pharmacol. Sci. 104, 387-391.

ITO,M. (2006). Cerebellar circuitry as a neuronal machine. Prog. Neurobiol. 78, 272-303.

ITO,M., YOSHIDA,M., and OBATA,K. (1964). Monosynaptic inhibition of the intracerebellar nuclei induced rom the cerebellar cortex. Experientia 20, 575-576.

Iyanagi,T., Watanabe,T., and Uchiyama,Y. (1989). The 3-methylcholanthrene-inducible UDP-glucuronosyltransferase deficiency in the hyperbilirubinemic rat (Gunn rat) is caused by a -1 frameshift mutation. J. Biol. Chem. 264, 21302-21307.

Jacobsen,J. and Wennberg,R.P. (1974). Determination of unbound bilirubin in the serum of newborns. Clin. Chem. 20, 783.

Johnson,D.G. and Walker,C.L. (1999). Cyclins and cell cycle checkpoints. Annu. Rev. Pharmacol. Toxicol. 39, 295-312.

Johnson,L., SARMIENTO,F., BLANC,W.A., and DAY,R. (1959). Kernicterus in rats with an inherited deficiency of glucuronyl transferase. AMA. J. Dis. Child 97, 591-608.

Kamisako,T., Leier,I., Cui,Y., Konig,J., Buchholz,U., Hummel-Eisenbeiss,J., and Keppler,D. (1999). Transport of monoglucuronosyl and bisglucuronosyl bilirubin by recombinant human and rat multidrug resistance protein 2. Hepatology 30, 485-490.

Kaplan, M. and Hammerman, C. The Bilirubin and the Genome: The Hereditary Basis of Unconjugated Neonatal Hyperbilirubinemia. Current Pharmacogenomics 3. 2005a. Ref Type: Generic

Kaplan,M. and Hammerman,C. (2005b). Understanding severe hyperbilirubinemia and preventing kernicterus: adjuncts in the interpretation of neonatal serum bilirubin. Clin. Chim. Acta 356, 9-21.

Kaplan,M., Renbaum,P., Levy-Lahad,E., Hammerman,C., Lahad,A., and Beutler,E. (1997). Gilbert syndrome and glucose-6-phosphate dehydrogenase deficiency: a dose-dependent genetic interaction crucial to neonatal hyperbilirubinemia. Proc. Natl. Acad. Sci. U. S. A 94, 12128-12132.

Kashiwamata,S., Aono,S., and Semba,R.K. (1980). Characteristic changes of cerebellar proteins associated with cerebellar hypoplasia in jaundiced Gunn rats and the prevention of these by phototherapy. Experientia 36, 1143-1144.

Kato,J., Matsushime,H., Hiebert,S.W., Ewen,M.E., and Sherr,C.J. (1993). Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase CDK4. Genes Dev. 7, 331-342.

Katoh-Semba,R. and Kashiwamata,S. (1984). Rates of protein synthesis and degradation in Gunn rat cerebellum with bilirubin-induced cerebellar hypoplasia. Neurochem. Pathol. 2, 31-37.

Kaufmann,S.H., Desnoyers,S., Ottaviano,Y., Davidson,N.E., and Poirier,G.G. (1993). Specific proteolytic cleavage of poly(ADP-ribose) polymerase: an early marker of chemotherapy-induced apoptosis. Cancer Res. 53, 3976-3985.

REFERENCES

84

Keino,H. and Kashiwamata,S. (1989). Critical period of bilirubin-induced cerebellar hypoplasia in a new Sprague-Dawley strain of jaundiced Gunn rats. Neurosci. Res. 6, 209-215.

Keyomarsi,K. and Pardee,A.B. (1993). Redundant cyclin overexpression and gene amplification in breast cancer cells. Proc. Natl. Acad. Sci. U. S. A 90, 1112-1116.

Lavia,P. and Jansen-Durr,P. (1999). E2F target genes and cell-cycle checkpoint control. Bioessays 21, 221-230.

Lester,R. and Schmid,R. (1963). Intestinal absorption of bile pigments. I. The enterohepatic circulation of bilirubin in the rat. J. Clin. Invest 42, 736-746.

LONDON,I.M., WEST,R., SHEMIN,D., and RITTENBERG,D. (1950). On the origin of bile pigment in normal man. J. Biol. Chem. 184, 351-358.

Los,M., Van de Craen,M., Penning,L.C., Schenk,H., Westendorp,M., Baeuerle,P.A., Droge,W., Krammer,P.H., Fiers,W., and Schulze-Osthoff,K. (1995). Requirement of an ICE/CED-3 protease for Fas/APO-1-mediated apoptosis. Nature 375, 81-83.

LUYET,B. and GONZALES,F. (1953). Growth of nerve tissue after freezing in liquid nitrogen. Biodynamica. 7, 171-174.

Maddika,S., Ande,S.R., Panigrahi,S., Paranjothy,T., Weglarczyk,K., Zuse,A., Eshraghi,M., Manda,K.D., Wiechec,E., and Los,M. (2007). Cell survival, cell death and cell cycle pathways are interconnected: implications for cancer therapy. Drug Resist. Updat. 10, 13-29.

Maisels, M. J. The clinical approach to the jaundiced newborn. Maisels, M. J. and Watchko, J. F. Neonatal Jaundice , 139-168. 2000. Amsterdam 7 Harwood Academic. Ref Type: Generic

Maisels,M.J. and Newman,T.B. (1998). Jaundice in full-term and near-term babies who leave the hospital within 36 hours. The pediatrician's nemesis. Clin. Perinatol. 25, 295-302.

Mazumder,S., DuPree,E.L., and Almasan,A. (2004). A dual role of cyclin E in cell proliferation and apoptosis may provide a target for cancer therapy. Curr. Cancer Drug Targets. 4, 65-75.

Mazumder,S., Gong,B., Chen,Q., Drazba,J.A., Buchsbaum,J.C., and Almasan,A. (2002). Proteolytic cleavage of cyclin E leads to inactivation of associated kinase activity and amplification of apoptosis in hematopoietic cells. Mol. Cell Biol. 22, 2398-2409.

Mazumder,S., Plesca,D., and Almasan,A. (2007a). A jekyll and hyde role of cyclin E in the genotoxic stress response: switching from cell cycle control to apoptosis regulation. Cell Cycle 6, 1437-1442.

Mazumder,S., Plesca,D., Kinter,M., and Almasan,A. (2007b). Interaction of a cyclin E fragment with Ku70 regulates Bax-mediated apoptosis. Mol. Cell Biol. 27, 3511-3520.

Mazur,P. (1970). Cryobiology: the freezing of biological systems. Science 168, 939-949.

McCandless,D.W. and Abel,M.S. (1980). The effect of unconjugated bilirubin on regional cerebellar energy metabolism. Neurobehav. Toxicol. 2, 81-84.

REFERENCES

85

McDonald,J.W., Shapiro,S.M., Silverstein,F.S., and Johnston,M.V. (1998). Role of glutamate receptor-mediated excitotoxicity in bilirubin-induced brain injury in the Gunn rat model. Exp. Neurol. 150, 21-29.

Mikoshiba,K., Kohsaka,S., Takamatsu,K., and Tsukada,Y. (1980). Cerebellar hypoplasia in the Gunn rat with hereditary hyperbilirubinemia: immunohistochemical and neurochemical studies. J. Neurochem. 35, 1309-1318.

Mitchell,P.J., Hanson,J.C., Quets-Nguyen,A.T., Bergeron,M., and Smith,R.C. (2007). A quantitative method for analysis of in vitro neurite outgrowth. J. Neurosci. Methods 164, 350-362.

Montgomery,D.L. (1994). Astrocytes: form, functions, and roles in disease. Vet. Pathol. 31, 145-167.

Mosmann,T. (1983). Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55-63.

Ngai,K.C., Yeung,C.Y., and Leung,C.S. (2000). Difference in susceptibilities of different cell lines to bilirubin damage. J. Paediatr. Child Health 36, 51-55.

Nieuwenhuys, R, Voogd, J, and Van Huijizen, C. The Human Central Nervous System. 2008. Berlin Heildelberg, Springer. Ref Type: Generic

Notter,M.F. and Kendig,J.W. (1986). Differential sensitivity of neural cells to bilirubin toxicity. Exp. Neurol. 94, 670-682.

O'Callaghan,J.P. and Miller,D.B. (1985). Cerebellar hypoplasia in the Gunn rat is associated with quantitative changes in neurotypic and gliotypic proteins. J. Pharmacol. Exp. Ther. 234, 522-533.

Ochoa,E.L., Wennberg,R.P., An,Y., Tandon,T., Takashima,T., Nguyen,T., and Chui,A. (1993). Interactions of bilirubin with isolated presynaptic nerve terminals: functional effects on the uptake and release of neurotransmitters. Cell Mol. Neurobiol. 13, 69-86.

Odell,G.B. (1959). Studies in kernicterus. I. The protein binding of bilirubin. J. Clin. Invest 38, 823-833.

Ohnuma,S. and Harris,W.A. (2003). Neurogenesis and the cell cycle. Neuron 40, 199-208.

Olanow,C.W., Kordower,J.H., and Freeman,T.B. (1996). Fetal nigral transplantation as a therapy for Parkinson's disease. Trends Neurosci. 19, 102-109.

Olashaw,N. and Pledger,W.J. (2002). Paradigms of growth control: relation to Cdk activation. Sci. STKE. 2002, re7.

Ollinger,R., Bilban,M., Erat,A., Froio,A., McDaid,J., Tyagi,S., Csizmadia,E., Graca-Souza,A.V., Liloia,A., Soares,M.P., Otterbein,L.E., Usheva,A., Yamashita,K., and Bach,F.H. (2005). Bilirubin: a natural inhibitor of vascular smooth muscle cell proliferation. Circulation 112, 1030-1039.

Ollinger,R., Kogler,P., Troppmair,J., Hermann,M., Wurm,M., Drasche,A., Konigsrainer,I., Amberger,A., Weiss,H., Ofner,D., Bach,F.H., and Margreiter,R. (2007a). Bilirubin inhibits tumor cell growth via activation of ERK. Cell Cycle 6, 3078-3085.

REFERENCES

86

Ollinger,R., Yamashita,K., Bilban,M., Erat,A., Kogler,P., Thomas,M., Csizmadia,E., Usheva,A., Margreiter,R., and Bach,F.H. (2007b). Bilirubin and biliverdin treatment of atherosclerotic diseases. Cell Cycle 6, 39-43.

Oppenheim,R.W. (1991). Cell death during development of the nervous system. Annu. Rev. Neurosci. 14, 453-501.

Ostrow, J. D. Bile pigments and jaundice. 1987. Marcel Dekker,Inc. Ref Type: Generic

Ostrow,J.D., JANDL,J.H., and Schmid,R. (1962). The formation of bilirubin from hemoglobin in vivo. J. Clin. Invest 41, 1628-1637.

Ostrow,J.D. and Mukerjee,P. (2007). Solvent partition of 14C-unconjugated bilirubin to remove labeled polar contaminants. Transl. Res. 149, 37-45.

Ostrow,J.D., Mukerjee,P., and Tiribelli,C. (1994). Structure and binding of unconjugated bilirubin: relevance for physiological and pathophysiological function. J. Lipid Res. 35, 1715-1737.

Ostrow,J.D., Pascolo,L., Shapiro,S.M., and Tiribelli,C. (2003a). New concepts in bilirubin encephalopathy. Eur. J. Clin. Invest 33, 988-997.

Ostrow,J.D., Pascolo,L., and Tiribelli,C. (2003b). Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro. Pediatr. Res. 54, 926.

Pagano,M., Pepperkok,R., Verde,F., Ansorge,W., and Draetta,G. (1992). Cyclin A is required at two points in the human cell cycle. EMBO J. 11, 961-971.

Palozza,P., Serini,S., Maggiano,N., Angelini,M., Boninsegna,A., Di,N.F., Ranelletti,F.O., and Calviello,G. (2002). Induction of cell cycle arrest and apoptosis in human colon adenocarcinoma cell lines by beta-carotene through down-regulation of cyclin A and Bcl-2 family proteins. Carcinogenesis 23, 11-18.

Park,M.T. and Lee,S.J. (2003). Cell cycle and cancer. J. Biochem. Mol. Biol. 36, 60-65.

Paynter,S.J. (2008). Principles and practical issues for cryopreservation of nerve cells. Brain Res. Bull. 75, 1-14.

Pfaffl,M.W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45.

Poland,R.L. and Odell,G.B. (1971). Physiologic jaundice: the enterohepatic circulation of bilirubin. N. Engl. J. Med. 284, 1-6.

Porter,D.C. and Keyomarsi,K. (2000). Novel splice variants of cyclin E with altered substrate specificity. Nucleic Acids Res. 28, E101.

Porter,D.C., Zhang,N., Danes,C., McGahren,M.J., Harwell,R.M., Faruki,S., and Keyomarsi,K. (2001). Tumor-specific proteolytic processing of cyclin E generates hyperactive lower-molecular-weight forms. Mol. Cell Biol. 21, 6254-6269.

REFERENCES

87

Rao,P., Suzuki,R., Mizobuchi,S., Yamaguchi,T., and Sasaguri,S. (2006). Bilirubin exhibits a novel anti-cancer effect on human adenocarcinoma. Biochem. Biophys. Res. Commun. 342, 1279-1283.

Resnitzky,D. and Reed,S.I. (1995). Different roles for cyclins D1 and E in regulation of the G1-to-S transition. Mol. Cell Biol. 15, 3463-3469.

Rice, A. C. and Shapiro, S. M. Apoptosis in the Gunn rat model of kernicterus. PAS 57, 1269. 2005. Ref Type: Generic

Rice,D. and Barone S Jr (2000). Critical periods of vulnerability for the developing nervous system: evidence from humans and animal models. Environ. Health Perspect. 108 Suppl 3, 511-533.

Roca,L., Calligaris,S., Wennberg,R.P., Ahlfors,C.E., Malik,S.G., Ostrow,J.D., and Tiribelli,C. (2006). Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method. Pediatr. Res. 60, 724-728.

Rodrigues,C.M., Sola,S., and Brites,D. (2002a). Bilirubin induces apoptosis via the mitochondrial pathway in developing rat brain neurons. Hepatology 35, 1186-1195.

Rodrigues,C.M., Sola,S., Castro,R.E., Laires,P.A., Brites,D., and Moura,J.J. (2002b). Perturbation of membrane dynamics in nerve cells as an early event during bilirubin-induced apoptosis. J. Lipid Res. 43, 885-894.

Rodrigues,C.M., Sola,S., Silva,R., and Brites,D. (2000). Bilirubin and amyloid-beta peptide induce cytochrome c release through mitochondrial membrane permeabilization. Mol. Med. 6, 936-946.

Rodrigues,C.M., Sola,S., Silva,R.F., and Brites,D. (2002c). Aging confers different sensitivity to the neurotoxic properties of unconjugated bilirubin. Pediatr. Res. 51, 112-118.

Rowinsky,E.K. (2005). Targeted induction of apoptosis in cancer management: the emerging role of tumor necrosis factor-related apoptosis-inducing ligand receptor activating agents. J. Clin. Oncol. 23, 9394-9407.

Roy-Chowdhury, N. Disorders of Bilirubin Metabolism. The Liver: Biology and Pathobiology . 2001. Ref Type: Generic

Rubaltelli,F.F. (1993). Bilirubin metabolism in the newborn. Biol. Neonate 63, 133-138.

Salazar,G., Joshi,A., Liu,D., Wei,H., Persson,J.L., and Wolgemuth,D.J. (2005). Induction of apoptosis involving multiple pathways is a primary response to cyclin A1-deficiency in male meiosis. Dev. Dyn. 234, 114-123.

Sampietro,M. and Iolascon,A. (1999). Molecular pathology of Crigler-Najjar type I and II and Gilbert's syndromes. Haematologica 84, 150-157.

Sawasaki,Y., Yamada,N., and Nakajima,H. (1976). Developmental features of cerebellar hypoplasia and brain bilirubin levels in a mutant (Gunn) rat with hereditary hyperbilirubinaemia. J. Neurochem. 27, 577-583.

Schafer,K.A. (1998). The cell cycle: a review. Vet. Pathol. 35, 461-478.

REFERENCES

88

Schiff,D., Chan,G., and Poznansky,M.J. (1985). Bilirubin toxicity in neural cell lines N115 and NBR10A. Pediatr. Res. 19, 908-911.

Schutta,H.S. and Johnson,L. (1967). Bilirubin encephalopathy in the Gunn rat: a fine structure study of the cerebellar cortex. J. Neuropathol. Exp. Neurol. 26, 377-396.

Schutta,H.S., Johnson,L., and Neville,H.E. (1970). Mitochondrial abnormalities in bilirubin encephalopathy. J. Neuropathol. Exp. Neurol. 29, 296-305.

Shani,M., Seligsohn,U., Gilon,E., Sheba,C., and Adam,A. (1970). Dubin-Johnson syndrome in Israel. I. Clinical, laboratory, and genetic aspects of 101 cases. Q. J. Med. 39, 549-567.

Shapiro,S.M. (2010). Chronic bilirubin encephalopathy: diagnosis and outcome. Semin. Fetal Neonatal Med. 15, 157-163.

Sherr,C.J. and Roberts,J.M. (1999). CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 13, 1501-1512.

Silva,R., Mata,L.R., Gulbenkian,S., Brito,M.A., Tiribelli,C., and Brites,D. (1999). Inhibition of glutamate uptake by unconjugated bilirubin in cultured cortical rat astrocytes: role of concentration and pH. Biochem. Biophys. Res. Commun. 265, 67-72.

Silva,R.F., Rodrigues,C.M., and Brites,D. (2001). Bilirubin-induced apoptosis in cultured rat neural cells is aggravated by chenodeoxycholic acid but prevented by ursodeoxycholic acid. J. Hepatol. 34, 402-408.

Silva,R.F., Rodrigues,C.M., and Brites,D. (2002). Rat cultured neuronal and glial cells respond differently to toxicity of unconjugated bilirubin. Pediatr. Res. 51, 535-541.

Smith,P.K., Krohn,R.I., Hermanson,G.T., Mallia,A.K., Gartner,F.H., Provenzano,M.D., Fujimoto,E.K., Goeke,N.M., Olson,B.J., and Klenk,D.C. (1985). Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76-85.

Stevenson,D.K., Fanaroff,A.A., Maisels,M.J., Young,B.W., Wong,R.J., Vreman,H.J., MacMahon,J.R., Yeung,C.Y., Seidman,D.S., Gale,R., Oh,W., Bhutani,V.K., Johnson,L.H., Kaplan,M., Hammerman,C., and Nakamura,H. (2001). Prediction of hyperbilirubinemia in near-term and term infants. J. Perinatol. 21 Suppl 1, S63-S72.

Strassburg,C.P. (2010). Hyperbilirubinemia syndromes (Gilbert-Meulengracht, Crigler-Najjar, Dubin-Johnson, and Rotor syndrome). Best. Pract. Res. Clin. Gastroenterol. 24, 555-571.

Sukhotnik,I., Shaoul,R., Lieber,M., Coran,A.G., Abassi,Z., Shiloni,E., and Mogilner,J.G. (2009). Bilirubin impairs intestinal regrowth following massive small bowel resection in a rat model. J. Pediatr. Gastroenterol. Nutr. 49, 16-22.

Sweeney,C., Murphy,M., Kubelka,M., Ravnik,S.E., Hawkins,C.F., Wolgemuth,D.J., and Carrington,M. (1996). A distinct cyclin A is expressed in germ cells in the mouse. Development 122, 53-64.

Takagishi,Y. and Yamamura,H. (1987). The critical period of Purkinje cell degeneration and cerebellar hypoplasia due to bilirubin. Acta Neuropathol. 75, 41-45.

REFERENCES

89

Takagishi,Y. and Yamamura,H. (1989). Purkinje cell abnormalities and synaptogenesis in genetically jaundiced rats (Gunn rats). Brain Res. 492, 116-128.

Taylor, M. J, Song, Y. C, and Brockbank, G. M. Vitrification in tissue preservation: new developments. Fuller, B. J., Lane, N., and Benson, E. Life in the frozen state. 603. 2004. London, UK, CRC Press London. Ref Type: Generic

Tenhunen,R., Marver,H.S., and Schmid,R. (1968). The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc. Natl. Acad. Sci. U. S. A 61, 748-755.

Tewari,M., Quan,L.T., O'Rourke,K., Desnoyers,S., Zeng,Z., Beidler,D.R., Poirier,G.G., Salvesen,G.S., and Dixit,V.M. (1995). Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81, 801-809.

Tichopad,A., Didier,A., and Pfaffl,M.W. (2004). Inhibition of real-time RT-PCR quantification due to tissue-specific contaminants. Mol. Cell Probes 18, 45-50.

Van Der Veere,C.N., Sinaasappel,M., McDonagh,A.F., Rosenthal,P., Labrune,P., Odievre,M., Fevery,J., Otte,J.B., McClean,P., Burk,G., Masakowski,V., Sperl,W., Mowat,A.P., Vergani,G.M., Heller,K., Wilson,J.P., Shepherd,R., and Jansen,P.L. (1996). Current therapy for Crigler-Najjar syndrome type 1: report of a world registry. Hepatology 24, 311-315.

Van Vliet,B.J., Sebben,M., Dumuis,A., Gabrion,J., Bockaert,J., and Pin,J.P. (1989). Endogenous amino acid release from cultured cerebellar neuronal cells: effect of tetanus toxin on glutamate release. J. Neurochem. 52, 1229-1239.

Vandesompele,J., De,P.K., Pattyn,F., Poppe,B., Van,R.N., De,P.A., and Speleman,F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, RESEARCH0034.

Vaz,A.R., Delgado-Esteban,M., Brito,M.A., Bolanos,J.P., Brites,D., and Almeida,A. (2010). Bilirubin selectively inhibits cytochrome c oxidase activity and induces apoptosis in immature cortical neurons: assessment of the protective effects of glycoursodeoxycholic acid. J. Neurochem. 112, 56-65.

Vazquez,J., Garcia-Calvo,M., Valdivieso,F., Mayor,F., and Mayor,F., Jr. (1988). Interaction of bilirubin with the synaptosomal plasma membrane. J. Biol. Chem. 263, 1255-1265.

Vermeulen,K., Van Bockstaele,D.R., and Berneman,Z.N. (2003). The cell cycle: a review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif. 36, 131-149.

Vitek,L., Kotal,P., Jirsa,M., Malina,J., Cerna,M., Chmelar,D., and Fevery,J. (2000). Intestinal colonization leading to fecal urobilinoid excretion may play a role in the pathogenesis of neonatal jaundice. J. Pediatr. Gastroenterol. Nutr. 30, 294-298.

Watchko,J.F. (2006). Kernicterus and the molecular mechanisms of bilirubin-induced CNS injury in newborns. Neuromolecular. Med. 8, 513-529.

Weisiger,R.A., Ostrow,J.D., Koehler,R.K., Webster,C.C., Mukerjee,P., Pascolo,L., and Tiribelli,C. (2001). Affinity of human serum albumin for bilirubin varies with albumin concentration and buffer composition: results of a novel ultrafiltration method. J. Biol. Chem. 276, 29953-29960.

REFERENCES

90

Wen,Y., Yang,S., Liu,R., and Simpkins,J.W. (2005). Cell-cycle regulators are involved in transient cerebral ischemia induced neuronal apoptosis in female rats. FEBS Lett. 579, 4591-4599.

Wennberg,R.P. (1993). Animal models of bilirubin encephalopathy. Adv. Vet. Sci. Comp Med. 37, 87-113.

Wennberg,R.P. (2000). The blood-brain barrier and bilirubin encephalopathy. Cell Mol. Neurobiol. 20, 97-109.

Wennberg,R.P., Ahlfors,C.E., and Rasmussen,L.F. (1979). The pathochemistry of kernicterus. Early Hum. Dev. 3, 353-372.

Wilks,A. and Ortiz de Montellano,P.R. (1993). Rat liver heme oxygenase. High level expression of a truncated soluble form and nature of the meso-hydroxylating species. J. Biol. Chem. 268, 22357-22362.

Wingate,H., Bedrosian,I., Akli,S., and Keyomarsi,K. (2003). The low molecular weight (LMW) isoforms of cyclin E deregulate the cell cycle of mammary epithelial cells. Cell Cycle 2, 461-466.

Yamada,N., Sawasaki,Y., and Nakajima,H. (1977). Impairment of DNA synthesis in Gunn rat cerebellum. Brain Res. 126, 295-307.

Yang,R., Morosetti,R., and Koeffler,H.P. (1997). Characterization of a second human cyclin A that is highly expressed in testis and in several leukemic cell lines. Cancer Res. 57, 913-920.

Yannas,I. (1968). Vitrification temperature of water. Science 160, 298-299.

Yoshida,T. and Kikuchi,G. (1978). Features of the reaction of heme degradation catalyzed by the reconstituted microsomal heme oxygenase system. J. Biol. Chem. 253, 4230-4236.

Zarattini, P, Gazzin, S., and Stebel, M. Improvement of a historical animal model for Crigler- Najjar type I syndrome: development of the normobilirubinemic JJ genotype as a true control for the Gunn jaundice rat. Experimental models . 2011. Ref Type: Generic

Zucker,S.D., Goessling,W., and Hoppin,A.G. (1999). Unconjugated bilirubin exhibits spontaneous diffusion through model lipid bilayers and native hepatocyte membranes. J. Biol. Chem. 274, 10852-10862.

Zucker,S.D., Goessling,W., Ransil,B.J., and Gollan,J.L. (1995). Influence of glutathione S-transferase B (ligandin) on the intermembrane transfer of bilirubin. Implications for the intracellular transport of nonsubstrate ligands in hepatocytes. J. Clin. Invest 96, 1927-1935.

università degli studi di trieste mc... · università di udine prof. claudio santoro università...

Documents